(data stored in ACNUC8465 zone)

EMBL: AB451349

ID   AB451349; SV 1; linear; mRNA; STD; HUM; 1041 BP.
AC   AB451349;
DT   02-SEP-2008 (Rel. 97, Created)
DT   02-SEP-2008 (Rel. 97, Last updated, Version 1)
DE   Homo sapiens MAP2K3 mRNA for mitogen-activated protein kinase kinase 3
DE   isoform B, partial cds, clone: FLJ08011AAAF.
KW   Gateway cloning system.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1041
RA   Kawamura Y., Nomura N., Goshima N.;
RT   ;
RL   Submitted (31-JUL-2008) to the INSDC.
RL   Contact:Naoki Goshima Biomedicinal Information Research Center (BIRC),
RL   National Institute of Advanced Industrial Science and Technology (AIST);
RL   2-42 Aomi, Koto-ku, Tokyo 135-0064, Japan
RN   [2]
RA   Goshima N., Kawamura Y., Fukumoto A., Miura A., Honma R., Satoh R.,
RA   Wakamatsu A., Yamamoto J.-I., Kimura K., Nishikawa T., Andoh T., Iida Y.,
RA   Ishikawa K., Ito E., Kagawa N., Kaminaga C., Kanehori K., Kawakami B.,
RA   Kenmochi K.-I., Kimura R., Kobayashi M., Kuroita T., Kuwayama H.,
RA   Maruyama Y., Matsuo K., Minami K., Mitsubori M., Mori M., Morishita R.,
RA   Murase A., Nishikawa A., Nishikawa S., Okamoto T., Sakagami N.,
RA   Sakamoto Y., Sasaki Y., Seki T., Sono S., Sugiyama A., Sumiya T.,
RA   Takayama T., Takayama Y., Takeda H., Togashi T., Yahata K., Yamada H.,
RA   Yanagisawa Y., Endo Y., Imamoto F., Kisu Y., Tanaka S., Isogai T.,
RA   Imai J.-I., Watanabe S., Nomura N.;
RT   "Human Protein Factory: an infrastructure to convert the human
RT   transcriptome into the in vitro-expressed human proteome of versatile
RT   utility";
RL   Unpublished.
DR   MD5; 37786964e871d4ce7f99555e2004d2fd.
DR   Ensembl-Gn; ENSG00000034152; homo_sapiens.
DR   Ensembl-Tr; ENST00000342679; homo_sapiens.
CC   This human Gateway entry clone was constructed by recombining an
CC   attB-attached open reading frame (ORF) fragment with attP
CC   sequences of the Gateway donor vector pDONR201. The ORF sequence
CC   in the entry clone is flanked with attL1 sequence (100 nt) -
CC   spacer nucleotides (TC) - Shine-Dalgano sequence (GAAGGAGATA) -
CC   spacer nucleotides (GA) - Kozak sequence (ACC) upstream of the
CC   translational initiation codon (ATG) and is also flanked with
CC   spacer nucleotides (TATG) - attL2 sequence (99 nt) downstream of
CC   the ORF. This is an F-type clone that deletes the stop codon for
CC   C-terminal tagged proteins. DNA sequences of the entire ORF and
CC   flanking regions were validated by sequencing. Clone structure of
CC   the ORF and flanking sequences is as follows:
CC   5'-caaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgct
CC   tttttataatgccaactttgtacaaaaaagcaggct TC GAAGGAGATA GA ACC 5'ORF3'
CC   TATG acccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaac
CC   gaacaggtcactatcagtcaaaataaaatcattattg-3' (5'ORF3'; ORF sequence.
CC   attL sequences are described in lower cases).
CC   Clone information: http://www.HGPD.jp/
CC   This clone was produced in the "Functional Analysis of Protein and
CC   Research Application" project supported by the New Energy and
CC   Industrial Technology Development Organization (NEDO), Japan
FH   Key             Location/Qualifiers
FT   source          1..1041
FT                   /organism="Homo sapiens"
FT                   /mol_type="mRNA"
FT                   /clone="FLJ08011AAAF"
FT                   /note="Vector: pDONR201"
FT                   /db_xref="taxon:9606"
FT   CDS_pept        1..>1041
FT                   /codon_start=1
FT                   /transl_table=1
FT                   /gene="MAP2K3"
FT                   /product="mitogen-activated protein kinase kinase 3 isoform
FT                   B"
FT                   /db_xref="GOA:Q6FI23"
FT                   /db_xref="H-InvDB:HIT000487562.4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q6FI23"
FT                   /protein_id="BAG70163.1"
FT                   EILGEDS"
SQ   Sequence 1041 BP; 248 A; 298 C; 299 G; 196 T; 0 other;
     atggagtcgc ccgcctcgag ccagcccgcc agcatgcccc agtccaaagg aaaatccaag        60
     aggaagaagg atctacggat atcctgcatg tccaagccac ccgcacccaa ccccacaccc       120
     ccccggaacc tggactcccg gaccttcatc accattggag acagaaactt tgaggtggag       180
     gctgatgact tggtgaccat ctcagaactg ggccgtggag cctatggggt ggtagagaag       240
     gtgcggcacg cccagagcgg caccatcatg gccgtgaagc ggatccgggc caccgtgaac       300
     tcacaggagc agaagcggct gctcatggac ctggacatca acatgcgcac ggtcgactgt       360
     ttctacactg tcaccttcta cggggcacta ttcagagagg gagacgtgtg gatctgcatg       420
     gagctcatgg acacatcctt ggacaagttc taccggaagg tgctggataa aaacatgaca       480
     attccagagg acatccttgg ggagattgct gtgtctatcg tgcgggccct ggagcatctg       540
     cacagcaagc tgtcggtgat ccacagagat gtgaagccct ccaatgtcct tatcaacaag       600
     gagggccatg tgaagatgtg tgactttggc atcagtggct acttggtgga ctctgtggcc       660
     aagacgatgg atgccggctg caagccctac atggcccctg agaggatcaa cccagagctg       720
     aaccagaagg gctacaatgt caagtccgac gtctggagcc tgggcatcac catgattgag       780
     atggccatcc tgcggttccc ttacgagtcc tgggggaccc cgttccagca gctgaagcag       840
     gtggtggagg agccgtcccc ccagctccca gccgaccgtt tctcccccga gtttgtggac       900
     ttcactgctc agtgcctgag gaagaacccc gcagagcgta tgagctacct ggagctgatg       960
     gagcacccct tcttcacctt gcacaaaacc aagaagacgg acattgctgc cttcgtgaag      1020
     gagatcctgg gagaagactc a                                                1041

If you have problems or comments...

PBIL Back to PBIL home page