(data stored in ACNUC8465 zone)

EMBL: AE016816

ID   AE016816; SV 3; linear; genomic DNA; STD; FUN; 907494 BP.
AC   AE016816; AE016886-AE016888;
PR   Project:PRJNA13834;
DT   08-SEP-2004 (Rel. 81, Created)
DT   19-SEP-2017 (Rel. 134, Last updated, Version 12)
DE   Ashbya gossypii ATCC 10895 chromosome III, complete sequence.
KW   .
OS   Eremothecium gossypii ATCC 10895
OC   Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes;
OC   Saccharomycetales; Saccharomycetaceae; Eremothecium.
RN   [1]
RP   1-907494
RX   DOI; 10.1126/science.1095781.
RX   PUBMED; 15001715.
RA   Dietrich F.S., Voegeli S., Brachat S., Lerch A., Gates K., Steiner S.,
RA   Mohr C., Pohlmann R., Luedi P., Choi S., Wing R.A., Flavier A.,
RA   Gaffney T.D., Philippsen P.;
RT   "The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces
RT   cerevisiae genome";
RL   Science, e1252229 304(5668):304-307(2004).
RN   [2]
RP   1-907494
RA   Lerch A., Brachat S., Voegeli S.E., Gaffney T., Philippsen P.,
RA   Dietrich F.S.;
RT   ;
RL   Submitted (20-DEC-2002) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [3]
RC   Sequence update by submitter
RP   1-907494
RA   Lerch A., Brachat S., Voegeli S.E., Gaffney T., Philippsen P.,
RA   Dietrich F.S.;
RT   ;
RL   Submitted (09-AUG-2007) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [4]
RC   Sequence update by submitter
RP   1-907494
RA   Dietrich F.S., Voegeli S., Philippsen P.;
RT   ;
RL   Submitted (03-JUN-2010) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [5]
RC   Protein update by submitter
RP   1-907494
RA   Dietrich F.S., Voegeli S., Philippsen P.;
RT   ;
RL   Submitted (18-OCT-2010) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
DR   MD5; 65304b6fc663a1f96b2c181eb027a339.
DR   BioSample; SAMN03081415.
DR   EnsemblGenomes-Gn; AGOS_ACR186W.
DR   EnsemblGenomes-Gn; EFAGOG00000000014.
DR   EnsemblGenomes-Gn; EFAGOG00000000038.
DR   EnsemblGenomes-Gn; EFAGOG00000000079.
DR   EnsemblGenomes-Gn; EFAGOG00000000107.
DR   EnsemblGenomes-Gn; EFAGOG00000000141.
DR   EnsemblGenomes-Gn; EFAGOG00000000205.
DR   EnsemblGenomes-Gn; EFAGOG00000000230.
DR   EnsemblGenomes-Gn; EFAGOG00000000247.
DR   EnsemblGenomes-Gn; EFAGOG00000000302.
DR   EnsemblGenomes-Gn; EFAGOG00000000326.
DR   EnsemblGenomes-Gn; EFAGOG00000000342.
DR   EnsemblGenomes-Gn; EFAGOG00000000395.
DR   EnsemblGenomes-Gn; EFAGOG00000000398.
DR   EnsemblGenomes-Gn; EFAGOG00000000407.
DR   EnsemblGenomes-Gn; ENSRNA049495751.
DR   EnsemblGenomes-Gn; ENSRNA049495756.
DR   EnsemblGenomes-Gn; ENSRNA049495757.
DR   EnsemblGenomes-Gn; ENSRNA049495758.
DR   EnsemblGenomes-Gn; ENSRNA049495759.
DR   EnsemblGenomes-Gn; ENSRNA049518761.
DR   EnsemblGenomes-Gn; ENSRNA049518785.
DR   EnsemblGenomes-Gn; ENSRNA049518797.
DR   EnsemblGenomes-Gn; ENSRNA049518810.
DR   EnsemblGenomes-Gn; ENSRNA049518831.
DR   EnsemblGenomes-Gn; ENSRNA049518848.
DR   EnsemblGenomes-Gn; ENSRNA049518870.
DR   EnsemblGenomes-Gn; ENSRNA049518894.
DR   EnsemblGenomes-Gn; ENSRNA049518923.
DR   EnsemblGenomes-Gn; ENSRNA049518954.
DR   EnsemblGenomes-Gn; ENSRNA049518965.
DR   EnsemblGenomes-Gn; ENSRNA049518984.
DR   EnsemblGenomes-Gn; ENSRNA049519002.
DR   EnsemblGenomes-Gn; ENSRNA049519020.
DR   EnsemblGenomes-Tr; AAS51412.
DR   EnsemblGenomes-Tr; EFAGOT00000000014.
DR   EnsemblGenomes-Tr; EFAGOT00000000038.
DR   EnsemblGenomes-Tr; EFAGOT00000000079.
DR   EnsemblGenomes-Tr; EFAGOT00000000107.
DR   EnsemblGenomes-Tr; EFAGOT00000000141.
DR   EnsemblGenomes-Tr; EFAGOT00000000205.
DR   EnsemblGenomes-Tr; EFAGOT00000000230.
DR   EnsemblGenomes-Tr; EFAGOT00000000247.
DR   EnsemblGenomes-Tr; EFAGOT00000000302.
DR   EnsemblGenomes-Tr; EFAGOT00000000326.
DR   EnsemblGenomes-Tr; EFAGOT00000000342.
DR   EnsemblGenomes-Tr; EFAGOT00000000395.
DR   EnsemblGenomes-Tr; EFAGOT00000000398.
DR   EnsemblGenomes-Tr; EFAGOT00000000407.
DR   RFAM; RF00005; tRNA.
DR   RFAM; RF00016; SNORD14.
DR   RFAM; RF01059; mir-598.
DR   RFAM; RF01249; snR190.
DR   RFAM; RF01255; snR35.
DR   RFAM; RF01265; snR42.
DR   RFAM; RF01846; Fungi_U3.
DR   StrainInfo; 195190; 0.
CC   On Jun 29, 2010 this sequence version replaced AE016816.2.
CC   This genome has been completely resequenced to high accuracy (derf)
CC   and reannotated. Gene names have been maintained, though some genes
CC   have been added, and many protein sequences have been corrected.
FH   Key             Location/Qualifiers
FT   source          1..907494
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /chromosome="III"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /db_xref="taxon:284811"
FT                   /culture_collection="ATCC:10895"
FT   source          2559..57203
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1677"
FT                   /db_xref="taxon:284811"
FT   source          3631..64548
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1086"
FT                   /db_xref="taxon:284811"
FT   source          57213..135792
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1274"
FT                   /db_xref="taxon:284811"
FT   source          107128..176940
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1790"
FT                   /db_xref="taxon:284811"
FT   source          149823..243459
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1190"
FT                   /db_xref="taxon:284811"
FT   source          201398..267970
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1174"
FT                   /db_xref="taxon:284811"
FT   source          264450..332467
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1022"
FT                   /db_xref="taxon:284811"
FT   source          325912..386547
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1575"
FT                   /db_xref="taxon:284811"
FT   source          371236..419267
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1061"
FT                   /db_xref="taxon:284811"
FT   source          404424..464899
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1912"
FT                   /db_xref="taxon:284811"
FT   source          444094..492746
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1713"
FT                   /db_xref="taxon:284811"
FT   source          477754..540368
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1901"
FT                   /db_xref="taxon:284811"
FT   source          523833..587378
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1503"
FT                   /db_xref="taxon:284811"
FT   source          571891..644277
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1132"
FT                   /db_xref="taxon:284811"
FT   source          639028..723809
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1591"
FT                   /db_xref="taxon:284811"
FT   source          715565..785511
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1038"
FT                   /db_xref="taxon:284811"
FT   source          760870..838803
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1820"
FT                   /db_xref="taxon:284811"
FT   source          814120..874204
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2333"
FT                   /db_xref="taxon:284811"
FT   source          832880..895506
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC DNA bAG2449"
FT                   /db_xref="taxon:284811"
FT   telomere        complement(1..577)
FT                   /rpt_type=DIRECT
FT                   /rpt_unit_range=16..39
FT                   /rpt_unit_seq="ggtgtggtgtatgggtctctcagc"
FT                   /note="Chromosome III left end terminal telomere repeat.
FT                   Composed of approximately 20 copies of a 24 base repeat
FT                   unit, and occasionally sequence varients of this repeat."
FT   telomere        complement(578..1100)
FT                   /note="Chromosome III left subtelomeric sequence. Shares
FT                   some sequence similarity with other subtelomeric regions."
FT   gene            complement(<1205..>3841)
FT                   /locus_tag="AGOS_ACL205C"
FT                   /old_locus_tag="ACL205C"
FT   mRNA            complement(<1205..>3841)
FT                   /locus_tag="AGOS_ACL205C"
FT                   /old_locus_tag="ACL205C"
FT                   /product="ACL205Cp"
FT   CDS_pept        complement(1205..3841)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL205C"
FT                   /old_locus_tag="ACL205C"
FT                   /product="ACL205Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YPR194C (OPT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL205C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51023"
FT                   /db_xref="GOA:Q75CX1"
FT                   /db_xref="InterPro:IPR004648"
FT                   /db_xref="InterPro:IPR004813"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CX1"
FT                   /protein_id="AAS51023.2"
FT                   ELGHIPK"
FT   gene            <3901..>4620
FT                   /locus_tag="AGOS_ACL204W"
FT                   /old_locus_tag="ACL204W"
FT   mRNA            <3901..>4620
FT                   /locus_tag="AGOS_ACL204W"
FT                   /old_locus_tag="ACL204W"
FT                   /product="ACL204Wp"
FT   CDS_pept        3901..4620
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL204W"
FT                   /old_locus_tag="ACL204W"
FT                   /product="ACL204Wp"
FT                   /note="NOHBY315; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL204W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51024"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CX0"
FT                   /protein_id="AAS51024.2"
FT                   AKARSWSRNGVASVLMV"
FT   gene            complement(<4853..>6466)
FT                   /locus_tag="AGOS_ACL203C"
FT                   /old_locus_tag="ACL203C"
FT   mRNA            complement(<4853..>6466)
FT                   /locus_tag="AGOS_ACL203C"
FT                   /old_locus_tag="ACL203C"
FT                   /product="ACL203Cp"
FT   CDS_pept        complement(4853..6466)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL203C"
FT                   /old_locus_tag="ACL203C"
FT                   /product="ACL203Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIL166C, YOL162W and YOL163W; YOL162W and YOL163W represent
FT                   one ORF in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL203C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51025"
FT                   /db_xref="GOA:Q75CW9"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CW9"
FT                   /protein_id="AAS51025.1"
FT   gene            7554..7635
FT                   /locus_tag="AGOS_t0043"
FT   tRNA            7554..7635
FT                   /locus_tag="AGOS_t0043"
FT                   /product="tRNA-Ser"
FT                   /note="codon recognized: UCU"
FT   gene            <8390..>9742
FT                   /locus_tag="AGOS_ACL202W"
FT                   /old_locus_tag="ACL202W"
FT   mRNA            <8390..>9742
FT                   /locus_tag="AGOS_ACL202W"
FT                   /old_locus_tag="ACL202W"
FT                   /product="ACL202Wp"
FT   CDS_pept        8390..9742
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL202W"
FT                   /old_locus_tag="ACL202W"
FT                   /product="ACL202Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YMR238W (DFG5); Tandem gene triplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL202W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51026"
FT                   /db_xref="GOA:Q75CW8"
FT                   /db_xref="InterPro:IPR005198"
FT                   /db_xref="InterPro:IPR008928"
FT                   /db_xref="InterPro:IPR014480"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CW8"
FT                   /protein_id="AAS51026.1"
FT   gene            <10277..>11623
FT                   /locus_tag="AGOS_ACL201W"
FT                   /old_locus_tag="ACL201W"
FT   mRNA            <10277..>11623
FT                   /locus_tag="AGOS_ACL201W"
FT                   /old_locus_tag="ACL201W"
FT                   /product="ACL201Wp"
FT   CDS_pept        10277..11623
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL201W"
FT                   /old_locus_tag="ACL201W"
FT                   /product="ACL201Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YMR238W (DFG5); Tandem gene triplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL201W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51027"
FT                   /db_xref="GOA:Q75CW7"
FT                   /db_xref="InterPro:IPR005198"
FT                   /db_xref="InterPro:IPR008928"
FT                   /db_xref="InterPro:IPR014480"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CW7"
FT                   /protein_id="AAS51027.1"
FT   gene            <12145..>13536
FT                   /locus_tag="AGOS_ACL200W"
FT                   /old_locus_tag="ACL200W"
FT   mRNA            <12145..>13536
FT                   /locus_tag="AGOS_ACL200W"
FT                   /old_locus_tag="ACL200W"
FT                   /product="ACL200Wp"
FT   CDS_pept        12145..13536
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL200W"
FT                   /old_locus_tag="ACL200W"
FT                   /product="ACL200Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YMR238W (DFG5); Tandem gene triplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL200W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51028"
FT                   /db_xref="GOA:Q75CW6"
FT                   /db_xref="InterPro:IPR005198"
FT                   /db_xref="InterPro:IPR008928"
FT                   /db_xref="InterPro:IPR014480"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CW6"
FT                   /protein_id="AAS51028.1"
FT                   IWMSI"
FT   gene            complement(<13961..>15061)
FT                   /locus_tag="AGOS_ACL199C"
FT                   /old_locus_tag="ACL199C"
FT   mRNA            complement(<13961..>15061)
FT                   /locus_tag="AGOS_ACL199C"
FT                   /old_locus_tag="ACL199C"
FT                   /product="ACL199Cp"
FT   CDS_pept        complement(13961..15061)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL199C"
FT                   /old_locus_tag="ACL199C"
FT                   /product="ACL199Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR191W
FT                   (QCR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL199C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51029"
FT                   /db_xref="GOA:Q75CW5"
FT                   /db_xref="InterPro:IPR007863"
FT                   /db_xref="InterPro:IPR011249"
FT                   /db_xref="InterPro:IPR011765"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CW5"
FT                   /protein_id="AAS51029.2"
FT   gene            <15600..>16784
FT                   /locus_tag="AGOS_ACL198W"
FT                   /old_locus_tag="ACL198W"
FT   mRNA            <15600..>16784
FT                   /locus_tag="AGOS_ACL198W"
FT                   /old_locus_tag="ACL198W"
FT                   /product="ACL198Wp"
FT   CDS_pept        15600..16784
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL198W"
FT                   /old_locus_tag="ACL198W"
FT                   /product="ACL198Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR355C
FT                   (ILV5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL198W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51030"
FT                   /db_xref="GOA:Q75CW4"
FT                   /db_xref="InterPro:IPR000506"
FT                   /db_xref="InterPro:IPR008927"
FT                   /db_xref="InterPro:IPR013023"
FT                   /db_xref="InterPro:IPR013116"
FT                   /db_xref="InterPro:IPR013328"
FT                   /db_xref="InterPro:IPR016207"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CW4"
FT                   /protein_id="AAS51030.2"
FT   gene            <16997..>17677
FT                   /locus_tag="AGOS_ACL197W"
FT                   /old_locus_tag="ACL197W"
FT   mRNA            <16997..>17677
FT                   /locus_tag="AGOS_ACL197W"
FT                   /old_locus_tag="ACL197W"
FT                   /product="ACL197Wp"
FT   CDS_pept        16997..17677
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL197W"
FT                   /old_locus_tag="ACL197W"
FT                   /product="ACL197Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YBL064C (PRX1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL197W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51031"
FT                   /db_xref="GOA:Q75CW3"
FT                   /db_xref="InterPro:IPR000866"
FT                   /db_xref="InterPro:IPR013766"
FT                   /db_xref="InterPro:IPR019479"
FT                   /db_xref="InterPro:IPR024706"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CW3"
FT                   /protein_id="AAS51031.1"
FT                   QLDR"
FT   gene            <18016..>19020
FT                   /locus_tag="AGOS_ACL196W"
FT                   /old_locus_tag="ACL196W"
FT   mRNA            <18016..>19020
FT                   /locus_tag="AGOS_ACL196W"
FT                   /old_locus_tag="ACL196W"
FT                   /product="ACL196Wp"
FT   CDS_pept        18016..19020
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL196W"
FT                   /old_locus_tag="ACL196W"
FT                   /product="ACL196Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR354C
FT                   (TAL1) and YGR043C (NQM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL196W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51032"
FT                   /db_xref="GOA:Q75CW2"
FT                   /db_xref="InterPro:IPR001585"
FT                   /db_xref="InterPro:IPR004730"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR018225"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CW2"
FT                   /protein_id="AAS51032.2"
FT   gene            complement(<19203..>19532)
FT                   /locus_tag="AGOS_ACL195C"
FT                   /old_locus_tag="ACL195C"
FT   mRNA            complement(<19203..>19532)
FT                   /locus_tag="AGOS_ACL195C"
FT                   /old_locus_tag="ACL195C"
FT                   /product="ACL195Cp"
FT   CDS_pept        complement(19203..19532)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL195C"
FT                   /old_locus_tag="ACL195C"
FT                   /product="ACL195Cp"
FT                   /note="NOHBY314; No homolog in Saccharomyces cerevisiae;
FT                   Non-syntenic homolog of Kluyveromyces lactis KLLA0D00396g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL195C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51033"
FT                   /db_xref="GOA:Q75CW1"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CW1"
FT                   /protein_id="AAS51033.1"
FT                   ASVDA"
FT   gene            complement(<19831..>20496)
FT                   /locus_tag="AGOS_ACL194C"
FT                   /old_locus_tag="ACL194C"
FT   mRNA            complement(<19831..>20496)
FT                   /locus_tag="AGOS_ACL194C"
FT                   /old_locus_tag="ACL194C"
FT                   /product="ACL194Cp"
FT   CDS_pept        complement(19831..20496)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL194C"
FT                   /old_locus_tag="ACL194C"
FT                   /product="ACL194Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR042W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL194C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51034"
FT                   /db_xref="GOA:Q75CW0"
FT                   /db_xref="InterPro:IPR018838"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CW0"
FT                   /protein_id="AAS51034.2"
FT   gene            complement(<21009..>22628)
FT                   /locus_tag="AGOS_ACL193C"
FT                   /old_locus_tag="ACL193C"
FT   mRNA            complement(<21009..>22628)
FT                   /locus_tag="AGOS_ACL193C"
FT                   /old_locus_tag="ACL193C"
FT                   /product="ACL193Cp"
FT   CDS_pept        complement(21009..22628)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL193C"
FT                   /old_locus_tag="ACL193C"
FT                   /product="ACL193Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR041W
FT                   (BUD9) and YLR353W (BUD8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL193C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51035"
FT                   /db_xref="GOA:Q75CV9"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV9"
FT                   /protein_id="AAS51035.1"
FT   gene            complement(<23513..>25966)
FT                   /locus_tag="AGOS_ACL192C"
FT                   /old_locus_tag="ACL192C"
FT   mRNA            complement(<23513..>25966)
FT                   /locus_tag="AGOS_ACL192C"
FT                   /old_locus_tag="ACL192C"
FT                   /product="ACL192Cp"
FT   CDS_pept        complement(23513..25966)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL192C"
FT                   /old_locus_tag="ACL192C"
FT                   /product="ACL192Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR352W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL192C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51036"
FT                   /db_xref="GOA:Q75CV8"
FT                   /db_xref="InterPro:IPR006553"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV8"
FT                   /protein_id="AAS51036.1"
FT                   YSLRT"
FT   gene            complement(<26476..>27573)
FT                   /locus_tag="AGOS_ACL191C"
FT                   /old_locus_tag="ACL191C"
FT   mRNA            complement(<26476..>27573)
FT                   /locus_tag="AGOS_ACL191C"
FT                   /old_locus_tag="ACL191C"
FT                   /product="ACL191Cp"
FT   CDS_pept        complement(26476..27573)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL191C"
FT                   /old_locus_tag="ACL191C"
FT                   /product="ACL191Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR040W
FT                   (KSS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL191C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51037"
FT                   /db_xref="GOA:Q75CV7"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR003527"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV7"
FT                   /protein_id="AAS51037.1"
FT   gene            <27999..>28874
FT                   /locus_tag="AGOS_ACL190W"
FT                   /old_locus_tag="ACL190W"
FT   mRNA            <27999..>28874
FT                   /locus_tag="AGOS_ACL190W"
FT                   /old_locus_tag="ACL190W"
FT                   /product="ACL190Wp"
FT   CDS_pept        27999..28874
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL190W"
FT                   /old_locus_tag="ACL190W"
FT                   /product="ACL190Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR351C
FT                   (NIT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL190W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51038"
FT                   /db_xref="GOA:Q75CV6"
FT                   /db_xref="InterPro:IPR001110"
FT                   /db_xref="InterPro:IPR003010"
FT                   /db_xref="InterPro:IPR036526"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV6"
FT                   /protein_id="AAS51038.1"
FT                   VYADVAASSP"
FT   gene            complement(<28911..>29510)
FT                   /locus_tag="AGOS_ACL189C"
FT                   /old_locus_tag="ACL189C"
FT   mRNA            complement(<28911..>29510)
FT                   /locus_tag="AGOS_ACL189C"
FT                   /old_locus_tag="ACL189C"
FT                   /product="ACL189Cp"
FT   CDS_pept        complement(28911..29510)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL189C"
FT                   /old_locus_tag="ACL189C"
FT                   /product="ACL189Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR038W
FT                   (ORM1) and YLR350W (ORM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL189C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51039"
FT                   /db_xref="GOA:Q75CV5"
FT                   /db_xref="InterPro:IPR007203"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV5"
FT                   /protein_id="AAS51039.1"
FT   gene            <29727..>30035
FT                   /locus_tag="AGOS_ACL188W"
FT                   /old_locus_tag="ACL188W"
FT   mRNA            join(<29727..29753,29802..>30035)
FT                   /locus_tag="AGOS_ACL188W"
FT                   /old_locus_tag="ACL188W"
FT                   /product="ACL188Wp"
FT   CDS_pept        join(29727..29753,29802..30035)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL188W"
FT                   /old_locus_tag="ACL188W"
FT                   /product="ACL188Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR037C
FT                   (ACB1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL188W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51040"
FT                   /db_xref="GOA:Q75CV4"
FT                   /db_xref="InterPro:IPR000582"
FT                   /db_xref="InterPro:IPR014352"
FT                   /db_xref="InterPro:IPR022408"
FT                   /db_xref="InterPro:IPR035984"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV4"
FT                   /protein_id="AAS51040.1"
FT   gene            <30323..>32908
FT                   /locus_tag="AGOS_ACL187W"
FT                   /old_locus_tag="ACL187W"
FT   mRNA            <30323..>32908
FT                   /locus_tag="AGOS_ACL187W"
FT                   /old_locus_tag="ACL187W"
FT                   /product="ACL187Wp"
FT   CDS_pept        30323..32908
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL187W"
FT                   /old_locus_tag="ACL187W"
FT                   /product="ACL187Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR347C
FT                   (KAP95)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL187W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51041"
FT                   /db_xref="GOA:Q75CV3"
FT                   /db_xref="InterPro:IPR001494"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR040122"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV3"
FT                   /protein_id="AAS51041.2"
FT   gene            <33458..>34162
FT                   /locus_tag="AGOS_ACL186W"
FT                   /old_locus_tag="ACL186W"
FT   mRNA            <33458..>34162
FT                   /locus_tag="AGOS_ACL186W"
FT                   /old_locus_tag="ACL186W"
FT                   /product="ACL186Wp"
FT   CDS_pept        33458..34162
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL186W"
FT                   /old_locus_tag="ACL186W"
FT                   /product="ACL186Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR036C
FT                   (CAX4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL186W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51042"
FT                   /db_xref="GOA:Q75CV2"
FT                   /db_xref="InterPro:IPR000326"
FT                   /db_xref="InterPro:IPR036938"
FT                   /db_xref="InterPro:IPR039666"
FT                   /db_xref="InterPro:IPR039667"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV2"
FT                   /protein_id="AAS51042.1"
FT                   RRSRIEGPGKTE"
FT   gene            complement(<34360..>36060)
FT                   /locus_tag="AGOS_ACL185C"
FT                   /old_locus_tag="ACL185C"
FT   mRNA            complement(<34360..>36060)
FT                   /locus_tag="AGOS_ACL185C"
FT                   /old_locus_tag="ACL185C"
FT                   /product="ACL185Cp"
FT   CDS_pept        complement(34360..36060)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL185C"
FT                   /old_locus_tag="ACL185C"
FT                   /product="ACL185Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR345W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL185C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51043"
FT                   /db_xref="GOA:Q75CV1"
FT                   /db_xref="InterPro:IPR003094"
FT                   /db_xref="InterPro:IPR013078"
FT                   /db_xref="InterPro:IPR013079"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR029033"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV1"
FT                   /protein_id="AAS51043.1"
FT   gene            complement(<36438..>36983)
FT                   /locus_tag="AGOS_ACL184C"
FT                   /old_locus_tag="ACL184C"
FT   mRNA            complement(join(<36438..36802,36965..>36983))
FT                   /locus_tag="AGOS_ACL184C"
FT                   /old_locus_tag="ACL184C"
FT                   /product="ACL184Cp"
FT   CDS_pept        complement(join(36438..36802,36965..36983))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL184C"
FT                   /old_locus_tag="ACL184C"
FT                   /product="ACL184Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR344W
FT                   (RPL26A) and YGR034W (RPL26B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL184C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51044"
FT                   /db_xref="GOA:Q75CV0"
FT                   /db_xref="InterPro:IPR005756"
FT                   /db_xref="InterPro:IPR005824"
FT                   /db_xref="InterPro:IPR005825"
FT                   /db_xref="InterPro:IPR008991"
FT                   /db_xref="InterPro:IPR014722"
FT                   /db_xref="InterPro:IPR041988"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CV0"
FT                   /protein_id="AAS51044.1"
FT   gene            complement(37262..37333)
FT                   /locus_tag="AGOS_t0044"
FT   tRNA            complement(37262..37333)
FT                   /locus_tag="AGOS_t0044"
FT                   /product="tRNA-Arg"
FT                   /note="codon recognized: CGG"
FT   gene            <37474..>38178
FT                   /locus_tag="AGOS_ACL183W"
FT                   /old_locus_tag="ACL183W"
FT   mRNA            <37474..>38178
FT                   /locus_tag="AGOS_ACL183W"
FT                   /old_locus_tag="ACL183W"
FT                   /product="ACL183Wp"
FT   CDS_pept        37474..38178
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL183W"
FT                   /old_locus_tag="ACL183W"
FT                   /product="ACL183Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR033C
FT                   (TIM21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL183W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51045"
FT                   /db_xref="GOA:Q75CX4"
FT                   /db_xref="InterPro:IPR013261"
FT                   /db_xref="InterPro:IPR038552"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CX4"
FT                   /protein_id="AAS51045.1"
FT                   GFLGLNWGPRKD"
FT   gene            complement(<38290..>39900)
FT                   /locus_tag="AGOS_ACL182C"
FT                   /old_locus_tag="ACL182C"
FT   mRNA            complement(<38290..>39900)
FT                   /locus_tag="AGOS_ACL182C"
FT                   /old_locus_tag="ACL182C"
FT                   /product="ACL182Cp"
FT   CDS_pept        complement(38290..39900)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL182C"
FT                   /old_locus_tag="ACL182C"
FT                   /product="ACL182Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR343W
FT                   (GAS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL182C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51046"
FT                   /db_xref="GOA:Q75CX3"
FT                   /db_xref="InterPro:IPR004886"
FT                   /db_xref="InterPro:IPR012946"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CX3"
FT                   /protein_id="AAS51046.1"
FT   gene            complement(<40325..>46105)
FT                   /locus_tag="AGOS_ACL181C"
FT                   /old_locus_tag="ACL181C"
FT   mRNA            complement(<40325..>46105)
FT                   /locus_tag="AGOS_ACL181C"
FT                   /old_locus_tag="ACL181C"
FT                   /product="ACL181Cp"
FT   CDS_pept        complement(40325..46105)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL181C"
FT                   /old_locus_tag="ACL181C"
FT                   /product="ACL181Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR342W
FT                   (FKS1) and YGR032W (GSC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL181C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51047"
FT                   /db_xref="GOA:Q75CX2"
FT                   /db_xref="InterPro:IPR003440"
FT                   /db_xref="InterPro:IPR026899"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CX2"
FT                   /protein_id="AAS51047.2"
FT   gene            complement(<46850..>47815)
FT                   /locus_tag="AGOS_ACL180C"
FT                   /old_locus_tag="ACL180C"
FT   mRNA            complement(<46850..>47815)
FT                   /locus_tag="AGOS_ACL180C"
FT                   /old_locus_tag="ACL180C"
FT                   /product="ACL180Cp"
FT   CDS_pept        complement(46850..47815)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL180C"
FT                   /old_locus_tag="ACL180C"
FT                   /product="ACL180Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR031W
FT                   (IMO32)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL180C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51048"
FT                   /db_xref="GOA:Q75CU9"
FT                   /db_xref="InterPro:IPR000073"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU9"
FT                   /protein_id="AAS51048.2"
FT   gene            complement(<48041..>49843)
FT                   /locus_tag="AGOS_ACL179C"
FT                   /old_locus_tag="ACL179C"
FT   mRNA            complement(<48041..>49843)
FT                   /locus_tag="AGOS_ACL179C"
FT                   /old_locus_tag="ACL179C"
FT                   /product="ACL179Cp"
FT   CDS_pept        complement(48041..49843)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL179C"
FT                   /old_locus_tag="ACL179C"
FT                   /product="ACL179Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR341W
FT                   (SPO77)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL179C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51049"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU8"
FT                   /protein_id="AAS51049.2"
FT   gene            complement(<50147..>51076)
FT                   /locus_tag="AGOS_ACL178C"
FT                   /old_locus_tag="ACL178C"
FT   mRNA            complement(<50147..>51076)
FT                   /locus_tag="AGOS_ACL178C"
FT                   /old_locus_tag="ACL178C"
FT                   /product="ACL178Cp"
FT   CDS_pept        complement(50147..51076)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL178C"
FT                   /old_locus_tag="ACL178C"
FT                   /product="ACL178Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR340W
FT                   (RPP0)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL178C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51050"
FT                   /db_xref="GOA:Q75CU7"
FT                   /db_xref="InterPro:IPR001790"
FT                   /db_xref="InterPro:IPR030670"
FT                   /db_xref="InterPro:IPR040637"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU7"
FT                   /protein_id="AAS51050.2"
FT   gene            <51359..>51808
FT                   /locus_tag="AGOS_ACL177W"
FT                   /old_locus_tag="ACL177W"
FT   mRNA            <51359..>51808
FT                   /locus_tag="AGOS_ACL177W"
FT                   /old_locus_tag="ACL177W"
FT                   /product="ACL177Wp"
FT   CDS_pept        51359..51808
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL177W"
FT                   /old_locus_tag="ACL177W"
FT                   /product="ACL177Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR030C
FT                   (POP6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL177W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51051"
FT                   /db_xref="GOA:Q75CU6"
FT                   /db_xref="InterPro:IPR036882"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU6"
FT                   /protein_id="AAS51051.1"
FT   gene            52178..52249
FT                   /locus_tag="AGOS_t0045"
FT   tRNA            52178..52249
FT                   /locus_tag="AGOS_t0045"
FT                   /product="tRNA-Asp"
FT                   /note="codon recognized: GAC"
FT   gene            <52436..>53308
FT                   /locus_tag="AGOS_ACL176W"
FT                   /old_locus_tag="ACL176W"
FT   mRNA            <52436..>53308
FT                   /locus_tag="AGOS_ACL176W"
FT                   /old_locus_tag="ACL176W"
FT                   /product="ACL176Wp"
FT   CDS_pept        52436..53308
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL176W"
FT                   /old_locus_tag="ACL176W"
FT                   /product="ACL176Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR039W
FT                   (ATP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL176W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51052"
FT                   /db_xref="GOA:Q75CU5"
FT                   /db_xref="InterPro:IPR000131"
FT                   /db_xref="InterPro:IPR023632"
FT                   /db_xref="InterPro:IPR035968"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU5"
FT                   /protein_id="AAS51052.2"
FT                   IITGASSLD"
FT   gene            <53707..>54591
FT                   /locus_tag="AGOS_ACL175W"
FT                   /old_locus_tag="ACL175W"
FT   mRNA            <53707..>54591
FT                   /locus_tag="AGOS_ACL175W"
FT                   /old_locus_tag="ACL175W"
FT                   /product="ACL175Wp"
FT   CDS_pept        53707..54591
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL175W"
FT                   /old_locus_tag="ACL175W"
FT                   /product="ACL175Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR040W
FT                   (FIG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL175W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51053"
FT                   /db_xref="GOA:Q75CU4"
FT                   /db_xref="InterPro:IPR016509"
FT                   /db_xref="InterPro:IPR033481"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU4"
FT                   /protein_id="AAS51053.2"
FT                   YAQSDRSTLGNKY"
FT   gene            <54838..>56790
FT                   /locus_tag="AGOS_ACL174W"
FT                   /old_locus_tag="ACL174W"
FT   mRNA            <54838..>56790
FT                   /locus_tag="AGOS_ACL174W"
FT                   /old_locus_tag="ACL174W"
FT                   /product="ACL174Wp"
FT   CDS_pept        54838..56790
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL174W"
FT                   /old_locus_tag="ACL174W"
FT                   /product="ACL174Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR041W
FT                   (FAT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL174W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51054"
FT                   /db_xref="GOA:Q75CU3"
FT                   /db_xref="InterPro:IPR000873"
FT                   /db_xref="InterPro:IPR020845"
FT                   /db_xref="InterPro:IPR030310"
FT                   /db_xref="InterPro:IPR042099"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU3"
FT                   /protein_id="AAS51054.2"
FT                   TDEDWEQISTGKAKL"
FT   gene            complement(<56905..>58140)
FT                   /locus_tag="AGOS_ACL173C"
FT                   /old_locus_tag="ACL173C"
FT   mRNA            complement(<56905..>58140)
FT                   /locus_tag="AGOS_ACL173C"
FT                   /old_locus_tag="ACL173C"
FT                   /product="ACL173Cp"
FT   CDS_pept        complement(56905..58140)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL173C"
FT                   /old_locus_tag="ACL173C"
FT                   /product="ACL173Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR042C
FT                   (CST26) and YDR018C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL173C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51055"
FT                   /db_xref="GOA:Q75CU2"
FT                   /db_xref="InterPro:IPR002123"
FT                   /db_xref="InterPro:IPR032098"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU2"
FT                   /protein_id="AAS51055.1"
FT                   YFGKYSMAAAIY"
FT   gene            complement(<58312..>60207)
FT                   /locus_tag="AGOS_ACL172C"
FT                   /old_locus_tag="ACL172C"
FT   mRNA            complement(<58312..>60207)
FT                   /locus_tag="AGOS_ACL172C"
FT                   /old_locus_tag="ACL172C"
FT                   /product="ACL172Cp"
FT   CDS_pept        complement(58312..60207)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL172C"
FT                   /old_locus_tag="ACL172C"
FT                   /product="ACL172Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR043C
FT                   (QDR3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL172C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51056"
FT                   /db_xref="GOA:Q75CU1"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU1"
FT                   /protein_id="AAS51056.1"
FT   gene            <60437..>61108
FT                   /locus_tag="AGOS_ACL171W"
FT                   /old_locus_tag="ACL171W"
FT   mRNA            <60437..>61108
FT                   /locus_tag="AGOS_ACL171W"
FT                   /old_locus_tag="ACL171W"
FT                   /product="ACL171Wp"
FT   CDS_pept        60437..61108
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL171W"
FT                   /old_locus_tag="ACL171W"
FT                   /product="ACL171Wp"
FT                   /note="NOHBY313; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL171W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51057"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CU0"
FT                   /protein_id="AAS51057.1"
FT                   T"
FT   gene            <61181..>61753
FT                   /locus_tag="AGOS_ACL170W"
FT                   /old_locus_tag="ACL170W"
FT   mRNA            <61181..>61753
FT                   /locus_tag="AGOS_ACL170W"
FT                   /old_locus_tag="ACL170W"
FT                   /product="ACL170Wp"
FT   CDS_pept        61181..61753
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL170W"
FT                   /old_locus_tag="ACL170W"
FT                   /product="ACL170Wp"
FT                   /note="NOHBY312; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL170W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51058"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CT9"
FT                   /protein_id="AAS51058.2"
FT   gene            <61957..>62268
FT                   /locus_tag="AGOS_ACL169W"
FT                   /old_locus_tag="ACL169W"
FT   mRNA            <61957..>62268
FT                   /locus_tag="AGOS_ACL169W"
FT                   /old_locus_tag="ACL169W"
FT                   /product="ACL169Wp"
FT   CDS_pept        61957..62268
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL169W"
FT                   /old_locus_tag="ACL169W"
FT                   /product="ACL169Wp"
FT                   /note="NOHBY311; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E02266g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL169W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51059"
FT                   /db_xref="InterPro:IPR005545"
FT                   /db_xref="InterPro:IPR011008"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CT8"
FT                   /protein_id="AAS51059.1"
FT   gene            complement(<62414..>62853)
FT                   /locus_tag="AGOS_ACL168C"
FT                   /old_locus_tag="ACL168C"
FT   mRNA            complement(join(<62414..62781,62841..>62853))
FT                   /locus_tag="AGOS_ACL168C"
FT                   /old_locus_tag="ACL168C"
FT                   /product="ACL168Cp"
FT   CDS_pept        complement(join(62414..62781,62841..62853))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL168C"
FT                   /old_locus_tag="ACL168C"
FT                   /product="ACL168Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR122C
FT                   (PFY1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL168C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51060"
FT                   /db_xref="GOA:Q75CT7"
FT                   /db_xref="InterPro:IPR005455"
FT                   /db_xref="InterPro:IPR027310"
FT                   /db_xref="InterPro:IPR036140"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CT7"
FT                   /protein_id="AAS51060.1"
FT   gene            complement(<63133..>64449)
FT                   /locus_tag="AGOS_ACL167C"
FT                   /old_locus_tag="ACL167C"
FT   mRNA            complement(<63133..>64449)
FT                   /locus_tag="AGOS_ACL167C"
FT                   /old_locus_tag="ACL167C"
FT                   /product="ACL167Cp"
FT   CDS_pept        complement(63133..64449)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL167C"
FT                   /old_locus_tag="ACL167C"
FT                   /product="ACL167Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR123C
FT                   (LEO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL167C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51061"
FT                   /db_xref="GOA:Q75CT6"
FT                   /db_xref="InterPro:IPR007149"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CT6"
FT                   /protein_id="AAS51061.2"
FT   gene            <64824..>66296
FT                   /locus_tag="AGOS_ACL166W"
FT                   /old_locus_tag="ACL166W"
FT   mRNA            <64824..>66296
FT                   /locus_tag="AGOS_ACL166W"
FT                   /old_locus_tag="ACL166W"
FT                   /product="ACL166Wp"
FT   CDS_pept        64824..66296
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL166W"
FT                   /old_locus_tag="ACL166W"
FT                   /product="ACL166Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR371W
FT                   (CTS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL166W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51062"
FT                   /db_xref="GOA:Q75CT5"
FT                   /db_xref="InterPro:IPR001223"
FT                   /db_xref="InterPro:IPR001579"
FT                   /db_xref="InterPro:IPR011583"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="InterPro:IPR029070"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CT5"
FT                   /protein_id="AAS51062.1"
FT   gene            complement(<66495..>67490)
FT                   /locus_tag="AGOS_ACL165C"
FT                   /old_locus_tag="ACL165C"
FT   mRNA            complement(<66495..>67490)
FT                   /locus_tag="AGOS_ACL165C"
FT                   /old_locus_tag="ACL165C"
FT                   /product="ACL165Cp"
FT   CDS_pept        complement(66495..67490)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL165C"
FT                   /old_locus_tag="ACL165C"
FT                   /product="ACL165Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR372C
FT                   (VPS74)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL165C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51063"
FT                   /db_xref="GOA:P62583"
FT                   /db_xref="InterPro:IPR008628"
FT                   /db_xref="InterPro:IPR038261"
FT                   /db_xref="UniProtKB/Swiss-Prot:P62583"
FT                   /protein_id="AAS51063.1"
FT   gene            complement(<67788..>71957)
FT                   /locus_tag="AGOS_ACL164C"
FT                   /old_locus_tag="ACL164C"
FT   mRNA            complement(<67788..>71957)
FT                   /locus_tag="AGOS_ACL164C"
FT                   /old_locus_tag="ACL164C"
FT                   /product="ACL164Cp"
FT   CDS_pept        complement(67788..71957)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL164C"
FT                   /old_locus_tag="ACL164C"
FT                   /product="ACL164Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR124C
FT                   (UBP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL164C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51064"
FT                   /db_xref="GOA:Q75CT3"
FT                   /db_xref="InterPro:IPR001394"
FT                   /db_xref="InterPro:IPR018200"
FT                   /db_xref="InterPro:IPR025305"
FT                   /db_xref="InterPro:IPR028889"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CT3"
FT                   /protein_id="AAS51064.2"
FT   gene            <72510..>73082
FT                   /locus_tag="AGOS_ACL163W"
FT                   /old_locus_tag="ACL163W"
FT   mRNA            <72510..>73082
FT                   /locus_tag="AGOS_ACL163W"
FT                   /old_locus_tag="ACL163W"
FT                   /product="ACL163Wp"
FT   CDS_pept        72510..73082
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL163W"
FT                   /old_locus_tag="ACL163W"
FT                   /product="ACL163Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR373W
FT                   (FRQ1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL163W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51065"
FT                   /db_xref="GOA:Q75CT2"
FT                   /db_xref="InterPro:IPR002048"
FT                   /db_xref="InterPro:IPR011992"
FT                   /db_xref="InterPro:IPR018247"
FT                   /db_xref="InterPro:IPR028846"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CT2"
FT                   /protein_id="AAS51065.1"
FT   gene            complement(<73189..>73869)
FT                   /locus_tag="AGOS_ACL162C"
FT                   /old_locus_tag="ACL162C"
FT   mRNA            complement(<73189..>73869)
FT                   /locus_tag="AGOS_ACL162C"
FT                   /old_locus_tag="ACL162C"
FT                   /product="ACL162Cp"
FT   CDS_pept        complement(73189..73869)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL162C"
FT                   /old_locus_tag="ACL162C"
FT                   /product="ACL162Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR125C
FT                   (CAT5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL162C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51066"
FT                   /db_xref="GOA:Q75CT1"
FT                   /db_xref="InterPro:IPR009078"
FT                   /db_xref="InterPro:IPR011566"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CT1"
FT                   /protein_id="AAS51066.1"
FT                   AERV"
FT   gene            complement(<74072..>74953)
FT                   /locus_tag="AGOS_ACL161C"
FT                   /old_locus_tag="ACL161C"
FT   mRNA            complement(<74072..>74953)
FT                   /locus_tag="AGOS_ACL161C"
FT                   /old_locus_tag="ACL161C"
FT                   /product="ACL161Cp"
FT   CDS_pept        complement(74072..74953)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL161C"
FT                   /old_locus_tag="ACL161C"
FT                   /product="ACL161Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR374C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL161C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51067"
FT                   /db_xref="GOA:Q75CT0"
FT                   /db_xref="InterPro:IPR007275"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CT0"
FT                   /protein_id="AAS51067.1"
FT                   NTKKNRSSFLED"
FT   gene            complement(<75267..>77321)
FT                   /locus_tag="AGOS_ACL160C"
FT                   /old_locus_tag="ACL160C"
FT   mRNA            complement(<75267..>77321)
FT                   /locus_tag="AGOS_ACL160C"
FT                   /old_locus_tag="ACL160C"
FT                   /product="ACL160Cp"
FT   CDS_pept        complement(75267..77321)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL160C"
FT                   /old_locus_tag="ACL160C"
FT                   /product="ACL160Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR207W
FT                   (HRD3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL160C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51068"
FT                   /db_xref="GOA:Q75CS9"
FT                   /db_xref="InterPro:IPR006597"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS9"
FT                   /protein_id="AAS51068.1"
FT   gene            <77493..>78734
FT                   /locus_tag="AGOS_ACL159W"
FT                   /old_locus_tag="ACL159W"
FT   mRNA            <77493..>78734
FT                   /locus_tag="AGOS_ACL159W"
FT                   /old_locus_tag="ACL159W"
FT                   /product="ACL159Wp"
FT   CDS_pept        77493..78734
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL159W"
FT                   /old_locus_tag="ACL159W"
FT                   /product="ACL159Wp"
FT                   /note="NOHBY310; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0C16687g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL159W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51069"
FT                   /db_xref="GOA:Q75CS8"
FT                   /db_xref="InterPro:IPR008603"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS8"
FT                   /protein_id="AAS51069.1"
FT                   NLNLHFKQHIATIT"
FT   gene            <78848..>79135
FT                   /locus_tag="AGOS_ACL158W"
FT                   /old_locus_tag="ACL158W"
FT   mRNA            <78848..>79135
FT                   /locus_tag="AGOS_ACL158W"
FT                   /old_locus_tag="ACL158W"
FT                   /product="ACL158Wp"
FT   CDS_pept        78848..79135
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL158W"
FT                   /old_locus_tag="ACL158W"
FT                   /product="ACL158Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDL160C-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL158W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51070"
FT                   /db_xref="GOA:Q75CS7"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="InterPro:IPR018552"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS7"
FT                   /protein_id="AAS51070.1"
FT   gene            complement(<79321..>80868)
FT                   /locus_tag="AGOS_ACL157C"
FT                   /old_locus_tag="ACL157C"
FT   mRNA            complement(<79321..>80868)
FT                   /locus_tag="AGOS_ACL157C"
FT                   /old_locus_tag="ACL157C"
FT                   /product="ACL157Cp"
FT   CDS_pept        complement(79321..80868)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL157C"
FT                   /old_locus_tag="ACL157C"
FT                   /product="ACL157Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR206W
FT                   (ENT2) and YDL161W (ENT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL157C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51071"
FT                   /db_xref="InterPro:IPR003903"
FT                   /db_xref="InterPro:IPR008942"
FT                   /db_xref="InterPro:IPR013809"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS6"
FT                   /protein_id="AAS51071.1"
FT   gene            <81015..>81470
FT                   /locus_tag="AGOS_ACL156W"
FT                   /old_locus_tag="ACL156W"
FT   mRNA            <81015..>81470
FT                   /locus_tag="AGOS_ACL156W"
FT                   /old_locus_tag="ACL156W"
FT                   /product="ACL156Wp"
FT   CDS_pept        81015..81470
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL156W"
FT                   /old_locus_tag="ACL156W"
FT                   /product="ACL156Wp"
FT                   /note="NOHBY309; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL156W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51072"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS5"
FT                   /protein_id="AAS51072.1"
FT   gene            <81488..>83581
FT                   /locus_tag="AGOS_ACL155W"
FT                   /old_locus_tag="ACL155W"
FT   mRNA            <81488..>83581
FT                   /locus_tag="AGOS_ACL155W"
FT                   /old_locus_tag="ACL155W"
FT                   /product="ACL155Wp"
FT   CDS_pept        81488..83581
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL155W"
FT                   /old_locus_tag="ACL155W"
FT                   /product="ACL155Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL164C
FT                   (CDC9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL155W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51073"
FT                   /db_xref="GOA:Q75CS4"
FT                   /db_xref="InterPro:IPR000977"
FT                   /db_xref="InterPro:IPR012308"
FT                   /db_xref="InterPro:IPR012309"
FT                   /db_xref="InterPro:IPR012310"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR016059"
FT                   /db_xref="InterPro:IPR036599"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS4"
FT                   /protein_id="AAS51073.1"
FT                   SSG"
FT   gene            <83958..>84917
FT                   /locus_tag="AGOS_ACL154W"
FT                   /old_locus_tag="ACL154W"
FT   mRNA            <83958..>84917
FT                   /locus_tag="AGOS_ACL154W"
FT                   /old_locus_tag="ACL154W"
FT                   /product="ACL154Wp"
FT   CDS_pept        83958..84917
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL154W"
FT                   /old_locus_tag="ACL154W"
FT                   /product="ACL154Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR205C
FT                   (HMX1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL154W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51074"
FT                   /db_xref="GOA:Q75CS3"
FT                   /db_xref="InterPro:IPR002051"
FT                   /db_xref="InterPro:IPR016053"
FT                   /db_xref="InterPro:IPR016084"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS3"
FT                   /protein_id="AAS51074.1"
FT   gene            complement(<84954..>85289)
FT                   /locus_tag="AGOS_ACL153C"
FT                   /old_locus_tag="ACL153C"
FT   mRNA            complement(<84954..>85289)
FT                   /locus_tag="AGOS_ACL153C"
FT                   /old_locus_tag="ACL153C"
FT                   /product="ACL153Cp"
FT   CDS_pept        complement(84954..85289)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL153C"
FT                   /old_locus_tag="ACL153C"
FT                   /product="ACL153Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR204W
FT                   (QRI5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL153C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51075"
FT                   /db_xref="GOA:Q75CS2"
FT                   /db_xref="InterPro:IPR013177"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS2"
FT                   /protein_id="AAS51075.1"
FT                   RKLSQGR"
FT   gene            <85697..>86983
FT                   /locus_tag="AGOS_ACL152W"
FT                   /old_locus_tag="ACL152W"
FT   mRNA            <85697..>86983
