(data stored in ACNUC17492 zone)

EMBL: AB380348

ID   AB380348; SV 1; linear; genomic DNA; STD; MAM; 839 BP.
AC   AB380348;
DT   06-NOV-2008 (Rel. 97, Created)
DT   23-JUL-2010 (Rel. 105, Last updated, Version 2)
DE   Macaca mulatta RGS18 gene for regulator of G-protein signaling 18, partial
DE   cds, seq_ID: RGS18_020609028.
KW   .
OS   Macaca mulatta (Rhesus monkey)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini;
OC   Cercopithecidae; Cercopithecinae; Macaca.
RN   [1]
RP   1-839
RA   Osada N., Terao K., Kameoka Y., Takahashi I.;
RT   ;
RL   Submitted (13-FEB-2008) to the INSDC.
RL   Contact:Naoki Osada National Institute of Biomedical Innovation, Division
RL   of Biomedical Resources; Saito-Asagi 7-6-8, Ibaraki, Osaka 567-0085, Japan
RN   [2]
RX   DOI; 10.1111/j.1365-294X.2010.04687.x.
RX   PUBMED; 20579289.
RA   Osada N., Uno Y., Mineta K., Kameoka Y., Takahashi I., Terao K.;
RT   "Ancient genome-wide admixture extends beyond the current hybrid zone
RT   between Macaca fascicularis and M. mulatta";
RL   Mol. Ecol. 19(14):2884-2895(2010).
DR   MD5; a9dc371dfa3445cb5f74ab6ce1dedb21.
CC   URL: http://genebank.nibio.go.jp/gbank/
FH   Key             Location/Qualifiers
FT   source          1..839
FT                   /organism="Macaca mulatta"
FT                   /mol_type="genomic DNA"
FT                   /country="Philippines"
FT                   /sex="male"
FT                   /PCR_primers="fwd_seq: accctccacagttttgatgc, rev_seq:
FT                   tactcggttccctacctgga"
FT                   /note="TPRC: Tsukuba Primate Research Center, National
FT                   Institute of Biomedical Innovation"
FT                   /db_xref="taxon:9544"
FT                   /bio_material="TPRC:020609028"
FT   misc_feature    1..839
FT                   /note="seq_ID: RGS18_020609028"
FT   CDS_pept        <1..143
FT                   /codon_start=3
FT                   /transl_table=1
FT                   /gene="RGS18"
FT                   /product="regulator of G-protein signaling 18"
FT                   /db_xref="GOA:B6EYN8"
FT                   /db_xref="InterPro:IPR024066"
FT                   /db_xref="InterPro:IPR034950"
FT                   /db_xref="UniProtKB/TrEMBL:B6EYN8"
FT                   /protein_id="BAG81252.1"
FT                   L"
FT   variation       819
FT                   /replace="a"
SQ   Sequence 839 BP; 309 A; 135 C; 120 G; 275 T; 0 other;
     atacacgttt tctgaaatct gacatctatt tagacttgat tgaaggaaga cctcagagac        60
     caacaaatct taggagacga tcacgctcat ttacctgcaa tgaattccaa gatgtacaat       120
     cagatgttgc catttggtta taaagaaaat ttattttgct catttttatg acaaacttat       180
     acatctgctt ctaacatatc gcatgtttat gttaagatct ggtcccatcc tttaaactga       240
     aatatgtcat gtgaaatgat tttaaaaatg taaaaactaa actttttgtt aacaaaatac       300
     agtatctgcc agtatattct ataaaacctt ctatttgatg tcattccatt cataatcaga       360
     aaaaaactta tttcttaatt aaaaggcagt agaaaaaagt aataatgttt tataagattg       420
     tagagttaag taaaagttaa gcttttgcaa agttgtcaac agttcaaaca aaaatctagt       480
     tgggattttt ttacaaaagc agcataatat gtgttatata aacaaaataa tactcagata       540
     tccaaatgtt catatagcat cttccataat gaatgttctc ttttttcagt actagtgcag       600
     aagtgatctg attcttacaa tgggagagga agaacattta ttattgggtt attactaacc       660
     ctgtcccaag aatagtaaca tcacttctag ttataaaaca gcaacaggaa cttttgtgaa       720
     gacacattca tctctacaga acttcagttt aaatataatc tagattaatg actgagaata       780
     agatccacat atgaactcat tcctaagtga gcattgacgt acccagttac aaaaagcac        839

If you have problems or comments...

PBIL Back to PBIL home page