(data stored in ACNUC8465 zone)

EMBL: AB451252

ID   AB451252; SV 1; linear; mRNA; STD; HUM; 1005 BP.
AC   AB451252;
DT   02-SEP-2008 (Rel. 97, Created)
DT   02-SEP-2008 (Rel. 97, Last updated, Version 1)
DE   Homo sapiens MAP2K6 mRNA for mitogen-activated protein kinase kinase 6,
DE   complete cds, clone: FLJ08063AAAN.
KW   Gateway cloning system.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1005
RA   Kawamura Y., Nomura N., Goshima N.;
RT   ;
RL   Submitted (31-JUL-2008) to the INSDC.
RL   Contact:Naoki Goshima Biomedicinal Information Research Center (BIRC),
RL   National Institute of Advanced Industrial Science and Technology (AIST);
RL   2-42 Aomi, Koto-ku, Tokyo 135-0064, Japan
RN   [2]
RA   Goshima N., Kawamura Y., Fukumoto A., Miura A., Honma R., Satoh R.,
RA   Wakamatsu A., Yamamoto J.-I., Kimura K., Nishikawa T., Andoh T., Iida Y.,
RA   Ishikawa K., Ito E., Kagawa N., Kaminaga C., Kanehori K., Kawakami B.,
RA   Kenmochi K.-I., Kimura R., Kobayashi M., Kuroita T., Kuwayama H.,
RA   Maruyama Y., Matsuo K., Minami K., Mitsubori M., Mori M., Morishita R.,
RA   Murase A., Nishikawa A., Nishikawa S., Okamoto T., Sakagami N.,
RA   Sakamoto Y., Sasaki Y., Seki T., Sono S., Sugiyama A., Sumiya T.,
RA   Takayama T., Takayama Y., Takeda H., Togashi T., Yahata K., Yamada H.,
RA   Yanagisawa Y., Endo Y., Imamoto F., Kisu Y., Tanaka S., Isogai T.,
RA   Imai J.-I., Watanabe S., Nomura N.;
RT   "Human Protein Factory: an infrastructure to convert the human
RT   transcriptome into the in vitro-expressed human proteome of versatile
RT   utility";
RL   Unpublished.
DR   MD5; e3df6b6cf64108011c891a7406eb6fb5.
CC   This human Gateway entry clone was constructed by recombining an
CC   attB-attached open reading frame (ORF) fragment with attP
CC   sequences of the Gateway donor vector pDONR201. The ORF sequence
CC   in the entry clone is flanked with attL1 sequence (100 nt) -
CC   spacer nucleotides (TC) - Shine-Dalgano sequence (GAAGGAGATA) -
CC   spacer nucleotides (GA) - Kozak sequence (ACC) upstream of the
CC   translational initiation codon (ATG) and is also flanked with a
CC   spacer nucleotide (G) - attL2 sequence (99 nt) downstream of the
CC   ORF. This is an N-type clone which has an intrinsic stop codon at
CC   the end of ORF. DNA sequences of the entire ORF and flanking
CC   regions were validated by sequencing. Clone structure of the ORF
CC   and flanking sequences is as follows:
CC   5'-caaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgct
CC   tttttataatgccaactttgtacaaaaaagcaggct TC GAAGGAGATA GA ACC 5'ORF3'
CC   G acccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaa
CC   caggtcactatcagtcaaaataaaatcattattg-3' (5'ORF3'; ORF sequence. attL
CC   sequences are described in lower cases).
CC   Clone information: http://www.HGPD.jp/
CC   This clone was produced in the "Functional Analysis of Protein and
CC   Research Application" project supported by the New Energy and
CC   Industrial Technology Development Organization (NEDO), Japan
FH   Key             Location/Qualifiers
FT   source          1..1005
FT                   /organism="Homo sapiens"
FT                   /mol_type="mRNA"
FT                   /clone="FLJ08063AAAN"
FT                   /note="Vector: pDONR201"
FT                   /db_xref="taxon:9606"
FT   CDS_pept        1..1005
FT                   /codon_start=1
FT                   /transl_table=1
FT                   /gene="MAP2K6"
FT                   /product="mitogen-activated protein kinase kinase 6"
FT                   /db_xref="GOA:B5BU16"
FT                   /db_xref="H-InvDB:HIT000487465.4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:B5BU16"
FT                   /protein_id="BAG70066.1"
SQ   Sequence 1005 BP; 303 A; 216 C; 240 G; 246 T; 0 other;
     atgtctcagt cgaaaggcaa gaagcgaaac cctggcctta aaattccaaa agaagcattt        60
     gaacaacctc agaccagttc cacaccacct cgagatttag actccaaggc ttgcatttct       120
     attggaaatc agaactttga ggtgaaggca gatgacctgg agcctataat ggaactggga       180
     cgaggtgcgt acggggtggt ggagaagatg cagcacgtgc ccagcgggca gatcatggca       240
     gtgaagcgga tccgagccac agtaaatagc caggaacaga aacggctact gatggatttg       300
     gatatttcca tgaggacggt ggactgtcca ttcactgtca ccttttatgg cgcactgttt       360
     cgggagggtg atgtgtggat ctgcatggag ctcatggata catcactaga taaattctac       420
     aaacaagtta ttgataaagg ccagacaatt ccagaggaca tcttagggaa aatagcagtt       480
     tctattgtaa aagcattaga acatttacat agtaagctgt ctgtcattca cagagacgtc       540
     aagccttcta atgtactcat caatgctctc ggtcaagtga agatgtgcga ttttggaatc       600
     agtggctact tggtggactc tgttgctaaa acaattgatg caggttgcaa accatacatg       660
     gcccctgaaa gaataaaccc agagctcaac cagaagggat acagtgtgaa gtctgacatt       720
     tggagtctgg gcatcacgat gattgagttg gccatccttc gatttcccta tgattcatgg       780
     ggaactccat ttcagcagct caaacaggtg gtagaggagc catcgccaca actcccagca       840
     gacaagttct ctgcagagtt tgttgacttt acctcacagt gcttaaagaa gaattccaaa       900
     gaacggccta catacccaga gctaatgcaa catccatttt tcaccctaca tgaatccaaa       960
     ggaacagatg tggcatcttt tgtaaaactg attcttggag actaa                      1005

If you have problems or comments...

PBIL Back to PBIL home page