FT                   /locus_tag="AGOS_ACL152W"
FT                   /old_locus_tag="ACL152W"
FT                   /product="ACL152Wp"
FT   CDS_pept        85697..86983
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL152W"
FT                   /old_locus_tag="ACL152W"
FT                   /product="ACL152Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR203C
FT                   (MSS51)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL152W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51076"
FT                   /db_xref="GOA:Q75CS1"
FT                   /db_xref="InterPro:IPR032717"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS1"
FT                   /protein_id="AAS51076.1"
FT   gene            complement(<87033..>87659)
FT                   /locus_tag="AGOS_ACL151C"
FT                   /old_locus_tag="ACL151C"
FT   mRNA            complement(<87033..>87659)
FT                   /locus_tag="AGOS_ACL151C"
FT                   /old_locus_tag="ACL151C"
FT                   /product="ACL151Cp"
FT   CDS_pept        complement(87033..87659)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL151C"
FT                   /old_locus_tag="ACL151C"
FT                   /product="ACL151Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL165W
FT                   (CDC36)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL151C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51077"
FT                   /db_xref="GOA:Q75CS0"
FT                   /db_xref="InterPro:IPR007282"
FT                   /db_xref="InterPro:IPR038635"
FT                   /db_xref="InterPro:IPR040168"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CS0"
FT                   /protein_id="AAS51077.1"
FT   gene            <87741..>88400
FT                   /locus_tag="AGOS_ACL150W"
FT                   /old_locus_tag="ACL150W"
FT   mRNA            <87741..>88400
FT                   /locus_tag="AGOS_ACL150W"
FT                   /old_locus_tag="ACL150W"
FT                   /product="ACL150Wp"
FT   CDS_pept        87741..88400
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL150W"
FT                   /old_locus_tag="ACL150W"
FT                   /product="ACL150Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL166C
FT                   (FAP7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL150W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51078"
FT                   /db_xref="GOA:Q75CR9"
FT                   /db_xref="InterPro:IPR020618"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CR9"
FT                   /protein_id="AAS51078.1"
FT   gene            <88711..>90597
FT                   /locus_tag="AGOS_ACL149W"
FT                   /old_locus_tag="ACL149W"
FT   mRNA            <88711..>90597
FT                   /locus_tag="AGOS_ACL149W"
FT                   /old_locus_tag="ACL149W"
FT                   /product="ACL149Wp"
FT   CDS_pept        88711..90597
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL149W"
FT                   /old_locus_tag="ACL149W"
FT                   /product="ACL149Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL167C
FT                   (NRP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL149W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51079"
FT                   /db_xref="GOA:Q75CR8"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR001876"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="InterPro:IPR036443"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CR8"
FT                   /protein_id="AAS51079.1"
FT   gene            complement(<90928..>92073)
FT                   /locus_tag="AGOS_ACL148C"
FT                   /old_locus_tag="ACL148C"
FT   mRNA            complement(<90928..>92073)
FT                   /locus_tag="AGOS_ACL148C"
FT                   /old_locus_tag="ACL148C"
FT                   /product="ACL148Cp"
FT   CDS_pept        complement(90928..92073)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL148C"
FT                   /old_locus_tag="ACL148C"
FT                   /product="ACL148Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL168W
FT                   (SFA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL148C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51080"
FT                   /db_xref="GOA:Q75CR7"
FT                   /db_xref="InterPro:IPR002328"
FT                   /db_xref="InterPro:IPR011032"
FT                   /db_xref="InterPro:IPR013149"
FT                   /db_xref="InterPro:IPR013154"
FT                   /db_xref="InterPro:IPR014183"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CR7"
FT                   /protein_id="AAS51080.1"
FT   gene            <92473..>93213
FT                   /locus_tag="AGOS_ACL147W"
FT                   /old_locus_tag="ACL147W"
FT   mRNA            <92473..>93213
FT                   /locus_tag="AGOS_ACL147W"
FT                   /old_locus_tag="ACL147W"
FT                   /product="ACL147Wp"
FT   CDS_pept        92473..93213
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL147W"
FT                   /old_locus_tag="ACL147W"
FT                   /product="ACL147Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR201C
FT                   (COQ9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL147W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51081"
FT                   /db_xref="GOA:Q75CR6"
FT                   /db_xref="InterPro:IPR012762"
FT                   /db_xref="InterPro:IPR013718"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CR6"
FT                   /protein_id="AAS51081.1"
FT   gene            complement(<93265..>93588)
FT                   /locus_tag="AGOS_ACL146C"
FT                   /old_locus_tag="ACL146C"
FT   mRNA            complement(<93265..>93588)
FT                   /locus_tag="AGOS_ACL146C"
FT                   /old_locus_tag="ACL146C"
FT                   /product="ACL146Cp"
FT   CDS_pept        complement(93265..93588)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL146C"
FT                   /old_locus_tag="ACL146C"
FT                   /product="ACL146Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR200W
FT                   (YKE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL146C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51082"
FT                   /db_xref="GOA:Q75CR5"
FT                   /db_xref="InterPro:IPR002777"
FT                   /db_xref="InterPro:IPR009053"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CR5"
FT                   /protein_id="AAS51082.1"
FT                   LRG"
FT   gene            <93787..>94620
FT                   /locus_tag="AGOS_ACL145W"
FT                   /old_locus_tag="ACL145W"
FT   mRNA            join(<93787..93792,93859..>94620)
FT                   /locus_tag="AGOS_ACL145W"
FT                   /old_locus_tag="ACL145W"
FT                   /product="ACL145Wp"
FT   CDS_pept        join(93787..93792,93859..94620)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL145W"
FT                   /old_locus_tag="ACL145W"
FT                   /product="ACL145Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR199C
FT                   (PBA1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL145W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51083"
FT                   /db_xref="GOA:Q75CR4"
FT                   /db_xref="InterPro:IPR018855"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CR4"
FT                   /protein_id="AAS51083.2"
FT   gene            complement(<94805..>96454)
FT                   /locus_tag="AGOS_ACL144C"
FT                   /old_locus_tag="ACL144C"
FT   mRNA            complement(<94805..>96454)
FT                   /locus_tag="AGOS_ACL144C"
FT                   /old_locus_tag="ACL144C"
FT                   /product="ACL144Cp"
FT   CDS_pept        complement(94805..96454)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL144C"
FT                   /old_locus_tag="ACL144C"
FT                   /product="ACL144Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR197W
FT                   (NOP56)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL144C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51084"
FT                   /db_xref="GOA:Q75CR3"
FT                   /db_xref="InterPro:IPR002687"
FT                   /db_xref="InterPro:IPR012974"
FT                   /db_xref="InterPro:IPR012976"
FT                   /db_xref="InterPro:IPR029012"
FT                   /db_xref="InterPro:IPR036070"
FT                   /db_xref="InterPro:IPR042239"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CR3"
FT                   /protein_id="AAS51084.1"
FT   gene            97114..97184
FT                   /locus_tag="AGOS_t0046"
FT   tRNA            97114..97184
FT                   /locus_tag="AGOS_t0046"
FT                   /product="tRNA-Gly"
FT                   /note="codon recognized: GGC"
FT   gene            complement(<97254..>103145)
FT                   /locus_tag="AGOS_ACL143C"
FT                   /old_locus_tag="ACL143C"
FT   mRNA            complement(<97254..>103145)
FT                   /locus_tag="AGOS_ACL143C"
FT                   /old_locus_tag="ACL143C"
FT                   /product="ACL143Cp"
FT   CDS_pept        complement(97254..103145)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL143C"
FT                   /old_locus_tag="ACL143C"
FT                   /product="ACL143Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR217W
FT                   (CCH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL143C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51085"
FT                   /db_xref="GOA:Q75CR2"
FT                   /db_xref="InterPro:IPR002048"
FT                   /db_xref="InterPro:IPR005821"
FT                   /db_xref="InterPro:IPR027359"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CR2"
FT                   /protein_id="AAS51085.1"
FT   gene            <103238..>105223
FT                   /locus_tag="AGOS_ACL142W"
FT                   /old_locus_tag="ACL142W"
FT   mRNA            <103238..>105223
FT                   /locus_tag="AGOS_ACL142W"
FT                   /old_locus_tag="ACL142W"
FT                   /product="ACL142Wp"
FT   CDS_pept        103238..105223
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL142W"
FT                   /old_locus_tag="ACL142W"
FT                   /product="ACL142Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR216C
FT                   (GPI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL142W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51086"
FT                   /db_xref="GOA:Q75CR1"
FT                   /db_xref="InterPro:IPR007720"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CR1"
FT                   /protein_id="AAS51086.1"
FT   gene            complement(<105276..>105647)
FT                   /locus_tag="AGOS_ACL141C"
FT                   /old_locus_tag="ACL141C"
FT   mRNA            complement(<105276..>105647)
FT                   /locus_tag="AGOS_ACL141C"
FT                   /old_locus_tag="ACL141C"
FT                   /product="ACL141Cp"
FT   CDS_pept        complement(105276..105647)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL141C"
FT                   /old_locus_tag="ACL141C"
FT                   /product="ACL141Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR215W
FT                   (RSM27)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL141C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51087"
FT                   /db_xref="InterPro:IPR013219"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CR0"
FT                   /protein_id="AAS51087.1"
FT   gene            complement(<105867..>106728)
FT                   /locus_tag="AGOS_ACL140C"
FT                   /old_locus_tag="ACL140C"
FT   mRNA            complement(join(<105867..106538,106639..>106728))
FT                   /locus_tag="AGOS_ACL140C"
FT                   /old_locus_tag="ACL140C"
FT                   /product="ACL140Cp"
FT   CDS_pept        complement(join(105867..106538,106639..106728))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL140C"
FT                   /old_locus_tag="ACL140C"
FT                   /product="ACL140Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR214W
FT                   (RPS0A) and YLR048W (RPS0B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL140C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51088"
FT                   /db_xref="GOA:Q75CQ9"
FT                   /db_xref="InterPro:IPR001865"
FT                   /db_xref="InterPro:IPR005707"
FT                   /db_xref="InterPro:IPR018130"
FT                   /db_xref="InterPro:IPR023591"
FT                   /db_xref="InterPro:IPR027498"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CQ9"
FT                   /protein_id="AAS51088.1"
FT   gene            <107252..>109312
FT                   /locus_tag="AGOS_ACL139W"
FT                   /old_locus_tag="ACL139W"
FT   mRNA            <107252..>109312
FT                   /locus_tag="AGOS_ACL139W"
FT                   /old_locus_tag="ACL139W"
FT                   /product="ACL139Wp"
FT   CDS_pept        107252..109312
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL139W"
FT                   /old_locus_tag="ACL139W"
FT                   /product="ACL139Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR047C
FT                   (FRE8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL139W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51089"
FT                   /db_xref="GOA:Q75CQ8"
FT                   /db_xref="InterPro:IPR013130"
FT                   /db_xref="InterPro:IPR039261"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CQ8"
FT                   /protein_id="AAS51089.1"
FT   gene            complement(<109745..>111112)
FT                   /locus_tag="AGOS_ACL138C"
FT                   /old_locus_tag="ACL138C"
FT   mRNA            complement(<109745..>111112)
FT                   /locus_tag="AGOS_ACL138C"
FT                   /old_locus_tag="ACL138C"
FT                   /product="ACL138Cp"
FT   CDS_pept        complement(109745..111112)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL138C"
FT                   /old_locus_tag="ACL138C"
FT                   /product="ACL138Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR212W
FT                   (SLI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL138C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51090"
FT                   /db_xref="GOA:Q75CQ7"
FT                   /db_xref="InterPro:IPR010828"
FT                   /db_xref="InterPro:IPR023213"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CQ7"
FT                   /protein_id="AAS51090.1"
FT   gene            complement(<111649..>113082)
FT                   /locus_tag="AGOS_ACL137C"
FT                   /old_locus_tag="ACL137C"
FT   mRNA            complement(<111649..>113082)
FT                   /locus_tag="AGOS_ACL137C"
FT                   /old_locus_tag="ACL137C"
FT                   /product="ACL137Cp"
FT   CDS_pept        complement(111649..113082)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL137C"
FT                   /old_locus_tag="ACL137C"
FT                   /product="ACL137Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR211W
FT                   (ZPR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL137C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51091"
FT                   /db_xref="GOA:Q75CQ6"
FT                   /db_xref="InterPro:IPR004457"
FT                   /db_xref="InterPro:IPR040141"
FT                   /db_xref="InterPro:IPR042451"
FT                   /db_xref="InterPro:IPR042452"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CQ6"
FT                   /protein_id="AAS51091.1"
FT   gene            <113574..>114803
FT                   /locus_tag="AGOS_ACL136W"
FT                   /old_locus_tag="ACL136W"
FT   mRNA            <113574..>114803
FT                   /locus_tag="AGOS_ACL136W"
FT                   /old_locus_tag="ACL136W"
FT                   /product="ACL136Wp"
FT   CDS_pept        113574..114803
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL136W"
FT                   /old_locus_tag="ACL136W"
FT                   /product="ACL136Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR210C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL136W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51092"
FT                   /db_xref="GOA:Q75CQ5"
FT                   /db_xref="InterPro:IPR006073"
FT                   /db_xref="InterPro:IPR012675"
FT                   /db_xref="InterPro:IPR013646"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR031167"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CQ5"
FT                   /protein_id="AAS51092.2"
FT                   LSFKLAPRSL"
FT   gene            <115355..>117121
FT                   /locus_tag="AGOS_ACL135W"
FT                   /old_locus_tag="ACL135W"
FT   mRNA            <115355..>117121
FT                   /locus_tag="AGOS_ACL135W"
FT                   /old_locus_tag="ACL135W"
FT                   /product="ACL135Wp"
FT   CDS_pept        115355..117121
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL135W"
FT                   /old_locus_tag="ACL135W"
FT                   /product="ACL135Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YPL265W (DIP5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL135W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51093"
FT                   /db_xref="GOA:Q75CQ4"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="InterPro:IPR004840"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CQ4"
FT                   /protein_id="AAS51093.1"
FT                   KKIYDNVLGWIF"
FT   gene            complement(<117340..>119100)
FT                   /locus_tag="AGOS_ACL134C"
FT                   /old_locus_tag="ACL134C"
FT   mRNA            complement(<117340..>119100)
FT                   /locus_tag="AGOS_ACL134C"
FT                   /old_locus_tag="ACL134C"
FT                   /product="ACL134Cp"
FT   CDS_pept        complement(117340..119100)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL134C"
FT                   /old_locus_tag="ACL134C"
FT                   /product="ACL134Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR044C
FT                   (PDC1) and Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YLR134W (PDC5) and YGR087C (PDC6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL134C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51094"
FT                   /db_xref="GOA:Q75CQ3"
FT                   /db_xref="InterPro:IPR000399"
FT                   /db_xref="InterPro:IPR011766"
FT                   /db_xref="InterPro:IPR012000"
FT                   /db_xref="InterPro:IPR012001"
FT                   /db_xref="InterPro:IPR012110"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="InterPro:IPR029061"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CQ3"
FT                   /protein_id="AAS51094.1"
FT                   LTAATNAKQE"
FT   gene            <119499..>120614
FT                   /locus_tag="AGOS_ACL133W"
FT                   /old_locus_tag="ACL133W"
FT   mRNA            <119499..>120614
FT                   /locus_tag="AGOS_ACL133W"
FT                   /old_locus_tag="ACL133W"
FT                   /product="ACL133Wp"
FT   CDS_pept        119499..120614
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL133W"
FT                   /old_locus_tag="ACL133W"
FT                   /product="ACL133Wp"
FT                   /note="NOHBY308; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0G14872g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL133W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51095"
FT                   /db_xref="GOA:Q75CQ2"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CQ2"
FT                   /protein_id="AAS51095.1"
FT   gene            complement(<120946..>123810)
FT                   /locus_tag="AGOS_ACL132C"
FT                   /old_locus_tag="ACL132C"
FT   mRNA            complement(<120946..>123810)
FT                   /locus_tag="AGOS_ACL132C"
FT                   /old_locus_tag="ACL132C"
FT                   /product="ACL132Cp"
FT   CDS_pept        complement(120946..123810)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL132C"
FT                   /old_locus_tag="ACL132C"
FT                   /product="ACL132Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR045C
FT                   (STU2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL132C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51096"
FT                   /db_xref="GOA:Q75CQ1"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR021133"
FT                   /db_xref="InterPro:IPR024395"
FT                   /db_xref="InterPro:IPR034085"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CQ1"
FT                   /protein_id="AAS51096.1"
FT   gene            <124302..>124613
FT                   /locus_tag="AGOS_ACL131W"
FT                   /old_locus_tag="ACL131W"
FT   mRNA            <124302..>124613
FT                   /locus_tag="AGOS_ACL131W"
FT                   /old_locus_tag="ACL131W"
FT                   /product="ACL131Wp"
FT   CDS_pept        124302..124613
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL131W"
FT                   /old_locus_tag="ACL131W"
FT                   /product="ACL131Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR043C
FT                   (TRX1) and YGR209C (TRX2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL131W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51097"
FT                   /db_xref="GOA:Q75CQ0"
FT                   /db_xref="InterPro:IPR005746"
FT                   /db_xref="InterPro:IPR013766"
FT                   /db_xref="InterPro:IPR017937"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CQ0"
FT                   /protein_id="AAS51097.1"
FT   gene            complement(<124646..>125596)
FT                   /locus_tag="AGOS_ACL130C"
FT                   /old_locus_tag="ACL130C"
FT   mRNA            complement(<124646..>125596)
FT                   /locus_tag="AGOS_ACL130C"
FT                   /old_locus_tag="ACL130C"
FT                   /product="ACL130Cp"
FT   CDS_pept        complement(124646..125596)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL130C"
FT                   /old_locus_tag="ACL130C"
FT                   /product="ACL130Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR208W
FT                   (SER2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL130C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51098"
FT                   /db_xref="GOA:Q75CP9"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CP9"
FT                   /protein_id="AAS51098.1"
FT   gene            <125915..>126691
FT                   /locus_tag="AGOS_ACL129W"
FT                   /old_locus_tag="ACL129W"
FT   mRNA            <125915..>126691
FT                   /locus_tag="AGOS_ACL129W"
FT                   /old_locus_tag="ACL129W"
FT                   /product="ACL129Wp"
FT   CDS_pept        125915..126691
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL129W"
FT                   /old_locus_tag="ACL129W"
FT                   /product="ACL129Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR207C
FT                   (CIR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL129W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51099"
FT                   /db_xref="GOA:Q75CP8"
FT                   /db_xref="InterPro:IPR000049"
FT                   /db_xref="InterPro:IPR012255"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR014730"
FT                   /db_xref="InterPro:IPR033948"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CP8"
FT                   /protein_id="AAS51099.1"
FT   gene            complement(<126714..>126995)
FT                   /locus_tag="AGOS_ACL128C"
FT                   /old_locus_tag="ACL128C"
FT   mRNA            complement(<126714..>126995)
FT                   /locus_tag="AGOS_ACL128C"
FT                   /old_locus_tag="ACL128C"
FT                   /product="ACL128Cp"
FT   CDS_pept        complement(126714..126995)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL128C"
FT                   /old_locus_tag="ACL128C"
FT                   /product="ACL128Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR206W
FT                   (MVB12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL128C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51100"
FT                   /db_xref="GOA:Q75CP7"
FT                   /db_xref="InterPro:IPR019014"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CP7"
FT                   /protein_id="AAS51100.1"
FT   gene            <127224..>127766
FT                   /locus_tag="AGOS_ACL127W"
FT                   /old_locus_tag="ACL127W"
FT   mRNA            <127224..>127766
FT                   /locus_tag="AGOS_ACL127W"
FT                   /old_locus_tag="ACL127W"
FT                   /product="ACL127Wp"
FT   CDS_pept        127224..127766
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL127W"
FT                   /old_locus_tag="ACL127W"
FT                   /product="ACL127Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR025C
FT                   (BNA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL127W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51101"
FT                   /db_xref="GOA:Q75CP6"
FT                   /db_xref="InterPro:IPR010329"
FT                   /db_xref="InterPro:IPR011051"
FT                   /db_xref="InterPro:IPR014710"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CP6"
FT                   /protein_id="AAS51101.1"
FT                   CKHCGTLNYPTPQASAT"
FT   gene            <127878..>128606
FT                   /locus_tag="AGOS_ACL126W"
FT                   /old_locus_tag="ACL126W"
FT   mRNA            <127878..>128606
FT                   /locus_tag="AGOS_ACL126W"
FT                   /old_locus_tag="ACL126W"
FT                   /product="ACL126Wp"
FT   CDS_pept        127878..128606
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL126W"
FT                   /old_locus_tag="ACL126W"
FT                   /product="ACL126Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR024C
FT                   (MDE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL126W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51102"
FT                   /db_xref="GOA:Q75CP5"
FT                   /db_xref="InterPro:IPR001303"
FT                   /db_xref="InterPro:IPR017714"
FT                   /db_xref="InterPro:IPR027514"
FT                   /db_xref="InterPro:IPR036409"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CP5"
FT                   /protein_id="AAS51102.1"
FT   gene            complement(<128645..>128965)
FT                   /locus_tag="AGOS_ACL125C"
FT                   /old_locus_tag="ACL125C"
FT   mRNA            complement(<128645..>128965)
FT                   /locus_tag="AGOS_ACL125C"
FT                   /old_locus_tag="ACL125C"
FT                   /product="ACL125Cp"
FT   CDS_pept        complement(128645..128965)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL125C"
FT                   /old_locus_tag="ACL125C"
FT                   /product="ACL125Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR022W
FT                   (LSM8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL125C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51103"
FT                   /db_xref="GOA:Q75CP4"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR034103"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CP4"
FT                   /protein_id="AAS51103.1"
FT                   RE"
FT   gene            <129089..>129866
FT                   /locus_tag="AGOS_ACL124W"
FT                   /old_locus_tag="ACL124W"
FT   mRNA            join(<129089..129344,129400..>129866)
FT                   /locus_tag="AGOS_ACL124W"
FT                   /old_locus_tag="ACL124W"
FT                   /product="ACL124Wp"
FT   CDS_pept        join(129089..129344,129400..129866)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL124W"
FT                   /old_locus_tag="ACL124W"
FT                   /product="ACL124Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR021C
FT                   (REC107); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL124W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51104"
FT                   /db_xref="GOA:Q75CP3"
FT                   /db_xref="InterPro:IPR015159"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CP3"
FT                   /protein_id="AAS51104.2"
FT                   AHQTRYLIPWEDISDQEL"
FT   gene            complement(<129875..>130708)
FT                   /locus_tag="AGOS_ACL123C"
FT                   /old_locus_tag="ACL123C"
FT   mRNA            complement(<129875..>130708)
FT                   /locus_tag="AGOS_ACL123C"
FT                   /old_locus_tag="ACL123C"
FT                   /product="ACL123Cp"
FT   CDS_pept        complement(129875..130708)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL123C"
FT                   /old_locus_tag="ACL123C"
FT                   /product="ACL123Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR205W
FT                   (TDA10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL123C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51105"
FT                   /db_xref="GOA:Q75CP2"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CP2"
FT                   /protein_id="AAS51105.1"
FT   gene            <131078..>132052
FT                   /locus_tag="AGOS_ACL122W"
FT                   /old_locus_tag="ACL122W"
FT   mRNA            <131078..>132052
FT                   /locus_tag="AGOS_ACL122W"
FT                   /old_locus_tag="ACL122W"
FT                   /product="ACL122Wp"
FT   CDS_pept        131078..132052
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL122W"
FT                   /old_locus_tag="ACL122W"
FT                   /product="ACL122Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR019C
FT                   (TES1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL122W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51106"
FT                   /db_xref="GOA:Q75CP1"
FT                   /db_xref="InterPro:IPR003703"
FT                   /db_xref="InterPro:IPR029069"
FT                   /db_xref="InterPro:IPR042171"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CP1"
FT                   /protein_id="AAS51106.1"
FT   gene            complement(<132104..>134923)
FT                   /locus_tag="AGOS_ACL121C"
FT                   /old_locus_tag="ACL121C"
FT   mRNA            complement(<132104..>134923)
FT                   /locus_tag="AGOS_ACL121C"
FT                   /old_locus_tag="ACL121C"
FT                   /product="ACL121Cp"
FT   CDS_pept        complement(132104..134923)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL121C"
FT                   /old_locus_tag="ACL121C"
FT                   /product="ACL121Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR204W
FT                   (ADE3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL121C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51107"
FT                   /db_xref="GOA:Q75CP0"
FT                   /db_xref="InterPro:IPR000559"
FT                   /db_xref="InterPro:IPR000672"
FT                   /db_xref="InterPro:IPR020628"
FT                   /db_xref="InterPro:IPR020630"
FT                   /db_xref="InterPro:IPR020631"
FT                   /db_xref="InterPro:IPR020867"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CP0"
FT                   /protein_id="AAS51107.2"
FT                   DKGEIDGMF"
FT   gene            <135415..>135906
FT                   /locus_tag="AGOS_ACL120W"
FT                   /old_locus_tag="ACL120W"
FT   mRNA            <135415..>135906
FT                   /locus_tag="AGOS_ACL120W"
FT                   /old_locus_tag="ACL120W"
FT                   /product="ACL120Wp"
FT   CDS_pept        135415..135906
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL120W"
FT                   /old_locus_tag="ACL120W"
FT                   /product="ACL120Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR017C
FT                   (ESS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL120W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51108"
FT                   /db_xref="GOA:Q75CN9"
FT                   /db_xref="InterPro:IPR000297"
FT                   /db_xref="InterPro:IPR001202"
FT                   /db_xref="InterPro:IPR023058"
FT                   /db_xref="InterPro:IPR036020"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CN9"
FT                   /protein_id="AAS51108.1"
FT                   "
FT   gene            complement(<135913..>136368)
FT                   /locus_tag="AGOS_ACL119C"
FT                   /old_locus_tag="ACL119C"
FT   mRNA            complement(<135913..>136368)
FT                   /locus_tag="AGOS_ACL119C"
FT                   /old_locus_tag="ACL119C"
FT                   /product="ACL119Cp"
FT   CDS_pept        complement(135913..136368)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL119C"
FT                   /old_locus_tag="ACL119C"
FT                   /product="ACL119Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR203W
FT                   (YCH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL119C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51109"
FT                   /db_xref="GOA:Q75CN8"
FT                   /db_xref="InterPro:IPR001763"
FT                   /db_xref="InterPro:IPR036873"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CN8"
FT                   /protein_id="AAS51109.1"
FT   gene            complement(<136528..>137733)
FT                   /locus_tag="AGOS_ACL118C"
FT                   /old_locus_tag="ACL118C"
FT   mRNA            complement(<136528..>137733)
FT                   /locus_tag="AGOS_ACL118C"
FT                   /old_locus_tag="ACL118C"
FT                   /product="ACL118Cp"
FT   CDS_pept        complement(136528..137733)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL118C"
FT                   /old_locus_tag="ACL118C"
FT                   /product="ACL118Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR202C
FT                   (PCT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL118C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51110"
FT                   /db_xref="GOA:Q75CN7"
FT                   /db_xref="InterPro:IPR004821"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR041723"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CN7"
FT                   /protein_id="AAS51110.1"
FT                   SE"
FT   gene            complement(137956..138028)
FT                   /locus_tag="AGOS_t0047"
FT   tRNA            complement(137956..138028)
FT                   /locus_tag="AGOS_t0047"
FT                   /product="tRNA-Val"
FT                   /note="codon recognized: GUG"
FT   gene            <138626..>140371
FT                   /locus_tag="AGOS_ACL117W"
FT                   /old_locus_tag="ACL117W"
FT   mRNA            <138626..>140371
FT                   /locus_tag="AGOS_ACL117W"
FT                   /old_locus_tag="ACL117W"
FT                   /product="ACL117Wp"
FT   CDS_pept        138626..140371
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL117W"
FT                   /old_locus_tag="ACL117W"
FT                   /product="ACL117Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR016C
FT                   (ILV3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL117W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51111"
FT                   /db_xref="GOA:Q75CN6"
FT                   /db_xref="InterPro:IPR000581"
FT                   /db_xref="InterPro:IPR004404"
FT                   /db_xref="InterPro:IPR020558"
FT                   /db_xref="InterPro:IPR037237"
FT                   /db_xref="InterPro:IPR042096"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CN6"
FT                   /protein_id="AAS51111.1"
FT                   LDSDD"
FT   gene            <140584..>142998
FT                   /locus_tag="AGOS_ACL116W"
FT                   /old_locus_tag="ACL116W"
FT   mRNA            <140584..>142998
FT                   /locus_tag="AGOS_ACL116W"
FT                   /old_locus_tag="ACL116W"
FT                   /product="ACL116Wp"
FT   CDS_pept        140584..142998
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL116W"
FT                   /old_locus_tag="ACL116W"
FT                   /product="ACL116Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR200C
FT                   (ELP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL116W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51112"
FT                   /db_xref="GOA:Q75CN5"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR011047"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR037289"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CN5"
FT                   /protein_id="AAS51112.1"
FT   gene            <143555..>144070
FT                   /locus_tag="AGOS_ACL115W"
FT                   /old_locus_tag="ACL115W"
FT   mRNA            <143555..>144070
FT                   /locus_tag="AGOS_ACL115W"
FT                   /old_locus_tag="ACL115W"
FT                   /product="ACL115Wp"
FT   CDS_pept        143555..144070
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL115W"
FT                   /old_locus_tag="ACL115W"
FT                   /product="ACL115Wp"
FT                   /note="NOHBY307; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL115W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51113"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CN4"
FT                   /protein_id="AAS51113.1"
FT                   RGPLYSRT"
FT   gene            <144795..>145754
FT                   /locus_tag="AGOS_ACL114W"
FT                   /old_locus_tag="ACL114W"
FT   mRNA            <144795..>145754
FT                   /locus_tag="AGOS_ACL114W"
FT                   /old_locus_tag="ACL114W"
FT                   /product="ACL114Wp"
FT   CDS_pept        144795..145754
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL114W"
FT                   /old_locus_tag="ACL114W"
FT                   /product="ACL114Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YJR107W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL114W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51114"
FT                   /db_xref="GOA:Q75CN3"
FT                   /db_xref="InterPro:IPR002921"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CN3"
FT                   /protein_id="AAS51114.1"
FT   gene            complement(<146081..>148387)
FT                   /locus_tag="AGOS_ACL113C"
FT                   /old_locus_tag="ACL113C"
FT   mRNA            complement(<146081..>148387)
FT                   /locus_tag="AGOS_ACL113C"
FT                   /old_locus_tag="ACL113C"
FT                   /product="ACL113Cp"
FT   CDS_pept        complement(146081..148387)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL113C"
FT                   /old_locus_tag="ACL113C"
FT                   /product="ACL113Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR198W
FT                   (YPP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL113C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51115"
FT                   /db_xref="GOA:Q75CN2"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CN2"
FT                   /protein_id="AAS51115.1"
FT                   FHELEPIRDFKYCMF"
FT   gene            complement(<148432..>149031)
FT                   /locus_tag="AGOS_ACL112C"
FT                   /old_locus_tag="ACL112C"
FT   mRNA            complement(<148432..>149031)
FT                   /locus_tag="AGOS_ACL112C"
FT                   /old_locus_tag="ACL112C"
FT                   /product="ACL112Cp"
FT   CDS_pept        complement(148432..149031)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL112C"
FT                   /old_locus_tag="ACL112C"
FT                   /product="ACL112Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR014W
FT                   (TMA22)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL112C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51116"
FT                   /db_xref="GOA:Q75CN1"
FT                   /db_xref="InterPro:IPR001950"
FT                   /db_xref="InterPro:IPR005873"
FT                   /db_xref="InterPro:IPR036877"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CN1"
FT                   /protein_id="AAS51116.1"
FT   gene            <149112..>149678
FT                   /locus_tag="AGOS_ACL111W"
FT                   /old_locus_tag="ACL111W"
FT   mRNA            <149112..>149678
FT                   /locus_tag="AGOS_ACL111W"
FT                   /old_locus_tag="ACL111W"
FT                   /product="ACL111Wp"
FT   CDS_pept        149112..149678
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL111W"
FT                   /old_locus_tag="ACL111W"
FT                   /product="ACL111Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL159C
FT                   (RCN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL111W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51117"
FT                   /db_xref="GOA:Q75CN0"
FT                   /db_xref="InterPro:IPR006931"
FT                   /db_xref="InterPro:IPR016523"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CN0"
FT                   /protein_id="AAS51117.1"
FT   gene            <150096..>150545
FT                   /locus_tag="AGOS_ACL110W"
FT                   /old_locus_tag="ACL110W"
FT   mRNA            <150096..>150545
FT                   /locus_tag="AGOS_ACL110W"
FT                   /old_locus_tag="ACL110W"
FT                   /product="ACL110Wp"
FT   CDS_pept        150096..150545
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL110W"
FT                   /old_locus_tag="ACL110W"
FT                   /product="ACL110Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR051W
FT                   (COX6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL110W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51118"
FT                   /db_xref="GOA:Q75CM9"
FT                   /db_xref="InterPro:IPR003204"
FT                   /db_xref="InterPro:IPR036545"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CM9"
FT                   /protein_id="AAS51118.1"
FT   gene            complement(<150609..>151619)
FT                   /locus_tag="AGOS_ACL109C"
FT                   /old_locus_tag="ACL109C"
FT   mRNA            complement(<150609..>151619)
FT                   /locus_tag="AGOS_ACL109C"
FT                   /old_locus_tag="ACL109C"
FT                   /product="ACL109Cp"
FT   CDS_pept        complement(150609..151619)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL109C"
FT                   /old_locus_tag="ACL109C"
FT                   /product="ACL109Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR353W
FT                   (TRR1) and YHR106W (TRR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL109C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51119"
FT                   /db_xref="GOA:Q75CM8"
FT                   /db_xref="InterPro:IPR005982"
FT                   /db_xref="InterPro:IPR008255"
FT                   /db_xref="InterPro:IPR023753"
FT                   /db_xref="InterPro:IPR036188"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CM8"
FT                   /protein_id="AAS51119.1"
FT   gene            complement(<151945..>152460)
FT                   /locus_tag="AGOS_ACL108C"
FT                   /old_locus_tag="ACL108C"
FT   mRNA            complement(<151945..>152460)
FT                   /locus_tag="AGOS_ACL108C"
FT                   /old_locus_tag="ACL108C"
FT                   /product="ACL108Cp"
FT   CDS_pept        complement(151945..152460)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL108C"
FT                   /old_locus_tag="ACL108C"
FT                   /product="ACL108Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR105W
FT                   (YPT35)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL108C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51120"
FT                   /db_xref="GOA:Q75CM7"
FT                   /db_xref="InterPro:IPR001683"
FT                   /db_xref="InterPro:IPR036871"
FT                   /db_xref="InterPro:IPR037917"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CM7"
FT                   /protein_id="AAS51120.2"
FT                   HRWVPVRA"
FT   gene            complement(<152559..>153623)
FT                   /locus_tag="AGOS_ACL107C"
FT                   /old_locus_tag="ACL107C"
FT   mRNA            complement(<152559..>153623)
FT                   /locus_tag="AGOS_ACL107C"
FT                   /old_locus_tag="ACL107C"
FT                   /product="ACL107Cp"
FT   CDS_pept        complement(152559..153623)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL107C"
FT                   /old_locus_tag="ACL107C"
FT                   /product="ACL107Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR104W
FT                   (GRE3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL107C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51121"
FT                   /db_xref="GOA:Q75CM6"
FT                   /db_xref="InterPro:IPR018170"
FT                   /db_xref="InterPro:IPR020471"
FT                   /db_xref="InterPro:IPR023210"
FT                   /db_xref="InterPro:IPR036812"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CM6"
FT                   /protein_id="AAS51121.1"
FT                   DPWDWSAQPLPTFI"
FT   gene            complement(<153770..>154591)
FT                   /locus_tag="AGOS_ACL106C"
FT                   /old_locus_tag="ACL106C"
FT   mRNA            complement(<153770..>154591)
FT                   /locus_tag="AGOS_ACL106C"
FT                   /old_locus_tag="ACL106C"
FT                   /product="ACL106Cp"
FT   CDS_pept        complement(153770..154591)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL106C"
FT                   /old_locus_tag="ACL106C"
FT                   /product="ACL106Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR352W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL106C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51122"
FT                   /db_xref="GOA:Q75CM5"
FT                   /db_xref="InterPro:IPR006603"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CM5"
FT                   /protein_id="AAS51122.1"
FT   gene            complement(<154783..>157227)
FT                   /locus_tag="AGOS_ACL105C"
FT                   /old_locus_tag="ACL105C"
FT   mRNA            complement(<154783..>157227)
FT                   /locus_tag="AGOS_ACL105C"
FT                   /old_locus_tag="ACL105C"
FT                   /product="ACL105Cp"
FT   CDS_pept        complement(154783..157227)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL105C"
FT                   /old_locus_tag="ACL105C"
FT                   /product="ACL105Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR103W
FT                   (SBE22) and YDR351W (SBE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL105C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51123"
FT                   /db_xref="GOA:Q75CM4"
FT                   /db_xref="InterPro:IPR031403"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CM4"
FT                   /protein_id="AAS51123.2"
FT                   KF"
FT   gene            complement(<157350..>160193)
FT                   /locus_tag="AGOS_ACL104C"
FT                   /old_locus_tag="ACL104C"
FT   mRNA            complement(<157350..>160193)
FT                   /locus_tag="AGOS_ACL104C"
FT                   /old_locus_tag="ACL104C"
FT                   /product="ACL104Cp"
FT   CDS_pept        complement(157350..160193)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL104C"
FT                   /old_locus_tag="ACL104C"
FT                   /product="ACL104Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR102W
FT                   (KIC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL104C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51124"
FT                   /db_xref="GOA:Q75CM3"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CM3"
FT                   /protein_id="AAS51124.1"
FT                   KAVLPTHIPNANDDEQR"
FT   gene            <160591..>162684
FT                   /locus_tag="AGOS_ACL103W"
FT                   /old_locus_tag="ACL103W"
FT   mRNA            <160591..>162684
FT                   /locus_tag="AGOS_ACL103W"
FT                   /old_locus_tag="ACL103W"
FT                   /product="ACL103Wp"
FT   CDS_pept        160591..162684
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL103W"
FT                   /old_locus_tag="ACL103W"
FT                   /product="ACL103Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR350C
FT                   (ATP22)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL103W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51125"
FT                   /db_xref="GOA:Q75CM2"
FT                   /db_xref="InterPro:IPR017207"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CM2"
FT                   /protein_id="AAS51125.1"
FT                   AAP"
FT   gene            <162886..>163956
FT                   /locus_tag="AGOS_ACL102W"
FT                   /old_locus_tag="ACL102W"
FT   mRNA            <162886..>163956
FT                   /locus_tag="AGOS_ACL102W"
FT                   /old_locus_tag="ACL102W"
FT                   /product="ACL102Wp"
FT   CDS_pept        162886..163956
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL102W"
FT                   /old_locus_tag="ACL102W"
FT                   /product="ACL102Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIR026C
FT                   (YVH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL102W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51126"
FT                   /db_xref="GOA:Q75CM1"
FT                   /db_xref="InterPro:IPR000340"
FT                   /db_xref="InterPro:IPR000387"
FT                   /db_xref="InterPro:IPR016278"
FT                   /db_xref="InterPro:IPR020422"
FT                   /db_xref="InterPro:IPR029021"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CM1"
FT                   /protein_id="AAS51126.2"
FT                   AARLALPNLVNFETKQ"
FT   gene            complement(<163977..>164765)
FT                   /locus_tag="AGOS_ACL101C"
FT                   /old_locus_tag="ACL101C"
FT   mRNA            complement(<163977..>164765)
FT                   /locus_tag="AGOS_ACL101C"
FT                   /old_locus_tag="ACL101C"
FT                   /product="ACL101Cp"
FT   CDS_pept        complement(163977..164765)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL101C"
FT                   /old_locus_tag="ACL101C"
FT                   /product="ACL101Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIR025W
FT                   (MND2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL101C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51127"
FT                   /db_xref="GOA:Q75CM0"
FT                   /db_xref="InterPro:IPR008402"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CM0"
FT                   /protein_id="AAS51127.2"
FT   gene            complement(<164882..>165259)
FT                   /locus_tag="AGOS_ACL100C"
FT                   /old_locus_tag="ACL100C"
FT   mRNA            complement(join(<164882..165202,165251..>165259))
FT                   /locus_tag="AGOS_ACL100C"
FT                   /old_locus_tag="ACL100C"
FT                   /product="ACL100Cp"
FT   CDS_pept        complement(join(164882..165202,165251..165259))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL100C"
FT                   /old_locus_tag="ACL100C"
FT                   /product="ACL100Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKL018C-A; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL100C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51128"
FT                   /db_xref="InterPro:IPR013726"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL9"
FT                   /protein_id="AAS51128.2"
FT                   PAHLD"
FT   gene            <165399..>166382
FT                   /locus_tag="AGOS_ACL099W"
FT                   /old_locus_tag="ACL099W"
FT   mRNA            <165399..>166382
FT                   /locus_tag="AGOS_ACL099W"
FT                   /old_locus_tag="ACL099W"
FT                   /product="ACL099Wp"
FT   CDS_pept        165399..166382
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL099W"
FT                   /old_locus_tag="ACL099W"
FT                   /product="ACL099Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL018W
FT                   (SWD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL099W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51129"
FT                   /db_xref="GOA:Q75CL8"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR037867"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL8"
FT                   /protein_id="AAS51129.2"
FT   gene            complement(<166415..>168388)
FT                   /locus_tag="AGOS_ACL098C"
FT                   /old_locus_tag="ACL098C"
FT   mRNA            complement(<166415..>168388)
FT                   /locus_tag="AGOS_ACL098C"
FT                   /old_locus_tag="ACL098C"
FT                   /product="ACL098Cp"
FT   CDS_pept        complement(166415..168388)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL098C"
FT                   /old_locus_tag="ACL098C"
FT                   /product="ACL098Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL017C
FT                   (HCS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL098C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51130"
FT                   /db_xref="GOA:Q75CL7"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR004483"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR041677"
FT                   /db_xref="InterPro:IPR041679"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL7"
FT                   /protein_id="AAS51130.2"
FT   gene            complement(<168541..>169065)
FT                   /locus_tag="AGOS_ACL097C"
FT                   /old_locus_tag="ACL097C"
FT   mRNA            complement(<168541..>169065)
FT                   /locus_tag="AGOS_ACL097C"
FT                   /old_locus_tag="ACL097C"
FT                   /product="ACL097Cp"
FT   CDS_pept        complement(168541..169065)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL097C"
FT                   /old_locus_tag="ACL097C"
FT                   /product="ACL097Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL016C
FT                   (ATP7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL097C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51131"
FT                   /db_xref="GOA:Q75CL6"
FT                   /db_xref="InterPro:IPR008689"
FT                   /db_xref="InterPro:IPR036228"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL6"
FT                   /protein_id="AAS51131.1"
FT                   YKEKFGDLTVM"
FT   gene            <169501..>172005
FT                   /locus_tag="AGOS_ACL096W"
FT                   /old_locus_tag="ACL096W"
FT   mRNA            <169501..>172005
FT                   /locus_tag="AGOS_ACL096W"
FT                   /old_locus_tag="ACL096W"
FT                   /product="ACL096Wp"
FT   CDS_pept        169501..172005
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL096W"
FT                   /old_locus_tag="ACL096W"
FT                   /product="ACL096Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL015W
FT                   (PUT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL096W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51132"
FT                   /db_xref="GOA:Q75CL5"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR007219"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL5"
FT                   /protein_id="AAS51132.2"
FT   gene            complement(<172123..>177228)
FT                   /locus_tag="AGOS_ACL095C"
FT                   /old_locus_tag="ACL095C"
FT   mRNA            complement(<172123..>177228)
FT                   /locus_tag="AGOS_ACL095C"
FT                   /old_locus_tag="ACL095C"
FT                   /product="ACL095Cp"
FT   CDS_pept        complement(172123..177228)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL095C"
FT                   /old_locus_tag="ACL095C"
FT                   /product="ACL095Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL014C
FT                   (URB1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL095C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51133"
FT                   /db_xref="GOA:Q75CL4"
FT                   /db_xref="InterPro:IPR021714"
FT                   /db_xref="InterPro:IPR032436"
FT                   /db_xref="InterPro:IPR039844"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL4"
FT                   /protein_id="AAS51133.1"
FT                   RLRK"
FT   gene            <177502..>178134
FT                   /locus_tag="AGOS_ACL094W"
FT                   /old_locus_tag="ACL094W"
FT   mRNA            <177502..>178134
FT                   /locus_tag="AGOS_ACL094W"
FT                   /old_locus_tag="ACL094W"
FT                   /product="ACL094Wp"
FT   CDS_pept        177502..178134
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL094W"
FT                   /old_locus_tag="ACL094W"
FT                   /product="ACL094Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YIR024C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL094W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51134"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL3"
FT                   /protein_id="AAS51134.1"
FT   gene            complement(<178229..>181261)
FT                   /locus_tag="AGOS_ACL093C"
FT                   /old_locus_tag="ACL093C"
FT   mRNA            complement(<178229..>181261)
FT                   /locus_tag="AGOS_ACL093C"
FT                   /old_locus_tag="ACL093C"
FT                   /product="ACL093Cp"
FT   CDS_pept        complement(178229..181261)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL093C"
FT                   /old_locus_tag="ACL093C"
FT                   /product="ACL093Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIR023W
FT                   (DAL81)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL093C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51135"
FT                   /db_xref="GOA:Q75CL2"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR007219"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL2"
FT                   /protein_id="AAS51135.2"
FT   gene            complement(<181562..>182077)
FT                   /locus_tag="AGOS_ACL092C"
FT                   /old_locus_tag="ACL092C"
FT   mRNA            complement(<181562..>182077)
FT                   /locus_tag="AGOS_ACL092C"
FT                   /old_locus_tag="ACL092C"
FT                   /product="ACL092Cp"
FT   CDS_pept        complement(181562..182077)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL092C"
FT                   /old_locus_tag="ACL092C"
FT                   /product="ACL092Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL013C
FT                   (ARC19)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL092C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51136"
