(data stored in ACNUC8465 zone)

EMBL: AB451376

ID   AB451376; SV 1; linear; mRNA; STD; HUM; 1002 BP.
AC   AB451376;
DT   02-SEP-2008 (Rel. 97, Created)
DT   02-SEP-2008 (Rel. 97, Last updated, Version 1)
DE   Homo sapiens MAP2K6 mRNA for mitogen-activated protein kinase kinase 6,
DE   partial cds, clone: FLJ08063AAAF.
KW   Gateway cloning system.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1002
RA   Kawamura Y., Nomura N., Goshima N.;
RT   ;
RL   Submitted (31-JUL-2008) to the INSDC.
RL   Contact:Naoki Goshima Biomedicinal Information Research Center (BIRC),
RL   National Institute of Advanced Industrial Science and Technology (AIST);
RL   2-42 Aomi, Koto-ku, Tokyo 135-0064, Japan
RN   [2]
RA   Goshima N., Kawamura Y., Fukumoto A., Miura A., Honma R., Satoh R.,
RA   Wakamatsu A., Yamamoto J.-I., Kimura K., Nishikawa T., Andoh T., Iida Y.,
RA   Ishikawa K., Ito E., Kagawa N., Kaminaga C., Kanehori K., Kawakami B.,
RA   Kenmochi K.-I., Kimura R., Kobayashi M., Kuroita T., Kuwayama H.,
RA   Maruyama Y., Matsuo K., Minami K., Mitsubori M., Mori M., Morishita R.,
RA   Murase A., Nishikawa A., Nishikawa S., Okamoto T., Sakagami N.,
RA   Sakamoto Y., Sasaki Y., Seki T., Sono S., Sugiyama A., Sumiya T.,
RA   Takayama T., Takayama Y., Takeda H., Togashi T., Yahata K., Yamada H.,
RA   Yanagisawa Y., Endo Y., Imamoto F., Kisu Y., Tanaka S., Isogai T.,
RA   Imai J.-I., Watanabe S., Nomura N.;
RT   "Human Protein Factory: an infrastructure to convert the human
RT   transcriptome into the in vitro-expressed human proteome of versatile
RT   utility";
RL   Unpublished.
DR   MD5; 70e385a8f8e1fa6843f641948ac81930.
DR   Ensembl-Gn; ENSG00000108984; homo_sapiens.
DR   Ensembl-Tr; ENST00000590474; homo_sapiens.
CC   This human Gateway entry clone was constructed by recombining an
CC   attB-attached open reading frame (ORF) fragment with attP
CC   sequences of the Gateway donor vector pDONR201. The ORF sequence
CC   in the entry clone is flanked with attL1 sequence (100 nt) -
CC   spacer nucleotides (TC) - Shine-Dalgano sequence (GAAGGAGATA) -
CC   spacer nucleotides (GA) - Kozak sequence (ACC) upstream of the
CC   translational initiation codon (ATG) and is also flanked with
CC   spacer nucleotides (TATG) - attL2 sequence (99 nt) downstream of
CC   the ORF. This is an F-type clone that deletes the stop codon for
CC   C-terminal tagged proteins. DNA sequences of the entire ORF and
CC   flanking regions were validated by sequencing. Clone structure of
CC   the ORF and flanking sequences is as follows:
CC   5'-caaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgct
CC   tttttataatgccaactttgtacaaaaaagcaggct TC GAAGGAGATA GA ACC 5'ORF3'
CC   TATG acccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaac
CC   gaacaggtcactatcagtcaaaataaaatcattattg-3' (5'ORF3'; ORF sequence.
CC   attL sequences are described in lower cases).
CC   Clone information: http://www.HGPD.jp/
CC   This clone was produced in the "Functional Analysis of Protein and
CC   Research Application" project supported by the New Energy and
CC   Industrial Technology Development Organization (NEDO), Japan
FH   Key             Location/Qualifiers
FT   source          1..1002
FT                   /organism="Homo sapiens"
FT                   /mol_type="mRNA"
FT                   /clone="FLJ08063AAAF"
FT                   /note="Vector: pDONR201"
FT                   /db_xref="taxon:9606"
FT   CDS_pept        1..>1002
FT                   /codon_start=1
FT                   /transl_table=1
FT                   /gene="MAP2K6"
FT                   /product="mitogen-activated protein kinase kinase 6"
FT                   /db_xref="GOA:A8K3Y2"
FT                   /db_xref="H-InvDB:HIT000487589.4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:A8K3Y2"
FT                   /protein_id="BAG70190.1"
SQ   Sequence 1002 BP; 300 A; 216 C; 241 G; 245 T; 0 other;
     atgtctcagt cgaaaggcaa gaagcgaaac cctggcctta aaattccaaa agaagcattt        60
     gaacaacctc agaccagttc cacaccacct cgagatttag actccaaggc ttgcatttct       120
     attggaaatc agaactttga ggtgaaggca gatgacctgg agcctataat ggaactggga       180
     cgaggtgcgt acggggtggt ggagaagatg cggcacgtgc ccagcgggca gatcatggca       240
     gtgaagcgga tccgagccac agtaaatagc caggaacaga aacggctact gatggatttg       300
     gatatttcca tgaggacggt ggactgtcca ttcactgtca ccttttatgg cgcactgttt       360
     cgggagggtg atgtgtggat ctgcatggag ctcatggata catcactaga taaattctac       420
     aaacaagtta ttgataaagg ccagacaatt ccagaggaca tcttagggaa aatagcagtt       480
     tctattgtaa aagcattaga acatttacat agtaagctgt ctgtcattca cagagacgtc       540
     aagccttcta atgtactcat caatgctctc ggtcaagtga agatgtgcga ttttggaatc       600
     agtggctact tggtggactc tgttgctaaa acaattgatg caggttgcaa accatacatg       660
     gcccctgaaa gaataaaccc agagctcaac cagaagggat acagtgtgaa gtctgacatt       720
     tggagtctgg gcatcacgat gattgagttg gccatccttc gatttcccta tgattcatgg       780
     ggaactccat ttcagcagct caaacaggtg gtagaggagc catcgccaca actcccagca       840
     gacaagttct ctgcagagtt tgttgacttt acctcacagt gcttaaagaa gaattccaaa       900
     gaacggccta catacccaga gctaatgcaa catccatttt tcaccctaca tgaatccaaa       960
     ggaacagatg tggcatcttt tgtaaaactg attcttggag ac                         1002

If you have problems or comments...

PBIL Back to PBIL home page