(data stored in ACNUC26462 zone)

EMBL: AB451277

ID   AB451277; SV 1; linear; mRNA; STD; HUM; 1113 BP.
AC   AB451277;
DT   02-SEP-2008 (Rel. 97, Created)
DT   02-SEP-2008 (Rel. 97, Last updated, Version 1)
DE   Homo sapiens CAMK1 mRNA for calcium/calmodulin-dependent protein kinase I,
DE   complete cds, clone: FLJ08111AAAN.
KW   Gateway cloning system.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1113
RA   Kawamura Y., Nomura N., Goshima N.;
RT   ;
RL   Submitted (31-JUL-2008) to the INSDC.
RL   Contact:Naoki Goshima Biomedicinal Information Research Center (BIRC),
RL   National Institute of Advanced Industrial Science and Technology (AIST);
RL   2-42 Aomi, Koto-ku, Tokyo 135-0064, Japan
RN   [2]
RA   Goshima N., Kawamura Y., Fukumoto A., Miura A., Honma R., Satoh R.,
RA   Wakamatsu A., Yamamoto J.-I., Kimura K., Nishikawa T., Andoh T., Iida Y.,
RA   Ishikawa K., Ito E., Kagawa N., Kaminaga C., Kanehori K., Kawakami B.,
RA   Kenmochi K.-I., Kimura R., Kobayashi M., Kuroita T., Kuwayama H.,
RA   Maruyama Y., Matsuo K., Minami K., Mitsubori M., Mori M., Morishita R.,
RA   Murase A., Nishikawa A., Nishikawa S., Okamoto T., Sakagami N.,
RA   Sakamoto Y., Sasaki Y., Seki T., Sono S., Sugiyama A., Sumiya T.,
RA   Takayama T., Takayama Y., Takeda H., Togashi T., Yahata K., Yamada H.,
RA   Yanagisawa Y., Endo Y., Imamoto F., Kisu Y., Tanaka S., Isogai T.,
RA   Imai J.-I., Watanabe S., Nomura N.;
RT   "Human Protein Factory: an infrastructure to convert the human
RT   transcriptome into the in vitro-expressed human proteome of versatile
RT   utility";
RL   Unpublished.
DR   MD5; 198b074077ba1fbf49c3fed6cf98b6be.
CC   This human Gateway entry clone was constructed by recombining an
CC   attB-attached open reading frame (ORF) fragment with attP
CC   sequences of the Gateway donor vector pDONR201. The ORF sequence
CC   in the entry clone is flanked with attL1 sequence (100 nt) -
CC   spacer nucleotides (TC) - Shine-Dalgano sequence (GAAGGAGATA) -
CC   spacer nucleotides (GA) - Kozak sequence (ACC) upstream of the
CC   translational initiation codon (ATG) and is also flanked with a
CC   spacer nucleotide (G) - attL2 sequence (99 nt) downstream of the
CC   ORF. This is an N-type clone which has an intrinsic stop codon at
CC   the end of ORF. DNA sequences of the entire ORF and flanking
CC   regions were validated by sequencing. Clone structure of the ORF
CC   and flanking sequences is as follows:
CC   5'-caaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgct
CC   tttttataatgccaactttgtacaaaaaagcaggct TC GAAGGAGATA GA ACC 5'ORF3'
CC   G acccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaacgaa
CC   caggtcactatcagtcaaaataaaatcattattg-3' (5'ORF3'; ORF sequence. attL
CC   sequences are described in lower cases).
CC   Clone information: http://www.HGPD.jp/
CC   This clone was produced in the "Functional Analysis of Protein and
CC   Research Application" project supported by the New Energy and
CC   Industrial Technology Development Organization (NEDO), Japan
FH   Key             Location/Qualifiers
FT   source          1..1113
FT                   /organism="Homo sapiens"
FT                   /mol_type="mRNA"
FT                   /clone="FLJ08111AAAN"
FT                   /note="Vector: pDONR201"
FT                   /db_xref="taxon:9606"
FT   CDS_pept        1..1113
FT                   /codon_start=1
FT                   /transl_table=1
FT                   /gene="CAMK1"
FT                   /product="calcium/calmodulin-dependent protein kinase I"
FT                   /db_xref="GOA:B5BU41"
FT                   /db_xref="H-InvDB:HIT000487490.4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:B5BU41"
FT                   /protein_id="BAG70091.1"
SQ   Sequence 1113 BP; 266 A; 290 C; 338 G; 219 T; 0 other;
     atgctggggg cagtggaagg ccccaggtgg aagcaggcgg aggacattag agacatctac        60
     gacttccgag atgttctggg cacgggggcc ttctcggagg tgatcctggc agaagataag       120
     aggacgcaga agctggtggc catcaaatgc attgccaagg aggccctgga gggcaaggaa       180
     ggcagcatgg agaatgagat tgctgtcctg cacaagatca agcaccccaa cattgtagcc       240
     ctggatgaca tctatgagag tgggggccac ctctacctca tcatgcagct ggtgtcgggt       300
     ggggagctct ttgaccgtat tgtggaaaaa ggcttctaca cggagcggga cgccagccgc       360
     ctcatcttcc aggtgctgga tgctgtgaaa tacctgcatg acctgggcat tgtacaccgg       420
     gatctcaagc cagagaatct gctgtactac agcctggatg aagactccaa aatcatgatc       480
     tccgactttg gcctctccaa gatggaggac ccgggcagtg tgctctccac cgcctgtgga       540
     actccgggat acgtggcccc tgaagtcctg gcccagaagc cctacagcaa ggctgtggat       600
     tgctggtcca taggtgtcat cgcctacatc ttgctctgcg gttaccctcc cttctatgac       660
     gagaatggtg ccaaactctt tgaacagatt ttgaaggccg agtacgagtt tgactctcct       720
     tactgggacg acatctctga ctctgccaaa gatttcatcc ggcacttgat ggagaaggac       780
     ccagagaaaa gattcacctg tgagcaggcc ttgcagcacc catggattgc aggagataca       840
     gctctagata agaatatcca ccagtcggtg agtgagcaga tcaagaagaa ctttgccaag       900
     agcaagtgga agcaagcctt caatgccacg gctgtggtgc ggcacatgag gaaactgcag       960
     ctgggcacca gccaggaggg gcaggggcag acggcgagcc atggggagct gctgacacca      1020
     gtggctgggg ggccggcagc tggctgttgc tgtcgagact gctgcgtgga gccgggcaca      1080
     gaactgtccc ccacactgcc ccaccagctc taa                                   1113

If you have problems or comments...

PBIL Back to PBIL home page