FT                   /db_xref="GOA:Q75CL1"
FT                   /db_xref="InterPro:IPR008384"
FT                   /db_xref="InterPro:IPR034666"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL1"
FT                   /protein_id="AAS51136.2"
FT                   AYLGEFVY"
FT   gene            complement(<182416..>184365)
FT                   /locus_tag="AGOS_ACL091C"
FT                   /old_locus_tag="ACL091C"
FT   mRNA            complement(<182416..>184365)
FT                   /locus_tag="AGOS_ACL091C"
FT                   /old_locus_tag="ACL091C"
FT                   /product="ACL091Cp"
FT   CDS_pept        complement(182416..184365)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL091C"
FT                   /old_locus_tag="ACL091C"
FT                   /product="ACL091Cp"
FT                   /note="NOHBY306; No homolog in Saccharomyces cerevisiae;
FT                   Non-syntenic homolog of Kluyveromyces thermotolerans
FT                   KLTH0E00638g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL091C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51137"
FT                   /db_xref="GOA:Q75CL0"
FT                   /db_xref="InterPro:IPR004843"
FT                   /db_xref="InterPro:IPR029052"
FT                   /db_xref="InterPro:IPR041805"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CL0"
FT                   /protein_id="AAS51137.1"
FT                   DQRDNCKSLHQMRF"
FT   gene            complement(<184871..>186292)
FT                   /locus_tag="AGOS_ACL090C"
FT                   /old_locus_tag="ACL090C"
FT   mRNA            complement(<184871..>186292)
FT                   /locus_tag="AGOS_ACL090C"
FT                   /old_locus_tag="ACL090C"
FT                   /product="ACL090Cp"
FT   CDS_pept        complement(184871..186292)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL090C"
FT                   /old_locus_tag="ACL090C"
FT                   /product="ACL090Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR053W
FT                   (BFA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL090C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51138"
FT                   /db_xref="GOA:Q75CK9"
FT                   /db_xref="InterPro:IPR034586"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CK9"
FT                   /protein_id="AAS51138.1"
FT                   FMYEIRKMVMNSARN"
FT   gene            <186582..>188414
FT                   /locus_tag="AGOS_ACL089W"
FT                   /old_locus_tag="ACL089W"
FT   mRNA            <186582..>188414
FT                   /locus_tag="AGOS_ACL089W"
FT                   /old_locus_tag="ACL089W"
FT                   /product="ACL089Wp"
FT   CDS_pept        186582..188414
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL089W"
FT                   /old_locus_tag="ACL089W"
FT                   /product="ACL089Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML046W
FT                   (PRP39)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL089W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51139"
FT                   /db_xref="GOA:Q75CK8"
FT                   /db_xref="InterPro:IPR003107"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CK8"
FT                   /protein_id="AAS51139.3"
FT   gene            complement(<188434..>190080)
FT                   /locus_tag="AGOS_ACL088C"
FT                   /old_locus_tag="ACL088C"
FT   mRNA            complement(<188434..>190080)
FT                   /locus_tag="AGOS_ACL088C"
FT                   /old_locus_tag="ACL088C"
FT                   /product="ACL088Cp"
FT   CDS_pept        complement(188434..190080)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL088C"
FT                   /old_locus_tag="ACL088C"
FT                   /product="ACL088Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR052W
FT                   (RAD7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL088C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51140"
FT                   /db_xref="GOA:Q75CK7"
FT                   /db_xref="InterPro:IPR006553"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CK7"
FT                   /protein_id="AAS51140.1"
FT   gene            191333..191406
FT                   /locus_tag="AGOS_t0048"
FT   tRNA            191333..191406
FT                   /locus_tag="AGOS_t0048"
FT                   /product="tRNA-Asn"
FT                   /note="codon recognized: AAC"
FT   gene            complement(<191562..>192125)
FT                   /locus_tag="AGOS_ACL087C"
FT                   /old_locus_tag="ACL087C"
FT   mRNA            complement(<191562..>192125)
FT                   /locus_tag="AGOS_ACL087C"
FT                   /old_locus_tag="ACL087C"
FT                   /product="ACL087Cp"
FT   CDS_pept        complement(191562..192125)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL087C"
FT                   /old_locus_tag="ACL087C"
FT                   /product="ACL087Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL090W
FT                   (RHO2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL087C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51141"
FT                   /db_xref="GOA:Q75CK6"
FT                   /db_xref="InterPro:IPR001806"
FT                   /db_xref="InterPro:IPR003578"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR017231"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CK6"
FT                   /protein_id="AAS51141.1"
FT   gene            complement(<192725..>196348)
FT                   /locus_tag="AGOS_ACL086C"
FT                   /old_locus_tag="ACL086C"
FT   mRNA            complement(<192725..>196348)
FT                   /locus_tag="AGOS_ACL086C"
FT                   /old_locus_tag="ACL086C"
FT                   /product="ACL086Cp"
FT   CDS_pept        complement(192725..196348)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL086C"
FT                   /old_locus_tag="ACL086C"
FT                   /product="ACL086Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL091W
FT                   (NST1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL086C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51142"
FT                   /db_xref="GOA:Q75CK5"
FT                   /db_xref="InterPro:IPR025279"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CK5"
FT                   /protein_id="AAS51142.2"
FT   gene            complement(<197607..>198797)
FT                   /locus_tag="AGOS_ACL085C"
FT                   /old_locus_tag="ACL085C"
FT   mRNA            complement(<197607..>198797)
FT                   /locus_tag="AGOS_ACL085C"
FT                   /old_locus_tag="ACL085C"
FT                   /product="ACL085Cp"
FT   CDS_pept        complement(197607..198797)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL085C"
FT                   /old_locus_tag="ACL085C"
FT                   /product="ACL085Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YNL092W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL085C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51143"
FT                   /db_xref="GOA:Q75CK4"
FT                   /db_xref="InterPro:IPR012901"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CK4"
FT                   /protein_id="AAS51143.1"
FT   gene            complement(<199009..>199632)
FT                   /locus_tag="AGOS_ACL084C"
FT                   /old_locus_tag="ACL084C"
FT   mRNA            complement(<199009..>199632)
FT                   /locus_tag="AGOS_ACL084C"
FT                   /old_locus_tag="ACL084C"
FT                   /product="ACL084Cp"
FT   CDS_pept        complement(199009..199632)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL084C"
FT                   /old_locus_tag="ACL084C"
FT                   /product="ACL084Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR089C
FT                   (VPS21) and YNL093W (YPT53)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL084C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51144"
FT                   /db_xref="GOA:Q75CK3"
FT                   /db_xref="InterPro:IPR001806"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CK3"
FT                   /protein_id="AAS51144.1"
FT   gene            complement(<199834..>201459)
FT                   /locus_tag="AGOS_ACL083C"
FT                   /old_locus_tag="ACL083C"
FT   mRNA            complement(<199834..>201459)
FT                   /locus_tag="AGOS_ACL083C"
FT                   /old_locus_tag="ACL083C"
FT                   /product="ACL083Cp"
FT   CDS_pept        complement(199834..201459)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL083C"
FT                   /old_locus_tag="ACL083C"
FT                   /product="ACL083Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR090C
FT                   (PTC5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL083C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51145"
FT                   /db_xref="GOA:Q75CK2"
FT                   /db_xref="InterPro:IPR000222"
FT                   /db_xref="InterPro:IPR001932"
FT                   /db_xref="InterPro:IPR015655"
FT                   /db_xref="InterPro:IPR036457"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CK2"
FT                   /protein_id="AAS51145.1"
FT   gene            <201876..>202907
FT                   /locus_tag="AGOS_ACL082W"
FT                   /old_locus_tag="ACL082W"
FT   mRNA            <201876..>202907
FT                   /locus_tag="AGOS_ACL082W"
FT                   /old_locus_tag="ACL082W"
FT                   /product="ACL082Wp"
FT   CDS_pept        201876..202907
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL082W"
FT                   /old_locus_tag="ACL082W"
FT                   /product="ACL082Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR091W
FT                   (TMA46)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL082W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51146"
FT                   /db_xref="GOA:Q75CK1"
FT                   /db_xref="InterPro:IPR000571"
FT                   /db_xref="InterPro:IPR032378"
FT                   /db_xref="InterPro:IPR036855"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CK1"
FT                   /protein_id="AAS51146.1"
FT                   TAA"
FT   gene            complement(<203075..>204856)
FT                   /locus_tag="AGOS_ACL081C"
FT                   /old_locus_tag="ACL081C"
FT   mRNA            complement(<203075..>204856)
FT                   /locus_tag="AGOS_ACL081C"
FT                   /old_locus_tag="ACL081C"
FT                   /product="ACL081Cp"
FT   CDS_pept        complement(203075..204856)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL081C"
FT                   /old_locus_tag="ACL081C"
FT                   /product="ACL081Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL094W
FT                   (APP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL081C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51147"
FT                   /db_xref="GOA:Q75CK0"
FT                   /db_xref="InterPro:IPR017210"
FT                   /db_xref="InterPro:IPR019236"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CK0"
FT                   /protein_id="AAS51147.2"
FT                   IEDSMTKINFTAKRKSA"
FT   gene            <205395..>207155
FT                   /locus_tag="AGOS_ACL080W"
FT                   /old_locus_tag="ACL080W"
FT   mRNA            <205395..>207155
FT                   /locus_tag="AGOS_ACL080W"
FT                   /old_locus_tag="ACL080W"
FT                   /product="ACL080Wp"
FT   CDS_pept        205395..207155
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL080W"
FT                   /old_locus_tag="ACL080W"
FT                   /product="ACL080Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL095C
FT                   and YOR092W (ECM3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL080W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51148"
FT                   /db_xref="GOA:Q75CJ9"
FT                   /db_xref="InterPro:IPR004776"
FT                   /db_xref="InterPro:IPR040254"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CJ9"
FT                   /protein_id="AAS51148.2"
FT                   TYFLKVKLDV"
FT   gene            complement(<207337..>212217)
FT                   /locus_tag="AGOS_ACL079C"
FT                   /old_locus_tag="ACL079C"
FT   mRNA            complement(<207337..>212217)
FT                   /locus_tag="AGOS_ACL079C"
FT                   /old_locus_tag="ACL079C"
FT                   /product="ACL079Cp"
FT   CDS_pept        complement(207337..212217)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL079C"
FT                   /old_locus_tag="ACL079C"
FT                   /product="ACL079Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOR093C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL079C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51149"
FT                   /db_xref="GOA:Q75CJ8"
FT                   /db_xref="InterPro:IPR000873"
FT                   /db_xref="InterPro:IPR037337"
FT                   /db_xref="InterPro:IPR042099"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CJ8"
FT                   /protein_id="AAS51149.2"
FT   gene            <212651..>213196
FT                   /locus_tag="AGOS_ACL078W"
FT                   /old_locus_tag="ACL078W"
FT   mRNA            <212651..>213196
FT                   /locus_tag="AGOS_ACL078W"
FT                   /old_locus_tag="ACL078W"
FT                   /product="ACL078Wp"
FT   CDS_pept        212651..213196
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL078W"
FT                   /old_locus_tag="ACL078W"
FT                   /product="ACL078Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR094W
FT                   (ARF3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL078W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51150"
FT                   /db_xref="GOA:Q75CJ7"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR006689"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CJ7"
FT                   /protein_id="AAS51150.1"
FT                   GQGLVEGLSWIANNTKSR"
FT   gene            complement(<213318..>214085)
FT                   /locus_tag="AGOS_ACL077C"
FT                   /old_locus_tag="ACL077C"
FT   mRNA            complement(<213318..>214085)
FT                   /locus_tag="AGOS_ACL077C"
FT                   /old_locus_tag="ACL077C"
FT                   /product="ACL077Cp"
FT   CDS_pept        complement(213318..214085)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL077C"
FT                   /old_locus_tag="ACL077C"
FT                   /product="ACL077Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR095C
FT                   (RKI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL077C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51151"
FT                   /db_xref="GOA:Q75CJ6"
FT                   /db_xref="InterPro:IPR004788"
FT                   /db_xref="InterPro:IPR037171"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CJ6"
FT                   /protein_id="AAS51151.1"
FT   gene            <214736..>215452
FT                   /locus_tag="AGOS_ACL076W"
FT                   /old_locus_tag="ACL076W"
FT   mRNA            join(<214736..214879,215024..>215452)
FT                   /locus_tag="AGOS_ACL076W"
FT                   /old_locus_tag="ACL076W"
FT                   /product="ACL076Wp"
FT   CDS_pept        join(214736..214879,215024..215452)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL076W"
FT                   /old_locus_tag="ACL076W"
FT                   /product="ACL076Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR096W
FT                   (RPS7A) and YNL096C (RPS7B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL076W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51152"
FT                   /db_xref="GOA:Q75CJ5"
FT                   /db_xref="InterPro:IPR000554"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CJ5"
FT                   /protein_id="AAS51152.1"
FT   gene            complement(<215791..>218337)
FT                   /locus_tag="AGOS_ACL075C"
FT                   /old_locus_tag="ACL075C"
FT   mRNA            complement(<215791..>218337)
FT                   /locus_tag="AGOS_ACL075C"
FT                   /old_locus_tag="ACL075C"
FT                   /product="ACL075Cp"
FT   CDS_pept        complement(215791..218337)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL075C"
FT                   /old_locus_tag="ACL075C"
FT                   /product="ACL075Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR098C
FT                   (NUP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL075C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51153"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CJ4"
FT                   /protein_id="AAS51153.1"
FT   gene            <220792..>221820
FT                   /locus_tag="AGOS_ACL074W"
FT                   /old_locus_tag="ACL074W"
FT   mRNA            <220792..>221820
FT                   /locus_tag="AGOS_ACL074W"
FT                   /old_locus_tag="ACL074W"
FT                   /product="ACL074Wp"
FT   CDS_pept        220792..221820
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL074W"
FT                   /old_locus_tag="ACL074W"
FT                   /product="ACL074Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YKR092C (SRP40)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL074W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51154"
FT                   /db_xref="GOA:Q75CJ3"
FT                   /db_xref="InterPro:IPR007718"
FT                   /db_xref="InterPro:IPR039191"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CJ3"
FT                   /protein_id="AAS51154.2"
FT                   VD"
FT   gene            <222050..>222211
FT                   /locus_tag="AGOS_ACL074WA"
FT   mRNA            <222050..>222211
FT                   /locus_tag="AGOS_ACL074WA"
FT                   /product="ACL074W-Ap"
FT   CDS_pept        222050..222211
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL074WA"
FT                   /product="ACL074W-Ap"
FT                   /note="NOHBY335; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E13101g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL074WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41753"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGB0"
FT                   /protein_id="ADJ41753.1"
FT                   KKFTGNRP"
FT   gene            <222769..>224418
FT                   /locus_tag="AGOS_ACL073W"
FT                   /old_locus_tag="ACL073W"
FT   mRNA            <222769..>224418
FT                   /locus_tag="AGOS_ACL073W"
FT                   /old_locus_tag="ACL073W"
FT                   /product="ACL073Wp"
FT   CDS_pept        222769..224418
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL073W"
FT                   /old_locus_tag="ACL073W"
FT                   /product="ACL073Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL036W
FT                   (MUP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL073W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51155"
FT                   /db_xref="GOA:Q75CJ2"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CJ2"
FT                   /protein_id="AAS51155.2"
FT   gene            complement(<224562..>229445)
FT                   /locus_tag="AGOS_ACL072C"
FT                   /old_locus_tag="ACL072C"
FT   mRNA            complement(<224562..>229445)
FT                   /locus_tag="AGOS_ACL072C"
FT                   /old_locus_tag="ACL072C"
FT                   /product="ACL072Cp"
FT   CDS_pept        complement(224562..229445)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL072C"
FT                   /old_locus_tag="ACL072C"
FT                   /product="ACL072Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL048C
FT                   (YBT1) and YHL035C (VMR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL072C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51156"
FT                   /db_xref="GOA:Q75CJ1"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR011527"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036640"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CJ1"
FT                   /protein_id="AAS51156.2"
FT   gene            complement(<229767..>230663)
FT                   /locus_tag="AGOS_ACL071C"
FT                   /old_locus_tag="ACL071C"
FT   mRNA            complement(<229767..>230663)
FT                   /locus_tag="AGOS_ACL071C"
FT                   /old_locus_tag="ACL071C"
FT                   /product="ACL071Cp"
FT   CDS_pept        complement(229767..230663)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL071C"
FT                   /old_locus_tag="ACL071C"
FT                   /product="ACL071Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL034C
FT                   (SBP1) and YLL046C (RNP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL071C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51157"
FT                   /db_xref="GOA:Q75CJ0"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CJ0"
FT                   /protein_id="AAS51157.1"
FT                   AAAPAQVSIVPAQAEVA"
FT   gene            complement(<231334..>232251)
FT                   /locus_tag="AGOS_ACL070C"
FT                   /old_locus_tag="ACL070C"
FT   mRNA            complement(<231334..>232251)
FT                   /locus_tag="AGOS_ACL070C"
FT                   /old_locus_tag="ACL070C"
FT                   /product="ACL070Cp"
FT   CDS_pept        complement(231334..232251)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL070C"
FT                   /old_locus_tag="ACL070C"
FT                   /product="ACL070Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL045C
FT                   (RPL8B) and YHL033C (RPL8A)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL070C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51158"
FT                   /db_xref="GOA:Q75CI9"
FT                   /db_xref="InterPro:IPR001921"
FT                   /db_xref="InterPro:IPR004037"
FT                   /db_xref="InterPro:IPR004038"
FT                   /db_xref="InterPro:IPR018492"
FT                   /db_xref="InterPro:IPR029064"
FT                   /db_xref="InterPro:IPR038524"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CI9"
FT                   /protein_id="AAS51158.1"
FT   gene            complement(<232439..>234373)
FT                   /locus_tag="AGOS_ACL069C"
FT                   /old_locus_tag="ACL069C"
FT   mRNA            complement(<232439..>234373)
FT                   /locus_tag="AGOS_ACL069C"
FT                   /old_locus_tag="ACL069C"
FT                   /product="ACL069Cp"
FT   CDS_pept        complement(232439..234373)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL069C"
FT                   /old_locus_tag="ACL069C"
FT                   /product="ACL069Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL032C
FT                   (GUT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL069C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51159"
FT                   /db_xref="GOA:Q75CI8"
FT                   /db_xref="InterPro:IPR005999"
FT                   /db_xref="InterPro:IPR018483"
FT                   /db_xref="InterPro:IPR018484"
FT                   /db_xref="InterPro:IPR018485"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CI8"
FT                   /protein_id="AAS51159.2"
FT                   GWLHDAEGN"
FT   gene            <235420..>236850
FT                   /locus_tag="AGOS_ACL068W"
FT                   /old_locus_tag="ACL068W"
FT   mRNA            <235420..>236850
FT                   /locus_tag="AGOS_ACL068W"
FT                   /old_locus_tag="ACL068W"
FT                   /product="ACL068Wp"
FT   CDS_pept        235420..236850
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL068W"
FT                   /old_locus_tag="ACL068W"
FT                   /product="ACL068Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL043W
FT                   (FPS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL068W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51160"
FT                   /db_xref="GOA:Q75CI7"
FT                   /db_xref="InterPro:IPR000425"
FT                   /db_xref="InterPro:IPR022357"
FT                   /db_xref="InterPro:IPR023271"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CI7"
FT                   /protein_id="AAS51160.2"
FT                   ESTNGVPTIYSQSNDPKK"
FT   gene            complement(<237012..>237671)
FT                   /locus_tag="AGOS_ACL067C"
FT                   /old_locus_tag="ACL067C"
FT   mRNA            complement(<237012..>237671)
FT                   /locus_tag="AGOS_ACL067C"
FT                   /old_locus_tag="ACL067C"
FT                   /product="ACL067Cp"
FT   CDS_pept        complement(237012..237671)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL067C"
FT                   /old_locus_tag="ACL067C"
FT                   /product="ACL067Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL031C
FT                   (GOS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL067C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51161"
FT                   /db_xref="GOA:Q75CI6"
FT                   /db_xref="InterPro:IPR023601"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CI6"
FT                   /protein_id="AAS51161.2"
FT   gene            complement(<237760..>238272)
FT                   /locus_tag="AGOS_ACL066C"
FT                   /old_locus_tag="ACL066C"
FT   mRNA            complement(<237760..>238272)
FT                   /locus_tag="AGOS_ACL066C"
FT                   /old_locus_tag="ACL066C"
FT                   /product="ACL066Cp"
FT   CDS_pept        complement(237760..238272)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL066C"
FT                   /old_locus_tag="ACL066C"
FT                   /product="ACL066Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL042C
FT                   (ATG10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL066C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51162"
FT                   /db_xref="GOA:Q75CI5"
FT                   /db_xref="InterPro:IPR007135"
FT                   /db_xref="InterPro:IPR016524"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CI5"
FT                   /protein_id="AAS51162.2"
FT                   CTDQKKA"
FT   gene            complement(<238400..>239185)
FT                   /locus_tag="AGOS_ACL065C"
FT                   /old_locus_tag="ACL065C"
FT   mRNA            complement(<238400..>239185)
FT                   /locus_tag="AGOS_ACL065C"
FT                   /old_locus_tag="ACL065C"
FT                   /product="ACL065Cp"
FT   CDS_pept        complement(238400..239185)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL065C"
FT                   /old_locus_tag="ACL065C"
FT                   /product="ACL065Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL041C
FT                   (SDH2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL065C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51163"
FT                   /db_xref="GOA:Q75CI4"
FT                   /db_xref="InterPro:IPR001041"
FT                   /db_xref="InterPro:IPR004489"
FT                   /db_xref="InterPro:IPR006058"
FT                   /db_xref="InterPro:IPR009051"
FT                   /db_xref="InterPro:IPR012675"
FT                   /db_xref="InterPro:IPR017896"
FT                   /db_xref="InterPro:IPR017900"
FT                   /db_xref="InterPro:IPR025192"
FT                   /db_xref="InterPro:IPR036010"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CI4"
FT                   /protein_id="AAS51163.1"
FT   gene            complement(<239883..>249233)
FT                   /locus_tag="AGOS_ACL064C"
FT                   /old_locus_tag="ACL064C"
FT   mRNA            complement(<239883..>249233)
FT                   /locus_tag="AGOS_ACL064C"
FT                   /old_locus_tag="ACL064C"
FT                   /product="ACL064Cp"
FT   CDS_pept        complement(239883..249233)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL064C"
FT                   /old_locus_tag="ACL064C"
FT                   /product="ACL064Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL040C
FT                   (VPS13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL064C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51164"
FT                   /db_xref="GOA:Q75CI3"
FT                   /db_xref="InterPro:IPR009543"
FT                   /db_xref="InterPro:IPR017148"
FT                   /db_xref="InterPro:IPR026847"
FT                   /db_xref="InterPro:IPR026854"
FT                   /db_xref="InterPro:IPR031642"
FT                   /db_xref="InterPro:IPR031645"
FT                   /db_xref="InterPro:IPR031646"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CI3"
FT                   /protein_id="AAS51164.2"
FT                   SEL"
FT   gene            <249546..>255098
FT                   /locus_tag="AGOS_ACL063W"
FT                   /old_locus_tag="ACL063W"
FT   mRNA            <249546..>255098
FT                   /locus_tag="AGOS_ACL063W"
FT                   /old_locus_tag="ACL063W"
FT                   /product="ACL063Wp"
FT   CDS_pept        249546..255098
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL063W"
FT                   /old_locus_tag="ACL063W"
FT                   /product="ACL063Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL030W
FT                   (ECM29)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL063W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51165"
FT                   /db_xref="GOA:Q75CI2"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR024372"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CI2"
FT                   /protein_id="AAS51165.2"
FT   gene            complement(<255355..>256503)
FT                   /locus_tag="AGOS_ACL062C"
FT                   /old_locus_tag="ACL062C"
FT   mRNA            complement(<255355..>256503)
FT                   /locus_tag="AGOS_ACL062C"
FT                   /old_locus_tag="ACL062C"
FT                   /product="ACL062Cp"
FT   CDS_pept        complement(255355..256503)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL062C"
FT                   /old_locus_tag="ACL062C"
FT                   /product="ACL062Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL039C
FT                   (UBI4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL062C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51166"
FT                   /db_xref="GOA:Q75CI1"
FT                   /db_xref="InterPro:IPR000626"
FT                   /db_xref="InterPro:IPR019954"
FT                   /db_xref="InterPro:IPR019956"
FT                   /db_xref="InterPro:IPR029071"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CI1"
FT                   /protein_id="AAS51166.1"
FT   gene            complement(<256805..>257509)
FT                   /locus_tag="AGOS_ACL061C"
FT                   /old_locus_tag="ACL061C"
FT   mRNA            complement(<256805..>257509)
FT                   /locus_tag="AGOS_ACL061C"
FT                   /old_locus_tag="ACL061C"
FT                   /product="ACL061Cp"
FT   CDS_pept        complement(256805..257509)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL061C"
FT                   /old_locus_tag="ACL061C"
FT                   /product="ACL061Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL038C
FT                   (ENT4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL061C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51167"
FT                   /db_xref="GOA:Q75CI0"
FT                   /db_xref="InterPro:IPR008942"
FT                   /db_xref="InterPro:IPR013809"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CI0"
FT                   /protein_id="AAS51167.1"
FT                   SGATLPTKDSYI"
FT   gene            complement(<257815..>259397)
FT                   /locus_tag="AGOS_ACL060C"
FT                   /old_locus_tag="ACL060C"
FT   mRNA            complement(join(<257815..259316,259385..>259397))
FT                   /locus_tag="AGOS_ACL060C"
FT                   /old_locus_tag="ACL060C"
FT                   /product="ACL060Cp"
FT   CDS_pept        complement(join(257815..259316,259385..259397))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL060C"
FT                   /old_locus_tag="ACL060C"
FT                   /product="ACL060Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL036C
FT                   (PRP19); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL060C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51168"
FT                   /db_xref="GOA:Q75CH9"
FT                   /db_xref="InterPro:IPR003613"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR013915"
FT                   /db_xref="InterPro:IPR038959"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CH9"
FT                   /protein_id="AAS51168.1"
FT   gene            complement(<259734..>261095)
FT                   /locus_tag="AGOS_ACL059C"
FT                   /old_locus_tag="ACL059C"
FT   mRNA            complement(<259734..>261095)
FT                   /locus_tag="AGOS_ACL059C"
FT                   /old_locus_tag="ACL059C"
FT                   /product="ACL059Cp"
FT   CDS_pept        complement(259734..261095)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL059C"
FT                   /old_locus_tag="ACL059C"
FT                   /product="ACL059Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL184C
FT                   (STR3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL059C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51169"
FT                   /db_xref="GOA:Q75CH8"
FT                   /db_xref="InterPro:IPR000277"
FT                   /db_xref="InterPro:IPR006238"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CH8"
FT                   /protein_id="AAS51169.1"
FT   gene            <261725..>264178
FT                   /locus_tag="AGOS_ACL058W"
FT                   /old_locus_tag="ACL058W"
FT   mRNA            <261725..>264178
FT                   /locus_tag="AGOS_ACL058W"
FT                   /old_locus_tag="ACL058W"
FT                   /product="ACL058Wp"
FT   CDS_pept        261725..264178
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL058W"
FT                   /old_locus_tag="ACL058W"
FT                   /product="ACL058Wp"
FT                   /note="NOHBY305; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0C17050g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL058W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51170"
FT                   /db_xref="GOA:Q75CH7"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR007219"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CH7"
FT                   /protein_id="AAS51170.2"
FT                   TTLSM"
FT   gene            <264936..>266498
FT                   /locus_tag="AGOS_ACL057W"
FT                   /old_locus_tag="ACL057W"
FT   mRNA            <264936..>266498
FT                   /locus_tag="AGOS_ACL057W"
FT                   /old_locus_tag="ACL057W"
FT                   /product="ACL057Wp"
FT   CDS_pept        264936..266498
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL057W"
FT                   /old_locus_tag="ACL057W"
FT                   /product="ACL057Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YER130C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL057W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51171"
FT                   /db_xref="GOA:Q75CH6"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CH6"
FT                   /protein_id="AAS51171.1"
FT                   RKL"
FT   gene            complement(<266633..>267371)
FT                   /locus_tag="AGOS_ACL056C"
FT                   /old_locus_tag="ACL056C"
FT   mRNA            complement(join(<266633..267307,267369..>267371))
FT                   /locus_tag="AGOS_ACL056C"
FT                   /old_locus_tag="ACL056C"
FT                   /product="ACL056Cp"
FT   CDS_pept        complement(join(266633..267307,267369..267371))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL056C"
FT                   /old_locus_tag="ACL056C"
FT                   /product="ACL056Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL183C
FT                   (MND1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL056C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51172"
FT                   /db_xref="GOA:Q75CH5"
FT                   /db_xref="InterPro:IPR005647"
FT                   /db_xref="InterPro:IPR040453"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CH5"
FT                   /protein_id="AAS51172.2"
FT                   SLP"
FT   gene            <267927..>269342
FT                   /locus_tag="AGOS_ACL055W"
FT                   /old_locus_tag="ACL055W"
FT   mRNA            <267927..>269342
FT                   /locus_tag="AGOS_ACL055W"
FT                   /old_locus_tag="ACL055W"
FT                   /product="ACL055Wp"
FT   CDS_pept        267927..269342
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL055W"
FT                   /old_locus_tag="ACL055W"
FT                   /product="ACL055Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL181W
FT                   (GTS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL055W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51173"
FT                   /db_xref="GOA:Q75CH4"
FT                   /db_xref="InterPro:IPR001164"
FT                   /db_xref="InterPro:IPR009060"
FT                   /db_xref="InterPro:IPR015940"
FT                   /db_xref="InterPro:IPR037278"
FT                   /db_xref="InterPro:IPR038508"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CH4"
FT                   /protein_id="AAS51173.1"
FT                   ASQGAYPGYNYQM"
FT   gene            <269705..>272623
FT                   /locus_tag="AGOS_ACL054W"
FT                   /old_locus_tag="ACL054W"
FT   mRNA            <269705..>272623
FT                   /locus_tag="AGOS_ACL054W"
FT                   /old_locus_tag="ACL054W"
FT                   /product="ACL054Wp"
FT   CDS_pept        269705..272623
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL054W"
FT                   /old_locus_tag="ACL054W"
FT                   /product="ACL054Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL180W
FT                   (ATG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL054W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51174"
FT                   /db_xref="GOA:Q75CH3"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR022708"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CH3"
FT                   /protein_id="AAS51174.1"
FT   gene            complement(<273165..>276710)
FT                   /locus_tag="AGOS_ACL053C"
FT                   /old_locus_tag="ACL053C"
FT   mRNA            complement(<273165..>276710)
FT                   /locus_tag="AGOS_ACL053C"
FT                   /old_locus_tag="ACL053C"
FT                   /product="ACL053Cp"
FT   CDS_pept        complement(273165..276710)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL053C"
FT                   /old_locus_tag="ACL053C"
FT                   /product="ACL053Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER129W
FT                   (SAK1) and YGL179C (TOS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL053C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51175"
FT                   /db_xref="GOA:Q75CH2"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CH2"
FT                   /protein_id="AAS51175.2"
FT                   QLDKRNNDTLGSPYN"
FT   gene            complement(<277079..>277693)
FT                   /locus_tag="AGOS_ACL052C"
FT                   /old_locus_tag="ACL052C"
FT   mRNA            complement(<277079..>277693)
FT                   /locus_tag="AGOS_ACL052C"
FT                   /old_locus_tag="ACL052C"
FT                   /product="ACL052Cp"
FT   CDS_pept        complement(277079..277693)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL052C"
FT                   /old_locus_tag="ACL052C"
FT                   /product="ACL052Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER128W
FT                   (VFA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL052C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51176"
FT                   /db_xref="GOA:Q75CH1"
FT                   /db_xref="InterPro:IPR013640"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CH1"
FT                   /protein_id="AAS51176.1"
FT   gene            complement(<277785..>278801)
FT                   /locus_tag="AGOS_ACL051C"
FT                   /old_locus_tag="ACL051C"
FT   mRNA            complement(<277785..>278801)
FT                   /locus_tag="AGOS_ACL051C"
FT                   /old_locus_tag="ACL051C"
FT                   /product="ACL051Cp"
FT   CDS_pept        complement(277785..278801)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL051C"
FT                   /old_locus_tag="ACL051C"
FT                   /product="ACL051Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER127W
FT                   (LCP5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL051C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51177"
FT                   /db_xref="GOA:Q75CH0"
FT                   /db_xref="InterPro:IPR007146"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CH0"
FT                   /protein_id="AAS51177.1"
FT   gene            <279017..>279802
FT                   /locus_tag="AGOS_ACL050W"
FT                   /old_locus_tag="ACL050W"
FT   mRNA            <279017..>279802
FT                   /locus_tag="AGOS_ACL050W"
FT                   /old_locus_tag="ACL050W"
FT                   /product="ACL050Wp"
FT   CDS_pept        279017..279802
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL050W"
FT                   /old_locus_tag="ACL050W"
FT                   /product="ACL050Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER126C
FT                   (NSA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL050W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51178"
FT                   /db_xref="GOA:Q75CG9"
FT                   /db_xref="InterPro:IPR022309"
FT                   /db_xref="InterPro:IPR039411"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CG9"
FT                   /protein_id="AAS51178.1"
FT   gene            <279887..>280492
FT                   /locus_tag="AGOS_ACL049W"
FT                   /old_locus_tag="ACL049W"
FT   mRNA            <279887..>280492
FT                   /locus_tag="AGOS_ACL049W"
FT                   /old_locus_tag="ACL049W"
FT                   /product="ACL049Wp"
FT   CDS_pept        279887..280492
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL049W"
FT                   /old_locus_tag="ACL049W"
FT                   /product="ACL049Wp"
FT                   /note="NOHBY304; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL049W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51179"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CG8"
FT                   /protein_id="AAS51179.1"
FT   gene            <280762..>282663
FT                   /locus_tag="AGOS_ACL048W"
FT                   /old_locus_tag="ACL048W"
FT   mRNA            <280762..>282663
FT                   /locus_tag="AGOS_ACL048W"
FT                   /old_locus_tag="ACL048W"
FT                   /product="ACL048Wp"
FT   CDS_pept        280762..282663
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL048W"
FT                   /old_locus_tag="ACL048W"
FT                   /product="ACL048Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YIL067C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL048W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51180"
FT                   /db_xref="GOA:Q75CG7"
FT                   /db_xref="InterPro:IPR004043"
FT                   /db_xref="InterPro:IPR036609"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CG7"
FT                   /protein_id="AAS51180.2"
FT   gene            <282894..>285284
FT                   /locus_tag="AGOS_ACL047W"
FT                   /old_locus_tag="ACL047W"
FT   mRNA            <282894..>285284
FT                   /locus_tag="AGOS_ACL047W"
FT                   /old_locus_tag="ACL047W"
FT                   /product="ACL047Wp"
FT   CDS_pept        282894..285284
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL047W"
FT                   /old_locus_tag="ACL047W"
FT                   /product="ACL047Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL068C
FT                   (SEC6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL047W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51181"
FT                   /db_xref="GOA:Q75CG6"
FT                   /db_xref="InterPro:IPR010326"
FT                   /db_xref="InterPro:IPR042532"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CG6"
FT                   /protein_id="AAS51181.2"
FT   gene            complement(<285294..>285635)
FT                   /locus_tag="AGOS_ACL046C"
FT                   /old_locus_tag="ACL046C"
FT   mRNA            complement(<285294..>285635)
FT                   /locus_tag="AGOS_ACL046C"
FT                   /old_locus_tag="ACL046C"
FT                   /product="ACL046Cp"
FT   CDS_pept        complement(285294..285635)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL046C"
FT                   /old_locus_tag="ACL046C"
FT                   /product="ACL046Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER071C
FT                   (TDA2); Newly annotated start codon"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL046C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51182"
FT                   /db_xref="InterPro:IPR005334"
FT                   /db_xref="InterPro:IPR038586"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CG5"
FT                   /experiment="RACE determination of 5' region of mRNA"
FT                   /protein_id="AAS51182.2"
FT                   LVTVVWLAR"
FT   gene            <285773..>286141
FT                   /locus_tag="AGOS_ACL045W"
FT                   /old_locus_tag="ACL045W"
FT   mRNA            <285773..>286141
FT                   /locus_tag="AGOS_ACL045W"
FT                   /old_locus_tag="ACL045W"
FT                   /product="ACL045Wp"
FT   CDS_pept        285773..286141
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL045W"
FT                   /old_locus_tag="ACL045W"
FT                   /product="ACL045Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER072W
FT                   (VTC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL045W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51183"
FT                   /db_xref="GOA:Q75CG4"
FT                   /db_xref="InterPro:IPR003807"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CG4"
FT                   /protein_id="AAS51183.1"
FT                   CFFLLAAVVVNFVLRLSQ"
FT   gene            <286310..>287851
FT                   /locus_tag="AGOS_ACL044W"
FT                   /old_locus_tag="ACL044W"
FT   mRNA            <286310..>287851
FT                   /locus_tag="AGOS_ACL044W"
FT                   /old_locus_tag="ACL044W"
FT                   /product="ACL044Wp"
FT   CDS_pept        286310..287851
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL044W"
FT                   /old_locus_tag="ACL044W"
FT                   /product="ACL044Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER073W
FT                   (ALD5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL044W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51184"
FT                   /db_xref="GOA:Q75CG3"
FT                   /db_xref="InterPro:IPR015590"
FT                   /db_xref="InterPro:IPR016160"
FT                   /db_xref="InterPro:IPR016161"
FT                   /db_xref="InterPro:IPR016162"
FT                   /db_xref="InterPro:IPR016163"
FT                   /db_xref="InterPro:IPR029510"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CG3"
FT                   /protein_id="AAS51184.1"
FT   gene            <288221..>288904
FT                   /locus_tag="AGOS_ACL043W"
FT                   /old_locus_tag="ACL043W"
FT   mRNA            join(<288221..288223,288500..>288904)
FT                   /locus_tag="AGOS_ACL043W"
FT                   /old_locus_tag="ACL043W"
FT                   /product="ACL043Wp"
FT   CDS_pept        join(288221..288223,288500..288904)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL043W"
FT                   /old_locus_tag="ACL043W"
FT                   /product="ACL043Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL069C
FT                   (RPS24B) and YER074W (RPS24A); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL043W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51185"
FT                   /db_xref="GOA:Q75CG2"
FT                   /db_xref="InterPro:IPR001976"
FT                   /db_xref="InterPro:IPR012678"
FT                   /db_xref="InterPro:IPR018098"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CG2"
FT                   /protein_id="AAS51185.1"
FT   gene            <289168..>289481
FT                   /locus_tag="AGOS_ACL042W"
FT                   /old_locus_tag="ACL042W"
FT   mRNA            join(<289168..289258,289321..>289481)
FT                   /locus_tag="AGOS_ACL042W"
FT                   /old_locus_tag="ACL042W"
FT                   /product="ACL042Wp"
FT   CDS_pept        join(289168..289258,289321..289481)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL042W"
FT                   /old_locus_tag="ACL042W"
FT                   /product="ACL042Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YER074W-A (YOS1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL042W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51186"
FT                   /db_xref="GOA:Q75CG1"
FT                   /db_xref="InterPro:IPR013880"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CG1"
FT                   /protein_id="AAS51186.1"
FT   gene            complement(<289647..>291944)
FT                   /locus_tag="AGOS_ACL041C"
FT                   /old_locus_tag="ACL041C"
FT   mRNA            complement(<289647..>291944)
FT                   /locus_tag="AGOS_ACL041C"
FT                   /old_locus_tag="ACL041C"
FT                   /product="ACL041Cp"
FT   CDS_pept        complement(289647..291944)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL041C"
FT                   /old_locus_tag="ACL041C"
FT                   /product="ACL041Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER075C
FT                   (PTP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL041C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51187"
FT                   /db_xref="GOA:Q75CG0"
FT                   /db_xref="InterPro:IPR000242"
FT                   /db_xref="InterPro:IPR000387"
FT                   /db_xref="InterPro:IPR001763"
FT                   /db_xref="InterPro:IPR003595"
FT                   /db_xref="InterPro:IPR016130"
FT                   /db_xref="InterPro:IPR029021"
FT                   /db_xref="InterPro:IPR036873"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CG0"
FT                   /protein_id="AAS51187.2"
FT                   LGNFIRSKITAR"
FT   gene            complement(292553..292625)
FT                   /locus_tag="AGOS_t0049"
FT   tRNA            complement(292553..292625)
FT                   /locus_tag="AGOS_t0049"
FT                   /product="tRNA-Ala"
FT                   /note="codon recognized: GCA"
FT   gene            293221..293294
FT                   /locus_tag="AGOS_t0050"
FT   tRNA            293221..293294
FT                   /locus_tag="AGOS_t0050"
FT                   /product="tRNA-Ile"
FT                   /note="codon recognized: AUU"
FT   gene            complement(<293393..>294421)
FT                   /locus_tag="AGOS_ACL040C"
FT                   /old_locus_tag="ACL040C"
FT   mRNA            complement(<293393..>294421)
FT                   /locus_tag="AGOS_ACL040C"
FT                   /old_locus_tag="ACL040C"
FT                   /product="ACL040Cp"
FT   CDS_pept        complement(293393..294421)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL040C"
FT                   /old_locus_tag="ACL040C"
FT                   /product="ACL040Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL175C
FT                   (AIR2) and YIL079C (AIR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL040C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51188"
FT                   /db_xref="GOA:Q75CF9"
FT                   /db_xref="InterPro:IPR001878"
FT                   /db_xref="InterPro:IPR016713"
FT                   /db_xref="InterPro:IPR036875"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CF9"
FT                   /protein_id="AAS51188.1"
FT                   RR"
FT   gene            <294922..>297096
FT                   /locus_tag="AGOS_ACL039W"
FT                   /old_locus_tag="ACL039W"
FT   mRNA            <294922..>297096
FT                   /locus_tag="AGOS_ACL039W"
FT                   /old_locus_tag="ACL039W"
FT                   /product="ACL039Wp"
FT   CDS_pept        294922..297096
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL039W"
FT                   /old_locus_tag="ACL039W"
FT                   /product="ACL039Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL078W
FT                   (THS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL039W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51189"
FT                   /db_xref="GOA:Q75CF8"
FT                   /db_xref="InterPro:IPR002314"
FT                   /db_xref="InterPro:IPR002320"
FT                   /db_xref="InterPro:IPR004095"
FT                   /db_xref="InterPro:IPR004154"
FT                   /db_xref="InterPro:IPR006195"
FT                   /db_xref="InterPro:IPR012675"
FT                   /db_xref="InterPro:IPR012676"
FT                   /db_xref="InterPro:IPR012947"
FT                   /db_xref="InterPro:IPR018163"
FT                   /db_xref="InterPro:IPR033728"
FT                   /db_xref="InterPro:IPR036621"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CF8"
FT                   /protein_id="AAS51189.1"
FT   gene            complement(<297187..>298167)
FT                   /locus_tag="AGOS_ACL038C"
FT                   /old_locus_tag="ACL038C"
FT   mRNA            complement(<297187..>298167)
FT                   /locus_tag="AGOS_ACL038C"
FT                   /old_locus_tag="ACL038C"
FT                   /product="ACL038Cp"
FT   CDS_pept        complement(297187..298167)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL038C"
FT                   /old_locus_tag="ACL038C"
FT                   /product="ACL038Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YIL077C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL038C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51190"
FT                   /db_xref="InterPro:IPR012470"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CF7"
FT                   /protein_id="AAS51190.1"
FT   gene            <298389..>299252
FT                   /locus_tag="AGOS_ACL037W"
FT                   /old_locus_tag="ACL037W"
FT   mRNA            <298389..>299252
FT                   /locus_tag="AGOS_ACL037W"
FT                   /old_locus_tag="ACL037W"
FT                   /product="ACL037Wp"
FT   CDS_pept        298389..299252
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL037W"
FT                   /old_locus_tag="ACL037W"
FT                   /product="ACL037Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL076W
FT                   (SEC28)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL037W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51191"
FT                   /db_xref="GOA:Q75CF6"
FT                   /db_xref="InterPro:IPR006822"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CF6"
FT                   /protein_id="AAS51191.1"
FT                   SIQDAK"
FT   gene            <299410..>300279
FT                   /locus_tag="AGOS_ACL036W"
FT                   /old_locus_tag="ACL036W"
FT   mRNA            <299410..>300279
FT                   /locus_tag="AGOS_ACL036W"
FT                   /old_locus_tag="ACL036W"
FT                   /product="ACL036Wp"
FT   CDS_pept        299410..300279
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL036W"
FT                   /old_locus_tag="ACL036W"
FT                   /product="ACL036Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER083C
FT                   (GET2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL036W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51192"
FT                   /db_xref="GOA:Q75CF5"
FT                   /db_xref="InterPro:IPR014802"
FT                   /db_xref="InterPro:IPR028143"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CF5"
FT                   /protein_id="AAS51192.1"
FT                   MKYYHAAP"
FT   gene            complement(<300382..>301716)
FT                   /locus_tag="AGOS_ACL035C"
FT                   /old_locus_tag="ACL035C"
FT   mRNA            complement(<300382..>301716)
FT                   /locus_tag="AGOS_ACL035C"
FT                   /old_locus_tag="ACL035C"
FT                   /product="ACL035Cp"
FT   CDS_pept        complement(300382..301716)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL035C"
FT                   /old_locus_tag="ACL035C"
FT                   /product="ACL035Cp"
FT                   /note="NOHBY303; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0C09240g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL035C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51193"
FT                   /db_xref="GOA:Q75CE1"
FT                   /db_xref="InterPro:IPR001295"
FT                   /db_xref="InterPro:IPR005719"
FT                   /db_xref="InterPro:IPR005720"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CE1"
FT                   /protein_id="AAS51193.1"
FT   gene            <302398..>304050
FT                   /locus_tag="AGOS_ACL034W"
FT                   /old_locus_tag="ACL034W"
FT   mRNA            <302398..>304050
FT                   /locus_tag="AGOS_ACL034W"
FT                   /old_locus_tag="ACL034W"
FT                   /product="ACL034Wp"
FT   CDS_pept        302398..304050
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL034W"
FT                   /old_locus_tag="ACL034W"
FT                   /product="ACL034Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER082C
FT                   (UTP7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL034W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51194"
FT                   /db_xref="GOA:Q75CF4"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR012952"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR040315"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CF4"
FT                   /protein_id="AAS51194.1"
FT   gene            complement(<304168..>306960)
FT                   /locus_tag="AGOS_ACL033C"
FT                   /old_locus_tag="ACL033C"
FT   mRNA            complement(<304168..>306960)
FT                   /locus_tag="AGOS_ACL033C"
FT                   /old_locus_tag="ACL033C"
FT                   /product="ACL033Cp"
FT   CDS_pept        complement(304168..306960)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL033C"
FT                   /old_locus_tag="ACL033C"
