(data stored in ACNUC27125 zone)

EMBL: AB451487

ID   AB451487; SV 1; linear; mRNA; STD; HUM; 1563 BP.
AC   AB451487;
DT   02-SEP-2008 (Rel. 97, Created)
DT   02-SEP-2008 (Rel. 97, Last updated, Version 1)
DE   Homo sapiens PPP3CA mRNA for serine/threonine-protein phosphatase 2B
DE   catalytic subunit alpha isoform, partial cds, clone: FLJ85501SAAF.
KW   Gateway cloning system.
OS   Homo sapiens (human)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia;
OC   Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae;
OC   Homo.
RN   [1]
RP   1-1563
RA   Kawamura Y., Nomura N., Goshima N.;
RT   ;
RL   Submitted (31-JUL-2008) to the INSDC.
RL   Contact:Naoki Goshima Biomedicinal Information Research Center (BIRC),
RL   National Institute of Advanced Industrial Science and Technology (AIST);
RL   2-42 Aomi, Koto-ku, Tokyo 135-0064, Japan
RN   [2]
RA   Goshima N., Kawamura Y., Fukumoto A., Miura A., Honma R., Satoh R.,
RA   Wakamatsu A., Yamamoto J.-I., Kimura K., Nishikawa T., Andoh T., Iida Y.,
RA   Ishikawa K., Ito E., Kagawa N., Kaminaga C., Kanehori K., Kawakami B.,
RA   Kenmochi K.-I., Kimura R., Kobayashi M., Kuroita T., Kuwayama H.,
RA   Maruyama Y., Matsuo K., Minami K., Mitsubori M., Mori M., Morishita R.,
RA   Murase A., Nishikawa A., Nishikawa S., Okamoto T., Sakagami N.,
RA   Sakamoto Y., Sasaki Y., Seki T., Sono S., Sugiyama A., Sumiya T.,
RA   Takayama T., Takayama Y., Takeda H., Togashi T., Yahata K., Yamada H.,
RA   Yanagisawa Y., Endo Y., Imamoto F., Kisu Y., Tanaka S., Isogai T.,
RA   Imai J.-I., Watanabe S., Nomura N.;
RT   "Human Protein Factory: an infrastructure to convert the human
RT   transcriptome into the in vitro-expressed human proteome of versatile
RT   utility";
RL   Unpublished.
DR   MD5; 3e1b30b204aa89ade45166f405e0282a.
DR   Ensembl-Gn; ENSG00000138814; homo_sapiens.
DR   Ensembl-Tr; ENST00000323055; homo_sapiens.
DR   Ensembl-Tr; ENST00000394853; homo_sapiens.
DR   Ensembl-Tr; ENST00000394854; homo_sapiens.
DR   Ensembl-Tr; ENST00000512215; homo_sapiens.
CC   This human Gateway entry clone was constructed by recombining an
CC   attB-attached open reading frame (ORF) fragment with attP
CC   sequences of the Gateway donor vector pDONR201. The ORF sequence
CC   in the entry clone is flanked with attL1 sequence (100 nt) -
CC   spacer nucleotides (TC) - Shine-Dalgano sequence (GAAGGAGATA) -
CC   spacer nucleotides (GA) - Kozak sequence (ACC) upstream of the
CC   translational initiation codon (ATG) and is also flanked with
CC   spacer nucleotides (TATG) - attL2 sequence (99 nt) downstream of
CC   the ORF. This is an F-type clone that deletes the stop codon for
CC   C-terminal tagged proteins. DNA sequences of the entire ORF and
CC   flanking regions were validated by sequencing. Clone structure of
CC   the ORF and flanking sequences is as follows:
CC   5'-caaataatgattttattttgactgatagtgacctgttcgttgcaacaaattgatgagcaatgct
CC   tttttataatgccaactttgtacaaaaaagcaggct TC GAAGGAGATA GA ACC 5'ORF3'
CC   TATG acccagctttcttgtacaaagttggcattataagaaagcattgcttatcaatttgttgcaac
CC   gaacaggtcactatcagtcaaaataaaatcattattg-3' (5'ORF3'; ORF sequence.
CC   attL sequences are described in lower cases).
CC   Clone information: http://www.HGPD.jp/
CC   This clone was produced in the "Functional Analysis of Protein and
CC   Research Application" project supported by the New Energy and
CC   Industrial Technology Development Organization (NEDO), Japan
FH   Key             Location/Qualifiers
FT   source          1..1563
FT                   /organism="Homo sapiens"
FT                   /mol_type="mRNA"
FT                   /clone="FLJ85501SAAF"
FT                   /note="Vector: pDONR201"
FT                   /db_xref="taxon:9606"
