(data stored in ACNUC17492 zone)

EMBL: AB380352

ID   AB380352; SV 1; linear; genomic DNA; STD; MAM; 843 BP.
AC   AB380352;
DT   06-NOV-2008 (Rel. 97, Created)
DT   23-JUL-2010 (Rel. 105, Last updated, Version 2)
DE   Macaca mulatta RGS18 gene for regulator of G-protein signaling 18, partial
DE   cds, seq_ID: RGS18_020609033.
KW   .
OS   Macaca mulatta (Rhesus monkey)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini;
OC   Cercopithecidae; Cercopithecinae; Macaca.
RN   [1]
RP   1-843
RA   Osada N., Terao K., Kameoka Y., Takahashi I.;
RT   ;
RL   Submitted (13-FEB-2008) to the INSDC.
RL   Contact:Naoki Osada National Institute of Biomedical Innovation, Division
RL   of Biomedical Resources; Saito-Asagi 7-6-8, Ibaraki, Osaka 567-0085, Japan
RN   [2]
RX   DOI; 10.1111/j.1365-294X.2010.04687.x.
RX   PUBMED; 20579289.
RA   Osada N., Uno Y., Mineta K., Kameoka Y., Takahashi I., Terao K.;
RT   "Ancient genome-wide admixture extends beyond the current hybrid zone
RT   between Macaca fascicularis and M. mulatta";
RL   Mol. Ecol. 19(14):2884-2895(2010).
DR   MD5; 6b53c48a087e78b1f498df3012d9d3bd.
CC   URL: http://genebank.nibio.go.jp/gbank/
FH   Key             Location/Qualifiers
FT   source          1..843
FT                   /organism="Macaca mulatta"
FT                   /mol_type="genomic DNA"
FT                   /country="Philippines"
FT                   /sex="male"
FT                   /PCR_primers="fwd_seq: accctccacagttttgatgc, rev_seq:
FT                   tactcggttccctacctgga"
FT                   /note="TPRC: Tsukuba Primate Research Center, National
FT                   Institute of Biomedical Innovation"
FT                   /db_xref="taxon:9544"
FT                   /bio_material="TPRC:020609033"
FT   misc_feature    1..843
FT                   /note="seq_ID: RGS18_020609033"
FT   CDS_pept        <1..143
FT                   /codon_start=3
FT                   /transl_table=1
FT                   /gene="RGS18"
FT                   /product="regulator of G-protein signaling 18"
FT                   /db_xref="GOA:B6EYN8"
FT                   /db_xref="InterPro:IPR024066"
FT                   /db_xref="InterPro:IPR034950"
FT                   /db_xref="UniProtKB/TrEMBL:B6EYN8"
FT                   /protein_id="BAG81256.1"
FT                   L"
FT   variation       244
FT                   /replace="a"
FT   variation       823
FT                   /replace="a"
SQ   Sequence 843 BP; 308 A; 135 C; 121 G; 275 T; 4 other;
     atacacgttt tctgaaatct gacatctatt tagacttgat tgaaggaaga cctcagagac        60
     caacaaatct taggagacga tcacgctcat ttacctgcaa tgaattccaa gatgtacaat       120
     cagatgttgc catttggtta taaagaaaat ttattttgct catttttatg acaaacttat       180
     acatctgctt ctaacatatc gcatgtttat gttaagatct ggtcccatcc tttaaactga       240
     aatgtgtcat gtgaaatgat tttaaaaatg taaaaactaa actttttgtt aacaaaatac       300
     annnngtatc tgccagtata ttctataaaa ccttctattt gatgtcattc cattcataat       360
     cagaaaaaaa cttatttctt aattaaaagg cagtagaaaa aagtaataat gttttataag       420
     attgtagagt taagtaaaag ttaagctttt gcaaagttgt caacagttca aacaaaaatc       480
     tagttgggat ttttttacaa aagcagcata atatgtgtta tataaacaaa ataatactca       540
     gatatccaaa tgttcatata gcatcttcca taatgaatgt tctctttttt cagtactagt       600
     gcagaagtga tctgattctt acaatgggag aggaagaaca tttattattg ggttattact       660
     aaccctgtcc caagaatagt aacatcactt ctagttataa aacagcaaca ggaacttttg       720
     tgaagacaca ttcatctcta cagaacttca gtttaaatat aatctagatt aatgactgag       780
     aataagatcc acatatgaac tcattcctaa gtgagcattg acgtacccag ttacaaaaag       840
     cac                                                                     843

If you have problems or comments...

PBIL Back to PBIL home page