FT                   /product="ACL033Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL075C
FT                   (RPN2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL033C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51195"
FT                   /db_xref="GOA:Q75CF3"
FT                   /db_xref="InterPro:IPR002015"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR016642"
FT                   /db_xref="InterPro:IPR035266"
FT                   /db_xref="InterPro:IPR040623"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CF3"
FT                   /protein_id="AAS51195.1"
FT                   "
FT   gene            complement(<307190..>308602)
FT                   /locus_tag="AGOS_ACL032C"
FT                   /old_locus_tag="ACL032C"
FT   mRNA            complement(<307190..>308602)
FT                   /locus_tag="AGOS_ACL032C"
FT                   /old_locus_tag="ACL032C"
FT                   /product="ACL032Cp"
FT   CDS_pept        complement(307190..308602)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL032C"
FT                   /old_locus_tag="ACL032C"
FT                   /product="ACL032Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL074C
FT                   (SER33) and YER081W (SER3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL032C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51196"
FT                   /db_xref="GOA:Q75CF2"
FT                   /db_xref="InterPro:IPR002912"
FT                   /db_xref="InterPro:IPR006139"
FT                   /db_xref="InterPro:IPR006140"
FT                   /db_xref="InterPro:IPR029015"
FT                   /db_xref="InterPro:IPR029752"
FT                   /db_xref="InterPro:IPR029753"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CF2"
FT                   /protein_id="AAS51196.1"
FT                   ATEYKISIRLLY"
FT   gene            complement(<309371..>311215)
FT                   /locus_tag="AGOS_ACL031C"
FT                   /old_locus_tag="ACL031C"
FT   mRNA            complement(<309371..>311215)
FT                   /locus_tag="AGOS_ACL031C"
FT                   /old_locus_tag="ACL031C"
FT                   /product="ACL031Cp"
FT   CDS_pept        complement(309371..311215)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL031C"
FT                   /old_locus_tag="ACL031C"
FT                   /product="ACL031Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER080W
FT                   (AIM9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL031C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51197"
FT                   /db_xref="GOA:Q75CE0"
FT                   /db_xref="InterPro:IPR002575"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CE0"
FT                   /protein_id="AAS51197.2"
FT   gene            complement(<311596..>312195)
FT                   /locus_tag="AGOS_ACL030C"
FT                   /old_locus_tag="ACL030C"
FT   mRNA            complement(<311596..>312195)
FT                   /locus_tag="AGOS_ACL030C"
FT                   /old_locus_tag="ACL030C"
FT                   /product="ACL030Cp"
FT   CDS_pept        complement(311596..312195)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL030C"
FT                   /old_locus_tag="ACL030C"
FT                   /product="ACL030Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YER079W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL030C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51198"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CD9"
FT                   /protein_id="AAS51198.2"
FT   gene            <312952..>314694
FT                   /locus_tag="AGOS_ACL029W"
FT                   /old_locus_tag="ACL029W"
FT   mRNA            <312952..>314694
FT                   /locus_tag="AGOS_ACL029W"
FT                   /old_locus_tag="ACL029W"
FT                   /product="ACL029Wp"
FT   CDS_pept        312952..314694
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL029W"
FT                   /old_locus_tag="ACL029W"
FT                   /product="ACL029Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL072W
FT                   (HOP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL029W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51199"
FT                   /db_xref="GOA:Q75CD8"
FT                   /db_xref="InterPro:IPR003511"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR016573"
FT                   /db_xref="InterPro:IPR036570"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CD8"
FT                   /protein_id="AAS51199.1"
FT                   KSAW"
FT   gene            <314891..>316420
FT                   /locus_tag="AGOS_ACL028W"
FT                   /old_locus_tag="ACL028W"
FT   mRNA            <314891..>316420
FT                   /locus_tag="AGOS_ACL028W"
FT                   /old_locus_tag="ACL028W"
FT                   /product="ACL028Wp"
FT   CDS_pept        314891..316420
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL028W"
FT                   /old_locus_tag="ACL028W"
FT                   /product="ACL028Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER078C
FT                   (ICP55)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL028W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51200"
FT                   /db_xref="GOA:Q75CD7"
FT                   /db_xref="InterPro:IPR000994"
FT                   /db_xref="InterPro:IPR001131"
FT                   /db_xref="InterPro:IPR007865"
FT                   /db_xref="InterPro:IPR029149"
FT                   /db_xref="InterPro:IPR036005"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CD7"
FT                   /protein_id="AAS51200.2"
FT   gene            complement(<316466..>317728)
FT                   /locus_tag="AGOS_ACL027C"
FT                   /old_locus_tag="ACL027C"
FT   mRNA            complement(<316466..>317728)
FT                   /locus_tag="AGOS_ACL027C"
FT                   /old_locus_tag="ACL027C"
FT                   /product="ACL027Cp"
FT   CDS_pept        complement(316466..317728)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL027C"
FT                   /old_locus_tag="ACL027C"
FT                   /product="ACL027Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL071C
FT                   (PCI8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL027C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51201"
FT                   /db_xref="GOA:Q75CD6"
FT                   /db_xref="InterPro:IPR000717"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CD6"
FT                   /protein_id="AAS51201.1"
FT   gene            <317891..>319783
FT                   /locus_tag="AGOS_ACL026W"
FT                   /old_locus_tag="ACL026W"
FT   mRNA            <317891..>319783
FT                   /locus_tag="AGOS_ACL026W"
FT                   /old_locus_tag="ACL026W"
FT                   /product="ACL026Wp"
FT   CDS_pept        317891..319783
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL026W"
FT                   /old_locus_tag="ACL026W"
FT                   /product="ACL026Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YER077C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL026W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51202"
FT                   /db_xref="InterPro:IPR002885"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CD5"
FT                   /protein_id="AAS51202.1"
FT   gene            complement(<319938..>320678)
FT                   /locus_tag="AGOS_ACL025C"
FT                   /old_locus_tag="ACL025C"
FT   mRNA            complement(<319938..>320678)
FT                   /locus_tag="AGOS_ACL025C"
FT                   /old_locus_tag="ACL025C"
FT                   /product="ACL025Cp"
FT   CDS_pept        complement(319938..320678)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL025C"
FT                   /old_locus_tag="ACL025C"
FT                   /product="ACL025Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL070C
FT                   (MAM33)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL025C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51203"
FT                   /db_xref="GOA:Q75CD4"
FT                   /db_xref="InterPro:IPR003428"
FT                   /db_xref="InterPro:IPR036561"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CD4"
FT                   /protein_id="AAS51203.2"
FT   gene            <321051..>321434
FT                   /locus_tag="AGOS_ACL024W"
FT                   /old_locus_tag="ACL024W"
FT   mRNA            <321051..>321434
FT                   /locus_tag="AGOS_ACL024W"
FT                   /old_locus_tag="ACL024W"
FT                   /product="ACL024Wp"
FT   CDS_pept        321051..321434
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL024W"
FT                   /old_locus_tag="ACL024W"
FT                   /product="ACL024Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL123W
FT                   (SNA4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL024W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51204"
FT                   /db_xref="GOA:Q75CD3"
FT                   /db_xref="InterPro:IPR000612"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CD3"
FT                   /protein_id="AAS51204.1"
FT   gene            complement(<321528..>323528)
FT                   /locus_tag="AGOS_ACL023C"
FT                   /old_locus_tag="ACL023C"
FT   mRNA            complement(<321528..>323528)
FT                   /locus_tag="AGOS_ACL023C"
FT                   /old_locus_tag="ACL023C"
FT                   /product="ACL023Cp"
FT   CDS_pept        complement(321528..323528)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL023C"
FT                   /old_locus_tag="ACL023C"
FT                   /product="ACL023Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDL176W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL023C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51205"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CD2"
FT                   /protein_id="AAS51205.2"
FT   gene            <323727..>324218
FT                   /locus_tag="AGOS_ACL022W"
FT                   /old_locus_tag="ACL022W"
FT   mRNA            <323727..>324218
FT                   /locus_tag="AGOS_ACL022W"
FT                   /old_locus_tag="ACL022W"
FT                   /product="ACL022Wp"
FT   CDS_pept        323727..324218
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL022W"
FT                   /old_locus_tag="ACL022W"
FT                   /product="ACL022Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDL177C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL022W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51206"
FT                   /db_xref="InterPro:IPR001498"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR020569"
FT                   /db_xref="InterPro:IPR023582"
FT                   /db_xref="InterPro:IPR036956"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CD1"
FT                   /protein_id="AAS51206.1"
FT                   "
FT   gene            complement(<324259..>325863)
FT                   /locus_tag="AGOS_ACL021C"
FT                   /old_locus_tag="ACL021C"
FT   mRNA            complement(<324259..>325863)
FT                   /locus_tag="AGOS_ACL021C"
FT                   /old_locus_tag="ACL021C"
FT                   /product="ACL021Cp"
FT   CDS_pept        complement(324259..325863)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL021C"
FT                   /old_locus_tag="ACL021C"
FT                   /product="ACL021Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL178W
FT                   (DLD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL021C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51207"
FT                   /db_xref="GOA:Q75CD0"
FT                   /db_xref="InterPro:IPR004113"
FT                   /db_xref="InterPro:IPR006094"
FT                   /db_xref="InterPro:IPR016164"
FT                   /db_xref="InterPro:IPR016166"
FT                   /db_xref="InterPro:IPR016167"
FT                   /db_xref="InterPro:IPR016169"
FT                   /db_xref="InterPro:IPR016171"
FT                   /db_xref="InterPro:IPR036318"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CD0"
FT                   /protein_id="AAS51207.1"
FT                   IKHHYDPNAILNPYKYV"
FT   gene            <326404..>327888
FT                   /locus_tag="AGOS_ACL020W"
FT                   /old_locus_tag="ACL020W"
FT   mRNA            <326404..>327888
FT                   /locus_tag="AGOS_ACL020W"
FT                   /old_locus_tag="ACL020W"
FT                   /product="ACL020Wp"
FT   CDS_pept        326404..327888
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL020W"
FT                   /old_locus_tag="ACL020W"
FT                   /product="ACL020Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YML043C (RRN11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL020W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51208"
FT                   /db_xref="GOA:Q75CC9"
FT                   /db_xref="InterPro:IPR007224"
FT                   /db_xref="InterPro:IPR016850"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CC9"
FT                   /protein_id="AAS51208.2"
FT   gene            complement(<328045..>329772)
FT                   /locus_tag="AGOS_ACL019C"
FT                   /old_locus_tag="ACL019C"
FT   mRNA            complement(<328045..>329772)
FT                   /locus_tag="AGOS_ACL019C"
FT                   /old_locus_tag="ACL019C"
FT                   /product="ACL019Cp"
FT   CDS_pept        complement(328045..329772)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL019C"
FT                   /old_locus_tag="ACL019C"
FT                   /product="ACL019Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL013C
FT                   (HRD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL019C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51209"
FT                   /db_xref="GOA:Q75CC8"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CC8"
FT                   /protein_id="AAS51209.2"
FT   gene            <329991..>330395
FT                   /locus_tag="AGOS_ACL018W"
FT                   /old_locus_tag="ACL018W"
FT   mRNA            <329991..>330395
FT                   /locus_tag="AGOS_ACL018W"
FT                   /old_locus_tag="ACL018W"
FT                   /product="ACL018Wp"
FT   CDS_pept        329991..330395
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL018W"
FT                   /old_locus_tag="ACL018W"
FT                   /product="ACL018Wp"
FT                   /note="NOHBY302; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0C05896g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL018W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51210"
FT                   /db_xref="GOA:Q75CC7"
FT                   /db_xref="InterPro:IPR010754"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CC7"
FT                   /protein_id="AAS51210.1"
FT   gene            complement(<330556..>330957)
FT                   /locus_tag="AGOS_ACL017C"
FT                   /old_locus_tag="ACL017C"
FT   mRNA            complement(<330556..>330957)
FT                   /locus_tag="AGOS_ACL017C"
FT                   /old_locus_tag="ACL017C"
FT                   /product="ACL017Cp"
FT   CDS_pept        complement(330556..330957)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL017C"
FT                   /old_locus_tag="ACL017C"
FT                   /product="ACL017Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL012C
FT                   (HTZ1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL017C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51211"
FT                   /db_xref="GOA:Q75CC6"
FT                   /db_xref="InterPro:IPR002119"
FT                   /db_xref="InterPro:IPR007125"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="InterPro:IPR032454"
FT                   /db_xref="InterPro:IPR032458"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CC6"
FT                   /protein_id="AAS51211.1"
FT   gene            complement(<331299..>332384)
FT                   /locus_tag="AGOS_ACL016C"
FT                   /old_locus_tag="ACL016C"
FT   mRNA            complement(<331299..>332384)
FT                   /locus_tag="AGOS_ACL016C"
FT                   /old_locus_tag="ACL016C"
FT                   /product="ACL016Cp"
FT   CDS_pept        complement(331299..332384)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL016C"
FT                   /old_locus_tag="ACL016C"
FT                   /product="ACL016Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR005W
FT                   (TAF4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL016C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51212"
FT                   /db_xref="GOA:Q75CC5"
FT                   /db_xref="InterPro:IPR007900"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CC5"
FT                   /protein_id="AAS51212.1"
FT   gene            <332684..>333772
FT                   /locus_tag="AGOS_ACL015W"
FT                   /old_locus_tag="ACL015W"
FT   mRNA            <332684..>333772
FT                   /locus_tag="AGOS_ACL015W"
FT                   /old_locus_tag="ACL015W"
FT                   /product="ACL015Wp"
FT   CDS_pept        332684..333772
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL015W"
FT                   /old_locus_tag="ACL015W"
FT                   /product="ACL015Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL010W
FT                   (RCL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL015W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51213"
FT                   /db_xref="GOA:Q75CC4"
FT                   /db_xref="InterPro:IPR000228"
FT                   /db_xref="InterPro:IPR013791"
FT                   /db_xref="InterPro:IPR013792"
FT                   /db_xref="InterPro:IPR016443"
FT                   /db_xref="InterPro:IPR020719"
FT                   /db_xref="InterPro:IPR023797"
FT                   /db_xref="InterPro:IPR036553"
FT                   /db_xref="InterPro:IPR037136"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CC4"
FT                   /protein_id="AAS51213.1"
FT   gene            complement(<333901..>335472)
FT                   /locus_tag="AGOS_ACL014C"
FT                   /old_locus_tag="ACL014C"
FT   mRNA            complement(<333901..>335472)
FT                   /locus_tag="AGOS_ACL014C"
FT                   /old_locus_tag="ACL014C"
FT                   /product="ACL014Cp"
FT   CDS_pept        complement(333901..335472)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL014C"
FT                   /old_locus_tag="ACL014C"
FT                   /product="ACL014Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR004W
FT                   (MVP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL014C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51214"
FT                   /db_xref="GOA:Q75CC3"
FT                   /db_xref="InterPro:IPR001683"
FT                   /db_xref="InterPro:IPR027267"
FT                   /db_xref="InterPro:IPR028662"
FT                   /db_xref="InterPro:IPR035704"
FT                   /db_xref="InterPro:IPR036871"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CC3"
FT                   /protein_id="AAS51214.2"
FT                   MPLSRS"
FT   gene            complement(<335715..>336509)
FT                   /locus_tag="AGOS_ACL013C"
FT                   /old_locus_tag="ACL013C"
FT   mRNA            complement(<335715..>336509)
FT                   /locus_tag="AGOS_ACL013C"
FT                   /old_locus_tag="ACL013C"
FT                   /product="ACL013Cp"
FT   CDS_pept        complement(335715..336509)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL013C"
FT                   /old_locus_tag="ACL013C"
FT                   /product="ACL013Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL009C
FT                   (MDM12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL013C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51215"
FT                   /db_xref="GOA:Q75CC2"
FT                   /db_xref="InterPro:IPR019411"
FT                   /db_xref="InterPro:IPR027532"
FT                   /db_xref="InterPro:IPR031468"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CC2"
FT                   /protein_id="AAS51215.2"
FT   gene            <336672..>337286
FT                   /locus_tag="AGOS_ACL012W"
FT                   /old_locus_tag="ACL012W"
FT   mRNA            <336672..>337286
FT                   /locus_tag="AGOS_ACL012W"
FT                   /old_locus_tag="ACL012W"
FT                   /product="ACL012Wp"
FT   CDS_pept        336672..337286
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL012W"
FT                   /old_locus_tag="ACL012W"
FT                   /product="ACL012Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL008W
FT                   (COQ10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL012W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51216"
FT                   /db_xref="GOA:Q75CC1"
FT                   /db_xref="InterPro:IPR005031"
FT                   /db_xref="InterPro:IPR023393"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CC1"
FT                   /protein_id="AAS51216.1"
FT   gene            complement(<337455..>338300)
FT                   /locus_tag="AGOS_ACL011C"
FT                   /old_locus_tag="ACL011C"
FT   mRNA            complement(<337455..>338300)
FT                   /locus_tag="AGOS_ACL011C"
FT                   /old_locus_tag="ACL011C"
FT                   /product="ACL011Cp"
FT   CDS_pept        complement(337455..338300)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL011C"
FT                   /old_locus_tag="ACL011C"
FT                   /product="ACL011Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR003W
FT                   (AIM34)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL011C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51217"
FT                   /db_xref="GOA:Q75CC0"
FT                   /db_xref="InterPro:IPR003034"
FT                   /db_xref="InterPro:IPR036361"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CC0"
FT                   /protein_id="AAS51217.1"
FT                   "
FT   gene            complement(<338687..>339136)
FT                   /locus_tag="AGOS_ACL010C"
FT                   /old_locus_tag="ACL010C"
FT   mRNA            complement(<338687..>339136)
FT                   /locus_tag="AGOS_ACL010C"
FT                   /old_locus_tag="ACL010C"
FT                   /product="ACL010Cp"
FT   CDS_pept        complement(338687..339136)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL010C"
FT                   /old_locus_tag="ACL010C"
FT                   /product="ACL010Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR002W
FT                   (MIC17)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL010C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51218"
FT                   /db_xref="GOA:Q75CB9"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CB9"
FT                   /protein_id="AAS51218.2"
FT   gene            complement(<339551..>340516)
FT                   /locus_tag="AGOS_ACL009C"
FT                   /old_locus_tag="ACL009C"
FT   mRNA            complement(<339551..>340516)
FT                   /locus_tag="AGOS_ACL009C"
FT                   /old_locus_tag="ACL009C"
FT                   /product="ACL009Cp"
FT   CDS_pept        complement(339551..340516)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL009C"
FT                   /old_locus_tag="ACL009C"
FT                   /product="ACL009Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL007C
FT                   (CSI2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL009C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51219"
FT                   /db_xref="GOA:Q75CB8"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CB8"
FT                   /protein_id="AAS51219.1"
FT   gene            complement(<341154..>343352)
FT                   /locus_tag="AGOS_ACL008C"
FT                   /old_locus_tag="ACL008C"
FT   mRNA            complement(<341154..>343352)
FT                   /locus_tag="AGOS_ACL008C"
FT                   /old_locus_tag="ACL008C"
FT                   /product="ACL008Cp"
FT   CDS_pept        complement(341154..343352)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL008C"
FT                   /old_locus_tag="ACL008C"
FT                   /product="ACL008Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL006C
FT                   (TOP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL008C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51220"
FT                   /db_xref="GOA:Q75CB7"
FT                   /db_xref="InterPro:IPR001631"
FT                   /db_xref="InterPro:IPR008336"
FT                   /db_xref="InterPro:IPR011010"
FT                   /db_xref="InterPro:IPR013030"
FT                   /db_xref="InterPro:IPR013034"
FT                   /db_xref="InterPro:IPR013499"
FT                   /db_xref="InterPro:IPR013500"
FT                   /db_xref="InterPro:IPR014711"
FT                   /db_xref="InterPro:IPR014727"
FT                   /db_xref="InterPro:IPR018521"
FT                   /db_xref="InterPro:IPR025834"
FT                   /db_xref="InterPro:IPR036202"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CB7"
FT                   /protein_id="AAS51220.2"
FT   gene            complement(<343662..>344261)
FT                   /locus_tag="AGOS_ACL007C"
FT                   /old_locus_tag="ACL007C"
FT   mRNA            complement(<343662..>344261)
FT                   /locus_tag="AGOS_ACL007C"
FT                   /old_locus_tag="ACL007C"
FT                   /product="ACL007Cp"
FT   CDS_pept        complement(343662..344261)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL007C"
FT                   /old_locus_tag="ACL007C"
FT                   /product="ACL007Cp"
FT                   /note="NOHBY301; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL007C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51221"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CB6"
FT                   /protein_id="AAS51221.2"
FT   gene            <344392..>346521
FT                   /locus_tag="AGOS_ACL006W"
FT                   /old_locus_tag="ACL006W"
FT   mRNA            <344392..>346521
FT                   /locus_tag="AGOS_ACL006W"
FT                   /old_locus_tag="ACL006W"
FT                   /product="ACL006Wp"
FT   CDS_pept        344392..346521
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL006W"
FT                   /old_locus_tag="ACL006W"
FT                   /product="ACL006Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR001C
FT                   (CDC5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL006W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51222"
FT                   /db_xref="GOA:Q75CB5"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR000959"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR033695"
FT                   /db_xref="InterPro:IPR033701"
FT                   /db_xref="InterPro:IPR036947"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CB5"
FT                   /protein_id="AAS51222.2"
FT                   EGLKQKSAIVSVAQQ"
FT   gene            complement(<346569..>346937)
FT                   /locus_tag="AGOS_ACL005C"
FT                   /old_locus_tag="ACL005C"
FT   mRNA            complement(<346569..>346937)
FT                   /locus_tag="AGOS_ACL005C"
FT                   /old_locus_tag="ACL005C"
FT                   /product="ACL005Cp"
FT   CDS_pept        complement(346569..346937)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL005C"
FT                   /old_locus_tag="ACL005C"
FT                   /product="ACL005Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL005C
FT                   (RPB11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL005C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51223"
FT                   /db_xref="GOA:Q75CF1"
FT                   /db_xref="InterPro:IPR008193"
FT                   /db_xref="InterPro:IPR009025"
FT                   /db_xref="InterPro:IPR036603"
FT                   /db_xref="InterPro:IPR037685"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CF1"
FT                   /protein_id="AAS51223.1"
FT                   FETEWNLQTLASEDQFRL"
FT   gene            <347726..>351859
FT                   /locus_tag="AGOS_ACL004W"
FT                   /old_locus_tag="ACL004W"
FT   mRNA            <347726..>351859
FT                   /locus_tag="AGOS_ACL004W"
FT                   /old_locus_tag="ACL004W"
FT                   /product="ACL004Wp"
FT   CDS_pept        347726..351859
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL004W"
FT                   /old_locus_tag="ACL004W"
FT                   /product="ACL004Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL004W
FT                   (SIN3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL004W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51224"
FT                   /db_xref="GOA:Q75CF0"
FT                   /db_xref="InterPro:IPR003822"
FT                   /db_xref="InterPro:IPR013194"
FT                   /db_xref="InterPro:IPR031693"
FT                   /db_xref="InterPro:IPR036600"
FT                   /db_xref="InterPro:IPR039774"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CF0"
FT                   /protein_id="AAS51224.1"
FT   gene            complement(<352023..>353150)
FT                   /locus_tag="AGOS_ACL003C"
FT                   /old_locus_tag="ACL003C"
FT   mRNA            complement(<352023..>353150)
FT                   /locus_tag="AGOS_ACL003C"
FT                   /old_locus_tag="ACL003C"
FT                   /product="ACL003Cp"
FT   CDS_pept        complement(352023..353150)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL003C"
FT                   /old_locus_tag="ACL003C"
FT                   /product="ACL003Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL003C
FT                   (PFA4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL003C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51225"
FT                   /db_xref="GOA:Q75CB4"
FT                   /db_xref="InterPro:IPR001594"
FT                   /db_xref="InterPro:IPR033682"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CB4"
FT                   /protein_id="AAS51225.2"
FT   gene            complement(<353448..>354437)
FT                   /locus_tag="AGOS_ACL002C"
FT                   /old_locus_tag="ACL002C"
FT   mRNA            complement(<353448..>354437)
FT                   /locus_tag="AGOS_ACL002C"
FT                   /old_locus_tag="ACL002C"
FT                   /product="ACL002Cp"
FT   CDS_pept        complement(353448..354437)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL002C"
FT                   /old_locus_tag="ACL002C"
FT                   /product="ACL002Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL002C
FT                   (IZH2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL002C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51226"
FT                   /db_xref="GOA:Q75CB3"
FT                   /db_xref="InterPro:IPR004254"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CB3"
FT                   /protein_id="AAS51226.2"
FT   gene            complement(<354803..>357040)
FT                   /locus_tag="AGOS_ACL001C"
FT                   /old_locus_tag="ACL001C"
FT   mRNA            complement(<354803..>357040)
FT                   /locus_tag="AGOS_ACL001C"
FT                   /old_locus_tag="ACL001C"
FT                   /product="ACL001Cp"
FT   CDS_pept        complement(354803..357040)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACL001C"
FT                   /old_locus_tag="ACL001C"
FT                   /product="ACL001Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR001W
FT                   (RRP6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACL001C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51227"
FT                   /db_xref="GOA:Q75CB2"
FT                   /db_xref="InterPro:IPR002121"
FT                   /db_xref="InterPro:IPR002562"
FT                   /db_xref="InterPro:IPR010997"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR012588"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CB2"
FT                   /protein_id="AAS51227.2"
FT   centromere      357359..357549
FT                   /note="Chromosome III centromere"
FT   centromere      357359..357366
FT                   /note="Chromosome III centromere CDE I element"
FT   centromere      357367..357532
FT                   /note="Chromosome III centromere CDE II element"
FT   centromere      357533..357549
FT                   /note="Chromosome III centromere CDE III element"
FT   gene            complement(<357961..>359001)
FT                   /locus_tag="AGOS_ACR001C"
FT                   /old_locus_tag="ACR001C"
FT   mRNA            complement(<357961..>359001)
FT                   /locus_tag="AGOS_ACR001C"
FT                   /old_locus_tag="ACR001C"
FT                   /product="ACR001Cp"
FT   CDS_pept        complement(357961..359001)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR001C"
FT                   /old_locus_tag="ACR001C"
FT                   /product="ACR001Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL001W
FT                   (PHO80)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR001C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51228"
FT                   /db_xref="GOA:Q75CB1"
FT                   /db_xref="InterPro:IPR013922"
FT                   /db_xref="InterPro:IPR036915"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CB1"
FT                   /protein_id="AAS51228.1"
FT                   SPREIV"
FT   gene            complement(<359133..>359633)
FT                   /locus_tag="AGOS_ACR002C"
FT                   /old_locus_tag="ACR002C"
FT   mRNA            complement(<359133..>359633)
FT                   /locus_tag="AGOS_ACR002C"
FT                   /old_locus_tag="ACR002C"
FT                   /product="ACR002Cp"
FT   CDS_pept        complement(359133..359633)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR002C"
FT                   /old_locus_tag="ACR002C"
FT                   /product="ACR002Cp"
FT                   /note="NOHBY316; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR002C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51229"
FT                   /db_xref="GOA:Q75CB0"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CB0"
FT                   /protein_id="AAS51229.1"
FT                   TVP"
FT   gene            complement(<359761..>360387)
FT                   /locus_tag="AGOS_ACR003C"
FT                   /old_locus_tag="ACR003C"
FT   mRNA            complement(<359761..>360387)
FT                   /locus_tag="AGOS_ACR003C"
FT                   /old_locus_tag="ACR003C"
FT                   /product="ACR003Cp"
FT   CDS_pept        complement(359761..360387)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR003C"
FT                   /old_locus_tag="ACR003C"
FT                   /product="ACR003Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML001W
FT                   (YPT7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR003C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51230"
FT                   /db_xref="GOA:Q75CA9"
FT                   /db_xref="InterPro:IPR001806"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CA9"
FT                   /protein_id="AAS51230.1"
FT   gene            <360903..>362594
FT                   /locus_tag="AGOS_ACR004W"
FT                   /old_locus_tag="ACR004W"
FT   mRNA            <360903..>362594
FT                   /locus_tag="AGOS_ACR004W"
FT                   /old_locus_tag="ACR004W"
FT                   /product="ACR004Wp"
FT   CDS_pept        360903..362594
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR004W"
FT                   /old_locus_tag="ACR004W"
FT                   /product="ACR004Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR002W
FT                   (ALG6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR004W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51231"
FT                   /db_xref="GOA:Q75CA8"
FT                   /db_xref="InterPro:IPR004856"
FT                   /db_xref="InterPro:IPR039488"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CA8"
FT                   /protein_id="AAS51231.1"
FT   gene            363106..363195
FT                   /locus_tag="AGOS_t0051"
FT   tRNA            join(363106..363142,363160..363195)
FT                   /locus_tag="AGOS_t0051"
FT                   /product="tRNA-Arg"
FT                   /note="codon recognized: CGU"
FT   gene            <363354..>364337
FT                   /locus_tag="AGOS_ACR005W"
FT                   /old_locus_tag="ACR005W"
FT   mRNA            <363354..>364337
FT                   /locus_tag="AGOS_ACR005W"
FT                   /old_locus_tag="ACR005W"
FT                   /product="ACR005Wp"
FT   CDS_pept        363354..364337
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR005W"
FT                   /old_locus_tag="ACR005W"
FT                   /product="ACR005Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR007C
FT                   (SGT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR005W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51232"
FT                   /db_xref="GOA:Q75CA7"
FT                   /db_xref="InterPro:IPR006636"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="InterPro:IPR013105"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="InterPro:IPR032374"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CA7"
FT                   /protein_id="AAS51232.1"
FT   gene            complement(<364435..>367650)
FT                   /locus_tag="AGOS_ACR006C"
FT                   /old_locus_tag="ACR006C"
FT   mRNA            complement(<364435..>367650)
FT                   /locus_tag="AGOS_ACR006C"
FT                   /old_locus_tag="ACR006C"
FT                   /product="ACR006Cp"
FT   CDS_pept        complement(364435..367650)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR006C"
FT                   /old_locus_tag="ACR006C"
FT                   /product="ACR006Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML002W
FT                   and YML003W; YML002W and YML003W represent one ORF in this
FT                   genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR006C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51233"
FT                   /db_xref="GOA:Q75CA6"
FT                   /db_xref="InterPro:IPR003123"
FT                   /db_xref="InterPro:IPR036770"
FT                   /db_xref="InterPro:IPR037191"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CA6"
FT                   /protein_id="AAS51233.1"
FT   gene            <367874..>368815
FT                   /locus_tag="AGOS_ACR007W"
FT                   /old_locus_tag="ACR007W"
FT   mRNA            <367874..>368815
FT                   /locus_tag="AGOS_ACR007W"
FT                   /old_locus_tag="ACR007W"
FT                   /product="ACR007Wp"
FT   CDS_pept        367874..368815
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR007W"
FT                   /old_locus_tag="ACR007W"
FT                   /product="ACR007Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR006C
FT                   (TSR3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR007W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51234"
FT                   /db_xref="GOA:Q75CA5"
FT                   /db_xref="InterPro:IPR007177"
FT                   /db_xref="InterPro:IPR007209"
FT                   /db_xref="InterPro:IPR022968"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CA5"
FT                   /protein_id="AAS51234.1"
FT   gene            <368912..>371857
FT                   /locus_tag="AGOS_ACR008W"
FT                   /old_locus_tag="ACR008W"
FT   mRNA            <368912..>371857
FT                   /locus_tag="AGOS_ACR008W"
FT                   /old_locus_tag="ACR008W"
FT                   /product="ACR008Wp"
FT   CDS_pept        368912..371857
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR008W"
FT                   /old_locus_tag="ACR008W"
FT                   /product="ACR008Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR005C
FT                   (DNL4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR008W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51235"
FT                   /db_xref="GOA:Q75CA4"
FT                   /db_xref="InterPro:IPR000977"
FT                   /db_xref="InterPro:IPR001357"
FT                   /db_xref="InterPro:IPR012308"
FT                   /db_xref="InterPro:IPR012309"
FT                   /db_xref="InterPro:IPR012310"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR016059"
FT                   /db_xref="InterPro:IPR029710"
FT                   /db_xref="InterPro:IPR036420"
FT                   /db_xref="InterPro:IPR036599"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75CA4"
FT                   /protein_id="AAS51235.1"
FT   gene            <371963..>374005
FT                   /locus_tag="AGOS_ACR009W"
FT                   /old_locus_tag="ACR009W"
FT   mRNA            <371963..>374005
FT                   /locus_tag="AGOS_ACR009W"
FT                   /old_locus_tag="ACR009W"
FT                   /product="ACR009Wp"
FT   CDS_pept        371963..374005
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR009W"
FT                   /old_locus_tag="ACR009W"
FT                   /product="ACR009Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL062W
FT                   (NPR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR009W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51236"
FT                   /db_xref="GOA:Q75CA3"
FT                   /db_xref="InterPro:IPR009348"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CA3"
FT                   /protein_id="AAS51236.1"
FT   gene            complement(<374084..>376921)
FT                   /locus_tag="AGOS_ACR010C"
FT                   /old_locus_tag="ACR010C"
FT   mRNA            complement(<374084..>376921)
FT                   /locus_tag="AGOS_ACR010C"
FT                   /old_locus_tag="ACR010C"
FT                   /product="ACR010Cp"
FT   CDS_pept        complement(374084..376921)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR010C"
FT                   /old_locus_tag="ACR010C"
FT                   /product="ACR010Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL061C
FT                   (CIN8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR010C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51237"
FT                   /db_xref="GOA:Q8J1G7"
FT                   /db_xref="InterPro:IPR001752"
FT                   /db_xref="InterPro:IPR019821"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR027640"
FT                   /db_xref="InterPro:IPR036961"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8J1G7"
FT                   /protein_id="AAS51237.1"
FT                   TIEFGAEGPPTKKVR"
FT   gene            complement(<377333..>378094)
FT                   /locus_tag="AGOS_ACR011C"
FT                   /old_locus_tag="ACR011C"
FT   mRNA            complement(<377333..>378094)
FT                   /locus_tag="AGOS_ACR011C"
FT                   /old_locus_tag="ACR011C"
FT                   /product="ACR011Cp"
FT   CDS_pept        complement(377333..378094)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR011C"
FT                   /old_locus_tag="ACR011C"
FT                   /product="ACR011Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR004W
FT                   (UTP23)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR011C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51238"
FT                   /db_xref="GOA:Q75CA1"
FT                   /db_xref="InterPro:IPR006984"
FT                   /db_xref="InterPro:IPR029060"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CA1"
FT                   /protein_id="AAS51238.1"
FT   gene            complement(<378749..>380374)
FT                   /locus_tag="AGOS_ACR012C"
FT                   /old_locus_tag="ACR012C"
FT   mRNA            complement(<378749..>380374)
FT                   /locus_tag="AGOS_ACR012C"
FT                   /old_locus_tag="ACR012C"
FT                   /product="ACR012Cp"
FT   CDS_pept        complement(378749..380374)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR012C"
FT                   /old_locus_tag="ACR012C"
FT                   /product="ACR012Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL060C
FT                   (PRB1) and YOR003W (YSP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR012C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51239"
FT                   /db_xref="GOA:Q75CA0"
FT                   /db_xref="InterPro:IPR000209"
FT                   /db_xref="InterPro:IPR010259"
FT                   /db_xref="InterPro:IPR015500"
FT                   /db_xref="InterPro:IPR022398"
FT                   /db_xref="InterPro:IPR023827"
FT                   /db_xref="InterPro:IPR023828"
FT                   /db_xref="InterPro:IPR034193"
FT                   /db_xref="InterPro:IPR036852"
FT                   /db_xref="InterPro:IPR037045"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CA0"
FT                   /protein_id="AAS51239.1"
FT   gene            complement(<381118..>382584)
FT                   /locus_tag="AGOS_ACR013C"
FT                   /old_locus_tag="ACR013C"
FT   mRNA            complement(<381118..>382584)
FT                   /locus_tag="AGOS_ACR013C"
FT                   /old_locus_tag="ACR013C"
FT                   /product="ACR013Cp"
FT   CDS_pept        complement(381118..382584)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR013C"
FT                   /old_locus_tag="ACR013C"
FT                   /product="ACR013Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL262W
FT                   (FUM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR013C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51240"
FT                   /db_xref="GOA:Q75CE3"
FT                   /db_xref="InterPro:IPR000362"
FT                   /db_xref="InterPro:IPR005677"
FT                   /db_xref="InterPro:IPR008948"
FT                   /db_xref="InterPro:IPR018951"
FT                   /db_xref="InterPro:IPR020557"
FT                   /db_xref="InterPro:IPR022761"
FT                   /db_xref="InterPro:IPR024083"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CE3"
FT                   /protein_id="AAS51240.2"
FT   gene            complement(<382775..>382987)
FT                   /locus_tag="AGOS_ACR014C"
FT                   /old_locus_tag="ACR014C"
FT   mRNA            complement(<382775..>382987)
FT                   /locus_tag="AGOS_ACR014C"
FT                   /old_locus_tag="ACR014C"
FT                   /product="ACR014Cp"
FT   CDS_pept        complement(382775..382987)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR014C"
FT                   /old_locus_tag="ACR014C"
FT                   /product="ACR014Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YEL059C-A (SOM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR014C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51241"
FT                   /db_xref="GOA:Q75CE6"
FT                   /db_xref="InterPro:IPR024645"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CE6"
FT                   /protein_id="AAS51241.1"
FT   gene            <383129..>384787
FT                   /locus_tag="AGOS_ACR015W"
FT                   /old_locus_tag="ACR015W"
FT   mRNA            <383129..>384787
FT                   /locus_tag="AGOS_ACR015W"
FT                   /old_locus_tag="ACR015W"
FT                   /product="ACR015Wp"
FT   CDS_pept        383129..384787
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR015W"
FT                   /old_locus_tag="ACR015W"
FT                   /product="ACR015Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL058W
FT                   (PCM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR015W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51242"
FT                   /db_xref="GOA:Q75CE5"
FT                   /db_xref="InterPro:IPR005843"
FT                   /db_xref="InterPro:IPR005844"
FT                   /db_xref="InterPro:IPR016055"
FT                   /db_xref="InterPro:IPR016066"
FT                   /db_xref="InterPro:IPR016657"
FT                   /db_xref="InterPro:IPR036900"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CE5"
FT                   /protein_id="AAS51242.1"
FT   gene            <384966..>386888
FT                   /locus_tag="AGOS_ACR016W"
FT                   /old_locus_tag="ACR016W"
FT   mRNA            <384966..>386888
FT                   /locus_tag="AGOS_ACR016W"
FT                   /old_locus_tag="ACR016W"
FT                   /product="ACR016Wp"
FT   CDS_pept        384966..386888
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR016W"
FT                   /old_locus_tag="ACR016W"
FT                   /product="ACR016Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL263C
FT                   (KEL3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR016W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51243"
FT                   /db_xref="InterPro:IPR015915"
FT                   /db_xref="InterPro:IPR025183"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CE4"
FT                   /protein_id="AAS51243.1"
FT                   PTKRR"
FT   gene            <387121..>388392
FT                   /locus_tag="AGOS_ACR017W"
FT                   /old_locus_tag="ACR017W"
FT   mRNA            <387121..>388392
FT                   /locus_tag="AGOS_ACR017W"
FT                   /old_locus_tag="ACR017W"
FT                   /product="ACR017Wp"
FT   CDS_pept        387121..388392
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR017W"
FT                   /old_locus_tag="ACR017W"
FT                   /product="ACR017Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL056W
FT                   (HAT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR017W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51244"
FT                   /db_xref="GOA:Q75C99"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR022052"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C99"
FT                   /protein_id="AAS51244.1"
FT   gene            complement(<388481..>389968)
FT                   /locus_tag="AGOS_ACR018C"
FT                   /old_locus_tag="ACR018C"
FT   mRNA            complement(<388481..>389968)
FT                   /locus_tag="AGOS_ACR018C"
FT                   /old_locus_tag="ACR018C"
FT                   /product="ACR018Cp"
FT   CDS_pept        complement(388481..389968)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR018C"
FT                   /old_locus_tag="ACR018C"
FT                   /product="ACR018Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL272C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR018C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51245"
FT                   /db_xref="GOA:Q75C98"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C98"
FT                   /protein_id="AAS51245.2"
FT   gene            <390550..>391416
FT                   /locus_tag="AGOS_ACR019W"
FT                   /old_locus_tag="ACR019W"
FT   mRNA            <390550..>391416
FT                   /locus_tag="AGOS_ACR019W"
FT                   /old_locus_tag="ACR019W"
FT                   /product="ACR019Wp"
FT   CDS_pept        390550..391416
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR019W"
FT                   /old_locus_tag="ACR019W"
FT                   /product="ACR019Wp"
FT                   /note="NOHBY317; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR019W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51246"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C97"
FT                   /protein_id="AAS51246.1"
FT                   PSCFDEK"
FT   gene            complement(<391571..>394579)
FT                   /locus_tag="AGOS_ACR020C"
FT                   /old_locus_tag="ACR020C"
FT   mRNA            complement(<391571..>394579)
FT                   /locus_tag="AGOS_ACR020C"
FT                   /old_locus_tag="ACR020C"
FT                   /product="ACR020Cp"
FT   CDS_pept        complement(391571..394579)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR020C"
FT                   /old_locus_tag="ACR020C"
FT                   /product="ACR020Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL055C
FT                   (POL5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR020C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51247"
FT                   /db_xref="GOA:Q75C96"
FT                   /db_xref="InterPro:IPR007015"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C96"
FT                   /protein_id="AAS51247.1"
FT                   DFINWLASKKSKN"
FT   gene            <394892..>395080
FT                   /locus_tag="AGOS_ACR021W"
FT                   /old_locus_tag="ACR021W"
FT   mRNA            <394892..>395080
FT                   /locus_tag="AGOS_ACR021W"
FT                   /old_locus_tag="ACR021W"
FT                   /product="ACR021Wp"
FT   CDS_pept        394892..395080
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR021W"
FT                   /old_locus_tag="ACR021W"
FT                   /product="ACR021Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL271W
FT                   (ATP15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR021W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51248"
FT                   /db_xref="GOA:Q75C95"
FT                   /db_xref="InterPro:IPR006721"
FT                   /db_xref="InterPro:IPR036742"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C95"
FT                   /protein_id="AAS51248.1"
FT                   IDYASKGSAAEAVPLRK"
FT   gene            <395425..>397689
FT                   /locus_tag="AGOS_ACR022W"
FT                   /old_locus_tag="ACR022W"
FT   mRNA            <395425..>397689
FT                   /locus_tag="AGOS_ACR022W"
FT                   /old_locus_tag="ACR022W"
FT                   /product="ACR022Wp"
FT   CDS_pept        395425..397689
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR022W"
FT                   /old_locus_tag="ACR022W"
FT                   /product="ACR022Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL270W
FT                   (MDL2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR022W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51249"
FT                   /db_xref="GOA:Q75C94"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR011527"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR030279"
FT                   /db_xref="InterPro:IPR036640"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C94"
FT                   /protein_id="AAS51249.2"
FT                   P"
FT   gene            <397968..>400277
FT                   /locus_tag="AGOS_ACR023W"
FT                   /old_locus_tag="ACR023W"
FT   mRNA            <397968..>400277
FT                   /locus_tag="AGOS_ACR023W"
FT                   /old_locus_tag="ACR023W"
FT                   /product="ACR023Wp"
FT   CDS_pept        397968..400277
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR023W"
FT                   /old_locus_tag="ACR023W"
FT                   /product="ACR023Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL269W
FT                   (KAR9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR023W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51250"
FT                   /db_xref="GOA:Q75C93"
FT                   /db_xref="InterPro:IPR013889"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C93"
FT                   /protein_id="AAS51250.1"
FT                   SRLKEPTPLADLLNLS"
FT   gene            <400379..>403012
FT                   /locus_tag="AGOS_ACR024W"
FT                   /old_locus_tag="ACR024W"
FT   mRNA            <400379..>403012
FT                   /locus_tag="AGOS_ACR024W"
FT                   /old_locus_tag="ACR024W"
FT                   /product="ACR024Wp"
FT   CDS_pept        400379..403012
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR024W"
FT                   /old_locus_tag="ACR024W"
FT                   /product="ACR024Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL268W
FT                   (PLC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR024W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51251"
FT                   /db_xref="GOA:Q75C92"
FT                   /db_xref="InterPro:IPR000008"
FT                   /db_xref="InterPro:IPR000909"
FT                   /db_xref="InterPro:IPR001192"
FT                   /db_xref="InterPro:IPR001711"
FT                   /db_xref="InterPro:IPR002048"
FT                   /db_xref="InterPro:IPR011992"
FT                   /db_xref="InterPro:IPR015359"
FT                   /db_xref="InterPro:IPR017946"
FT                   /db_xref="InterPro:IPR018247"
FT                   /db_xref="InterPro:IPR035892"
FT                   /db_xref="InterPro:IPR037755"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C92"
FT                   /protein_id="AAS51251.1"
FT                   IVRSLF"
FT   gene            <403211..>403834
FT                   /locus_tag="AGOS_ACR025W"
FT                   /old_locus_tag="ACR025W"
FT   mRNA            <403211..>403834
FT                   /locus_tag="AGOS_ACR025W"
FT                   /old_locus_tag="ACR025W"
FT                   /product="ACR025Wp"
FT   CDS_pept        403211..403834
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR025W"
FT                   /old_locus_tag="ACR025W"
FT                   /product="ACR025Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL267W
FT                   (ACM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR025W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51252"
FT                   /db_xref="GOA:Q75C91"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C91"
FT                   /protein_id="AAS51252.1"
FT   gene            <404009..>404968
FT                   /locus_tag="AGOS_ACR026W"
FT                   /old_locus_tag="ACR026W"
FT   mRNA            <404009..>404968
FT                   /locus_tag="AGOS_ACR026W"
FT                   /old_locus_tag="ACR026W"
FT                   /product="ACR026Wp"
FT   CDS_pept        404009..404968
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR026W"
FT                   /old_locus_tag="ACR026W"
FT                   /product="ACR026Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL266W
FT                   (DIM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR026W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51253"
FT                   /db_xref="GOA:Q75C90"
FT                   /db_xref="InterPro:IPR001737"
FT                   /db_xref="InterPro:IPR011530"
FT                   /db_xref="InterPro:IPR020596"
FT                   /db_xref="InterPro:IPR020598"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C90"
FT                   /protein_id="AAS51253.1"
FT   gene            complement(<405109..>408081)
FT                   /locus_tag="AGOS_ACR027C"
FT                   /old_locus_tag="ACR027C"
FT   mRNA            complement(<405109..>408081)