FT   CDS_pept        1..>1563
FT                   /codon_start=1
FT                   /transl_table=1
FT                   /gene="PPP3CA"
FT                   /product="serine/threonine-protein phosphatase 2B catalytic
FT                   subunit alpha isoform"
FT                   /db_xref="GOA:Q08209"
FT                   /db_xref="H-InvDB:HIT000487700.4"
FT                   /db_xref="HGNC:HGNC:9314"
FT                   /db_xref="InterPro:IPR004843"
FT                   /db_xref="InterPro:IPR006186"
FT                   /db_xref="InterPro:IPR029052"
FT                   /db_xref="InterPro:IPR041751"
FT                   /db_xref="PDB:1AUI"
FT                   /db_xref="PDB:1M63"
FT                   /db_xref="PDB:1MF8"
FT                   /db_xref="PDB:2JOG"
FT                   /db_xref="PDB:2JZI"
FT                   /db_xref="PDB:2P6B"
FT                   /db_xref="PDB:2R28"
FT                   /db_xref="PDB:2W73"
FT                   /db_xref="PDB:3LL8"
FT                   /db_xref="PDB:4F0Z"
FT                   /db_xref="PDB:4Q5U"
FT                   /db_xref="PDB:5C1V"
FT                   /db_xref="PDB:5SVE"
FT                   /db_xref="PDB:6NUC"
FT                   /db_xref="PDB:6NUF"
FT                   /db_xref="PDB:6NUU"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q08209"
FT                   /protein_id="BAG70301.1"
FT                   SNIQ"
SQ   Sequence 1563 BP; 463 A; 332 C; 365 G; 403 T; 0 other;
     atgtccgagc ccaaggcaat tgatcccaag ttgtcgacga ccgacagggt ggtgaaagct        60
     gttccatttc ctccaagtca ccggcttaca gcaaaagaag tgtttgataa tgatggaaaa       120
     cctcgtgtgg atatcttaaa ggcgcatctt atgaaggagg gaaggctgga agagagtgtt       180
     gcattgagaa taataacaga gggtgcatca attcttcgac aggaaaaaaa tttgctggat       240
     attgatgcgc cagtcactgt ttgtggggac attcatggac aattctttga tttgatgaag       300
     ctctttgaag tcgggggatc tcctgccaac actcgctacc tcttcttagg ggactatgtt       360
     gacagagggt acttcagtat tgaatgtgtg ctgtatttgt gggccttgaa aattctctac       420
     cccaaaacac tgtttttact tcgtggaaat catgaatgta gacatctaac agagtatttc       480
     acatttaaac aagaatgtaa aataaagtat tcagaacgcg tatatgatgc ctgtatggat       540
     gcctttgact gccttcccct ggctgccctg atgaaccaac agttcctgtg tgtgcatggt       600
     ggtttgtctc cagagattaa cactttagat gatatcagaa aattagaccg attcaaagaa       660
     ccacctgcat atggacctat gtgtgatatc ctgtggtcag accccctgga agattttgga       720
     aatgagaaga ctcaggaaca tttcactcac aacacagtca gggggtgttc atacttctac       780
     agttacccgg ctgtatgtga attcttacag cacaataact tgttatctat actccgagcc       840
     cacgaagccc aagatgcagg gtaccgcatg tacaggaaaa gccaaacaac aggcttccct       900
     tctctaatta caattttttc agcaccaaat tacttagatg tatacaataa caaagctgca       960
     gtattgaagt atgagaacaa tgttatgaat atcaggcaat tcaactgttc tcctcatcca      1020
     tactggcttc caaatttcat ggatgttttt acttggtccc ttccatttgt tggggaaaaa      1080
     gtgactgaga tgctggtaaa tgtcctcaac atctgctcag atgatgaact agggtcagaa      1140
     gaagatggat ttgatggtgc aacagctgca gcccggaaag aggtgataag gaacaagatc      1200
     cgagcaatag gcaaaatggc cagagtgttc tcagtgctca gagaagagag tgagagtgtg      1260
     ctgacgctga aaggcttgac cccaactggc atgctcccca gcggagtact ttctggaggg      1320
     aagcaaaccc tgcaaagcgc tactgttgag gctattgagg ctgatgaagc tatcaaagga      1380
     ttttcaccac aacataagat cactagcttc gaggaagcca agggcttaga ccgaattaat      1440
     gagaggatgc cgcctcgcag agatgccatg ccctctgacg ccaaccttaa ctccatcaac      1500
     aaggctctca cctcagagac taacggcacg gacagcaatg gcagtaatag cagcaatatt      1560
     cag                                                                    1563

If you have problems or comments...

PBIL Back to PBIL home page