FT                   /locus_tag="AGOS_ACR027C"
FT                   /old_locus_tag="ACR027C"
FT                   /product="ACR027Cp"
FT   CDS_pept        complement(405109..408081)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR027C"
FT                   /old_locus_tag="ACR027C"
FT                   /product="ACR027Cp"
FT                   /note="NOHBY318; No homolog in Saccharomyces cerevisiae;
FT                   Non-syntenic homolog of Kluyveromyces lactis KLLA0D00528g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR027C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51254"
FT                   /db_xref="GOA:Q75C89"
FT                   /db_xref="InterPro:IPR002821"
FT                   /db_xref="InterPro:IPR008040"
FT                   /db_xref="InterPro:IPR010318"
FT                   /db_xref="InterPro:IPR024071"
FT                   /db_xref="InterPro:IPR027479"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C89"
FT                   /protein_id="AAS51254.2"
FT                   Q"
FT   gene            complement(<408699..>410504)
FT                   /locus_tag="AGOS_ACR028C"
FT                   /old_locus_tag="ACR028C"
FT   mRNA            complement(<408699..>410504)
FT                   /locus_tag="AGOS_ACR028C"
FT                   /old_locus_tag="ACR028C"
FT                   /product="ACR028Cp"
FT   CDS_pept        complement(408699..410504)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR028C"
FT                   /old_locus_tag="ACR028C"
FT                   /product="ACR028Cp"
FT                   /note="NOHBY319; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0D00484g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR028C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51255"
FT                   /db_xref="GOA:Q75C88"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR021858"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C88"
FT                   /protein_id="AAS51255.1"
FT   gene            complement(<410921..>413233)
FT                   /locus_tag="AGOS_ACR029C"
FT                   /old_locus_tag="ACR029C"
FT   mRNA            complement(<410921..>413233)
FT                   /locus_tag="AGOS_ACR029C"
FT                   /old_locus_tag="ACR029C"
FT                   /product="ACR029Cp"
FT   CDS_pept        complement(410921..413233)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR029C"
FT                   /old_locus_tag="ACR029C"
FT                   /product="ACR029Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR001C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR029C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51256"
FT                   /db_xref="GOA:Q75C87"
FT                   /db_xref="InterPro:IPR000782"
FT                   /db_xref="InterPro:IPR036378"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C87"
FT                   /protein_id="AAS51256.2"
FT                   FRRSPESAPLLQESPPA"
FT   gene            <413857..>415656
FT                   /locus_tag="AGOS_ACR030W"
FT                   /old_locus_tag="ACR030W"
FT   mRNA            <413857..>415656
FT                   /locus_tag="AGOS_ACR030W"
FT                   /old_locus_tag="ACR030W"
FT                   /product="ACR030Wp"
FT   CDS_pept        413857..415656
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR030W"
FT                   /old_locus_tag="ACR030W"
FT                   /product="ACR030Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR001W
FT                   (AVT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR030W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51257"
FT                   /db_xref="GOA:Q75C86"
FT                   /db_xref="InterPro:IPR013057"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C86"
FT                   /protein_id="AAS51257.1"
FT   gene            <415993..>417810
FT                   /locus_tag="AGOS_ACR031W"
FT                   /old_locus_tag="ACR031W"
FT   mRNA            <415993..>417810
FT                   /locus_tag="AGOS_ACR031W"
FT                   /old_locus_tag="ACR031W"
FT                   /product="ACR031Wp"
FT   CDS_pept        415993..417810
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR031W"
FT                   /old_locus_tag="ACR031W"
FT                   /product="ACR031Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR002W
FT                   (MPP10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR031W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51258"
FT                   /db_xref="GOA:Q75C85"
FT                   /db_xref="InterPro:IPR012173"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C85"
FT                   /protein_id="AAS51258.1"
FT   gene            complement(<417953..>419995)
FT                   /locus_tag="AGOS_ACR032C"
FT                   /old_locus_tag="ACR032C"
FT   mRNA            complement(<417953..>419995)
FT                   /locus_tag="AGOS_ACR032C"
FT                   /old_locus_tag="ACR032C"
FT                   /product="ACR032Cp"
FT   CDS_pept        complement(417953..419995)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR032C"
FT                   /old_locus_tag="ACR032C"
FT                   /product="ACR032Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR002C
FT                   (NOC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR032C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51259"
FT                   /db_xref="GOA:Q75C84"
FT                   /db_xref="InterPro:IPR005612"
FT                   /db_xref="InterPro:IPR011501"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR016903"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C84"
FT                   /protein_id="AAS51259.1"
FT   gene            complement(<420392..>420679)
FT                   /locus_tag="AGOS_ACR033C"
FT                   /old_locus_tag="ACR033C"
FT   mRNA            complement(<420392..>420679)
FT                   /locus_tag="AGOS_ACR033C"
FT                   /old_locus_tag="ACR033C"
FT                   /product="ACR033Cp"
FT   CDS_pept        complement(420392..420679)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR033C"
FT                   /old_locus_tag="ACR033C"
FT                   /product="ACR033Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJR012C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR033C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51260"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C83"
FT                   /protein_id="AAS51260.1"
FT   gene            <420792..>421985
FT                   /locus_tag="AGOS_ACR034W"
FT                   /old_locus_tag="ACR034W"
FT   mRNA            <420792..>421985
FT                   /locus_tag="AGOS_ACR034W"
FT                   /old_locus_tag="ACR034W"
FT                   /product="ACR034Wp"
FT   CDS_pept        420792..421985
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR034W"
FT                   /old_locus_tag="ACR034W"
FT                   /product="ACR034Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR013W
FT                   (GPI14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR034W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51261"
FT                   /db_xref="GOA:Q75C82"
FT                   /db_xref="InterPro:IPR007704"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C82"
FT                   /protein_id="AAS51261.1"
FT   gene            <422234..>422974
FT                   /locus_tag="AGOS_ACR035W"
FT                   /old_locus_tag="ACR035W"
FT   mRNA            <422234..>422974
FT                   /locus_tag="AGOS_ACR035W"
FT                   /old_locus_tag="ACR035W"
FT                   /product="ACR035Wp"
FT   CDS_pept        422234..422974
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR035W"
FT                   /old_locus_tag="ACR035W"
FT                   /product="ACR035Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR195W
FT                   (SKI6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR035W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51262"
FT                   /db_xref="GOA:Q75C81"
FT                   /db_xref="InterPro:IPR001247"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR027408"
FT                   /db_xref="InterPro:IPR036345"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C81"
FT                   /protein_id="AAS51262.1"
FT   gene            complement(<423040..>425295)
FT                   /locus_tag="AGOS_ACR036C"
FT                   /old_locus_tag="ACR036C"
FT   mRNA            complement(<423040..>425295)
FT                   /locus_tag="AGOS_ACR036C"
FT                   /old_locus_tag="ACR036C"
FT                   /product="ACR036Cp"
FT   CDS_pept        complement(423040..425295)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR036C"
FT                   /old_locus_tag="ACR036C"
FT                   /product="ACR036Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR196C
FT                   (FYV8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR036C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51263"
FT                   /db_xref="InterPro:IPR026248"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C80"
FT                   /protein_id="AAS51263.2"
FT   gene            complement(<425613..>427283)
FT                   /locus_tag="AGOS_ACR037C"
FT                   /old_locus_tag="ACR037C"
FT   mRNA            complement(<425613..>427283)
FT                   /locus_tag="AGOS_ACR037C"
FT                   /old_locus_tag="ACR037C"
FT                   /product="ACR037Cp"
FT   CDS_pept        complement(425613..427283)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR037C"
FT                   /old_locus_tag="ACR037C"
FT                   /product="ACR037Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR050W
FT                   (SMF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR037C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51264"
FT                   /db_xref="GOA:Q75C79"
FT                   /db_xref="InterPro:IPR001046"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C79"
FT                   /protein_id="AAS51264.1"
FT   gene            <428007..>430031
FT                   /locus_tag="AGOS_ACR038W"
FT                   /old_locus_tag="ACR038W"
FT   mRNA            <428007..>430031
FT                   /locus_tag="AGOS_ACR038W"
FT                   /old_locus_tag="ACR038W"
FT                   /product="ACR038Wp"
FT   CDS_pept        428007..430031
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR038W"
FT                   /old_locus_tag="ACR038W"
FT                   /product="ACR038Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL034W
FT                   (KAR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR038W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51265"
FT                   /db_xref="GOA:Q75C78"
FT                   /db_xref="InterPro:IPR013126"
FT                   /db_xref="InterPro:IPR018181"
FT                   /db_xref="InterPro:IPR029047"
FT                   /db_xref="InterPro:IPR029048"
FT                   /db_xref="InterPro:IPR042050"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C78"
FT                   /protein_id="AAS51265.1"
FT   gene            complement(<430488..>431231)
FT                   /locus_tag="AGOS_ACR039C"
FT                   /old_locus_tag="ACR039C"
FT   mRNA            complement(<430488..>431231)
FT                   /locus_tag="AGOS_ACR039C"
FT                   /old_locus_tag="ACR039C"
FT                   /product="ACR039Cp"
FT   CDS_pept        complement(430488..431231)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR039C"
FT                   /old_locus_tag="ACR039C"
FT                   /product="ACR039Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR016C
FT                   (PML1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR039C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51266"
FT                   /db_xref="GOA:Q75C77"
FT                   /db_xref="InterPro:IPR000253"
FT                   /db_xref="InterPro:IPR008984"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C77"
FT                   /protein_id="AAS51266.1"
FT   gene            <431344..>433635
FT                   /locus_tag="AGOS_ACR040W"
FT                   /old_locus_tag="ACR040W"
FT   mRNA            <431344..>433635
FT                   /locus_tag="AGOS_ACR040W"
FT                   /old_locus_tag="ACR040W"
FT                   /product="ACR040Wp"
FT   CDS_pept        431344..433635
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR040W"
FT                   /old_locus_tag="ACR040W"
FT                   /product="ACR040Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL033W
FT                   (HCA4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR040W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51267"
FT                   /db_xref="GOA:Q75C76"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR025313"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C76"
FT                   /protein_id="AAS51267.2"
FT                   ESLTARLISG"
FT   gene            <433910..>434890
FT                   /locus_tag="AGOS_ACR041W"
FT                   /old_locus_tag="ACR041W"
FT   mRNA            <433910..>434890
FT                   /locus_tag="AGOS_ACR041W"
FT                   /old_locus_tag="ACR041W"
FT                   /product="ACR041Wp"
FT   CDS_pept        433910..434890
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR041W"
FT                   /old_locus_tag="ACR041W"
FT                   /product="ACR041Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL006C
FT                   (CTK2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR041W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51268"
FT                   /db_xref="GOA:Q75C75"
FT                   /db_xref="InterPro:IPR006671"
FT                   /db_xref="InterPro:IPR013763"
FT                   /db_xref="InterPro:IPR036915"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C75"
FT                   /protein_id="AAS51268.2"
FT   gene            complement(<434955..>435991)
FT                   /locus_tag="AGOS_ACR042C"
FT                   /old_locus_tag="ACR042C"
FT   mRNA            complement(join(<434955..435929,435989..>435991))
FT                   /locus_tag="AGOS_ACR042C"
FT                   /old_locus_tag="ACR042C"
FT                   /product="ACR042Cp"
FT   CDS_pept        complement(join(434955..435929,435989..435991))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR042C"
FT                   /old_locus_tag="ACR042C"
FT                   /product="ACR042Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL031C
FT                   (BET4); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR042C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51269"
FT                   /db_xref="GOA:Q75C74"
FT                   /db_xref="InterPro:IPR002088"
FT                   /db_xref="InterPro:IPR032955"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C74"
FT                   /protein_id="AAS51269.1"
FT   gene            <436152..>436751
FT                   /locus_tag="AGOS_ACR043W"
FT                   /old_locus_tag="ACR043W"
FT   mRNA            <436152..>436751
FT                   /locus_tag="AGOS_ACR043W"
FT                   /old_locus_tag="ACR043W"
FT                   /product="ACR043Wp"
FT   CDS_pept        436152..436751
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR043W"
FT                   /old_locus_tag="ACR043W"
FT                   /product="ACR043Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL030W
FT                   (MAD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR043W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51270"
FT                   /db_xref="GOA:Q75C73"
FT                   /db_xref="InterPro:IPR003511"
FT                   /db_xref="InterPro:IPR027097"
FT                   /db_xref="InterPro:IPR036570"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C73"
FT                   /protein_id="AAS51270.1"
FT   gene            complement(<436805..>439201)
FT                   /locus_tag="AGOS_ACR044C"
FT                   /old_locus_tag="ACR044C"
FT   mRNA            complement(<436805..>439201)
FT                   /locus_tag="AGOS_ACR044C"
FT                   /old_locus_tag="ACR044C"
FT                   /product="ACR044Cp"
FT   CDS_pept        complement(436805..439201)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR044C"
FT                   /old_locus_tag="ACR044C"
FT                   /product="ACR044Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL029C
FT                   (VPS53)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR044C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51271"
FT                   /db_xref="GOA:Q75C72"
FT                   /db_xref="InterPro:IPR007234"
FT                   /db_xref="InterPro:IPR031745"
FT                   /db_xref="InterPro:IPR038260"
FT                   /db_xref="InterPro:IPR039766"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C72"
FT                   /protein_id="AAS51271.2"
FT   gene            complement(439327..439399)
FT                   /locus_tag="AGOS_t0052"
FT   tRNA            complement(439327..439399)
FT                   /locus_tag="AGOS_t0052"
FT                   /product="tRNA-Met"
FT                   /note="codon recognized: AUG"
FT   gene            <439721..>441412
FT                   /locus_tag="AGOS_ACR045W"
FT                   /old_locus_tag="ACR045W"
FT   mRNA            <439721..>441412
FT                   /locus_tag="AGOS_ACR045W"
FT                   /old_locus_tag="ACR045W"
FT                   /product="ACR045Wp"
FT   CDS_pept        439721..441412
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR045W"
FT                   /old_locus_tag="ACR045W"
FT                   /product="ACR045Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL008C
FT                   (CCT8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR045W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51272"
FT                   /db_xref="GOA:Q75C71"
FT                   /db_xref="InterPro:IPR002194"
FT                   /db_xref="InterPro:IPR002423"
FT                   /db_xref="InterPro:IPR012721"
FT                   /db_xref="InterPro:IPR017998"
FT                   /db_xref="InterPro:IPR027409"
FT                   /db_xref="InterPro:IPR027410"
FT                   /db_xref="InterPro:IPR027413"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C71"
FT                   /protein_id="AAS51272.2"
FT   gene            <441675..>443711
FT                   /locus_tag="AGOS_ACR046W"
FT                   /old_locus_tag="ACR046W"
FT   mRNA            <441675..>443711
FT                   /locus_tag="AGOS_ACR046W"
FT                   /old_locus_tag="ACR046W"
FT                   /product="ACR046Wp"
FT   CDS_pept        441675..443711
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR046W"
FT                   /old_locus_tag="ACR046W"
FT                   /product="ACR046Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL010C
FT                   (NOP9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR046W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51273"
FT                   /db_xref="GOA:Q75C70"
FT                   /db_xref="InterPro:IPR001313"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR040000"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C70"
FT                   /protein_id="AAS51273.2"
FT   gene            complement(<443875..>444513)
FT                   /locus_tag="AGOS_ACR047C"
FT                   /old_locus_tag="ACR047C"
FT   mRNA            complement(<443875..>444513)
FT                   /locus_tag="AGOS_ACR047C"
FT                   /old_locus_tag="ACR047C"
FT                   /product="ACR047Cp"
FT   CDS_pept        complement(443875..444513)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR047C"
FT                   /old_locus_tag="ACR047C"
FT                   /product="ACR047Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL142W
FT                   (MRP8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR047C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51274"
FT                   /db_xref="InterPro:IPR012917"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C69"
FT                   /protein_id="AAS51274.1"
FT   gene            complement(<444777..>446099)
FT                   /locus_tag="AGOS_ACR048C"
FT                   /old_locus_tag="ACR048C"
FT   mRNA            complement(<444777..>446099)
FT                   /locus_tag="AGOS_ACR048C"
FT                   /old_locus_tag="ACR048C"
FT                   /product="ACR048Cp"
FT   CDS_pept        complement(444777..446099)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR048C"
FT                   /old_locus_tag="ACR048C"
FT                   /product="ACR048Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL143W
FT                   (LTV1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR048C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51275"
FT                   /db_xref="GOA:Q75C68"
FT                   /db_xref="InterPro:IPR007307"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C68"
FT                   /protein_id="AAS51275.1"
FT   gene            <446476..>447108
FT                   /locus_tag="AGOS_ACR049W"
FT                   /old_locus_tag="ACR049W"
FT   mRNA            <446476..>447108
FT                   /locus_tag="AGOS_ACR049W"
FT                   /old_locus_tag="ACR049W"
FT                   /product="ACR049Wp"
FT   CDS_pept        446476..447108
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR049W"
FT                   /old_locus_tag="ACR049W"
FT                   /product="ACR049Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL144C
FT                   (RPC25)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR049W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51276"
FT                   /db_xref="GOA:Q75C67"
FT                   /db_xref="InterPro:IPR004519"
FT                   /db_xref="InterPro:IPR005576"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR013238"
FT                   /db_xref="InterPro:IPR036898"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C67"
FT                   /protein_id="AAS51276.1"
FT   gene            complement(<447220..>448647)
FT                   /locus_tag="AGOS_ACR050C"
FT                   /old_locus_tag="ACR050C"
FT   mRNA            complement(<447220..>448647)
FT                   /locus_tag="AGOS_ACR050C"
FT                   /old_locus_tag="ACR050C"
FT                   /product="ACR050Cp"
FT   CDS_pept        complement(447220..448647)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR050C"
FT                   /old_locus_tag="ACR050C"
FT                   /product="ACR050Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL145W
FT                   (RPT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR050C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51277"
FT                   /db_xref="GOA:Q75C66"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR005937"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR035245"
FT                   /db_xref="InterPro:IPR041569"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C66"
FT                   /protein_id="AAS51277.1"
FT                   INGYKKFSSTSRYMQYN"
FT   gene            complement(<448843..>450495)
FT                   /locus_tag="AGOS_ACR051C"
FT                   /old_locus_tag="ACR051C"
FT   mRNA            complement(<448843..>450495)
FT                   /locus_tag="AGOS_ACR051C"
FT                   /old_locus_tag="ACR051C"
FT                   /product="ACR051Cp"
FT   CDS_pept        complement(448843..450495)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR051C"
FT                   /old_locus_tag="ACR051C"
FT                   /product="ACR051Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL146W
FT                   (AVT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR051C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51278"
FT                   /db_xref="GOA:Q75C65"
FT                   /db_xref="InterPro:IPR013057"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C65"
FT                   /protein_id="AAS51278.2"
FT   gene            <450772..>452673
FT                   /locus_tag="AGOS_ACR052W"
FT                   /old_locus_tag="ACR052W"
FT   mRNA            <450772..>452673
FT                   /locus_tag="AGOS_ACR052W"
FT                   /old_locus_tag="ACR052W"
FT                   /product="ACR052Wp"
FT   CDS_pept        450772..452673
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR052W"
FT                   /old_locus_tag="ACR052W"
FT                   /product="ACR052Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL148C
FT                   (SDH1) and YJL045W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR052W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51279"
FT                   /db_xref="GOA:Q75C64"
FT                   /db_xref="InterPro:IPR003952"
FT                   /db_xref="InterPro:IPR003953"
FT                   /db_xref="InterPro:IPR011281"
FT                   /db_xref="InterPro:IPR014006"
FT                   /db_xref="InterPro:IPR015939"
FT                   /db_xref="InterPro:IPR027477"
FT                   /db_xref="InterPro:IPR036188"
FT                   /db_xref="InterPro:IPR037099"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C64"
FT                   /protein_id="AAS51279.2"
FT   gene            <452806..>453978
FT                   /locus_tag="AGOS_ACR053W"
FT                   /old_locus_tag="ACR053W"
FT   mRNA            <452806..>453978
FT                   /locus_tag="AGOS_ACR053W"
FT                   /old_locus_tag="ACR053W"
FT                   /product="ACR053Wp"
FT   CDS_pept        452806..453978
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR053W"
FT                   /old_locus_tag="ACR053W"
FT                   /product="ACR053Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL149C
FT                   (DBR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR053W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51280"
FT                   /db_xref="GOA:Q75C63"
FT                   /db_xref="InterPro:IPR004843"
FT                   /db_xref="InterPro:IPR007708"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C63"
FT                   /protein_id="AAS51280.1"
FT   gene            complement(<454022..>454942)
FT                   /locus_tag="AGOS_ACR054C"
FT                   /old_locus_tag="ACR054C"
FT   mRNA            complement(<454022..>454942)
FT                   /locus_tag="AGOS_ACR054C"
FT                   /old_locus_tag="ACR054C"
FT                   /product="ACR054Cp"
FT   CDS_pept        complement(454022..454942)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR054C"
FT                   /old_locus_tag="ACR054C"
FT                   /product="ACR054Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL150W
FT                   (MCR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR054C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51281"
FT                   /db_xref="GOA:Q75C62"
FT                   /db_xref="InterPro:IPR001433"
FT                   /db_xref="InterPro:IPR001709"
FT                   /db_xref="InterPro:IPR001834"
FT                   /db_xref="InterPro:IPR008333"
FT                   /db_xref="InterPro:IPR017927"
FT                   /db_xref="InterPro:IPR017938"
FT                   /db_xref="InterPro:IPR039261"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C62"
FT                   /protein_id="AAS51281.1"
FT   gene            <455219..>456295
FT                   /locus_tag="AGOS_ACR055W"
FT                   /old_locus_tag="ACR055W"
FT   mRNA            <455219..>456295
FT                   /locus_tag="AGOS_ACR055W"
FT                   /old_locus_tag="ACR055W"
FT                   /product="ACR055Wp"
FT   CDS_pept        455219..456295
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR055W"
FT                   /old_locus_tag="ACR055W"
FT                   /product="ACR055Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKL151C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR055W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51282"
FT                   /db_xref="GOA:Q75C61"
FT                   /db_xref="InterPro:IPR000631"
FT                   /db_xref="InterPro:IPR017953"
FT                   /db_xref="InterPro:IPR029056"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C61"
FT                   /protein_id="AAS51282.2"
FT                   DLNGHVGAIFRDFFPERQ"
FT   gene            <456517..>457260
FT                   /locus_tag="AGOS_ACR056W"
FT                   /old_locus_tag="ACR056W"
FT   mRNA            <456517..>457260
FT                   /locus_tag="AGOS_ACR056W"
FT                   /old_locus_tag="ACR056W"
FT                   /product="ACR056Wp"
FT   CDS_pept        456517..457260
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR056W"
FT                   /old_locus_tag="ACR056W"
FT                   /product="ACR056Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL152C
FT                   (GPM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR056W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51283"
FT                   /db_xref="GOA:Q75C60"
FT                   /db_xref="InterPro:IPR001345"
FT                   /db_xref="InterPro:IPR005952"
FT                   /db_xref="InterPro:IPR013078"
FT                   /db_xref="InterPro:IPR029033"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C60"
FT                   /protein_id="AAS51283.2"
FT   gene            complement(<457331..>458455)
FT                   /locus_tag="AGOS_ACR057C"
FT                   /old_locus_tag="ACR057C"
FT   mRNA            complement(<457331..>458455)
FT                   /locus_tag="AGOS_ACR057C"
FT                   /old_locus_tag="ACR057C"
FT                   /product="ACR057Cp"
FT   CDS_pept        complement(457331..458455)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR057C"
FT                   /old_locus_tag="ACR057C"
FT                   /product="ACR057Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL044C
FT                   (GYP6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR057C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51284"
FT                   /db_xref="GOA:Q75C59"
FT                   /db_xref="InterPro:IPR000195"
FT                   /db_xref="InterPro:IPR035969"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C59"
FT                   /protein_id="AAS51284.1"
FT   gene            complement(<458702..>459172)
FT                   /locus_tag="AGOS_ACR058C"
FT                   /old_locus_tag="ACR058C"
FT   mRNA            complement(<458702..>459172)
FT                   /locus_tag="AGOS_ACR058C"
FT                   /old_locus_tag="ACR058C"
FT                   /product="ACR058Cp"
FT   CDS_pept        complement(458702..459172)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR058C"
FT                   /old_locus_tag="ACR058C"
FT                   /product="ACR058Cp"
FT                   /note="NOHBY320; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR058C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51285"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C58"
FT                   /protein_id="AAS51285.2"
FT   gene            <459750..>463400
FT                   /locus_tag="AGOS_ACR059W"
FT                   /old_locus_tag="ACR059W"
FT   mRNA            <459750..>463400
FT                   /locus_tag="AGOS_ACR059W"
FT                   /old_locus_tag="ACR059W"
FT                   /product="ACR059Wp"
FT   CDS_pept        459750..463400
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR059W"
FT                   /old_locus_tag="ACR059W"
FT                   /product="ACR059Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL042W
FT                   (MHP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR059W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51286"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C57"
FT                   /protein_id="AAS51286.2"
FT   gene            <463770..>465865
FT                   /locus_tag="AGOS_ACR060W"
FT                   /old_locus_tag="ACR060W"
FT   mRNA            join(<463770,463860..>465865)
FT                   /locus_tag="AGOS_ACR060W"
FT                   /old_locus_tag="ACR060W"
FT                   /product="ACR060Wp"
FT   CDS_pept        join(463770,463860..465865)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR060W"
FT                   /old_locus_tag="ACR060W"
FT                   /product="ACR060Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL041W
FT                   (NSP1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR060W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51287"
FT                   /db_xref="GOA:Q75C56"
FT                   /db_xref="InterPro:IPR007758"
FT                   /db_xref="InterPro:IPR026010"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C56"
FT                   /protein_id="AAS51287.1"
FT   gene            complement(<466023..>470975)
FT                   /locus_tag="AGOS_ACR061C"
FT                   /old_locus_tag="ACR061C"
FT   mRNA            complement(<466023..>470975)
FT                   /locus_tag="AGOS_ACR061C"
FT                   /old_locus_tag="ACR061C"
FT                   /product="ACR061Cp"
FT   CDS_pept        complement(466023..470975)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR061C"
FT                   /old_locus_tag="ACR061C"
FT                   /product="ACR061Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL039C
FT                   (NUP192)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR061C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51288"
FT                   /db_xref="GOA:Q75C55"
FT                   /db_xref="InterPro:IPR021827"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C55"
FT                   /protein_id="AAS51288.2"
FT                   CTLTGYLGEQDV"
FT   gene            complement(471125..471196)
FT                   /locus_tag="AGOS_t0053"
FT   tRNA            complement(471125..471196)
FT                   /locus_tag="AGOS_t0053"
FT                   /product="tRNA-Arg"
FT                   /note="codon recognized: AGA"
FT   gene            <471356..>471583
FT                   /locus_tag="AGOS_ACR063WA"
FT   mRNA            <471356..>471583
FT                   /locus_tag="AGOS_ACR063WA"
FT                   /product="ACR063W-Ap"
FT   CDS_pept        471356..471583
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR063WA"
FT                   /product="ACR063W-Ap"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIL102C-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR063WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41754"
FT                   /db_xref="GOA:D8FGB1"
FT                   /db_xref="InterPro:IPR009914"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGB1"
FT                   /protein_id="ADJ41754.1"
FT   gene            complement(<471608..>472357)
FT                   /locus_tag="AGOS_ACR063C"
FT                   /old_locus_tag="ACR063C"
FT   mRNA            complement(<471608..>472357)
FT                   /locus_tag="AGOS_ACR063C"
FT                   /old_locus_tag="ACR063C"
FT                   /product="ACR063Cp"
FT   CDS_pept        complement(471608..472357)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR063C"
FT                   /old_locus_tag="ACR063C"
FT                   /product="ACR063Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL154W
FT                   (SRP102)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR063C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51289"
FT                   /db_xref="GOA:Q75C54"
FT                   /db_xref="InterPro:IPR019009"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C54"
FT                   /protein_id="AAS51289.1"
FT   gene            <472523..>474652
FT                   /locus_tag="AGOS_ACR064W"
FT                   /old_locus_tag="ACR064W"
FT   mRNA            <472523..>474652
FT                   /locus_tag="AGOS_ACR064W"
FT                   /old_locus_tag="ACR064W"
FT                   /product="ACR064Wp"
FT   CDS_pept        472523..474652
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR064W"
FT                   /old_locus_tag="ACR064W"
FT                   /product="ACR064Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL155C
FT                   (RSM22)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR064W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51290"
FT                   /db_xref="GOA:Q75C53"
FT                   /db_xref="InterPro:IPR015324"
FT                   /db_xref="InterPro:IPR016522"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C53"
FT                   /protein_id="AAS51290.1"
FT                   KRDKNRKLAVDAIRK"
FT   gene            complement(<474760..>475257)
FT                   /locus_tag="AGOS_ACR065C"
FT                   /old_locus_tag="ACR065C"
FT   mRNA            complement(join(<474760..475005,475255..>475257))
FT                   /locus_tag="AGOS_ACR065C"
FT                   /old_locus_tag="ACR065C"
FT                   /product="ACR065Cp"
FT   CDS_pept        complement(join(474760..475005,475255..475257))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR065C"
FT                   /old_locus_tag="ACR065C"
FT                   /product="ACR065Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR021C
FT                   (RPS27B) and YKL156W (RPS27A); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR065C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51291"
FT                   /db_xref="GOA:Q75C52"
FT                   /db_xref="InterPro:IPR000592"
FT                   /db_xref="InterPro:IPR011332"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C52"
FT                   /protein_id="AAS51291.2"
FT   gene            complement(<475709..>476731)
FT                   /locus_tag="AGOS_ACR066C"
FT                   /old_locus_tag="ACR066C"
FT   mRNA            complement(<475709..>476731)
FT                   /locus_tag="AGOS_ACR066C"
FT                   /old_locus_tag="ACR066C"
FT                   /product="ACR066Cp"
FT   CDS_pept        complement(475709..476731)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR066C"
FT                   /old_locus_tag="ACR066C"
FT                   /product="ACR066Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHR022C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR066C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51292"
FT                   /db_xref="GOA:Q75C51"
FT                   /db_xref="InterPro:IPR001806"
FT                   /db_xref="InterPro:IPR020849"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C51"
FT                   /protein_id="AAS51292.1"
FT                   "
FT   gene            complement(<477457..>479196)
FT                   /locus_tag="AGOS_ACR067C"
FT                   /old_locus_tag="ACR067C"
FT   mRNA            complement(<477457..>479196)
FT                   /locus_tag="AGOS_ACR067C"
FT                   /old_locus_tag="ACR067C"
FT                   /product="ACR067Cp"
FT   CDS_pept        complement(477457..479196)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR067C"
FT                   /old_locus_tag="ACR067C"
FT                   /product="ACR067Cp"
FT                   /note="NOHBY321; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E11594g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR067C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51293"
FT                   /db_xref="InterPro:IPR001810"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="InterPro:IPR036047"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C50"
FT                   /protein_id="AAS51293.1"
FT                   ADD"
FT   gene            <480140..>485557
FT                   /locus_tag="AGOS_ACR068W"
FT                   /old_locus_tag="ACR068W"
FT   mRNA            <480140..>485557
FT                   /locus_tag="AGOS_ACR068W"
FT                   /old_locus_tag="ACR068W"
FT                   /product="ACR068Wp"
FT   CDS_pept        480140..485557
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR068W"
FT                   /old_locus_tag="ACR068W"
FT                   /product="ACR068Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR023W
FT                   (MYO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR068W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51294"
FT                   /db_xref="GOA:Q75C49"
FT                   /db_xref="InterPro:IPR001609"
FT                   /db_xref="InterPro:IPR008989"
FT                   /db_xref="InterPro:IPR027401"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036961"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C49"
FT                   /protein_id="AAS51294.2"
FT   gene            complement(<485715..>487190)
FT                   /locus_tag="AGOS_ACR069C"
FT                   /old_locus_tag="ACR069C"
FT   mRNA            complement(<485715..>487190)
FT                   /locus_tag="AGOS_ACR069C"
FT                   /old_locus_tag="ACR069C"
FT                   /product="ACR069Cp"
FT   CDS_pept        complement(485715..487190)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR069C"
FT                   /old_locus_tag="ACR069C"
FT                   /product="ACR069Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR024C
FT                   (MAS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR069C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51295"
FT                   /db_xref="GOA:Q75C48"
FT                   /db_xref="InterPro:IPR007863"
FT                   /db_xref="InterPro:IPR011249"
FT                   /db_xref="InterPro:IPR011765"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C48"
FT                   /protein_id="AAS51295.1"
FT   gene            <487566..>488642
FT                   /locus_tag="AGOS_ACR070W"
FT                   /old_locus_tag="ACR070W"
FT   mRNA            <487566..>488642
FT                   /locus_tag="AGOS_ACR070W"
FT                   /old_locus_tag="ACR070W"
FT                   /product="ACR070Wp"
FT   CDS_pept        487566..488642
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR070W"
FT                   /old_locus_tag="ACR070W"
FT                   /product="ACR070Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR025W
FT                   (THR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR070W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51296"
FT                   /db_xref="GOA:Q75C47"
FT                   /db_xref="InterPro:IPR000870"
FT                   /db_xref="InterPro:IPR006203"
FT                   /db_xref="InterPro:IPR006204"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR036554"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C47"
FT                   /protein_id="AAS51296.2"
FT                   TCTWKLLDIAEQGSAVEA"
FT   gene            <488919..>489554
FT                   /locus_tag="AGOS_ACR071W"
FT                   /old_locus_tag="ACR071W"
FT   mRNA            <488919..>489554
FT                   /locus_tag="AGOS_ACR071W"
FT                   /old_locus_tag="ACR071W"
FT                   /product="ACR071Wp"
FT   CDS_pept        488919..489554
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR071W"
FT                   /old_locus_tag="ACR071W"
FT                   /product="ACR071Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR026W
FT                   (VMA16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR071W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51297"
FT                   /db_xref="GOA:Q75C46"
FT                   /db_xref="InterPro:IPR000245"
FT                   /db_xref="InterPro:IPR002379"
FT                   /db_xref="InterPro:IPR035921"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C46"
FT                   /protein_id="AAS51297.1"
FT   gene            complement(<489698..>492670)
FT                   /locus_tag="AGOS_ACR072C"
FT                   /old_locus_tag="ACR072C"
FT   mRNA            complement(<489698..>492670)
FT                   /locus_tag="AGOS_ACR072C"
FT                   /old_locus_tag="ACR072C"
FT                   /product="ACR072Cp"
FT   CDS_pept        complement(489698..492670)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR072C"
FT                   /old_locus_tag="ACR072C"
FT                   /product="ACR072Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR027C
FT                   (RPN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR072C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51298"
FT                   /db_xref="GOA:Q75C45"
FT                   /db_xref="InterPro:IPR002015"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR016643"
FT                   /db_xref="InterPro:IPR040892"
FT                   /db_xref="InterPro:IPR041433"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C45"
FT                   /protein_id="AAS51298.1"
FT                   E"
FT   gene            complement(<492978..>495596)
FT                   /locus_tag="AGOS_ACR073C"
FT                   /old_locus_tag="ACR073C"
FT   mRNA            complement(<492978..>495596)
FT                   /locus_tag="AGOS_ACR073C"
FT                   /old_locus_tag="ACR073C"
FT                   /product="ACR073Cp"
FT   CDS_pept        complement(492978..495596)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR073C"
FT                   /old_locus_tag="ACR073C"
FT                   /product="ACR073Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR028C
FT                   (DAP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR073C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51299"
FT                   /db_xref="GOA:Q75C44"
FT                   /db_xref="InterPro:IPR001375"
FT                   /db_xref="InterPro:IPR002469"
FT                   /db_xref="InterPro:IPR002471"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="InterPro:IPR038554"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C44"
FT                   /protein_id="AAS51299.2"
FT                   K"
FT   gene            <496155..>497387
FT                   /locus_tag="AGOS_ACR074W"
FT                   /old_locus_tag="ACR074W"
FT   mRNA            <496155..>497387
FT                   /locus_tag="AGOS_ACR074W"
FT                   /old_locus_tag="ACR074W"
FT                   /product="ACR074Wp"
FT   CDS_pept        496155..497387
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR074W"
FT                   /old_locus_tag="ACR074W"
FT                   /product="ACR074Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL036W
FT                   (SNX4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR074W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51300"
FT                   /db_xref="GOA:Q75C43"
FT                   /db_xref="InterPro:IPR001683"
FT                   /db_xref="InterPro:IPR027267"
FT                   /db_xref="InterPro:IPR036871"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C43"
FT                   /protein_id="AAS51300.1"
FT                   VNTWSKIEESL"
FT   gene            complement(<497466..>498203)
FT                   /locus_tag="AGOS_ACR075C"
FT                   /old_locus_tag="ACR075C"
FT   mRNA            complement(<497466..>498203)
FT                   /locus_tag="AGOS_ACR075C"
FT                   /old_locus_tag="ACR075C"
FT                   /product="ACR075Cp"
FT   CDS_pept        complement(497466..498203)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR075C"
FT                   /old_locus_tag="ACR075C"
FT                   /product="ACR075Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL035C
FT                   (TAD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR075C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51301"
FT                   /db_xref="GOA:Q75C42"
FT                   /db_xref="InterPro:IPR002125"
FT                   /db_xref="InterPro:IPR016192"
FT                   /db_xref="InterPro:IPR016193"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C42"
FT                   /protein_id="AAS51301.1"
FT   gene            complement(<498322..>499029)
FT                   /locus_tag="AGOS_ACR076C"
FT                   /old_locus_tag="ACR076C"
FT   mRNA            complement(<498322..>499029)
FT                   /locus_tag="AGOS_ACR076C"
FT                   /old_locus_tag="ACR076C"
FT                   /product="ACR076Cp"
FT   CDS_pept        complement(498322..499029)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR076C"
FT                   /old_locus_tag="ACR076C"
FT                   /product="ACR076Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR049W
FT                   (FSH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR076C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51302"
FT                   /db_xref="GOA:Q75C41"
FT                   /db_xref="InterPro:IPR005645"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C41"
FT                   /protein_id="AAS51302.1"
FT                   PIVDEIAKALGLP"
FT   gene            <499409..>500812
FT                   /locus_tag="AGOS_ACR077W"
FT                   /old_locus_tag="ACR077W"
FT   mRNA            <499409..>500812
FT                   /locus_tag="AGOS_ACR077W"
FT                   /old_locus_tag="ACR077W"
FT                   /product="ACR077Wp"
FT   CDS_pept        499409..500812
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR077W"
FT                   /old_locus_tag="ACR077W"
FT                   /product="ACR077Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YML083C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR077W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51303"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C40"
FT                   /protein_id="AAS51303.2"
FT                   DSSSDLLKE"
FT   gene            <501162..>502646
FT                   /locus_tag="AGOS_ACR078W"
FT                   /old_locus_tag="ACR078W"
FT   mRNA            join(<501162..501168,501253..>502646)
FT                   /locus_tag="AGOS_ACR078W"
FT                   /old_locus_tag="ACR078W"
FT                   /product="ACR078Wp"
FT   CDS_pept        join(501162..501168,501253..502646)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR078W"
FT                   /old_locus_tag="ACR078W"
FT                   /product="ACR078Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR046C
FT                   (DBP5); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR078W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51304"
FT                   /db_xref="GOA:Q75C39"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C39"
FT                   /protein_id="AAS51304.2"
FT                   KIVKKVLK"
FT   gene            <502831..>503049
FT                   /locus_tag="AGOS_ACR079W"
FT                   /old_locus_tag="ACR079W"
FT   mRNA            join(<502831..502864,502916..>503049)
FT                   /locus_tag="AGOS_ACR079W"
FT                   /old_locus_tag="ACR079W"
FT                   /product="ACR079Wp"
FT   CDS_pept        join(502831..502864,502916..503049)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR079W"
FT                   /old_locus_tag="ACR079W"
FT                   /product="ACR079Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR276C
FT                   (PMP3); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR079W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51305"
FT                   /db_xref="GOA:Q75C38"
FT                   /db_xref="InterPro:IPR000612"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C38"
FT                   /protein_id="AAS51305.1"
FT                   LYALYIVLTS"
FT   gene            complement(<503129..>503305)
FT                   /locus_tag="AGOS_ACR080C"
FT                   /old_locus_tag="ACR080C"
FT   mRNA            complement(<503129..>503305)
FT                   /locus_tag="AGOS_ACR080C"
FT                   /old_locus_tag="ACR080C"
FT                   /product="ACR080Cp"
FT   CDS_pept        complement(503129..503305)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR080C"
FT                   /old_locus_tag="ACR080C"
FT                   /product="ACR080Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR045W
FT                   (TOM6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR080C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51306"
FT                   /db_xref="GOA:Q75C37"
FT                   /db_xref="InterPro:IPR020266"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C37"
FT                   /protein_id="AAS51306.1"
FT                   VQSSLMDMMAPQL"
FT   gene            complement(<503390..>503680)
FT                   /locus_tag="AGOS_ACR081C"
FT                   /old_locus_tag="ACR081C"
FT   mRNA            complement(<503390..>503680)
FT                   /locus_tag="AGOS_ACR081C"
FT                   /old_locus_tag="ACR081C"
FT                   /product="ACR081Cp"
FT   CDS_pept        complement(503390..503680)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR081C"
FT                   /old_locus_tag="ACR081C"
FT                   /product="ACR081Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR044W
FT                   (IRC23)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR081C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51307"
FT                   /db_xref="GOA:Q75C36"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C36"
FT                   /protein_id="AAS51307.1"
FT   gene            complement(<503956..>505224)
FT                   /locus_tag="AGOS_ACR082C"
FT                   /old_locus_tag="ACR082C"
FT   mRNA            complement(<503956..>505224)
FT                   /locus_tag="AGOS_ACR082C"
FT                   /old_locus_tag="ACR082C"
FT                   /product="ACR082Cp"
FT   CDS_pept        complement(503956..505224)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR082C"
FT                   /old_locus_tag="ACR082C"
FT                   /product="ACR082Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR043W
FT                   (WHI2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR082C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51308"
FT                   /db_xref="GOA:Q75C35"
FT                   /db_xref="InterPro:IPR011333"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C35"
FT                   /protein_id="AAS51308.1"
FT   gene            505681..505741
FT                   /locus_tag="AGOS_AgSNR62"
FT                   /old_locus_tag="AgSNR62"
FT   ncRNA           505681..505741
FT                   /locus_tag="AGOS_AgSNR62"
FT                   /old_locus_tag="AgSNR62"
FT                   /product="AgSNR62"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR62; start and end coordinates are approximate;
FT                   similarity is partial; In synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<505796..>506923)
FT                   /locus_tag="AGOS_ACR083C"
FT                   /old_locus_tag="ACR083C"
FT   mRNA            complement(<505796..>506923)
FT                   /locus_tag="AGOS_ACR083C"
FT                   /old_locus_tag="ACR083C"
FT                   /product="ACR083Cp"
FT   CDS_pept        complement(505796..506923)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR083C"
FT                   /old_locus_tag="ACR083C"
FT                   /product="ACR083Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR042W
FT                   (CUE5) and YDR273W (DON1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR083C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51309"
FT                   /db_xref="GOA:Q75C34"
FT                   /db_xref="InterPro:IPR003892"
FT                   /db_xref="InterPro:IPR009060"
FT                   /db_xref="InterPro:IPR041807"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C34"
FT                   /protein_id="AAS51309.1"
FT   gene            507133..507216
FT                   /locus_tag="AGOS_AgSNR9"
FT                   /old_locus_tag="AgSNR9"
FT   ncRNA           507133..507216
FT                   /locus_tag="AGOS_AgSNR9"
FT                   /old_locus_tag="AgSNR9"
FT                   /product="AgSNR9"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR9; start and end coordinates are approximate"
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<507340..>508221)
FT                   /locus_tag="AGOS_ACR084C"
FT                   /old_locus_tag="ACR084C"
FT   mRNA            complement(<507340..>508221)
FT                   /locus_tag="AGOS_ACR084C"
FT                   /old_locus_tag="ACR084C"
FT                   /product="ACR084Cp"
FT   CDS_pept        complement(507340..508221)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR084C"
FT                   /old_locus_tag="ACR084C"
FT                   /product="ACR084Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR040W
FT                   (GLO4) and YDR272W (GLO2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR084C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51310"
FT                   /db_xref="InterPro:IPR001279"
FT                   /db_xref="InterPro:IPR032282"
FT                   /db_xref="InterPro:IPR035680"
FT                   /db_xref="InterPro:IPR036866"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C33"
FT                   /protein_id="AAS51310.1"
FT                   VMAKLRSMKNTM"
FT   gene            complement(<508366..>511230)
FT                   /locus_tag="AGOS_ACR085C"
FT                   /old_locus_tag="ACR085C"
FT   mRNA            complement(<508366..>511230)
FT                   /locus_tag="AGOS_ACR085C"
FT                   /old_locus_tag="ACR085C"
FT                   /product="ACR085Cp"
FT   CDS_pept        complement(508366..511230)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR085C"
FT                   /old_locus_tag="ACR085C"
FT                   /product="ACR085Cp"
FT                   /note="NOHBY322; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F16038g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR085C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51311"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C32"
FT                   /protein_id="AAS51311.1"
FT   gene            complement(<511970..>514402)
FT                   /locus_tag="AGOS_ACR086C"
FT                   /old_locus_tag="ACR086C"
FT   mRNA            complement(<511970..>514402)
FT                   /locus_tag="AGOS_ACR086C"
FT                   /old_locus_tag="ACR086C"
FT                   /product="ACR086Cp"
FT   CDS_pept        complement(511970..514402)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR086C"
FT                   /old_locus_tag="ACR086C"
FT                   /product="ACR086Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR270W
FT                   (CCC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR086C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51312"
FT                   /db_xref="GOA:Q75C31"
FT                   /db_xref="InterPro:IPR001757"
FT                   /db_xref="InterPro:IPR006121"
FT                   /db_xref="InterPro:IPR008250"
FT                   /db_xref="InterPro:IPR017969"
FT                   /db_xref="InterPro:IPR018303"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR023298"
FT                   /db_xref="InterPro:IPR023299"
FT                   /db_xref="InterPro:IPR027256"
FT                   /db_xref="InterPro:IPR036163"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C31"
FT                   /protein_id="AAS51312.2"
FT   gene            complement(<514604..>515377)
FT                   /locus_tag="AGOS_ACR087C"
FT                   /old_locus_tag="ACR087C"
FT   mRNA            complement(<514604..>515377)
FT                   /locus_tag="AGOS_ACR087C"
FT                   /old_locus_tag="ACR087C"
FT                   /product="ACR087Cp"
FT   CDS_pept        complement(514604..515377)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR087C"
FT                   /old_locus_tag="ACR087C"
FT                   /product="ACR087Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR039W
FT                   (CKB2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR087C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51313"
FT                   /db_xref="GOA:Q75C30"
FT                   /db_xref="InterPro:IPR000704"
FT                   /db_xref="InterPro:IPR016149"
FT                   /db_xref="InterPro:IPR035991"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C30"
FT                   /protein_id="AAS51313.1"
FT   gene            <515563..>518115
FT                   /locus_tag="AGOS_ACR088W"
FT                   /old_locus_tag="ACR088W"
FT   mRNA            <515563..>518115
FT                   /locus_tag="AGOS_ACR088W"
FT                   /old_locus_tag="ACR088W"
FT                   /product="ACR088Wp"
FT   CDS_pept        515563..518115
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR088W"
FT                   /old_locus_tag="ACR088W"
FT                   /product="ACR088Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR038C
FT                   (HIR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR088W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51314"
FT                   /db_xref="GOA:Q75C29"
FT                   /db_xref="InterPro:IPR011494"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR031120"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C29"
FT                   /protein_id="AAS51314.2"
FT   gene            complement(<518156..>519325)
FT                   /locus_tag="AGOS_ACR089C"
FT                   /old_locus_tag="ACR089C"
FT   mRNA            complement(<518156..>519325)
FT                   /locus_tag="AGOS_ACR089C"
FT                   /old_locus_tag="ACR089C"
FT                   /product="ACR089Cp"
FT   CDS_pept        complement(518156..519325)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR089C"
FT                   /old_locus_tag="ACR089C"
FT                   /product="ACR089Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR268W
FT                   (MSW1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR089C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51315"
FT                   /db_xref="GOA:Q75C28"
FT                   /db_xref="InterPro:IPR001412"
FT                   /db_xref="InterPro:IPR002305"
FT                   /db_xref="InterPro:IPR002306"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C28"
FT                   /protein_id="AAS51315.1"
FT   gene            complement(<519433..>520530)
FT                   /locus_tag="AGOS_ACR090C"
FT                   /old_locus_tag="ACR090C"
FT   mRNA            complement(<519433..>520530)
FT                   /locus_tag="AGOS_ACR090C"
FT                   /old_locus_tag="ACR090C"
FT                   /product="ACR090Cp"
FT   CDS_pept        complement(519433..520530)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR090C"
FT                   /old_locus_tag="ACR090C"
FT                   /product="ACR090Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR037W
FT                   (CYC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR090C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51316"
FT                   /db_xref="GOA:Q75C27"
FT                   /db_xref="InterPro:IPR017927"
FT                   /db_xref="InterPro:IPR017938"
FT                   /db_xref="InterPro:IPR039261"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C27"
FT                   /protein_id="AAS51316.2"
FT   gene            <520608..>521594
FT                   /locus_tag="AGOS_ACR091W"
FT                   /old_locus_tag="ACR091W"
FT   mRNA            <520608..>521594
FT                   /locus_tag="AGOS_ACR091W"
FT                   /old_locus_tag="ACR091W"
FT                   /product="ACR091Wp"
FT   CDS_pept        520608..521594
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR091W"
FT                   /old_locus_tag="ACR091W"
FT                   /product="ACR091Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR267C
FT                   (CIA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR091W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51317"
FT                   /db_xref="GOA:Q75C26"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR028608"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C26"
FT                   /protein_id="AAS51317.1"
FT   gene            complement(<521645..>522469)
FT                   /locus_tag="AGOS_ACR092C"
FT                   /old_locus_tag="ACR092C"
FT   mRNA            complement(<521645..>522469)
FT                   /locus_tag="AGOS_ACR092C"
FT                   /old_locus_tag="ACR092C"
FT                   /product="ACR092Cp"
FT   CDS_pept        complement(521645..522469)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR092C"
FT                   /old_locus_tag="ACR092C"
FT                   /product="ACR092Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR036W
FT                   (PEP12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR092C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51318"
FT                   /db_xref="GOA:Q75C25"
FT                   /db_xref="InterPro:IPR000727"
FT                   /db_xref="InterPro:IPR006011"
FT                   /db_xref="InterPro:IPR006012"
FT                   /db_xref="InterPro:IPR010989"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C25"
FT                   /protein_id="AAS51318.1"
FT   gene            complement(<522624..>523709)
FT                   /locus_tag="AGOS_ACR093C"
FT                   /old_locus_tag="ACR093C"
FT   mRNA            complement(join(<522624..523554,523606..>523709))
FT                   /locus_tag="AGOS_ACR093C"
FT                   /old_locus_tag="ACR093C"
FT                   /product="ACR093Cp"
FT   CDS_pept        complement(join(522624..523554,523606..523709))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR093C"
FT                   /old_locus_tag="ACR093C"
FT                   /product="ACR093Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR101C
FT                   (BIG1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR093C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51319"
FT                   /db_xref="GOA:Q75C24"
FT                   /db_xref="InterPro:IPR037654"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C24"
FT                   /protein_id="AAS51319.2"
FT                   EKED"
FT   gene            complement(<523827..>524756)
FT                   /locus_tag="AGOS_ACR094C"
FT                   /old_locus_tag="ACR094C"
FT   mRNA            complement(<523827..>524756)
FT                   /locus_tag="AGOS_ACR094C"
FT                   /old_locus_tag="ACR094C"
FT                   /product="ACR094Cp"
FT   CDS_pept        complement(523827..524756)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR094C"
FT                   /old_locus_tag="ACR094C"
FT                   /product="ACR094Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL019W
FT                   (RAM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR094C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51320"
FT                   /db_xref="GOA:Q75C23"
FT                   /db_xref="InterPro:IPR002088"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C23"
FT                   /protein_id="AAS51320.1"
FT   gene            <526246..>526973
FT                   /locus_tag="AGOS_ACR095W"
FT                   /old_locus_tag="ACR095W"
FT   mRNA            join(<526246..526330,526381..>526973)
FT                   /locus_tag="AGOS_ACR095W"
FT                   /old_locus_tag="ACR095W"
FT                   /product="ACR095Wp"
FT   CDS_pept        join(526246..526330,526381..526973)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR095W"
FT                   /old_locus_tag="ACR095W"
FT                   /product="ACR095Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL127C
FT                   (HHO1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR095W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51321"
FT                   /db_xref="GOA:Q75C22"
FT                   /db_xref="InterPro:IPR005818"
FT                   /db_xref="InterPro:IPR005819"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C22"
FT                   /protein_id="AAS51321.1"
FT                   KSA"
FT   gene            <527645..>529162
FT                   /locus_tag="AGOS_ACR096W"
FT                   /old_locus_tag="ACR096W"
FT   mRNA            <527645..>529162
FT                   /locus_tag="AGOS_ACR096W"
FT                   /old_locus_tag="ACR096W"
FT                   /product="ACR096Wp"
FT   CDS_pept        527645..529162
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR096W"
FT                   /old_locus_tag="ACR096W"
FT                   /product="ACR096Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL128C
FT                   (TBF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR096W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51322"
FT                   /db_xref="GOA:Q75C21"
FT                   /db_xref="InterPro:IPR001005"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR013867"
FT                   /db_xref="InterPro:IPR017930"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C21"
FT                   /protein_id="AAS51322.1"
FT   gene            <529783..>531186
FT                   /locus_tag="AGOS_ACR097W"
FT                   /old_locus_tag="ACR097W"
FT   mRNA            <529783..>531186
FT                   /locus_tag="AGOS_ACR097W"
FT                   /old_locus_tag="ACR097W"
FT                   /product="ACR097Wp"
FT   CDS_pept        529783..531186
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR097W"
FT                   /old_locus_tag="ACR097W"
FT                   /product="ACR097Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR212W
FT                   (STE4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR097W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51323"
FT                   /db_xref="GOA:Q75C20"
FT                   /db_xref="InterPro:IPR001632"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR016346"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C20"
FT                   /protein_id="AAS51323.1"
FT                   MKVWSPAYM"
FT   gene            complement(<531330..>532047)
FT                   /locus_tag="AGOS_ACR098C"
FT                   /old_locus_tag="ACR098C"
FT   mRNA            complement(join(<531330..531983,532039..>532047))
FT                   /locus_tag="AGOS_ACR098C"
FT                   /old_locus_tag="ACR098C"
FT                   /product="ACR098Cp"
FT   CDS_pept        complement(join(531330..531983,532039..532047))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR098C"
FT                   /old_locus_tag="ACR098C"
FT                   /product="ACR098Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL129W
FT                   (TAF14) and YOR213C (SAS5); 1-intron; Tandem gene
FT                   duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR098C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51324"
FT                   /db_xref="GOA:Q75C19"
FT                   /db_xref="InterPro:IPR005033"
FT                   /db_xref="InterPro:IPR016665"
FT                   /db_xref="InterPro:IPR038704"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C19"
FT                   /protein_id="AAS51324.1"
FT   gene            complement(<532259..>533070)
FT                   /locus_tag="AGOS_ACR099C"
FT                   /old_locus_tag="ACR099C"
FT   mRNA            complement(join(<532259..532993,533062..>533070))
FT                   /locus_tag="AGOS_ACR099C"
FT                   /old_locus_tag="ACR099C"
FT                   /product="ACR099Cp"
FT   CDS_pept        complement(join(532259..532993,533062..533070))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR099C"
FT                   /old_locus_tag="ACR099C"
FT                   /product="ACR099Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL129W
FT                   (TAF14) and YOR213C (SAS5); 1-intron; Tandem gene
FT                   duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR099C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51325"
FT                   /db_xref="GOA:Q75C18"
FT                   /db_xref="InterPro:IPR005033"
FT                   /db_xref="InterPro:IPR016665"
FT                   /db_xref="InterPro:IPR027353"
FT                   /db_xref="InterPro:IPR038704"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C18"
FT                   /protein_id="AAS51325.1"
FT   gene            complement(<533261..>533812)
FT                   /locus_tag="AGOS_ACR100C"
FT                   /old_locus_tag="ACR100C"
FT   mRNA            complement(<533261..>533812)
FT                   /locus_tag="AGOS_ACR100C"
FT                   /old_locus_tag="ACR100C"
FT                   /product="ACR100Cp"
FT   CDS_pept        complement(533261..533812)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR100C"
FT                   /old_locus_tag="ACR100C"
FT                   /product="ACR100Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR215C
FT                   (AIM41)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR100C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51326"
FT                   /db_xref="GOA:Q75C17"
FT                   /db_xref="InterPro:IPR003789"
FT                   /db_xref="InterPro:IPR019004"
FT                   /db_xref="InterPro:IPR042184"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C17"
FT                   /protein_id="AAS51326.1"
FT   gene            complement(<534018..>535466)
FT                   /locus_tag="AGOS_ACR101C"
FT                   /old_locus_tag="ACR101C"
FT   mRNA            complement(<534018..>535466)
FT                   /locus_tag="AGOS_ACR101C"
FT                   /old_locus_tag="ACR101C"
FT                   /product="ACR101Cp"
FT   CDS_pept        complement(534018..535466)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR101C"
FT                   /old_locus_tag="ACR101C"
FT                   /product="ACR101Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR216C
FT                   (RUD3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR101C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51327"
FT                   /db_xref="GOA:Q75C16"
FT                   /db_xref="InterPro:IPR000237"
FT                   /db_xref="InterPro:IPR019459"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C16"
FT                   /protein_id="AAS51327.2"
FT   gene            <535738..>538260
FT                   /locus_tag="AGOS_ACR102W"
FT                   /old_locus_tag="ACR102W"
FT   mRNA            <535738..>538260
FT                   /locus_tag="AGOS_ACR102W"
FT                   /old_locus_tag="ACR102W"
FT                   /product="ACR102Wp"
FT   CDS_pept        535738..538260
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR102W"
FT                   /old_locus_tag="ACR102W"
FT                   /product="ACR102Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR217W
FT                   (RFC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR102W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51328"
FT                   /db_xref="GOA:Q75C15"
FT                   /db_xref="InterPro:IPR001357"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR008921"
FT                   /db_xref="InterPro:IPR012178"
FT                   /db_xref="InterPro:IPR013725"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036420"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C15"
FT                   /protein_id="AAS51328.2"
FT   gene            complement(<538345..>540981)
FT                   /locus_tag="AGOS_ACR103C"
FT                   /old_locus_tag="ACR103C"
FT   mRNA            complement(<538345..>540981)
FT                   /locus_tag="AGOS_ACR103C"
FT                   /old_locus_tag="ACR103C"
FT                   /product="ACR103Cp"
FT   CDS_pept        complement(538345..540981)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR103C"
FT                   /old_locus_tag="ACR103C"
FT                   /product="ACR103Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR219C
FT                   (STE13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR103C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51329"
FT                   /db_xref="GOA:Q75C14"
FT                   /db_xref="InterPro:IPR001375"
FT                   /db_xref="InterPro:IPR002469"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="InterPro:IPR038554"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C14"
FT                   /protein_id="AAS51329.2"
FT                   KFDALSS"
FT   gene            complement(<541331..>542224)
FT                   /locus_tag="AGOS_ACR104C"
FT                   /old_locus_tag="ACR104C"
FT   mRNA            complement(<541331..>542224)
FT                   /locus_tag="AGOS_ACR104C"
FT                   /old_locus_tag="ACR104C"
FT                   /product="ACR104Cp"
FT   CDS_pept        complement(541331..542224)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR104C"
FT                   /old_locus_tag="ACR104C"
FT                   /product="ACR104Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL131W
FT                   (RPL5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR104C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51330"
FT                   /db_xref="GOA:Q75C13"
FT                   /db_xref="InterPro:IPR005485"
FT                   /db_xref="InterPro:IPR025607"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C13"
FT                   /protein_id="AAS51330.1"
FT                   RKARVAAKIAALAAQE"
FT   gene            <542702..>543367
FT                   /locus_tag="AGOS_ACR105W"
FT                   /old_locus_tag="ACR105W"
FT   mRNA            <542702..>543367
FT                   /locus_tag="AGOS_ACR105W"
FT                   /old_locus_tag="ACR105W"
FT                   /product="ACR105Wp"
FT   CDS_pept        542702..543367
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR105W"
FT                   /old_locus_tag="ACR105W"
FT                   /product="ACR105Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR220W
FT                   (RCN2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR105W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51331"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C12"
FT                   /protein_id="AAS51331.1"
FT   gene            complement(<543419..>544219)
FT                   /locus_tag="AGOS_ACR106C"
FT                   /old_locus_tag="ACR106C"
FT   mRNA            complement(<543419..>544219)
FT                   /locus_tag="AGOS_ACR106C"
FT                   /old_locus_tag="ACR106C"
FT                   /product="ACR106Cp"
FT   CDS_pept        complement(543419..544219)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR106C"
FT                   /old_locus_tag="ACR106C"
FT                   /product="ACR106Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL132W
FT                   (COX11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR106C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51332"
FT                   /db_xref="GOA:Q75C11"
FT                   /db_xref="InterPro:IPR007533"
FT                   /db_xref="InterPro:IPR023471"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C11"
FT                   /protein_id="AAS51332.1"
FT   gene            <544400..>545554
FT                   /locus_tag="AGOS_ACR107W"
FT                   /old_locus_tag="ACR107W"
FT   mRNA            <544400..>545554
FT                   /locus_tag="AGOS_ACR107W"
FT                   /old_locus_tag="ACR107W"
FT                   /product="ACR107Wp"
FT   CDS_pept        544400..545554
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR107W"
FT                   /old_locus_tag="ACR107W"
FT                   /product="ACR107Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL133C
FT                   (RDS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR107W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51333"
FT                   /db_xref="GOA:Q75C10"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C10"
FT                   /protein_id="AAS51333.2"
FT   gene            complement(<545574..>546464)
FT                   /locus_tag="AGOS_ACR108C"
FT                   /old_locus_tag="ACR108C"
FT   mRNA            complement(<545574..>546464)
FT                   /locus_tag="AGOS_ACR108C"
FT                   /old_locus_tag="ACR108C"
FT                   /product="ACR108Cp"
FT   CDS_pept        complement(545574..546464)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR108C"
FT                   /old_locus_tag="ACR108C"
FT                   /product="ACR108Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR221C
FT                   (MCT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR108C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51334"
FT                   /db_xref="GOA:Q75CE8"
FT                   /db_xref="InterPro:IPR001227"
FT                   /db_xref="InterPro:IPR016035"
FT                   /db_xref="InterPro:IPR020801"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CE8"
FT                   /protein_id="AAS51334.1"
FT                   LVDRNTGLTASETLD"
FT   gene            <546743..>547642
FT                   /locus_tag="AGOS_ACR109W"
FT                   /old_locus_tag="ACR109W"
FT   mRNA            <546743..>547642
FT                   /locus_tag="AGOS_ACR109W"
FT                   /old_locus_tag="ACR109W"
FT                   /product="ACR109Wp"
FT   CDS_pept        546743..547642
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR109W"
FT                   /old_locus_tag="ACR109W"
FT                   /product="ACR109Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR222W
FT                   (ODC2) and YPL134C (ODC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR109W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51335"
FT                   /db_xref="GOA:Q75CE7"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR002113"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CE7"
FT                   /protein_id="AAS51335.2"
FT                   LVVFTGVLDFCRAIHYGK"
FT   gene            complement(547736..547857)
FT                   /locus_tag="AGOS_AgSNR35"
FT                   /old_locus_tag="AgSNR35"
FT   ncRNA           complement(547736..547857)
FT                   /locus_tag="AGOS_AgSNR35"
FT                   /old_locus_tag="AgSNR35"
FT                   /product="AgSNR35"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR35; start and end coordinates are approximate"
FT                   /ncRNA_class="snRNA"
FT   gene            <548054..>548812
FT                   /locus_tag="AGOS_ACR110W"
FT                   /old_locus_tag="ACR110W"
FT   mRNA            <548054..>548812
FT                   /locus_tag="AGOS_ACR110W"
FT                   /old_locus_tag="ACR110W"
FT                   /product="ACR110Wp"
FT   CDS_pept        548054..548812
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR110W"
FT                   /old_locus_tag="ACR110W"
FT                   /product="ACR110Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOR223W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR110W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51336"
FT                   /db_xref="GOA:Q75C09"
FT                   /db_xref="InterPro:IPR019413"
FT                   /db_xref="InterPro:IPR025390"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C09"
FT                   /protein_id="AAS51336.1"
FT   gene            complement(<548895..>549329)
FT                   /locus_tag="AGOS_ACR111C"
FT                   /old_locus_tag="ACR111C"
FT   mRNA            complement(<548895..>549329)
FT                   /locus_tag="AGOS_ACR111C"
FT                   /old_locus_tag="ACR111C"
FT                   /product="ACR111Cp"
FT   CDS_pept        complement(548895..549329)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR111C"
FT                   /old_locus_tag="ACR111C"
FT                   /product="ACR111Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR224C
FT                   (RPB8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR111C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51337"
FT                   /db_xref="GOA:Q75C08"
FT                   /db_xref="InterPro:IPR005570"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C08"
FT                   /protein_id="AAS51337.1"
FT   gene            complement(<549552..>550016)
FT                   /locus_tag="AGOS_ACR112C"
FT                   /old_locus_tag="ACR112C"
FT   mRNA            complement(<549552..>550016)
FT                   /locus_tag="AGOS_ACR112C"
FT                   /old_locus_tag="ACR112C"
FT                   /product="ACR112Cp"
FT   CDS_pept        complement(549552..550016)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR112C"
FT                   /old_locus_tag="ACR112C"
FT                   /product="ACR112Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL135W
FT                   (ISU1) and YOR226C (ISU2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR112C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51338"
FT                   /db_xref="GOA:Q75C07"
FT                   /db_xref="InterPro:IPR002871"
FT                   /db_xref="InterPro:IPR011339"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C07"
FT                   /protein_id="AAS51338.1"
FT   gene            <550376..>553684
FT                   /locus_tag="AGOS_ACR113W"
FT                   /old_locus_tag="ACR113W"
FT   mRNA            <550376..>553684
FT                   /locus_tag="AGOS_ACR113W"
FT                   /old_locus_tag="ACR113W"
FT                   /product="ACR113Wp"
FT   CDS_pept        550376..553684
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR113W"
FT                   /old_locus_tag="ACR113W"
FT                   /product="ACR113Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR227W
FT                   (HER1) and YPL137C (GIP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR113W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51339"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C06"
FT                   /protein_id="AAS51339.1"
FT   gene            complement(<553751..>554455)
FT                   /locus_tag="AGOS_ACR114C"
FT                   /old_locus_tag="ACR114C"
FT   mRNA            complement(<553751..>554455)
FT                   /locus_tag="AGOS_ACR114C"
FT                   /old_locus_tag="ACR114C"
FT                   /product="ACR114Cp"
FT   CDS_pept        complement(553751..554455)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR114C"
FT                   /old_locus_tag="ACR114C"
FT                   /product="ACR114Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOR228C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR114C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51340"
FT                   /db_xref="GOA:Q75C05"
FT                   /db_xref="InterPro:IPR012472"
FT                   /db_xref="InterPro:IPR039960"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C05"
FT                   /protein_id="AAS51340.1"
FT                   QYHRILQQLLWR"
FT   gene            <554692..>555738
FT                   /locus_tag="AGOS_ACR115W"
FT                   /old_locus_tag="ACR115W"
FT   mRNA            <554692..>555738
FT                   /locus_tag="AGOS_ACR115W"
FT                   /old_locus_tag="ACR115W"
FT                   /product="ACR115Wp"
FT   CDS_pept        554692..555738
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR115W"
FT                   /old_locus_tag="ACR115W"
FT                   /product="ACR115Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL138C
FT                   (SPP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR115W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51341"
FT                   /db_xref="GOA:Q75C04"
FT                   /db_xref="InterPro:IPR001965"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR019786"
FT                   /db_xref="InterPro:IPR019787"
FT                   /db_xref="InterPro:IPR037869"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C04"
FT                   /protein_id="AAS51341.2"
FT                   PRVATPAT"
FT   gene            <555943..>557304
FT                   /locus_tag="AGOS_ACR116W"
FT                   /old_locus_tag="ACR116W"
FT   mRNA            <555943..>557304
FT                   /locus_tag="AGOS_ACR116W"
FT                   /old_locus_tag="ACR116W"
FT                   /product="ACR116Wp"
FT   CDS_pept        555943..557304
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR116W"
FT                   /old_locus_tag="ACR116W"
FT                   /product="ACR116Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL139C
FT                   (UME1), YOR229W (WTM2) and YOR230W (WTM1); Tandem gene
FT                   duplication in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR116W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51342"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C03"
FT                   /protein_id="AAS51342.2"
FT   gene            <557735..>559309
FT                   /locus_tag="AGOS_ACR117W"
FT                   /old_locus_tag="ACR117W"
FT   mRNA            <557735..>559309
FT                   /locus_tag="AGOS_ACR117W"
FT                   /old_locus_tag="ACR117W"
FT                   /product="ACR117Wp"
FT   CDS_pept        557735..559309
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR117W"
FT                   /old_locus_tag="ACR117W"
FT                   /product="ACR117Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR231W
FT                   (MKK1) and YPL140C (MKK2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR117W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51343"
FT                   /db_xref="GOA:Q75C02"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C02"
FT                   /protein_id="AAS51343.1"
FT                   YKCWQAR"
FT   gene            <559468..>560106
FT                   /locus_tag="AGOS_ACR118W"
FT                   /old_locus_tag="ACR118W"
FT   mRNA            <559468..>560106
FT                   /locus_tag="AGOS_ACR118W"
FT                   /old_locus_tag="ACR118W"
FT                   /product="ACR118Wp"
FT   CDS_pept        559468..560106
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR118W"
FT                   /old_locus_tag="ACR118W"
FT                   /product="ACR118Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR232W
FT                   (MGE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR118W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51344"
FT                   /db_xref="GOA:Q75C01"
FT                   /db_xref="InterPro:IPR000740"
FT                   /db_xref="InterPro:IPR009012"
FT                   /db_xref="InterPro:IPR013805"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75C01"
FT                   /protein_id="AAS51344.1"
FT   gene            <560758..>563553
FT                   /locus_tag="AGOS_ACR119W"
FT                   /old_locus_tag="ACR119W"
FT   mRNA            <560758..>563553
FT                   /locus_tag="AGOS_ACR119W"
FT                   /old_locus_tag="ACR119W"
FT                   /product="ACR119Wp"
FT   CDS_pept        560758..563553
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR119W"
FT                   /old_locus_tag="ACR119W"
FT                   /product="ACR119Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL141C
FT                   (FRK1) and YOR233W (KIN4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR119W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51345"
FT                   /db_xref="GOA:Q75C00"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q75C00"
FT                   /protein_id="AAS51345.2"
FT                   I"
FT   gene            complement(<563768..>564320)
FT                   /locus_tag="AGOS_ACR120C"
FT                   /old_locus_tag="ACR120C"
FT   mRNA            complement(join(<563768..564072,564302..>564320))
FT                   /locus_tag="AGOS_ACR120C"
FT                   /old_locus_tag="ACR120C"
FT                   /product="ACR120Cp"
FT   CDS_pept        complement(join(563768..564072,564302..564320))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR120C"
FT                   /old_locus_tag="ACR120C"
FT                   /product="ACR120Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL143W
FT                   (RPL33A) and YOR234C (RPL33B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR120C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51346"
FT                   /db_xref="GOA:Q75BZ9"
FT                   /db_xref="InterPro:IPR001780"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR018266"
FT                   /db_xref="InterPro:IPR038661"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BZ9"
FT                   /protein_id="AAS51346.1"
FT                   SNI"
FT   gene            565017..565319
FT                   /locus_tag="AGOS_AgSNR17"
FT                   /old_locus_tag="AgSNR17"
FT   ncRNA           565017..565319
FT                   /locus_tag="AGOS_AgSNR17"
FT                   /old_locus_tag="AgSNR17"
FT                   /product="AgSNR17"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR17; start and end coordinates are approximate"
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<565394..>567424)
FT                   /locus_tag="AGOS_ACR122C"
FT                   /old_locus_tag="ACR122C"
FT   mRNA            complement(<565394..>567424)
FT                   /locus_tag="AGOS_ACR122C"
FT                   /old_locus_tag="ACR122C"
FT                   /product="ACR122Cp"
FT   CDS_pept        complement(565394..567424)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR122C"
FT                   /old_locus_tag="ACR122C"
FT                   /product="ACR122Cp"
FT                   /note="NOHBY324; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0D07414g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR122C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51348"
FT                   /db_xref="GOA:Q75BZ7"
FT                   /db_xref="InterPro:IPR000960"
FT                   /db_xref="InterPro:IPR020946"
FT                   /db_xref="InterPro:IPR036188"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BZ7"
FT                   /protein_id="AAS51348.2"
FT   gene            complement(<567776..>568162)
FT                   /locus_tag="AGOS_ACR123C"
FT                   /old_locus_tag="ACR123C"
FT   mRNA            complement(<567776..>568162)
FT                   /locus_tag="AGOS_ACR123C"
FT                   /old_locus_tag="ACR123C"
FT                   /product="ACR123Cp"
FT   CDS_pept        complement(567776..568162)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR123C"
FT                   /old_locus_tag="ACR123C"
FT                   /product="ACR123Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL144W
FT                   (POC4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR123C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51349"
FT                   /db_xref="InterPro:IPR018854"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BZ6"
FT                   /protein_id="AAS51349.1"
FT   gene            <568310..>568945
FT                   /locus_tag="AGOS_ACR124W"
FT                   /old_locus_tag="ACR124W"
FT   mRNA            <568310..>568945
FT                   /locus_tag="AGOS_ACR124W"
FT                   /old_locus_tag="ACR124W"
FT                   /product="ACR124Wp"
FT   CDS_pept        568310..568945
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR124W"
FT                   /old_locus_tag="ACR124W"
FT                   /product="ACR124Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR236W
FT                   (DFR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR124W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51350"
FT                   /db_xref="GOA:Q75BZ5"
FT                   /db_xref="InterPro:IPR001796"
FT                   /db_xref="InterPro:IPR012259"
FT                   /db_xref="InterPro:IPR017925"
FT                   /db_xref="InterPro:IPR024072"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BZ5"
FT                   /protein_id="AAS51350.1"
FT   gene            <569250..>570512
FT                   /locus_tag="AGOS_ACR125W"
FT                   /old_locus_tag="ACR125W"
FT   mRNA            <569250..>570512
FT                   /locus_tag="AGOS_ACR125W"
FT                   /old_locus_tag="ACR125W"
FT                   /product="ACR125Wp"
FT   CDS_pept        569250..570512
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR125W"
FT                   /old_locus_tag="ACR125W"
FT                   /product="ACR125Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL145C
FT                   (KES1) and YOR237W (HES1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR125W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51351"
FT                   /db_xref="GOA:Q75BZ4"
FT                   /db_xref="InterPro:IPR000648"
FT                   /db_xref="InterPro:IPR018494"
FT                   /db_xref="InterPro:IPR037239"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BZ4"
FT                   /protein_id="AAS51351.1"
FT   gene            <570851..>572161
FT                   /locus_tag="AGOS_ACR126W"
FT                   /old_locus_tag="ACR126W"
FT   mRNA            <570851..>572161
FT                   /locus_tag="AGOS_ACR126W"
FT                   /old_locus_tag="ACR126W"
FT                   /product="ACR126Wp"
FT   CDS_pept        570851..572161
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR126W"
FT                   /old_locus_tag="ACR126W"
FT                   /product="ACR126Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL146C
FT                   (NOP53)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR126W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51352"
FT                   /db_xref="GOA:Q75BZ3"
FT                   /db_xref="InterPro:IPR011687"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BZ3"
FT                   /protein_id="AAS51352.1"
FT   gene            <572283..>573182
FT                   /locus_tag="AGOS_ACR127W"
FT                   /old_locus_tag="ACR127W"
FT   mRNA            <572283..>573182
FT                   /locus_tag="AGOS_ACR127W"
FT                   /old_locus_tag="ACR127W"
FT                   /product="ACR127Wp"
FT   CDS_pept        572283..573182
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR127W"
FT                   /old_locus_tag="ACR127W"
FT                   /product="ACR127Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOR238W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR127W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51353"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BZ2"
FT                   /protein_id="AAS51353.1"
FT                   NDATYYNASIKSKMPWSQ"
FT   gene            complement(<573248..>575734)
FT                   /locus_tag="AGOS_ACR128C"
FT                   /old_locus_tag="ACR128C"
FT   mRNA            complement(<573248..>575734)
FT                   /locus_tag="AGOS_ACR128C"
FT                   /old_locus_tag="ACR128C"
FT                   /product="ACR128Cp"
FT   CDS_pept        complement(573248..575734)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR128C"
FT                   /old_locus_tag="ACR128C"
FT                   /product="ACR128Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL147W
FT                   (PXA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR128C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51354"
FT                   /db_xref="GOA:Q75CE2"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR011527"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036640"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CE2"
FT                   /protein_id="AAS51354.2"
FT                   DAWEKEREELKRKLTH"
FT   gene            <576334..>576858
FT                   /locus_tag="AGOS_ACR129W"
FT                   /old_locus_tag="ACR129W"
FT   mRNA            <576334..>576858
FT                   /locus_tag="AGOS_ACR129W"
FT                   /old_locus_tag="ACR129W"
FT                   /product="ACR129Wp"
FT   CDS_pept        576334..576858
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR129W"
FT                   /old_locus_tag="ACR129W"
FT                   /product="ACR129Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL148C
FT                   (PPT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR129W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51355"
FT                   /db_xref="GOA:Q75BZ1"
FT                   /db_xref="InterPro:IPR008278"
FT                   /db_xref="InterPro:IPR016614"
FT                   /db_xref="InterPro:IPR037143"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BZ1"
FT                   /protein_id="AAS51355.2"
FT                   PDERQRITKNS"
FT   gene            <577065..>578778
FT                   /locus_tag="AGOS_ACR130W"
FT                   /old_locus_tag="ACR130W"
FT   mRNA            <577065..>578778
FT                   /locus_tag="AGOS_ACR130W"
FT                   /old_locus_tag="ACR130W"
FT                   /product="ACR130Wp"
FT   CDS_pept        join(577065..577709,577711..578778)
FT                   /codon_start=1
FT                   /ribosomal_slippage
FT                   /locus_tag="AGOS_ACR130W"
FT                   /old_locus_tag="ACR130W"
FT                   /product="ACR130Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR239W
FT                   (ABP140); no intron, ribosomal slippage at consensus
FT                   CTTAGGC site"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR130W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51356"
FT                   /db_xref="GOA:Q75BZ0"
FT                   /db_xref="InterPro:IPR026113"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BZ0"
FT                   /protein_id="AAS51356.2"
FT   gene            complement(<578869..>579750)
FT                   /locus_tag="AGOS_ACR131C"
FT                   /old_locus_tag="ACR131C"
FT   mRNA            complement(<578869..>579750)
FT                   /locus_tag="AGOS_ACR131C"
FT                   /old_locus_tag="ACR131C"
FT                   /product="ACR131Cp"
FT   CDS_pept        complement(578869..579750)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR131C"
FT                   /old_locus_tag="ACR131C"
FT                   /product="ACR131Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL149W
FT                   (ATG5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR131C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51357"
FT                   /db_xref="GOA:Q75BY9"
FT                   /db_xref="InterPro:IPR007239"
FT                   /db_xref="InterPro:IPR042526"
FT                   /db_xref="InterPro:IPR042527"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BY9"
FT                   /protein_id="AAS51357.2"
FT                   ICSPVALIIPTT"
FT   gene            <579893..>581434
FT                   /locus_tag="AGOS_ACR132W"
FT                   /old_locus_tag="ACR132W"
FT   mRNA            <579893..>581434
FT                   /locus_tag="AGOS_ACR132W"
FT                   /old_locus_tag="ACR132W"
FT                   /product="ACR132Wp"
FT   CDS_pept        579893..581434
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR132W"
FT                   /old_locus_tag="ACR132W"
FT                   /product="ACR132Wp"
FT                   /note="NOHBY325; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F11341g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR132W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51358"
FT                   /db_xref="GOA:Q75BY8"
FT                   /db_xref="InterPro:IPR010770"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BY8"
FT                   /protein_id="AAS51358.1"
FT   gene            complement(<581468..>584023)
FT                   /locus_tag="AGOS_ACR133C"
FT                   /old_locus_tag="ACR133C"
FT   mRNA            complement(<581468..>584023)
FT                   /locus_tag="AGOS_ACR133C"
FT                   /old_locus_tag="ACR133C"
FT                   /product="ACR133Cp"
FT   CDS_pept        complement(581468..584023)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR133C"
FT                   /old_locus_tag="ACR133C"
FT                   /product="ACR133Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL150W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR133C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51359"
FT                   /db_xref="GOA:Q75BY7"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BY7"
FT                   /protein_id="AAS51359.1"
FT   gene            <584443..>585897
FT                   /locus_tag="AGOS_ACR134W"
FT                   /old_locus_tag="ACR134W"
FT   mRNA            <584443..>585897
FT                   /locus_tag="AGOS_ACR134W"
FT                   /old_locus_tag="ACR134W"
FT                   /product="ACR134Wp"
FT   CDS_pept        584443..585897
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR134W"
FT                   /old_locus_tag="ACR134W"
FT                   /product="ACR134Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR241W
FT                   (MET7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR134W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51360"
FT                   /db_xref="GOA:Q75BY6"
FT                   /db_xref="InterPro:IPR001645"
FT                   /db_xref="InterPro:IPR018109"
FT                   /db_xref="InterPro:IPR023600"
FT                   /db_xref="InterPro:IPR036565"
FT                   /db_xref="InterPro:IPR036615"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BY6"
FT                   /protein_id="AAS51360.2"
FT   gene            complement(<585997..>587127)
FT                   /locus_tag="AGOS_ACR135C"
FT                   /old_locus_tag="ACR135C"
FT   mRNA            complement(<585997..>587127)
FT                   /locus_tag="AGOS_ACR135C"
FT                   /old_locus_tag="ACR135C"
FT                   /product="ACR135Cp"
FT   CDS_pept        complement(585997..587127)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR135C"
FT                   /old_locus_tag="ACR135C"
FT                   /product="ACR135Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR242C
FT                   (SSP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR135C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51361"
FT                   /db_xref="GOA:Q75BY5"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR034250"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BY5"
FT                   /protein_id="AAS51361.1"
FT   gene            complement(<587810..>589843)
FT                   /locus_tag="AGOS_ACR136C"
FT                   /old_locus_tag="ACR136C"
FT   mRNA            complement(<587810..>589843)
FT                   /locus_tag="AGOS_ACR136C"
FT                   /old_locus_tag="ACR136C"
FT                   /product="ACR136Cp"
FT   CDS_pept        complement(587810..589843)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR136C"
FT                   /old_locus_tag="ACR136C"
FT                   /product="ACR136Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR243C
FT                   (PUS7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR136C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51362"
FT                   /db_xref="GOA:Q75BY4"
FT                   /db_xref="InterPro:IPR001656"
FT                   /db_xref="InterPro:IPR011760"
FT                   /db_xref="InterPro:IPR020103"
FT                   /db_xref="InterPro:IPR020119"
FT                   /db_xref="InterPro:IPR042214"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BY4"
FT                   /protein_id="AAS51362.1"
FT   gene            <590077..>591354
FT                   /locus_tag="AGOS_ACR137W"
FT                   /old_locus_tag="ACR137W"
FT   mRNA            <590077..>591354
FT                   /locus_tag="AGOS_ACR137W"
FT                   /old_locus_tag="ACR137W"
FT                   /product="ACR137Wp"
FT   CDS_pept        590077..591354
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR137W"
FT                   /old_locus_tag="ACR137W"
FT                   /product="ACR137Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL151C
FT                   (PRP46)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR137W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51363"
FT                   /db_xref="GOA:Q75BY3"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BY3"
FT                   /protein_id="AAS51363.2"
FT   gene            <591528..>592835
FT                   /locus_tag="AGOS_ACR138W"
FT                   /old_locus_tag="ACR138W"
FT   mRNA            <591528..>592835
FT                   /locus_tag="AGOS_ACR138W"
FT                   /old_locus_tag="ACR138W"
FT                   /product="ACR138Wp"
FT   CDS_pept        591528..592835
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR138W"
FT                   /old_locus_tag="ACR138W"
FT                   /product="ACR138Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR244W
FT                   (ESA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR138W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51364"
FT                   /db_xref="GOA:Q75BY2"
FT                   /db_xref="InterPro:IPR002717"
FT                   /db_xref="InterPro:IPR016181"
FT                   /db_xref="InterPro:IPR016197"
FT                   /db_xref="InterPro:IPR025995"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR037995"
FT                   /db_xref="InterPro:IPR040706"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BY2"
FT                   /protein_id="AAS51364.2"
FT   gene            complement(<592864..>593943)
FT                   /locus_tag="AGOS_ACR139C"
FT                   /old_locus_tag="ACR139C"
FT   mRNA            complement(<592864..>593943)
FT                   /locus_tag="AGOS_ACR139C"
FT                   /old_locus_tag="ACR139C"
FT                   /product="ACR139Cp"
FT   CDS_pept        complement(592864..593943)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR139C"
FT                   /old_locus_tag="ACR139C"
FT                   /product="ACR139Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL152W
FT                   (RRD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR139C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51365"
FT                   /db_xref="GOA:Q75BY1"
FT                   /db_xref="InterPro:IPR004327"
FT                   /db_xref="InterPro:IPR037218"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BY1"
FT                   /protein_id="AAS51365.1"
FT   gene            complement(<594117..>595502)
FT                   /locus_tag="AGOS_ACR140C"
FT                   /old_locus_tag="ACR140C"
FT   mRNA            complement(<594117..>595502)
FT                   /locus_tag="AGOS_ACR140C"
FT                   /old_locus_tag="ACR140C"
FT                   /product="ACR140Cp"
FT   CDS_pept        complement(594117..595502)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR140C"
FT                   /old_locus_tag="ACR140C"
FT                   /product="ACR140Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR245C
FT                   (DGA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR140C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51366"
FT                   /db_xref="GOA:Q75BY0"
FT                   /db_xref="InterPro:IPR007130"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BY0"
FT                   /protein_id="AAS51366.1"
FT                   IVE"
FT   gene            <595694..>597385
FT                   /locus_tag="AGOS_ACR141W"
FT                   /old_locus_tag="ACR141W"
FT   mRNA            <595694..>597385
FT                   /locus_tag="AGOS_ACR141W"
FT                   /old_locus_tag="ACR141W"
FT                   /product="ACR141Wp"
FT   CDS_pept        595694..597385
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR141W"
FT                   /old_locus_tag="ACR141W"
FT                   /product="ACR141Wp"
FT                   /note="NOHBY326; Non-syntenic homolog of Saccharomyces
FT                   cerevisiae YKL201C (MNN4) and YJR061W; Syntenic homolog of
FT                   Saccharomyces kluyveri SAKL0H06556g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR141W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51367"
FT                   /db_xref="GOA:Q75BX9"
FT                   /db_xref="InterPro:IPR007074"
FT                   /db_xref="InterPro:IPR009644"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BX9"
FT                   /protein_id="AAS51367.2"
FT   gene            <597519..>600062
FT                   /locus_tag="AGOS_ACR142W"
FT                   /old_locus_tag="ACR142W"
FT   mRNA            <597519..>600062
FT                   /locus_tag="AGOS_ACR142W"
FT                   /old_locus_tag="ACR142W"
FT                   /product="ACR142Wp"
FT   CDS_pept        597519..600062
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR142W"
FT                   /old_locus_tag="ACR142W"
FT                   /product="ACR142Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL153C
FT                   (RAD53)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR142W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51368"
FT                   /db_xref="GOA:Q75CE9"
FT                   /db_xref="InterPro:IPR000253"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR008984"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR016256"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q75CE9"
FT                   /protein_id="AAS51368.2"
FT   gene            <601368..>602549
FT                   /locus_tag="AGOS_ACR143W"
FT                   /old_locus_tag="ACR143W"
FT   mRNA            <601368..>602549
FT                   /locus_tag="AGOS_ACR143W"
FT                   /old_locus_tag="ACR143W"
FT                   /product="ACR143Wp"
FT   CDS_pept        601368..602549
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR143W"
FT                   /old_locus_tag="ACR143W"
FT                   /product="ACR143Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL154C
FT                   (PEP4); Tandem gene duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR143W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51369"
FT                   /db_xref="GOA:Q75BX8"
FT                   /db_xref="InterPro:IPR001461"
FT                   /db_xref="InterPro:IPR001969"
FT                   /db_xref="InterPro:IPR021109"
FT                   /db_xref="InterPro:IPR033121"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BX8"
FT                   /protein_id="AAS51369.1"
FT   gene            <603305..>604531
FT                   /locus_tag="AGOS_ACR144W"
FT                   /old_locus_tag="ACR144W"
FT   mRNA            <603305..>604531
FT                   /locus_tag="AGOS_ACR144W"
FT                   /old_locus_tag="ACR144W"
FT                   /product="ACR144Wp"
FT   CDS_pept        603305..604531
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR144W"
FT                   /old_locus_tag="ACR144W"
FT                   /product="ACR144Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL154C
FT                   (PEP4); Tandem gene duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR144W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51370"
FT                   /db_xref="GOA:Q75BX7"
FT                   /db_xref="InterPro:IPR001461"
FT                   /db_xref="InterPro:IPR001969"
FT                   /db_xref="InterPro:IPR021109"
FT                   /db_xref="InterPro:IPR033121"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BX7"
FT                   /protein_id="AAS51370.1"
FT                   NAVGLATAV"
FT   gene            <605113..>607170
FT                   /locus_tag="AGOS_ACR145W"
FT                   /old_locus_tag="ACR145W"
FT   mRNA            <605113..>607170
FT                   /locus_tag="AGOS_ACR145W"
FT                   /old_locus_tag="ACR145W"
FT                   /product="ACR145Wp"
FT   CDS_pept        605113..607170
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR145W"
FT                   /old_locus_tag="ACR145W"
FT                   /product="ACR145Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL155C
FT                   (KIP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR145W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51371"
FT                   /db_xref="GOA:Q8J1G1"
FT                   /db_xref="InterPro:IPR001752"
FT                   /db_xref="InterPro:IPR019821"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR027640"
FT                   /db_xref="InterPro:IPR036961"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8J1G1"
FT                   /protein_id="AAS51371.1"
FT   gene            <607724..>608365
FT                   /locus_tag="AGOS_ACR146W"
FT                   /old_locus_tag="ACR146W"
FT   mRNA            <607724..>608365
FT                   /locus_tag="AGOS_ACR146W"
FT                   /old_locus_tag="ACR146W"
FT                   /product="ACR146Wp"
FT   CDS_pept        607724..608365
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR146W"
FT                   /old_locus_tag="ACR146W"
FT                   /product="ACR146Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL156C
FT                   (PRM4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR146W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51372"
FT                   /db_xref="GOA:Q75BX5"
FT                   /db_xref="InterPro:IPR002109"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BX5"
FT                   /protein_id="AAS51372.1"
FT   gene            complement(<608411..>609346)
FT                   /locus_tag="AGOS_ACR147C"
FT                   /old_locus_tag="ACR147C"
FT   mRNA            complement(<608411..>609346)
FT                   /locus_tag="AGOS_ACR147C"
FT                   /old_locus_tag="ACR147C"
FT                   /product="ACR147Cp"
FT   CDS_pept        complement(608411..609346)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR147C"
FT                   /old_locus_tag="ACR147C"
FT                   /product="ACR147Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL157W
FT                   (TGS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR147C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51373"
FT                   /db_xref="GOA:Q75BX4"
FT                   /db_xref="InterPro:IPR019012"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BX4"
FT                   /protein_id="AAS51373.1"
FT   gene            <609871..>611700
FT                   /locus_tag="AGOS_ACR148W"
FT                   /old_locus_tag="ACR148W"
FT   mRNA            <609871..>611700
FT                   /locus_tag="AGOS_ACR148W"
FT                   /old_locus_tag="ACR148W"
FT                   /product="ACR148Wp"
FT   CDS_pept        609871..611700
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR148W"
FT                   /old_locus_tag="ACR148W"
FT                   /product="ACR148Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL158C
FT                   (AIM44)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR148W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51374"
FT                   /db_xref="GOA:Q75BX3"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BX3"
FT                   /protein_id="AAS51374.1"
FT   gene            complement(<611921..>613288)
FT                   /locus_tag="AGOS_ACR149C"
FT                   /old_locus_tag="ACR149C"
FT   mRNA            complement(<611921..>613288)
FT                   /locus_tag="AGOS_ACR149C"
FT                   /old_locus_tag="ACR149C"
FT                   /product="ACR149Cp"
FT   CDS_pept        complement(611921..613288)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR149C"
FT                   /old_locus_tag="ACR149C"
FT                   /product="ACR149Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YMR210W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR149C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51375"
FT                   /db_xref="GOA:Q75BX2"
FT                   /db_xref="InterPro:IPR000073"
FT                   /db_xref="InterPro:IPR000952"
FT                   /db_xref="InterPro:IPR012020"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BX2"
FT                   /protein_id="AAS51375.1"
FT   gene            <614406..>616067
FT                   /locus_tag="AGOS_ACR150W"
FT                   /old_locus_tag="ACR150W"
FT   mRNA            <614406..>616067
FT                   /locus_tag="AGOS_ACR150W"
FT                   /old_locus_tag="ACR150W"
FT                   /product="ACR150Wp"
FT   CDS_pept        614406..616067
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR150W"
FT                   /old_locus_tag="ACR150W"
FT                   /product="ACR150Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR349C
FT                   (YPS7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR150W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51376"
FT                   /db_xref="GOA:Q75BX1"
FT                   /db_xref="InterPro:IPR001461"
FT                   /db_xref="InterPro:IPR021109"
FT                   /db_xref="InterPro:IPR033121"
FT                   /db_xref="InterPro:IPR034164"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BX1"
FT                   /protein_id="AAS51376.1"
FT   gene            <616344..>618995
FT                   /locus_tag="AGOS_ACR151W"
FT                   /old_locus_tag="ACR151W"
FT   mRNA            <616344..>618995
FT                   /locus_tag="AGOS_ACR151W"
FT                   /old_locus_tag="ACR151W"
FT                   /product="ACR151Wp"
FT   CDS_pept        616344..618995
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR151W"
FT                   /old_locus_tag="ACR151W"
FT                   /product="ACR151Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR098C
FT                   (SFB3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR151W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51377"
FT                   /db_xref="GOA:Q75BX0"
FT                   /db_xref="InterPro:IPR006895"
FT                   /db_xref="InterPro:IPR006896"
FT                   /db_xref="InterPro:IPR006900"
FT                   /db_xref="InterPro:IPR007123"
FT                   /db_xref="InterPro:IPR012990"
FT                   /db_xref="InterPro:IPR029006"
FT                   /db_xref="InterPro:IPR036174"
FT                   /db_xref="InterPro:IPR036175"
FT                   /db_xref="InterPro:IPR036180"
FT                   /db_xref="InterPro:IPR036465"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BX0"
FT                   /protein_id="AAS51377.2"
FT                   DHDSLAQRYIQF"
FT   gene            <619128..>620662
FT                   /locus_tag="AGOS_ACR152W"
FT                   /old_locus_tag="ACR152W"
FT   mRNA            join(<619128..619402,619579..>620662)
FT                   /locus_tag="AGOS_ACR152W"
FT                   /old_locus_tag="ACR152W"
FT                   /product="ACR152Wp"
FT   CDS_pept        join(619128..619402,619579..620662)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR152W"
FT                   /old_locus_tag="ACR152W"
FT                   /product="ACR152Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR348C
FT                   (PAL1) and YHR097C; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR152W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51378"
FT                   /db_xref="GOA:Q75BW9"
FT                   /db_xref="InterPro:IPR013226"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BW9"
FT                   /protein_id="AAS51378.1"
FT   gene            complement(<620924..>621865)
FT                   /locus_tag="AGOS_ACR153C"
FT                   /old_locus_tag="ACR153C"
FT   mRNA            complement(<620924..>621865)
FT                   /locus_tag="AGOS_ACR153C"
FT                   /old_locus_tag="ACR153C"
FT                   /product="ACR153Cp"
FT   CDS_pept        complement(620924..621865)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR153C"
FT                   /old_locus_tag="ACR153C"
FT                   /product="ACR153Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR347W
FT                   (MRP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR153C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51379"
FT                   /db_xref="GOA:Q75BW8"
FT                   /db_xref="InterPro:IPR019832"
FT                   /db_xref="InterPro:IPR036314"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BW8"
FT                   /protein_id="AAS51379.1"
FT   gene            <621993..>623348
FT                   /locus_tag="AGOS_ACR154W"
FT                   /old_locus_tag="ACR154W"
FT   mRNA            <621993..>623348
FT                   /locus_tag="AGOS_ACR154W"
FT                   /old_locus_tag="ACR154W"
FT                   /product="ACR154Wp"
FT   CDS_pept        621993..623348
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR154W"
FT                   /old_locus_tag="ACR154W"
FT                   /product="ACR154Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL120W
FT                   (VPS30)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR154W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51380"
FT                   /db_xref="GOA:Q75BW7"
FT                   /db_xref="InterPro:IPR007243"
FT                   /db_xref="InterPro:IPR038274"
FT                   /db_xref="InterPro:IPR040455"
FT                   /db_xref="InterPro:IPR041691"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BW7"
FT                   /protein_id="AAS51380.1"
FT   gene            <623556..>626150
FT                   /locus_tag="AGOS_ACR155W"
FT                   /old_locus_tag="ACR155W"
FT   mRNA            <623556..>626150
FT                   /locus_tag="AGOS_ACR155W"
FT                   /old_locus_tag="ACR155W"
FT                   /product="ACR155Wp"
FT   CDS_pept        623556..626150
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR155W"
FT                   /old_locus_tag="ACR155W"
FT                   /product="ACR155Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIL066C (RNR3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR155W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51381"
FT                   /db_xref="GOA:Q75BW6"
FT                   /db_xref="InterPro:IPR000788"
FT                   /db_xref="InterPro:IPR005144"
FT                   /db_xref="InterPro:IPR008926"
FT                   /db_xref="InterPro:IPR013346"
FT                   /db_xref="InterPro:IPR013509"
FT                   /db_xref="InterPro:IPR039718"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BW6"
FT                   /protein_id="AAS51381.1"
FT   gene            <626486..>627364
FT                   /locus_tag="AGOS_ACR156W"
FT                   /old_locus_tag="ACR156W"
FT   mRNA            <626486..>627364
FT                   /locus_tag="AGOS_ACR156W"
FT                   /old_locus_tag="ACR156W"
FT                   /product="ACR156Wp"
FT   CDS_pept        626486..627364
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR156W"
FT                   /old_locus_tag="ACR156W"
FT                   /product="ACR156Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL123C
FT                   (RNY1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR156W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51382"
FT                   /db_xref="GOA:Q75BW5"
FT                   /db_xref="InterPro:IPR001568"
FT                   /db_xref="InterPro:IPR033130"
FT                   /db_xref="InterPro:IPR033697"
FT                   /db_xref="InterPro:IPR036430"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BW5"
FT                   /protein_id="AAS51382.1"
FT                   GKIYWIPKSGC"
FT   gene            complement(<627594..>628475)
FT                   /locus_tag="AGOS_ACR157C"
FT                   /old_locus_tag="ACR157C"
FT   mRNA            complement(<627594..>628475)
FT                   /locus_tag="AGOS_ACR157C"
FT                   /old_locus_tag="ACR157C"
FT                   /product="ACR157Cp"
FT   CDS_pept        complement(627594..628475)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR157C"
FT                   /old_locus_tag="ACR157C"
FT                   /product="ACR157Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL124W
FT                   (SPC29)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR157C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51383"
FT                   /db_xref="GOA:Q75BW4"
FT                   /db_xref="InterPro:IPR031392"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BW4"
FT                   /protein_id="AAS51383.1"
FT                   LIQMSAGGKQKW"
FT   gene            <629138..>631540
FT                   /locus_tag="AGOS_ACR158W"
FT                   /old_locus_tag="ACR158W"
FT   mRNA            <629138..>631540
FT                   /locus_tag="AGOS_ACR158W"
FT                   /old_locus_tag="ACR158W"
FT                   /product="ACR158Wp"
FT   CDS_pept        629138..631540
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR158W"
FT                   /old_locus_tag="ACR158W"
FT                   /product="ACR158Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR208W
FT                   (PTP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR158W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51384"
FT                   /db_xref="GOA:Q75BW3"
FT                   /db_xref="InterPro:IPR000242"
FT                   /db_xref="InterPro:IPR000387"
FT                   /db_xref="InterPro:IPR003595"
FT                   /db_xref="InterPro:IPR016130"
FT                   /db_xref="InterPro:IPR029021"
FT                   /db_xref="InterPro:IPR036873"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BW3"
FT                   /protein_id="AAS51384.2"
FT   gene            complement(<631648..>634725)
FT                   /locus_tag="AGOS_ACR159C"
FT                   /old_locus_tag="ACR159C"
FT   mRNA            complement(<631648..>634725)
FT                   /locus_tag="AGOS_ACR159C"
FT                   /old_locus_tag="ACR159C"
FT                   /product="ACR159Cp"
FT   CDS_pept        complement(631648..634725)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR159C"
FT                   /old_locus_tag="ACR159C"
FT                   /product="ACR159Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL125W
FT                   (KAP120)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR159C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51385"
FT                   /db_xref="GOA:Q75BW2"
FT                   /db_xref="InterPro:IPR001494"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BW2"
FT                   /protein_id="AAS51385.2"
FT   gene            complement(<634983..>636275)
FT                   /locus_tag="AGOS_ACR160C"
FT                   /old_locus_tag="ACR160C"
FT   mRNA            complement(<634983..>636275)
FT                   /locus_tag="AGOS_ACR160C"
FT                   /old_locus_tag="ACR160C"
FT                   /product="ACR160Cp"
FT   CDS_pept        complement(634983..636275)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR160C"
FT                   /old_locus_tag="ACR160C"
FT                   /product="ACR160Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR209C
FT                   (NPT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR160C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51386"
FT                   /db_xref="GOA:Q75BW1"
FT                   /db_xref="InterPro:IPR006406"
FT                   /db_xref="InterPro:IPR007229"
FT                   /db_xref="InterPro:IPR036068"
FT                   /db_xref="InterPro:IPR040727"
FT                   /db_xref="InterPro:IPR041525"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BW1"
FT                   /protein_id="AAS51386.1"
FT   gene            complement(<636665..>637162)
FT                   /locus_tag="AGOS_ACR161C"
FT                   /old_locus_tag="ACR161C"
FT   mRNA            complement(<636665..>637162)
FT                   /locus_tag="AGOS_ACR161C"
FT                   /old_locus_tag="ACR161C"
FT                   /product="ACR161Cp"
FT   CDS_pept        complement(636665..637162)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR161C"
FT                   /old_locus_tag="ACR161C"
FT                   /product="ACR161Cp"
FT                   /note="NOHBY327; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR161C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51387"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BW0"
FT                   /protein_id="AAS51387.1"
FT                   DD"
FT   gene            complement(<637647..>640229)
FT                   /locus_tag="AGOS_ACR162C"
FT                   /old_locus_tag="ACR162C"
FT   mRNA            complement(<637647..>640229)
FT                   /locus_tag="AGOS_ACR162C"
FT                   /old_locus_tag="ACR162C"
FT                   /product="ACR162Cp"
FT   CDS_pept        complement(637647..640229)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR162C"
FT                   /old_locus_tag="ACR162C"
FT                   /product="ACR162Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL126W
FT                   (NAN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR162C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51388"
FT                   /db_xref="GOA:Q75BV9"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR011044"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BV9"
FT                   /protein_id="AAS51388.1"
FT   gene            <640498..>640710
FT                   /locus_tag="AGOS_ACR163W"
FT                   /old_locus_tag="ACR163W"
FT   mRNA            <640498..>640710
FT                   /locus_tag="AGOS_ACR163W"
FT                   /old_locus_tag="ACR163W"
FT                   /product="ACR163Wp"
FT   CDS_pept        640498..640710
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR163W"
FT                   /old_locus_tag="ACR163W"
FT                   /product="ACR163Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR210W
FT                   (RPB10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR163W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51389"
FT                   /db_xref="GOA:Q75BV8"
FT                   /db_xref="InterPro:IPR000268"
FT                   /db_xref="InterPro:IPR020789"
FT                   /db_xref="InterPro:IPR023580"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BV8"
FT                   /protein_id="AAS51389.1"
FT   gene            complement(<640837..>643443)
FT                   /locus_tag="AGOS_ACR164C"
FT                   /old_locus_tag="ACR164C"
FT   mRNA            complement(<640837..>643443)
FT                   /locus_tag="AGOS_ACR164C"
FT                   /old_locus_tag="ACR164C"
FT                   /product="ACR164Cp"
FT   CDS_pept        complement(640837..643443)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR164C"
FT                   /old_locus_tag="ACR164C"
FT                   /product="ACR164Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR211C
FT                   (MGM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR164C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51390"
FT                   /db_xref="GOA:Q75BV7"
FT                   /db_xref="InterPro:IPR001401"
FT                   /db_xref="InterPro:IPR019762"
FT                   /db_xref="InterPro:IPR020850"
FT                   /db_xref="InterPro:IPR022812"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR030381"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BV7"
FT                   /protein_id="AAS51390.2"
FT   gene            <644234..>647653
FT                   /locus_tag="AGOS_ACR165W"
FT                   /old_locus_tag="ACR165W"
FT   mRNA            <644234..>647653
FT                   /locus_tag="AGOS_ACR165W"
FT                   /old_locus_tag="ACR165W"
FT                   /product="ACR165Wp"
FT   CDS_pept        644234..647653
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR165W"
FT                   /old_locus_tag="ACR165W"
FT                   /product="ACR165Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL020C
FT                   (SPT23) and YIR033W (MGA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR165W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51391"
FT                   /db_xref="GOA:Q75BV6"
FT                   /db_xref="InterPro:IPR002110"
FT                   /db_xref="InterPro:IPR002909"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014756"
FT                   /db_xref="InterPro:IPR020683"
FT                   /db_xref="InterPro:IPR036770"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BV6"
FT                   /protein_id="AAS51391.1"
FT   gene            <647938..>649107
FT                   /locus_tag="AGOS_ACR166W"
FT                   /old_locus_tag="ACR166W"
FT   mRNA            <647938..>649107
FT                   /locus_tag="AGOS_ACR166W"
FT                   /old_locus_tag="ACR166W"
FT                   /product="ACR166Wp"
FT   CDS_pept        647938..649107
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR166W"
FT                   /old_locus_tag="ACR166W"
FT                   /product="ACR166Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL021C
FT                   (MAK11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR166W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51392"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BV5"
FT                   /protein_id="AAS51392.2"
FT   gene            complement(<649160..>650278)
FT                   /locus_tag="AGOS_ACR167C"
FT                   /old_locus_tag="ACR167C"
FT   mRNA            complement(<649160..>650278)
FT                   /locus_tag="AGOS_ACR167C"
FT                   /old_locus_tag="ACR167C"
FT                   /product="ACR167Cp"
FT   CDS_pept        complement(649160..650278)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR167C"
FT                   /old_locus_tag="ACR167C"
FT                   /product="ACR167Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIR034C
FT                   (LYS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR167C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51393"
FT                   /db_xref="GOA:Q75BV4"
FT                   /db_xref="InterPro:IPR007698"
FT                   /db_xref="InterPro:IPR007886"
FT                   /db_xref="InterPro:IPR027281"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BV4"
FT                   /protein_id="AAS51393.1"
FT   gene            <650620..>652743
FT                   /locus_tag="AGOS_ACR168W"
FT                   /old_locus_tag="ACR168W"
FT   mRNA            <650620..>652743
FT                   /locus_tag="AGOS_ACR168W"
FT                   /old_locus_tag="ACR168W"
FT                   /product="ACR168Wp"
FT   CDS_pept        650620..652743
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR168W"
FT                   /old_locus_tag="ACR168W"
FT                   /product="ACR168Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL022C
FT                   (CDC16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR168W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51394"
FT                   /db_xref="GOA:Q75BV3"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BV3"
FT                   /protein_id="AAS51394.1"
FT                   STSSDEGDSMDIE"
FT   gene            complement(<652870..>653427)
FT                   /locus_tag="AGOS_ACR169C"
FT                   /old_locus_tag="ACR169C"
FT   mRNA            complement(<652870..>653427)
FT                   /locus_tag="AGOS_ACR169C"
FT                   /old_locus_tag="ACR169C"
FT                   /product="ACR169Cp"
FT   CDS_pept        complement(652870..653427)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR169C"
FT                   /old_locus_tag="ACR169C"
FT                   /product="ACR169Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKL023W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR169C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51395"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BV2"
FT                   /protein_id="AAS51395.1"
FT   gene            complement(<653516..>654385)
FT                   /locus_tag="AGOS_ACR170C"
FT                   /old_locus_tag="ACR170C"
FT   mRNA            complement(<653516..>654385)
FT                   /locus_tag="AGOS_ACR170C"
FT                   /old_locus_tag="ACR170C"
FT                   /product="ACR170Cp"
FT   CDS_pept        complement(653516..654385)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR170C"
FT                   /old_locus_tag="ACR170C"
FT                   /product="ACR170Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL024C
FT                   (URA6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR170C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51396"
FT                   /db_xref="GOA:Q75BV1"
FT                   /db_xref="InterPro:IPR000850"
FT                   /db_xref="InterPro:IPR006266"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR033690"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BV1"
FT                   /protein_id="AAS51396.1"
FT                   VKERLGPH"
FT   gene            complement(<654585..>655389)
FT                   /locus_tag="AGOS_ACR171C"
FT                   /old_locus_tag="ACR171C"
FT   mRNA            complement(join(<654585..654914,654964..>655389))
FT                   /locus_tag="AGOS_ACR171C"
FT                   /old_locus_tag="ACR171C"
FT                   /product="ACR171Cp"
FT   CDS_pept        complement(join(654585..654914,654964..655389))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR171C"
FT                   /old_locus_tag="ACR171C"
FT                   /product="ACR171Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIR035C
FT                   and YIR036C (IRC24) (IRC24) (IRC24) (IRC24) (IRC24);
FT                   1-intron; Tandem gene duplication in Saccharomyces
FT                   cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR171C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51397"
FT                   /db_xref="GOA:Q75BV0"
FT                   /db_xref="InterPro:IPR002347"
FT                   /db_xref="InterPro:IPR020904"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BV0"
FT                   /protein_id="AAS51397.1"
FT   gene            <655569..>657407
FT                   /locus_tag="AGOS_ACR172W"
FT                   /old_locus_tag="ACR172W"
FT   mRNA            <655569..>657407
FT                   /locus_tag="AGOS_ACR172W"
FT                   /old_locus_tag="ACR172W"
FT                   /product="ACR172Wp"
FT   CDS_pept        655569..657407
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR172W"
FT                   /old_locus_tag="ACR172W"
FT                   /product="ACR172Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL025C
FT                   (PAN3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR172W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51398"
FT                   /db_xref="GOA:Q75BU9"
FT                   /db_xref="InterPro:IPR000571"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR030844"
FT                   /db_xref="InterPro:IPR041332"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BU9"
FT                   /protein_id="AAS51398.1"
FT   gene            complement(657502..657572)
FT                   /locus_tag="AGOS_t0054"
FT   tRNA            complement(657502..657572)
FT                   /locus_tag="AGOS_t0054"
FT                   /product="tRNA-Gly"
FT                   /note="codon recognized: GGC"
FT   gene            <657723..>658580
FT                   /locus_tag="AGOS_ACR173W"
FT                   /old_locus_tag="ACR173W"
FT   mRNA            <657723..>658580
FT                   /locus_tag="AGOS_ACR173W"
FT                   /old_locus_tag="ACR173W"
FT                   /product="ACR173Wp"
FT   CDS_pept        657723..658580
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR173W"
FT                   /old_locus_tag="ACR173W"
FT                   /product="ACR173Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR088C
FT                   (EMC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR173W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51399"
FT                   /db_xref="GOA:Q75BU8"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="InterPro:IPR013105"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="InterPro:IPR039856"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BU8"
FT                   /protein_id="AAS51399.1"
FT                   KSLE"
FT   gene            complement(<658685..>659830)
FT                   /locus_tag="AGOS_ACR174C"
FT                   /old_locus_tag="ACR174C"
FT   mRNA            complement(<658685..>659830)
FT                   /locus_tag="AGOS_ACR174C"
FT                   /old_locus_tag="ACR174C"
FT                   /product="ACR174Cp"
FT   CDS_pept        complement(658685..659830)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR174C"
FT                   /old_locus_tag="ACR174C"
FT                   /product="ACR174Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR040W
FT                   (TIP41)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR174C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51400"
FT                   /db_xref="GOA:Q75BU7"
FT                   /db_xref="InterPro:IPR007303"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BU7"
FT                   /protein_id="AAS51400.1"
FT   gene            <659996..>660592
FT                   /locus_tag="AGOS_ACR175W"
FT                   /old_locus_tag="ACR175W"
FT   mRNA            <659996..>660592
FT                   /locus_tag="AGOS_ACR175W"
FT                   /old_locus_tag="ACR175W"
FT                   /product="ACR175Wp"
FT   CDS_pept        659996..660592
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR175W"
FT                   /old_locus_tag="ACR175W"
FT                   /product="ACR175Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR037C
FT                   (ERV2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR175W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51401"
FT                   /db_xref="GOA:Q75BU6"
FT                   /db_xref="InterPro:IPR017905"
FT                   /db_xref="InterPro:IPR036774"
FT                   /db_xref="InterPro:IPR039799"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BU6"
FT                   /protein_id="AAS51401.1"
FT   gene            complement(<660654..>661016)
FT                   /locus_tag="AGOS_ACR176C"
FT                   /old_locus_tag="ACR176C"
FT   mRNA            complement(<660654..>661016)
FT                   /locus_tag="AGOS_ACR176C"
FT                   /old_locus_tag="ACR176C"
FT                   /product="ACR176Cp"
FT   CDS_pept        complement(660654..661016)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR176C"
FT                   /old_locus_tag="ACR176C"
FT                   /product="ACR176Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR086W
FT                   (STE18)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR176C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51402"
FT                   /db_xref="GOA:Q75BU5"
FT                   /db_xref="InterPro:IPR015898"
FT                   /db_xref="InterPro:IPR041848"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BU5"
FT                   /protein_id="AAS51402.1"
FT                   QARPRGGHEGSCCCIM"
FT   gene            <661157..>661531
FT                   /locus_tag="AGOS_ACR177W"
FT                   /old_locus_tag="ACR177W"
FT   mRNA            <661157..>661531
FT                   /locus_tag="AGOS_ACR177W"
FT                   /old_locus_tag="ACR177W"
FT                   /product="ACR177Wp"
FT   CDS_pept        661157..661531
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR177W"
FT                   /old_locus_tag="ACR177W"
FT                   /product="ACR177Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJR085C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR177W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51403"
FT                   /db_xref="GOA:Q75BU4"
FT                   /db_xref="InterPro:IPR005349"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BU4"
FT                   /protein_id="AAS51403.1"
FT   gene            complement(661605..661698)
FT                   /locus_tag="AGOS_t0055"
FT   tRNA            complement(join(661605..661649,661662..661698))
FT                   /locus_tag="AGOS_t0055"
FT                   /product="tRNA-Ser"
FT                   /note="codon recognized: UCG"
FT   gene            complement(<663044..>663241)
FT                   /locus_tag="AGOS_ACR178C"
FT                   /old_locus_tag="ACR178C"
FT   mRNA            complement(<663044..>663241)
FT                   /locus_tag="AGOS_ACR178C"
FT                   /old_locus_tag="ACR178C"
FT                   /product="ACR178Cp"
FT   CDS_pept        complement(663044..663241)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR178C"
FT                   /old_locus_tag="ACR178C"
FT                   /product="ACR178Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPR036W-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR178C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51404"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BU3"
FT                   /protein_id="AAS51404.1"
FT   gene            complement(<663330..>664568)
FT                   /locus_tag="AGOS_ACR179C"
FT                   /old_locus_tag="ACR179C"
FT   mRNA            complement(<663330..>664568)
FT                   /locus_tag="AGOS_ACR179C"
FT                   /old_locus_tag="ACR179C"
FT                   /product="ACR179Cp"
FT   CDS_pept        complement(663330..664568)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR179C"
FT                   /old_locus_tag="ACR179C"
FT                   /product="ACR179Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR084W
FT                   (CSN12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR179C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51405"
FT                   /db_xref="GOA:Q75BU2"
FT                   /db_xref="InterPro:IPR000717"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BU2"
FT                   /protein_id="AAS51405.2"
FT                   EPFPRLVRSETAA"
FT   gene            <664749..>665396
FT                   /locus_tag="AGOS_ACR180W"
FT                   /old_locus_tag="ACR180W"
FT   mRNA            <664749..>665396
FT                   /locus_tag="AGOS_ACR180W"
FT                   /old_locus_tag="ACR180W"
FT                   /product="ACR180Wp"
FT   CDS_pept        664749..665396
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR180W"
FT                   /old_locus_tag="ACR180W"
FT                   /product="ACR180Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR083C
FT                   (ACF4); Newly annotated start codon"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR180W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51406"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BU1"
FT                   /experiment="RACE determination of 5' region of mRNA"
FT                   /protein_id="AAS51406.2"
FT   gene            complement(<665494..>666915)
FT                   /locus_tag="AGOS_ACR181C"
FT                   /old_locus_tag="ACR181C"
FT   mRNA            complement(<665494..>666915)
FT                   /locus_tag="AGOS_ACR181C"
FT                   /old_locus_tag="ACR181C"
FT                   /product="ACR181Cp"
FT   CDS_pept        complement(665494..666915)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR181C"
FT                   /old_locus_tag="ACR181C"
FT                   /product="ACR181Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR036W
FT                   (VMA13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR181C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51407"
FT                   /db_xref="GOA:Q75BU0"
FT                   /db_xref="InterPro:IPR004908"
FT                   /db_xref="InterPro:IPR011987"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR038497"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BU0"
FT                   /protein_id="AAS51407.1"
FT                   EALKTTQAFVANTFK"
FT   gene            complement(<667269..>668378)
FT                   /locus_tag="AGOS_ACR182C"
FT                   /old_locus_tag="ACR182C"
FT   mRNA            complement(<667269..>668378)
FT                   /locus_tag="AGOS_ACR182C"
FT                   /old_locus_tag="ACR182C"
FT                   /product="ACR182Cp"
FT   CDS_pept        complement(667269..668378)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR182C"
FT                   /old_locus_tag="ACR182C"
FT                   /product="ACR182Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR035W
FT                   (GLN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR182C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51408"
FT                   /db_xref="GOA:Q75BT9"
FT                   /db_xref="InterPro:IPR008146"
FT                   /db_xref="InterPro:IPR008147"
FT                   /db_xref="InterPro:IPR014746"
FT                   /db_xref="InterPro:IPR027302"
FT                   /db_xref="InterPro:IPR027303"
FT                   /db_xref="InterPro:IPR036651"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BT9"
FT                   /protein_id="AAS51408.1"
FT   gene            complement(<668759..>669355)
FT                   /locus_tag="AGOS_ACR183C"
FT                   /old_locus_tag="ACR183C"
FT   mRNA            complement(<668759..>669355)
FT                   /locus_tag="AGOS_ACR183C"
FT                   /old_locus_tag="ACR183C"
FT                   /product="ACR183Cp"
FT   CDS_pept        complement(668759..669355)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR183C"
FT                   /old_locus_tag="ACR183C"
FT                   /product="ACR183Cp"
FT                   /note="NOHBY329; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of unannotated Saccharomyces kluyveri
FT                   gene"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR183C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51409"
FT                   /db_xref="InterPro:IPR012336"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BT8"
FT                   /protein_id="AAS51409.1"
FT   gene            complement(<669416..>670621)
FT                   /locus_tag="AGOS_ACR184C"
FT                   /old_locus_tag="ACR184C"
FT   mRNA            complement(<669416..>670621)
FT                   /locus_tag="AGOS_ACR184C"
FT                   /old_locus_tag="ACR184C"
FT                   /product="ACR184Cp"
FT   CDS_pept        complement(669416..670621)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR184C"
FT                   /old_locus_tag="ACR184C"
FT                   /product="ACR184Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR034W
FT                   (ARP7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR184C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51410"
FT                   /db_xref="GOA:Q75BT7"
FT                   /db_xref="InterPro:IPR004000"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BT7"
FT                   /protein_id="AAS51410.1"
FT                   DK"
FT   gene            <670814..>671110
FT                   /locus_tag="AGOS_ACR185W"
FT                   /old_locus_tag="ACR186W"
FT   mRNA            <670814..>671110
FT                   /locus_tag="AGOS_ACR185W"
FT                   /old_locus_tag="ACR186W"
FT                   /product="ACR185Wp"
FT   CDS_pept        670814..671110
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR185W"
FT                   /old_locus_tag="ACR186W"
FT                   /product="ACR185Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR082C
FT                   (EAF6)"
FT                   /db_xref="GOA:Q75BT5"
FT                   /db_xref="InterPro:IPR015418"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BT5"
FT                   /protein_id="AAS51411.2"
FT   gene            <671404..>672579
FT                   /locus_tag="AGOS_ACR186W"
FT                   /old_locus_tag="ACR185W"
FT   mRNA            <671404..>672579
FT                   /locus_tag="AGOS_ACR186W"
FT                   /old_locus_tag="ACR185W"
FT                   /product="ACR186Wp"
FT   CDS_pept        671404..672579
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR186W"
FT                   /old_locus_tag="ACR185W"
FT                   /product="ACR186Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR080C
FT                   (AIM24)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR185W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51411"
FT                   /protein_id="AAS51412.2"
FT   gene            <672779..>674404
FT                   /locus_tag="AGOS_ACR187W"
FT                   /old_locus_tag="ACR187W"
FT   mRNA            <672779..>674404
FT                   /locus_tag="AGOS_ACR187W"
FT                   /old_locus_tag="ACR187W"
FT                   /product="ACR187Wp"
FT   CDS_pept        672779..674404
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR187W"
FT                   /old_locus_tag="ACR187W"
FT                   /product="ACR187Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR033C
FT                   (HTS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR187W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51413"
FT                   /db_xref="GOA:Q75BT4"
FT                   /db_xref="InterPro:IPR004154"
FT                   /db_xref="InterPro:IPR004516"
FT                   /db_xref="InterPro:IPR006195"
FT                   /db_xref="InterPro:IPR015807"
FT                   /db_xref="InterPro:IPR036621"
FT                   /db_xref="InterPro:IPR041715"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BT4"
FT                   /protein_id="AAS51413.1"
FT   gene            complement(<674533..>675978)
FT                   /locus_tag="AGOS_ACR188C"
FT                   /old_locus_tag="ACR188C"
FT   mRNA            complement(<674533..>675978)
FT                   /locus_tag="AGOS_ACR188C"
FT                   /old_locus_tag="ACR188C"
FT                   /product="ACR188Cp"
FT   CDS_pept        complement(674533..675978)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR188C"
FT                   /old_locus_tag="ACR188C"
FT                   /product="ACR188Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR078W
FT                   (BNA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR188C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51414"
FT                   /db_xref="GOA:Q75BT3"
FT                   /db_xref="InterPro:IPR000898"
FT                   /db_xref="InterPro:IPR037217"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BT3"
FT                   /protein_id="AAS51414.1"
FT   gene            complement(<676283..>676873)
FT                   /locus_tag="AGOS_ACR189C"
FT                   /old_locus_tag="ACR189C"
FT   mRNA            complement(<676283..>676873)
FT                   /locus_tag="AGOS_ACR189C"
FT                   /old_locus_tag="ACR189C"
FT                   /product="ACR189Cp"
FT   CDS_pept        complement(676283..676873)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR189C"
FT                   /old_locus_tag="ACR189C"
FT                   /product="ACR189Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBL107C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR189C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51415"
FT                   /db_xref="InterPro:IPR016805"
FT                   /db_xref="InterPro:IPR019171"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BT2"
FT                   /protein_id="AAS51415.1"
FT   gene            complement(<677106..>680111)
FT                   /locus_tag="AGOS_ACR190C"
FT                   /old_locus_tag="ACR190C"
FT   mRNA            complement(<677106..>680111)
FT                   /locus_tag="AGOS_ACR190C"
FT                   /old_locus_tag="ACR190C"
FT                   /product="ACR190Cp"
FT   CDS_pept        complement(677106..680111)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR190C"
FT                   /old_locus_tag="ACR190C"
FT                   /product="ACR190Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL106C
FT                   (SRO77) and YPR032W (SRO7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR190C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51416"
FT                   /db_xref="GOA:Q75BT1"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR011047"
FT                   /db_xref="InterPro:IPR013905"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BT1"
FT                   /protein_id="AAS51416.1"
FT                   IVKGAFKSKMGI"
FT   gene            complement(<680403..>683852)
FT                   /locus_tag="AGOS_ACR191C"
FT                   /old_locus_tag="ACR191C"
FT   mRNA            complement(<680403..>683852)
FT                   /locus_tag="AGOS_ACR191C"
FT                   /old_locus_tag="ACR191C"
FT                   /product="ACR191Cp"
FT   CDS_pept        complement(680403..683852)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR191C"
FT                   /old_locus_tag="ACR191C"
FT                   /product="ACR191Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL105C
FT                   (PKC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR191C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51417"
FT                   /db_xref="GOA:Q75BT0"
FT                   /db_xref="InterPro:IPR000008"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR000961"
FT                   /db_xref="InterPro:IPR002219"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR011072"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR017892"
FT                   /db_xref="InterPro:IPR036274"
FT                   /db_xref="InterPro:IPR037312"
FT                   /db_xref="InterPro:IPR037778"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BT0"
FT                   /protein_id="AAS51417.1"
FT   gene            complement(<684502..>687492)
FT                   /locus_tag="AGOS_ACR192C"
FT                   /old_locus_tag="ACR192C"
FT   mRNA            complement(<684502..>687492)
FT                   /locus_tag="AGOS_ACR192C"
FT                   /old_locus_tag="ACR192C"
FT                   /product="ACR192Cp"
FT   CDS_pept        complement(684502..687492)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR192C"
FT                   /old_locus_tag="ACR192C"
FT                   /product="ACR192Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL104C
FT                   (SEA4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR192C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51418"
FT                   /db_xref="GOA:Q75BS9"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR031488"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR037593"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BS9"
FT                   /protein_id="AAS51418.1"
FT                   CTCNCND"
FT   gene            complement(<687673..>689862)
FT                   /locus_tag="AGOS_ACR193C"
FT                   /old_locus_tag="ACR193C"
FT   mRNA            complement(<687673..>689862)
FT                   /locus_tag="AGOS_ACR193C"
FT                   /old_locus_tag="ACR193C"
FT                   /product="ACR193Cp"
FT   CDS_pept        complement(687673..689862)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR193C"
FT                   /old_locus_tag="ACR193C"
FT                   /product="ACR193Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR031W
FT                   (NTO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR193C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51419"
FT                   /db_xref="GOA:Q75BS8"
FT                   /db_xref="InterPro:IPR001965"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR019542"
FT                   /db_xref="InterPro:IPR019787"
FT                   /db_xref="InterPro:IPR034732"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BS8"
FT                   /protein_id="AAS51419.1"
FT   gene            complement(<690191..>691732)
FT                   /locus_tag="AGOS_ACR194C"
FT                   /old_locus_tag="ACR194C"
FT   mRNA            complement(<690191..>691732)
FT                   /locus_tag="AGOS_ACR194C"
FT                   /old_locus_tag="ACR194C"
FT                   /product="ACR194Cp"
FT   CDS_pept        complement(690191..691732)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR194C"
FT                   /old_locus_tag="ACR194C"
FT                   /product="ACR194Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDL156W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR194C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51420"
FT                   /db_xref="GOA:Q75BS7"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR033052"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BS7"
FT                   /protein_id="AAS51420.1"
FT   gene            <691910..>692242
FT                   /locus_tag="AGOS_ACR195W"
FT                   /old_locus_tag="ACR195W"
FT   mRNA            <691910..>692242
FT                   /locus_tag="AGOS_ACR195W"
FT                   /old_locus_tag="ACR195W"
FT                   /product="ACR195Wp"
FT   CDS_pept        691910..692242
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR195W"
FT                   /old_locus_tag="ACR195W"
FT                   /product="ACR195Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDL157C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR195W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51421"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BS6"
FT                   /protein_id="AAS51421.1"
FT                   KEKNSR"
FT   gene            complement(<692326..>693918)
FT                   /locus_tag="AGOS_ACR196C"
FT                   /old_locus_tag="ACR196C"
FT   mRNA            complement(<692326..>693918)
FT                   /locus_tag="AGOS_ACR196C"
FT                   /old_locus_tag="ACR196C"
FT                   /product="ACR196Cp"
FT   CDS_pept        complement(692326..693918)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR196C"
FT                   /old_locus_tag="ACR196C"
FT                   /product="ACR196Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL159W
FT                   (STE7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR196C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51422"
FT                   /db_xref="GOA:Q75BS5"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BS5"
FT                   /protein_id="AAS51422.1"
FT                   RSAQAAMAARSGR"
FT   gene            <695410..>696864
FT                   /locus_tag="AGOS_ACR197W"
FT                   /old_locus_tag="ACR197W"
FT   mRNA            <695410..>696864
FT                   /locus_tag="AGOS_ACR197W"
FT                   /old_locus_tag="ACR197W"
FT                   /product="ACR197Wp"
FT   CDS_pept        695410..696864
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR197W"
FT                   /old_locus_tag="ACR197W"
FT                   /product="ACR197Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL160C
FT                   (DHH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR197W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51423"
FT                   /db_xref="GOA:Q75BS4"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BS4"
FT                   /protein_id="AAS51423.1"
FT   gene            <697837..>698763
FT                   /locus_tag="AGOS_ACR198W"
FT                   /old_locus_tag="ACR198W"
FT   mRNA            <697837..>698763
FT                   /locus_tag="AGOS_ACR198W"
FT                   /old_locus_tag="ACR198W"
FT                   /product="ACR198Wp"
FT   CDS_pept        697837..698763
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR198W"
FT                   /old_locus_tag="ACR198W"
FT                   /product="ACR198Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR209C
FT                   (PNP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR198W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51424"
FT                   /db_xref="GOA:Q75BS3"
FT                   /db_xref="InterPro:IPR000845"
FT                   /db_xref="InterPro:IPR011268"
FT                   /db_xref="InterPro:IPR035994"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BS3"
FT                   /protein_id="AAS51424.1"
FT   gene            complement(<698886..>699773)
FT                   /locus_tag="AGOS_ACR199C"
FT                   /old_locus_tag="ACR199C"
FT   mRNA            complement(<698886..>699773)
FT                   /locus_tag="AGOS_ACR199C"
FT                   /old_locus_tag="ACR199C"
FT                   /product="ACR199Cp"
FT   CDS_pept        complement(698886..699773)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR199C"
FT                   /old_locus_tag="ACR199C"
FT                   /product="ACR199Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR208W
FT                   (SEC13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR199C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51425"
FT                   /db_xref="GOA:Q75BS2"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR037363"
FT                   /db_xref="InterPro:IPR037596"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BS2"
FT                   /protein_id="AAS51425.1"
FT                   NLEGKWESAAEIEQ"
FT   gene            <700049..>700300
FT                   /locus_tag="AGOS_ACR199WA"
FT   mRNA            <700049..>700300
FT                   /locus_tag="AGOS_ACR199WA"
FT                   /product="ACR199WAp"
FT   CDS_pept        700049..700300
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR199WA"
FT                   /product="ACR199WAp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR374W-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR199WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41755"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGB2"
FT                   /protein_id="ADJ41755.1"
FT   gene            complement(<700329..>701663)
FT                   /locus_tag="AGOS_ACR200C"
FT                   /old_locus_tag="ACR200C"
FT   mRNA            complement(<700329..>701663)
FT                   /locus_tag="AGOS_ACR200C"
FT                   /old_locus_tag="ACR200C"
FT                   /product="ACR200Cp"
FT   CDS_pept        complement(700329..701663)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR200C"
FT                   /old_locus_tag="ACR200C"
FT                   /product="ACR200Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR375C
FT                   (BCS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR200C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51426"
FT                   /db_xref="GOA:Q75BS1"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR014851"
FT                   /db_xref="InterPro:IPR027243"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BS1"
FT                   /protein_id="AAS51426.1"
FT   gene            complement(<701797..>702507)
FT                   /locus_tag="AGOS_ACR201C"
FT                   /old_locus_tag="ACR201C"
FT   mRNA            complement(<701797..>702507)
FT                   /locus_tag="AGOS_ACR201C"
FT                   /old_locus_tag="ACR201C"
FT                   /product="ACR201Cp"
FT   CDS_pept        complement(701797..702507)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR201C"
FT                   /old_locus_tag="ACR201C"
FT                   /product="ACR201Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR126C
FT                   (IAH1); Newly annotated start codon"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR201C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51427"
FT                   /db_xref="InterPro:IPR013830"
FT                   /db_xref="InterPro:IPR036514"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BS0"
FT                   /experiment="RACE determination of 5' region of mRNA"
FT                   /protein_id="AAS51427.3"
FT                   FPNWRDVAPDGSNL"
FT   gene            <702638..>704131
FT                   /locus_tag="AGOS_ACR202W"
FT                   /old_locus_tag="ACR202W"
FT   mRNA            <702638..>704131
FT                   /locus_tag="AGOS_ACR202W"
FT                   /old_locus_tag="ACR202W"
FT                   /product="ACR202Wp"
FT   CDS_pept        702638..704131
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR202W"
FT                   /old_locus_tag="ACR202W"
FT                   /product="ACR202Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR376W
FT                   (ARH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR202W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51428"
FT                   /db_xref="GOA:Q75BR9"
FT                   /db_xref="InterPro:IPR021163"
FT                   /db_xref="InterPro:IPR023753"
FT                   /db_xref="InterPro:IPR036188"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BR9"
FT                   /protein_id="AAS51428.2"
FT   gene            <704284..>704641
FT                   /locus_tag="AGOS_ACR203W"
FT                   /old_locus_tag="ACR203W"
FT   mRNA            join(<704284..704340,704396..>704641)
FT                   /locus_tag="AGOS_ACR203W"
FT                   /old_locus_tag="ACR203W"
FT                   /product="ACR203Wp"
FT   CDS_pept        join(704284..704340,704396..704641)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR203W"
FT                   /old_locus_tag="ACR203W"
FT                   /product="ACR203Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR377W
FT                   (ATP17); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR203W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51429"
FT                   /db_xref="GOA:Q75BR8"
FT                   /db_xref="InterPro:IPR019727"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BR8"
FT                   /protein_id="AAS51429.2"
FT   gene            complement(<704697..>704954)
FT                   /locus_tag="AGOS_ACR204C"
FT                   /old_locus_tag="ACR204C"
FT   mRNA            complement(<704697..>704954)
FT                   /locus_tag="AGOS_ACR204C"
FT                   /old_locus_tag="ACR204C"
FT                   /product="ACR204Cp"
FT   CDS_pept        complement(704697..704954)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR204C"
FT                   /old_locus_tag="ACR204C"
FT                   /product="ACR204Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR378C
FT                   (LSM6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR204C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51430"
FT                   /db_xref="GOA:Q75BR7"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR016487"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BR7"
FT                   /protein_id="AAS51430.1"
FT   gene            <705744..>708983
FT                   /locus_tag="AGOS_ACR205W"
FT                   /old_locus_tag="ACR205W"
FT   mRNA            <705744..>708983
FT                   /locus_tag="AGOS_ACR205W"
FT                   /old_locus_tag="ACR205W"
FT                   /product="ACR205Wp"
FT   CDS_pept        705744..708983
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR205W"
FT                   /old_locus_tag="ACR205W"
FT                   /product="ACR205Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR127W
FT                   (RGA1) and YDR379W (RGA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR205W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51431"
FT                   /db_xref="GOA:Q75BR6"
FT                   /db_xref="InterPro:IPR000198"
FT                   /db_xref="InterPro:IPR001781"
FT                   /db_xref="InterPro:IPR008936"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BR6"
FT                   /protein_id="AAS51431.1"
FT   gene            complement(<709056..>709295)
FT                   /locus_tag="AGOS_ACR206C"
FT                   /old_locus_tag="ACR206C"
FT   mRNA            complement(<709056..>709295)
FT                   /locus_tag="AGOS_ACR206C"
FT                   /old_locus_tag="ACR206C"
FT                   /product="ACR206Cp"
FT   CDS_pept        complement(709056..709295)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR206C"
FT                   /old_locus_tag="ACR206C"
FT                   /product="ACR206Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR379C-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR206C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51432"
FT                   /db_xref="GOA:Q75BR5"
FT                   /db_xref="InterPro:IPR008011"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BR5"
FT                   /protein_id="AAS51432.1"
FT   gene            <709510..>711129
FT                   /locus_tag="AGOS_ACR207W"
FT                   /old_locus_tag="ACR207W"
FT   mRNA            <709510..>711129
FT                   /locus_tag="AGOS_ACR207W"
FT                   /old_locus_tag="ACR207W"
FT                   /product="ACR207Wp"
FT   CDS_pept        709510..711129
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR207W"
FT                   /old_locus_tag="ACR207W"
FT                   /product="ACR207Wp"
FT                   /note="NOHBY330; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E02596g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR207W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51433"
FT                   /db_xref="GOA:Q75BR4"
FT                   /db_xref="InterPro:IPR025993"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BR4"
FT                   /protein_id="AAS51433.2"
FT   gene            <711699..>714320
FT                   /locus_tag="AGOS_ACR209W"
FT                   /old_locus_tag="ACR209W"
FT   mRNA            <711699..>714320
FT                   /locus_tag="AGOS_ACR209W"
FT                   /old_locus_tag="ACR209W"
FT                   /product="ACR209Wp"
FT   CDS_pept        711699..714320
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR209W"
FT                   /old_locus_tag="ACR209W"
FT                   /product="ACR209Wp"
FT                   /note="NOHBY332; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E02618g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR209W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51435"
FT                   /db_xref="GOA:Q75BR2"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BR2"
FT                   /protein_id="AAS51435.2"
FT                   VV"
FT   gene            complement(<714553..>716250)
FT                   /locus_tag="AGOS_ACR210C"
FT                   /old_locus_tag="ACR210C"
FT   mRNA            complement(<714553..>716250)
FT                   /locus_tag="AGOS_ACR210C"
FT                   /old_locus_tag="ACR210C"
FT                   /product="ACR210Cp"
FT   CDS_pept        complement(714553..716250)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR210C"
FT                   /old_locus_tag="ACR210C"
FT                   /product="ACR210Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR128C
FT                   (ADE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR210C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51436"
FT                   /db_xref="GOA:Q75BR1"
FT                   /db_xref="InterPro:IPR000031"
FT                   /db_xref="InterPro:IPR003135"
FT                   /db_xref="InterPro:IPR005875"
FT                   /db_xref="InterPro:IPR011054"
FT                   /db_xref="InterPro:IPR011761"
FT                   /db_xref="InterPro:IPR013815"
FT                   /db_xref="InterPro:IPR016185"
FT                   /db_xref="InterPro:IPR016301"
FT                   /db_xref="InterPro:IPR033747"
FT                   /db_xref="InterPro:IPR035893"
FT                   /db_xref="InterPro:IPR040686"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BR1"
FT                   /protein_id="AAS51436.1"
FT   gene            <716697..>718586
FT                   /locus_tag="AGOS_ACR211W"
FT                   /old_locus_tag="ACR211W"
FT   mRNA            <716697..>718586
FT                   /locus_tag="AGOS_ACR211W"
FT                   /old_locus_tag="ACR211W"
FT                   /product="ACR211Wp"
FT   CDS_pept        716697..718586
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR211W"
FT                   /old_locus_tag="ACR211W"
FT                   /product="ACR211Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR380W
FT                   (ARO10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR211W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51437"
FT                   /db_xref="GOA:Q75BR0"
FT                   /db_xref="InterPro:IPR011766"
FT                   /db_xref="InterPro:IPR012000"
FT                   /db_xref="InterPro:IPR012001"
FT                   /db_xref="InterPro:IPR012110"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="InterPro:IPR029061"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BR0"
FT                   /protein_id="AAS51437.2"
FT   gene            complement(<718782..>721646)
FT                   /locus_tag="AGOS_ACR212C"
FT                   /old_locus_tag="ACR212C"
FT   mRNA            complement(<718782..>721646)
FT                   /locus_tag="AGOS_ACR212C"
FT                   /old_locus_tag="ACR212C"
FT                   /product="ACR212Cp"
FT   CDS_pept        complement(718782..721646)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR212C"
FT                   /old_locus_tag="ACR212C"
FT                   /product="ACR212Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR129C
FT                   (AFI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR212C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51438"
FT                   /db_xref="GOA:Q75BQ9"
FT                   /db_xref="InterPro:IPR012860"
FT                   /db_xref="InterPro:IPR037516"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BQ9"
FT                   /protein_id="AAS51438.2"
FT   gene            <722729..>724873
FT                   /locus_tag="AGOS_ACR213W"
FT                   /old_locus_tag="ACR213W"
FT   mRNA            <722729..>724873
FT                   /locus_tag="AGOS_ACR213W"
FT                   /old_locus_tag="ACR213W"
FT                   /product="ACR213Wp"
FT   CDS_pept        722729..724873
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR213W"
FT                   /old_locus_tag="ACR213W"
FT                   /product="ACR213Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR057W
FT                   (MNL2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR213W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51439"
FT                   /db_xref="GOA:Q75BQ8"
FT                   /db_xref="InterPro:IPR001382"
FT                   /db_xref="InterPro:IPR012341"
FT                   /db_xref="InterPro:IPR036026"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BQ8"
FT                   /protein_id="AAS51439.1"
FT   gene            complement(<724983..>725915)
FT                   /locus_tag="AGOS_ACR214C"
FT                   /old_locus_tag="ACR214C"
FT   mRNA            complement(<724983..>725915)
FT                   /locus_tag="AGOS_ACR214C"
FT                   /old_locus_tag="ACR214C"
FT                   /product="ACR214Cp"
FT   CDS_pept        complement(724983..725915)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR214C"
FT                   /old_locus_tag="ACR214C"
FT                   /product="ACR214Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIL119C (RPI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR214C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51440"
FT                   /db_xref="InterPro:IPR017877"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BQ7"
FT                   /protein_id="AAS51440.1"
FT   gene            complement(<726871..>728280)
FT                   /locus_tag="AGOS_ACR215C"
FT                   /old_locus_tag="ACR215C"
FT   mRNA            complement(<726871..>728280)
FT                   /locus_tag="AGOS_ACR215C"
FT                   /old_locus_tag="ACR215C"
FT                   /product="ACR215Cp"
FT   CDS_pept        complement(726871..728280)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR215C"
FT                   /old_locus_tag="ACR215C"
FT                   /product="ACR215Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR058C
FT                   (SHM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR215C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51441"
FT                   /db_xref="GOA:Q75BQ6"
FT                   /db_xref="InterPro:IPR001085"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="InterPro:IPR019798"
FT                   /db_xref="InterPro:IPR039429"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BQ6"
FT                   /protein_id="AAS51441.2"
FT                   YSWTEEYPLPV"
FT   gene            complement(<729208..>729957)
FT                   /locus_tag="AGOS_ACR216C"
FT                   /old_locus_tag="ACR216C"
FT   mRNA            complement(<729208..>729957)
FT                   /locus_tag="AGOS_ACR216C"
FT                   /old_locus_tag="ACR216C"
FT                   /product="ACR216Cp"
FT   CDS_pept        complement(729208..729957)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR216C"
FT                   /old_locus_tag="ACR216C"
FT                   /product="ACR216Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL031W
FT                   (HAC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR216C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51442"
FT                   /db_xref="GOA:Q75BQ5"
FT                   /db_xref="InterPro:IPR004827"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BQ5"
FT                   /protein_id="AAS51442.2"
FT   gene            complement(<730478..>731155)
FT                   /locus_tag="AGOS_ACR217C"
FT                   /old_locus_tag="ACR217C"
FT   mRNA            complement(<730478..>731155)
FT                   /locus_tag="AGOS_ACR217C"
FT                   /old_locus_tag="ACR217C"
FT                   /product="ACR217Cp"
FT   CDS_pept        complement(730478..731155)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR217C"
FT                   /old_locus_tag="ACR217C"
FT                   /product="ACR217Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR059C
FT                   (REX2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR217C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51443"
FT                   /db_xref="GOA:Q75BQ4"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR013520"
FT                   /db_xref="InterPro:IPR022894"
FT                   /db_xref="InterPro:IPR036397"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BQ4"
FT                   /protein_id="AAS51443.1"
FT                   TPT"
FT   gene            <731432..>736138
FT                   /locus_tag="AGOS_ACR218W"
FT                   /old_locus_tag="ACR218W"
FT   mRNA            <731432..>736138
FT                   /locus_tag="AGOS_ACR218W"
FT                   /old_locus_tag="ACR218W"
FT                   /product="ACR218Wp"
FT   CDS_pept        731432..736138
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR218W"
FT                   /old_locus_tag="ACR218W"
FT                   /product="ACR218Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL033C
FT                   (RIM15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR218W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51444"
FT                   /db_xref="GOA:Q75BQ3"
FT                   /db_xref="InterPro:IPR000014"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR000961"
FT                   /db_xref="InterPro:IPR001789"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011006"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR035965"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BQ3"
FT                   /protein_id="AAS51444.2"
FT   gene            <736511..>738298
FT                   /locus_tag="AGOS_ACR219W"
FT                   /old_locus_tag="ACR219W"
FT   mRNA            <736511..>738298
FT                   /locus_tag="AGOS_ACR219W"
FT                   /old_locus_tag="ACR219W"
FT                   /product="ACR219Wp"
FT   CDS_pept        736511..738298
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR219W"
FT                   /old_locus_tag="ACR219W"
FT                   /product="ACR219Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR060W
FT                   (FRS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR219W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51445"
FT                   /db_xref="GOA:Q75BQ2"
FT                   /db_xref="InterPro:IPR004531"
FT                   /db_xref="InterPro:IPR005146"
FT                   /db_xref="InterPro:IPR005147"
FT                   /db_xref="InterPro:IPR009061"
FT                   /db_xref="InterPro:IPR020825"
FT                   /db_xref="InterPro:IPR040659"
FT                   /db_xref="InterPro:IPR041616"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BQ2"
FT                   /protein_id="AAS51445.2"
FT   gene            complement(<738425..>741274)
FT                   /locus_tag="AGOS_ACR220C"
FT                   /old_locus_tag="ACR220C"
FT   mRNA            complement(<738425..>741274)
FT                   /locus_tag="AGOS_ACR220C"
FT                   /old_locus_tag="ACR220C"
FT                   /product="ACR220Cp"
FT   CDS_pept        complement(738425..741274)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR220C"
FT                   /old_locus_tag="ACR220C"
FT                   /product="ACR220Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YFL034W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR220C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51446"
FT                   /db_xref="GOA:Q75BQ1"
FT                   /db_xref="InterPro:IPR007941"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BQ1"
FT                   /protein_id="AAS51446.1"
FT   gene            <741589..>742154
FT                   /locus_tag="AGOS_ACR221W"
FT                   /old_locus_tag="ACR221W"
FT   mRNA            join(<741589..741600,741807..>742154)
FT                   /locus_tag="AGOS_ACR221W"
FT                   /old_locus_tag="ACR221W"
FT                   /product="ACR221Wp"
FT   CDS_pept        join(741589..741600,741807..742154)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR221W"
FT                   /old_locus_tag="ACR221W"
FT                   /product="ACR221Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR061W
FT                   (RPL22A) and YFL034C-A (RPL22B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR221W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51447"
FT                   /db_xref="GOA:Q75BQ0"
FT                   /db_xref="InterPro:IPR002671"
FT                   /db_xref="InterPro:IPR038526"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BQ0"
FT                   /protein_id="AAS51447.1"
FT                   LTFYQVTPEDEEDEE"
FT   gene            <742309..>743247
FT                   /locus_tag="AGOS_ACR222W"
FT                   /old_locus_tag="ACR222W"
FT   mRNA            <742309..>743247
FT                   /locus_tag="AGOS_ACR222W"
FT                   /old_locus_tag="ACR222W"
FT                   /product="ACR222Wp"
FT   CDS_pept        742309..743247
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR222W"
FT                   /old_locus_tag="ACR222W"
FT                   /product="ACR222Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR063W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR222W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51448"
FT                   /db_xref="GOA:Q75BP9"
FT                   /db_xref="InterPro:IPR021463"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BP9"
FT                   /protein_id="AAS51448.1"
FT   gene            <743500..>744356
FT                   /locus_tag="AGOS_ACR223W"
FT                   /old_locus_tag="ACR223W"
FT   mRNA            join(<743500..743522,743588..>744356)
FT                   /locus_tag="AGOS_ACR223W"
FT                   /old_locus_tag="ACR223W"
FT                   /product="ACR223Wp"
FT   CDS_pept        join(743500..743522,743588..744356)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR223W"
FT                   /old_locus_tag="ACR223W"
FT                   /product="ACR223Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YFL034C-B (MOB2); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR223W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51449"
FT                   /db_xref="GOA:Q75BP8"
FT                   /db_xref="InterPro:IPR005301"
FT                   /db_xref="InterPro:IPR036703"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BP8"
FT                   /protein_id="AAS51449.1"
FT   gene            complement(<744585..>748472)
FT                   /locus_tag="AGOS_ACR224C"
FT                   /old_locus_tag="ACR224C"
FT   mRNA            complement(<744585..>748472)
FT                   /locus_tag="AGOS_ACR224C"
FT                   /old_locus_tag="ACR224C"
FT                   /product="ACR224Cp"
FT   CDS_pept        complement(744585..748472)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR224C"
FT                   /old_locus_tag="ACR224C"
FT                   /product="ACR224Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL036W
FT                   (RPO41)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR224C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51450"
FT                   /db_xref="GOA:Q75BP7"
FT                   /db_xref="InterPro:IPR002092"
FT                   /db_xref="InterPro:IPR024075"
FT                   /db_xref="InterPro:IPR029262"
FT                   /db_xref="InterPro:IPR037159"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BP7"
FT                   /protein_id="AAS51450.1"
FT                   RQLVNSKYFFS"
FT   misc_feature    complement(749106..749386)
FT                   /note="similar to part of Saccharomyces cerevisiae Ty3b_g;
FT                   contains stop codons"
FT   gene            750890..750961
FT                   /locus_tag="AGOS_t0056"
FT   tRNA            750890..750961
FT                   /locus_tag="AGOS_t0056"
FT                   /product="tRNA-Gly"
FT                   /note="codon recognized: GGA"
FT   gene            complement(<751362..>752877)
FT                   /locus_tag="AGOS_ACR225C"
FT                   /old_locus_tag="ACR225C"
FT   mRNA            complement(join(<751362..752699,752866..>752877))
FT                   /locus_tag="AGOS_ACR225C"
FT                   /old_locus_tag="ACR225C"
FT                   /product="ACR225Cp"
FT   CDS_pept        complement(join(751362..752699,752866..752877))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR225C"
FT                   /old_locus_tag="ACR225C"
FT                   /product="ACR225Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL037W
FT                   (TUB2); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR225C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51451"
FT                   /db_xref="GOA:Q75BP6"
FT                   /db_xref="InterPro:IPR000217"
FT                   /db_xref="InterPro:IPR002453"
FT                   /db_xref="InterPro:IPR003008"
FT                   /db_xref="InterPro:IPR008280"
FT                   /db_xref="InterPro:IPR013838"
FT                   /db_xref="InterPro:IPR017975"
FT                   /db_xref="InterPro:IPR018316"
FT                   /db_xref="InterPro:IPR023123"
FT                   /db_xref="InterPro:IPR036525"
FT                   /db_xref="InterPro:IPR037103"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BP6"
FT                   /protein_id="AAS51451.1"
FT   gene            <753347..>754492
FT                   /locus_tag="AGOS_ACR226W"
FT                   /old_locus_tag="ACR226W"
FT   mRNA            <753347..>754492
FT                   /locus_tag="AGOS_ACR226W"
FT                   /old_locus_tag="ACR226W"
FT                   /product="ACR226Wp"
FT   CDS_pept        753347..754492
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR226W"
FT                   /old_locus_tag="ACR226W"
FT                   /product="ACR226Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER095W
FT                   (RAD51)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR226W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51452"
FT                   /db_xref="GOA:Q75BP5"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR010995"
FT                   /db_xref="InterPro:IPR011941"
FT                   /db_xref="InterPro:IPR013632"
FT                   /db_xref="InterPro:IPR016467"
FT                   /db_xref="InterPro:IPR020587"
FT                   /db_xref="InterPro:IPR020588"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR033925"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BP5"
FT                   /protein_id="AAS51452.1"
FT   gene            <755397..>757793
FT                   /locus_tag="AGOS_ACR227W"
FT                   /old_locus_tag="ACR227W"
FT   mRNA            <755397..>757793
FT                   /locus_tag="AGOS_ACR227W"
FT                   /old_locus_tag="ACR227W"
FT                   /product="ACR227Wp"
FT   CDS_pept        755397..757793
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR227W"
FT                   /old_locus_tag="ACR227W"
FT                   /product="ACR227Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL061C
FT                   (SKT5) and YER096W (SHC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR227W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51453"
FT                   /db_xref="GOA:Q75BP4"
FT                   /db_xref="InterPro:IPR006597"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BP4"
FT                   /protein_id="AAS51453.1"
FT   gene            complement(<758101..>761490)
FT                   /locus_tag="AGOS_ACR228C"
FT                   /old_locus_tag="ACR228C"
FT   mRNA            complement(<758101..>761490)
FT                   /locus_tag="AGOS_ACR228C"
FT                   /old_locus_tag="ACR228C"
FT                   /product="ACR228Cp"
FT   CDS_pept        complement(758101..761490)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR228C"
FT                   /old_locus_tag="ACR228C"
FT                   /product="ACR228Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL063W
FT                   (KIP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR228C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51454"
FT                   /db_xref="GOA:Q8J1G4"
FT                   /db_xref="InterPro:IPR001752"
FT                   /db_xref="InterPro:IPR019821"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR027640"
FT                   /db_xref="InterPro:IPR036961"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8J1G4"
FT                   /protein_id="AAS51454.1"
FT   gene            <762384..>763190
FT                   /locus_tag="AGOS_ACR229W"
FT                   /old_locus_tag="ACR229W"
FT   mRNA            <762384..>763190
FT                   /locus_tag="AGOS_ACR229W"
FT                   /old_locus_tag="ACR229W"
FT                   /product="ACR229Wp"
FT   CDS_pept        762384..763190
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR229W"
FT                   /old_locus_tag="ACR229W"
FT                   /product="ACR229Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR192C
FT                   (HCR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR229W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51455"
FT                   /db_xref="GOA:Q75BP2"
FT                   /db_xref="InterPro:IPR013906"
FT                   /db_xref="InterPro:IPR023194"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BP2"
FT                   /protein_id="AAS51455.1"
FT   gene            complement(<763420..>764616)
FT                   /locus_tag="AGOS_ACR230C"
FT                   /old_locus_tag="ACR230C"
FT   mRNA            complement(<763420..>764616)
FT                   /locus_tag="AGOS_ACR230C"
FT                   /old_locus_tag="ACR230C"
FT                   /product="ACR230Cp"
FT   CDS_pept        complement(763420..764616)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR230C"
FT                   /old_locus_tag="ACR230C"
FT                   /product="ACR230Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR191W
FT                   (PEX13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR230C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51456"
FT                   /db_xref="GOA:Q75BP1"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR007223"
FT                   /db_xref="InterPro:IPR035463"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BP1"
FT                   /protein_id="AAS51456.1"
FT   gene            complement(<765211..>766650)
FT                   /locus_tag="AGOS_ACR231C"
FT                   /old_locus_tag="ACR231C"
FT   mRNA            complement(<765211..>766650)
FT                   /locus_tag="AGOS_ACR231C"
FT                   /old_locus_tag="ACR231C"
FT                   /product="ACR231Cp"
FT   CDS_pept        complement(765211..766650)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR231C"
FT                   /old_locus_tag="ACR231C"
FT                   /product="ACR231Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR190W
FT                   (MMR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR231C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51457"
FT                   /db_xref="InterPro:IPR013712"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BP0"
FT                   /protein_id="AAS51457.1"
FT   gene            complement(<767320..>769002)
FT                   /locus_tag="AGOS_ACR232C"
FT                   /old_locus_tag="ACR232C"
FT   mRNA            complement(<767320..>769002)
FT                   /locus_tag="AGOS_ACR232C"
FT                   /old_locus_tag="ACR232C"
FT                   /product="ACR232Cp"
FT   CDS_pept        complement(767320..769002)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR232C"
FT                   /old_locus_tag="ACR232C"
FT                   /product="ACR232Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER086W
FT                   (ILV1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR232C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51458"
FT                   /db_xref="GOA:Q75BN9"
FT                   /db_xref="InterPro:IPR000634"
FT                   /db_xref="InterPro:IPR001721"
FT                   /db_xref="InterPro:IPR001926"
FT                   /db_xref="InterPro:IPR005787"
FT                   /db_xref="InterPro:IPR036052"
FT                   /db_xref="InterPro:IPR038110"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BN9"
FT                   /protein_id="AAS51458.1"
FT   gene            <769384..>771072
FT                   /locus_tag="AGOS_ACR233W"
FT                   /old_locus_tag="ACR233W"
FT   mRNA            <769384..>771072
FT                   /locus_tag="AGOS_ACR233W"
FT                   /old_locus_tag="ACR233W"
FT                   /product="ACR233Wp"
FT   CDS_pept        769384..771072
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR233W"
FT                   /old_locus_tag="ACR233W"
FT                   /product="ACR233Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER087W
FT                   (AIM10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR233W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51459"
FT                   /db_xref="GOA:Q75BN8"
FT                   /db_xref="InterPro:IPR002314"
FT                   /db_xref="InterPro:IPR002316"
FT                   /db_xref="InterPro:IPR004500"
FT                   /db_xref="InterPro:IPR006195"
FT                   /db_xref="InterPro:IPR036621"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BN8"
FT                   /protein_id="AAS51459.1"
FT   gene            complement(<771155..>771427)
FT                   /locus_tag="AGOS_ACR234C"
FT                   /old_locus_tag="ACR234C"
FT   mRNA            complement(<771155..>771427)
FT                   /locus_tag="AGOS_ACR234C"
FT                   /old_locus_tag="ACR234C"
FT                   /product="ACR234Cp"
FT   CDS_pept        complement(771155..771427)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR234C"
FT                   /old_locus_tag="ACR234C"
FT                   /product="ACR234Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YER019C-A (SBH2) and Syntenic homolog of Saccharomyces
FT                   cerevisiae YER087C-A (SBH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR234C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51460"
FT                   /db_xref="GOA:Q75BN7"
FT                   /db_xref="InterPro:IPR016482"
FT                   /db_xref="InterPro:IPR030671"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BN7"
FT                   /protein_id="AAS51460.1"
FT   gene            <771961..>773697
FT                   /locus_tag="AGOS_ACR235W"
FT                   /old_locus_tag="ACR235W"
FT   mRNA            <771961..>773697
FT                   /locus_tag="AGOS_ACR235W"
FT                   /old_locus_tag="ACR235W"
FT                   /product="ACR235Wp"
FT   CDS_pept        771961..773697
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR235W"
FT                   /old_locus_tag="ACR235W"
FT                   /product="ACR235Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL051C
FT                   (PIN4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR235W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51461"
FT                   /db_xref="GOA:Q75BN6"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR034186"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BN6"
FT                   /protein_id="AAS51461.1"
FT                   WG"
FT   gene            <774163..>776376
FT                   /locus_tag="AGOS_ACR236W"
FT                   /old_locus_tag="ACR236W"
FT   mRNA            <774163..>776376
FT                   /locus_tag="AGOS_ACR236W"
FT                   /old_locus_tag="ACR236W"
FT                   /product="ACR236Wp"
FT   CDS_pept        774163..776376
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR236W"
FT                   /old_locus_tag="ACR236W"
FT                   /product="ACR236Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL052C
FT                   (SAS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR236W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51462"
FT                   /db_xref="GOA:Q75BN5"
FT                   /db_xref="InterPro:IPR002717"
FT                   /db_xref="InterPro:IPR016181"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR037995"
FT                   /db_xref="InterPro:IPR040706"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BN5"
FT                   /protein_id="AAS51462.2"
FT   gene            complement(<776905..>778302)
FT                   /locus_tag="AGOS_ACR237C"
FT                   /old_locus_tag="ACR237C"
FT   mRNA            complement(<776905..>778302)
FT                   /locus_tag="AGOS_ACR237C"
FT                   /old_locus_tag="ACR237C"
FT                   /product="ACR237Cp"
FT   CDS_pept        complement(776905..778302)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR237C"
FT                   /old_locus_tag="ACR237C"
FT                   /product="ACR237Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER088C
FT                   (DOT6) and YBL054W (TOD6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR237C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51463"
FT                   /db_xref="GOA:Q75BN4"
FT                   /db_xref="InterPro:IPR001005"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR015495"
FT                   /db_xref="InterPro:IPR017877"
FT                   /db_xref="InterPro:IPR017930"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BN4"
FT                   /protein_id="AAS51463.2"
FT                   SIFKNVL"
FT   gene            <778652..>779722
FT                   /locus_tag="AGOS_ACR238W"
FT                   /old_locus_tag="ACR238W"
FT   mRNA            <778652..>779722
FT                   /locus_tag="AGOS_ACR238W"
FT                   /old_locus_tag="ACR238W"
FT                   /product="ACR238Wp"
FT   CDS_pept        778652..779722
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR238W"
FT                   /old_locus_tag="ACR238W"
FT                   /product="ACR238Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBL055C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR238W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51464"
FT                   /db_xref="GOA:Q75BN3"
FT                   /db_xref="InterPro:IPR001130"
FT                   /db_xref="InterPro:IPR032466"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BN3"
FT                   /protein_id="AAS51464.1"
FT                   EVAEAAWQTACAVYGS"
FT   gene            complement(<779821..>781191)
FT                   /locus_tag="AGOS_ACR239C"
FT                   /old_locus_tag="ACR239C"
FT   mRNA            complement(<779821..>781191)
FT                   /locus_tag="AGOS_ACR239C"
FT                   /old_locus_tag="ACR239C"
FT                   /product="ACR239Cp"
FT   CDS_pept        complement(779821..781191)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR239C"
FT                   /old_locus_tag="ACR239C"
FT                   /product="ACR239Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL056W
FT                   (PTC3) and YER089C (PTC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR239C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51465"
FT                   /db_xref="GOA:Q75BN2"
FT                   /db_xref="InterPro:IPR000222"
FT                   /db_xref="InterPro:IPR001932"
FT                   /db_xref="InterPro:IPR015655"
FT                   /db_xref="InterPro:IPR036457"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BN2"
FT                   /protein_id="AAS51465.1"
FT   gene            <782476..>784209
FT                   /locus_tag="AGOS_ACR240W"
FT                   /old_locus_tag="ACR240W"
FT   mRNA            <782476..>784209
FT                   /locus_tag="AGOS_ACR240W"
FT                   /old_locus_tag="ACR240W"
FT                   /product="ACR240Wp"
FT   CDS_pept        782476..784209
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR240W"
FT                   /old_locus_tag="ACR240W"
FT                   /product="ACR240Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL149W
FT                   (DAS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR240W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51466"
FT                   /db_xref="GOA:Q75BN1"
FT                   /db_xref="InterPro:IPR001810"
FT                   /db_xref="InterPro:IPR036047"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BN1"
FT                   /protein_id="AAS51466.1"
FT                   C"
FT   gene            complement(<784351..>786738)
FT                   /locus_tag="AGOS_ACR241C"
FT                   /old_locus_tag="ACR241C"
FT   mRNA            complement(<784351..>786738)
FT                   /locus_tag="AGOS_ACR241C"
FT                   /old_locus_tag="ACR241C"
FT                   /product="ACR241Cp"
FT   CDS_pept        complement(784351..786738)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR241C"
FT                   /old_locus_tag="ACR241C"
FT                   /product="ACR241Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR064W
FT                   (OAF3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR241C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51467"
FT                   /db_xref="GOA:Q75BN0"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BN0"
FT                   /protein_id="AAS51467.2"
FT   gene            <786925..>788298
FT                   /locus_tag="AGOS_ACR242W"
FT                   /old_locus_tag="ACR242W"
FT   mRNA            <786925..>788298
FT                   /locus_tag="AGOS_ACR242W"
FT                   /old_locus_tag="ACR242W"
FT                   /product="ACR242Wp"
FT   CDS_pept        786925..788298
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR242W"
FT                   /old_locus_tag="ACR242W"
FT                   /product="ACR242Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR063C
FT                   (LAS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR242W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51468"
FT                   /db_xref="GOA:Q75BM9"
FT                   /db_xref="InterPro:IPR007174"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BM9"
FT                   /protein_id="AAS51468.1"
FT   gene            complement(788327..788447)
FT                   /locus_tag="AGOS_AgSNR128"
FT                   /old_locus_tag="AgSNR128"
FT   ncRNA           complement(788327..788447)
FT                   /locus_tag="AGOS_AgSNR128"
FT                   /old_locus_tag="AgSNR128"
FT                   /product="AgSNR128"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR128; start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            complement(788566..788631)
FT                   /locus_tag="AGOS_AgSNR190"
FT                   /old_locus_tag="AgSNR190"
FT   ncRNA           complement(788566..788631)
FT                   /locus_tag="AGOS_AgSNR190"
FT                   /old_locus_tag="AgSNR190"
FT                   /product="AgSNR190"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR190; start and end coordinates are approximate;
FT                   similarity is partial; In synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <789202..>789843
FT                   /locus_tag="AGOS_ACR243W"
FT                   /old_locus_tag="ACR243W"
FT   mRNA            <789202..>789843
FT                   /locus_tag="AGOS_ACR243W"
FT                   /old_locus_tag="ACR243W"
FT                   /product="ACR243Wp"
FT   CDS_pept        789202..789843
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR243W"
FT                   /old_locus_tag="ACR243W"
FT                   /product="ACR243Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL148W
FT                   (RPA34)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR243W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51469"
FT                   /db_xref="GOA:Q75BM8"
FT                   /db_xref="InterPro:IPR013240"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BM8"
FT                   /protein_id="AAS51469.1"
FT   gene            complement(<789946..>790848)
FT                   /locus_tag="AGOS_ACR244C"
FT                   /old_locus_tag="ACR244C"
FT   mRNA            complement(<789946..>790848)
FT                   /locus_tag="AGOS_ACR244C"
FT                   /old_locus_tag="ACR244C"
FT                   /product="ACR244Cp"
FT   CDS_pept        complement(789946..790848)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR244C"
FT                   /old_locus_tag="ACR244C"
FT                   /product="ACR244Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR062W
FT                   (TFA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR244C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51470"
FT                   /db_xref="GOA:Q75BM7"
FT                   /db_xref="InterPro:IPR003166"
FT                   /db_xref="InterPro:IPR016656"
FT                   /db_xref="InterPro:IPR040501"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BM7"
FT                   /protein_id="AAS51470.1"
FT   gene            791173..791269
FT                   /locus_tag="AGOS_AgSNR42"
FT                   /old_locus_tag="AgSNR42"
FT   ncRNA           791173..791269
FT                   /locus_tag="AGOS_AgSNR42"
FT                   /old_locus_tag="AgSNR42"
FT                   /product="AgSNR42"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR42; start and end coordinates are approximate"
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<791294..>792340)
FT                   /locus_tag="AGOS_ACR245C"
FT                   /old_locus_tag="ACR245C"
FT   mRNA            complement(<791294..>792340)
FT                   /locus_tag="AGOS_ACR245C"
FT                   /old_locus_tag="ACR245C"
FT                   /product="ACR245Cp"
FT   CDS_pept        complement(791294..792340)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR245C"
FT                   /old_locus_tag="ACR245C"
FT                   /product="ACR245Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL147C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR245C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51471"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BM6"
FT                   /protein_id="AAS51471.2"
FT                   QPVLNFLS"
FT   gene            <792704..>793990
FT                   /locus_tag="AGOS_ACR246W"
FT                   /old_locus_tag="ACR246W"
FT   mRNA            <792704..>793990
FT                   /locus_tag="AGOS_ACR246W"
FT                   /old_locus_tag="ACR246W"
FT                   /product="ACR246Wp"
FT   CDS_pept        792704..793990
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR246W"
FT                   /old_locus_tag="ACR246W"
FT                   /product="ACR246Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL146W
FT                   (IDS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR246W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51472"
FT                   /db_xref="GOA:Q75BM5"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BM5"
FT                   /protein_id="AAS51472.1"
FT   gene            <794319..>795206
FT                   /locus_tag="AGOS_ACR247W"
FT                   /old_locus_tag="ACR247W"
FT   mRNA            <794319..>795206
FT                   /locus_tag="AGOS_ACR247W"
FT                   /old_locus_tag="ACR247W"
FT                   /product="ACR247Wp"
FT   CDS_pept        794319..795206
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR247W"
FT                   /old_locus_tag="ACR247W"
FT                   /product="ACR247Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL145W
FT                   (SFH5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR247W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51473"
FT                   /db_xref="GOA:Q75BM4"
FT                   /db_xref="InterPro:IPR001251"
FT                   /db_xref="InterPro:IPR011074"
FT                   /db_xref="InterPro:IPR036273"
FT                   /db_xref="InterPro:IPR036865"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BM4"
FT                   /protein_id="AAS51473.1"
FT                   ALFLLQKHISEELD"
FT   gene            <795539..>795964
FT                   /locus_tag="AGOS_ACR247CA"
FT   mRNA            <795539..>795964
FT                   /locus_tag="AGOS_ACR247CA"
FT                   /product="ACR247W-Ap"
FT   CDS_pept        795539..795964
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR247CA"
FT                   /product="ACR247W-Ap"
FT                   /note="NOHBY336; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0C06204g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR247CA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41756"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGB3"
FT                   /protein_id="ADJ41756.1"
FT   gene            <796275..>796745
FT                   /locus_tag="AGOS_ACR248W"
FT                   /old_locus_tag="ACR248W"
FT   mRNA            <796275..>796745
FT                   /locus_tag="AGOS_ACR248W"
FT                   /old_locus_tag="ACR248W"
FT                   /product="ACR248Wp"
FT   CDS_pept        796275..796745
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR248W"
FT                   /old_locus_tag="ACR248W"
FT                   /product="ACR248Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL143W
FT                   (TIM17)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR248W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51474"
FT                   /db_xref="GOA:Q75BM3"
FT                   /db_xref="InterPro:IPR005678"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BM3"
FT                   /protein_id="AAS51474.1"
FT   gene            complement(<797013..>798944)
FT                   /locus_tag="AGOS_ACR249C"
FT                   /old_locus_tag="ACR249C"
FT   mRNA            complement(<797013..>798944)
FT                   /locus_tag="AGOS_ACR249C"
FT                   /old_locus_tag="ACR249C"
FT                   /product="ACR249Cp"
FT   CDS_pept        complement(797013..798944)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR249C"
FT                   /old_locus_tag="ACR249C"
FT                   /product="ACR249Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL141C
FT                   (YAK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR249C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51475"
FT                   /db_xref="GOA:Q75BM2"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BM2"
FT                   /protein_id="AAS51475.1"
FT                   LNKLHLGE"
FT   gene            <799205..>799783
FT                   /locus_tag="AGOS_ACR250W"
FT                   /old_locus_tag="ACR250W"
FT   mRNA            <799205..>799783
FT                   /locus_tag="AGOS_ACR250W"
FT                   /old_locus_tag="ACR250W"
FT                   /product="ACR250Wp"
FT   CDS_pept        799205..799783
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR250W"
FT                   /old_locus_tag="ACR250W"
FT                   /product="ACR250Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL140W
FT                   (RPB4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR250W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51476"
FT                   /db_xref="GOA:Q75BM1"
FT                   /db_xref="InterPro:IPR005574"
FT                   /db_xref="InterPro:IPR006590"
FT                   /db_xref="InterPro:IPR010997"
FT                   /db_xref="InterPro:IPR038324"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BM1"
FT                   /protein_id="AAS51476.1"
FT   gene            complement(<799788..>801026)
FT                   /locus_tag="AGOS_ACR251C"
FT                   /old_locus_tag="ACR251C"
FT   mRNA            complement(<799788..>801026)
FT                   /locus_tag="AGOS_ACR251C"
FT                   /old_locus_tag="ACR251C"
FT                   /product="ACR251Cp"
FT   CDS_pept        complement(799788..801026)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR251C"
FT                   /old_locus_tag="ACR251C"
FT                   /product="ACR251Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR061W
FT                   (KTR2) and YJL139C (YUR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR251C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51477"
FT                   /db_xref="GOA:Q75BM0"
FT                   /db_xref="InterPro:IPR002685"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BM0"
FT                   /protein_id="AAS51477.1"
FT                   WWRRGGGKFFLSM"
FT   gene            complement(<801169..>801975)
FT                   /locus_tag="AGOS_ACR252C"
FT                   /old_locus_tag="ACR252C"
FT   mRNA            complement(<801169..>801975)
FT                   /locus_tag="AGOS_ACR252C"
FT                   /old_locus_tag="ACR252C"
FT                   /product="ACR252Cp"
FT   CDS_pept        complement(801169..801975)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR252C"
FT                   /old_locus_tag="ACR252C"
FT                   /product="ACR252Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR060W
FT                   (UTP30)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR252C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51478"
FT                   /db_xref="GOA:Q75BL9"
FT                   /db_xref="InterPro:IPR016095"
FT                   /db_xref="InterPro:IPR023674"
FT                   /db_xref="InterPro:IPR028364"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BL9"
FT                   /protein_id="AAS51478.1"
FT   gene            complement(<802229..>803419)
FT                   /locus_tag="AGOS_ACR253C"
FT                   /old_locus_tag="ACR253C"
FT   mRNA            complement(<802229..>803419)
FT                   /locus_tag="AGOS_ACR253C"
FT                   /old_locus_tag="ACR253C"
FT                   /product="ACR253Cp"
FT   CDS_pept        complement(802229..803419)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR253C"
FT                   /old_locus_tag="ACR253C"
FT                   /product="ACR253Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL138C
FT                   (TIF2) and YKR059W (TIF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR253C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51479"
FT                   /db_xref="GOA:Q75BL8"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BL8"
FT                   /protein_id="AAS51479.1"
FT   gene            complement(<803742..>805535)
FT                   /locus_tag="AGOS_ACR254C"
FT                   /old_locus_tag="ACR254C"
FT   mRNA            complement(<803742..>805535)
FT                   /locus_tag="AGOS_ACR254C"
FT                   /old_locus_tag="ACR254C"
FT                   /product="ACR254Cp"
FT   CDS_pept        complement(803742..805535)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR254C"
FT                   /old_locus_tag="ACR254C"
FT                   /product="ACR254Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL137C
FT                   (GLG2) and YKR058W (GLG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR254C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51480"
FT                   /db_xref="GOA:Q75BL7"
FT                   /db_xref="InterPro:IPR002495"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BL7"
FT                   /protein_id="AAS51480.1"
FT   gene            complement(<806045..>806381)
FT                   /locus_tag="AGOS_ACR255C"
FT                   /old_locus_tag="ACR255C"
FT   mRNA            complement(join(<806045..806284,806358..>806381))
FT                   /locus_tag="AGOS_ACR255C"
FT                   /old_locus_tag="ACR255C"
FT                   /product="ACR255Cp"
FT   CDS_pept        complement(join(806045..806284,806358..806381))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR255C"
FT                   /old_locus_tag="ACR255C"
FT                   /product="ACR255Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL136C
FT                   (RPS21B) and YKR057W (RPS21A); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR255C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51481"
FT                   /db_xref="GOA:Q75BL6"
FT                   /db_xref="InterPro:IPR001931"
FT                   /db_xref="InterPro:IPR018279"
FT                   /db_xref="InterPro:IPR038579"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BL6"
FT                   /protein_id="AAS51481.1"
FT   gene            complement(<806630..>808408)
FT                   /locus_tag="AGOS_ACR256C"
FT                   /old_locus_tag="ACR256C"
FT   mRNA            complement(<806630..>808408)
FT                   /locus_tag="AGOS_ACR256C"
FT                   /old_locus_tag="ACR256C"
FT                   /product="ACR256Cp"
FT   CDS_pept        complement(806630..808408)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR256C"
FT                   /old_locus_tag="ACR256C"
FT                   /product="ACR256Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR056W
FT                   (TRM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR256C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51482"
FT                   /db_xref="GOA:Q75BL5"
FT                   /db_xref="InterPro:IPR002792"
FT                   /db_xref="InterPro:IPR010280"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR025795"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="InterPro:IPR030390"
FT                   /db_xref="InterPro:IPR030391"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BL5"
FT                   /protein_id="AAS51482.1"
FT                   FPQTHHVEGVCVLSRD"
FT   gene            complement(<808660..>809439)
FT                   /locus_tag="AGOS_ACR257C"
FT                   /old_locus_tag="ACR257C"
FT   mRNA            complement(<808660..>809439)
FT                   /locus_tag="AGOS_ACR257C"
FT                   /old_locus_tag="ACR257C"
FT                   /product="ACR257Cp"
FT   CDS_pept        complement(808660..809439)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR257C"
FT                   /old_locus_tag="ACR257C"
FT                   /product="ACR257Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR055W
FT                   (RHO4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR257C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51483"
FT                   /db_xref="GOA:Q9P8V0"
FT                   /db_xref="InterPro:IPR001806"
FT                   /db_xref="InterPro:IPR003578"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9P8V0"
FT                   /protein_id="AAS51483.1"
FT   gene            <809741..>821992
FT                   /locus_tag="AGOS_ACR258W"
FT                   /old_locus_tag="ACR258W"
FT   mRNA            <809741..>821992
FT                   /locus_tag="AGOS_ACR258W"
FT                   /old_locus_tag="ACR258W"
FT                   /product="ACR258Wp"
FT   CDS_pept        809741..821992
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR258W"
FT                   /old_locus_tag="ACR258W"
FT                   /product="ACR258Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR054C
FT                   (DYN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR258W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51484"
FT                   /db_xref="GOA:Q9C1M7"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR004273"
FT                   /db_xref="InterPro:IPR013594"
FT                   /db_xref="InterPro:IPR013602"
FT                   /db_xref="InterPro:IPR024317"
FT                   /db_xref="InterPro:IPR024743"
FT                   /db_xref="InterPro:IPR026983"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR035699"
FT                   /db_xref="InterPro:IPR035706"
FT                   /db_xref="InterPro:IPR041466"
FT                   /db_xref="InterPro:IPR041658"
FT                   /db_xref="InterPro:IPR042219"
FT                   /db_xref="InterPro:IPR042222"
FT                   /db_xref="InterPro:IPR042228"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9C1M7"
FT                   /protein_id="AAS51484.1"
FT   gene            <822179..>823393
FT                   /locus_tag="AGOS_ACR259W"
FT                   /old_locus_tag="ACR259W"
FT   mRNA            <822179..>823393
FT                   /locus_tag="AGOS_ACR259W"
FT                   /old_locus_tag="ACR259W"
FT                   /product="ACR259Wp"
FT   CDS_pept        822179..823393
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR259W"
FT                   /old_locus_tag="ACR259W"
FT                   /product="ACR259Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL134W
FT                   (LCB3) and YKR053C (YSR3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR259W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51485"
FT                   /db_xref="GOA:Q75BL2"
FT                   /db_xref="InterPro:IPR000326"
FT                   /db_xref="InterPro:IPR036938"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BL2"
FT                   /protein_id="AAS51485.1"
FT                   ALLGI"
FT   gene            <823888..>824823
FT                   /locus_tag="AGOS_ACR260W"
FT                   /old_locus_tag="ACR260W"
FT   mRNA            <823888..>824823
FT                   /locus_tag="AGOS_ACR260W"
FT                   /old_locus_tag="ACR260W"
FT                   /product="ACR260Wp"
FT   CDS_pept        823888..824823
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR260W"
FT                   /old_locus_tag="ACR260W"
FT                   /product="ACR260Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL133W
FT                   (MRS3) and YKR052C (MRS4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR260W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51486"
FT                   /db_xref="GOA:Q75BL1"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BL1"
FT                   /protein_id="AAS51486.1"
FT   gene            complement(<825055..>826278)
FT                   /locus_tag="AGOS_ACR261C"
FT                   /old_locus_tag="ACR261C"
FT   mRNA            complement(<825055..>826278)
FT                   /locus_tag="AGOS_ACR261C"
FT                   /old_locus_tag="ACR261C"
FT                   /product="ACR261Cp"
FT   CDS_pept        complement(825055..826278)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR261C"
FT                   /old_locus_tag="ACR261C"
FT                   /product="ACR261Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKR051W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR261C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51487"
FT                   /db_xref="GOA:Q75BL0"
FT                   /db_xref="InterPro:IPR005178"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BL0"
FT                   /protein_id="AAS51487.1"
FT                   RERTSSAV"
FT   gene            complement(<826557..>827507)
FT                   /locus_tag="AGOS_ACR262C"
FT                   /old_locus_tag="ACR262C"
FT   mRNA            complement(<826557..>827507)
FT                   /locus_tag="AGOS_ACR262C"
FT                   /old_locus_tag="ACR262C"
FT                   /product="ACR262Cp"
FT   CDS_pept        complement(826557..827507)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR262C"
FT                   /old_locus_tag="ACR262C"
FT                   /product="ACR262Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL131C
FT                   (AIM23)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR262C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51488"
FT                   /db_xref="GOA:Q75BK9"
FT                   /db_xref="InterPro:IPR029427"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BK9"
FT                   /protein_id="AAS51488.1"
FT   gene            complement(<827823..>834545)
FT                   /locus_tag="AGOS_ACR263C"
FT                   /old_locus_tag="ACR263C"
FT   mRNA            complement(join(<827823..834491,834543..>834545))
FT                   /locus_tag="AGOS_ACR263C"
FT                   /old_locus_tag="ACR263C"
FT                   /product="ACR263Cp"
FT   CDS_pept        complement(join(827823..834491,834543..834545))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR263C"
FT                   /old_locus_tag="ACR263C"
FT                   /product="ACR263Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL130C
FT                   (URA2); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR263C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51489"
FT                   /db_xref="GOA:Q75BK8"
FT                   /db_xref="InterPro:IPR002082"
FT                   /db_xref="InterPro:IPR002474"
FT                   /db_xref="InterPro:IPR005479"
FT                   /db_xref="InterPro:IPR005480"
FT                   /db_xref="InterPro:IPR005483"
FT                   /db_xref="InterPro:IPR006130"
FT                   /db_xref="InterPro:IPR006131"
FT                   /db_xref="InterPro:IPR006132"
FT                   /db_xref="InterPro:IPR006274"
FT                   /db_xref="InterPro:IPR006275"
FT                   /db_xref="InterPro:IPR011607"
FT                   /db_xref="InterPro:IPR011761"
FT                   /db_xref="InterPro:IPR013815"
FT                   /db_xref="InterPro:IPR016185"
FT                   /db_xref="InterPro:IPR017926"
FT                   /db_xref="InterPro:IPR029062"
FT                   /db_xref="InterPro:IPR032466"
FT                   /db_xref="InterPro:IPR035686"
FT                   /db_xref="InterPro:IPR036480"
FT                   /db_xref="InterPro:IPR036897"
FT                   /db_xref="InterPro:IPR036901"
FT                   /db_xref="InterPro:IPR036914"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BK8"
FT                   /protein_id="AAS51489.2"
FT   gene            <835306..>837615
FT                   /locus_tag="AGOS_ACR264W"
FT                   /old_locus_tag="ACR264W"
FT   mRNA            <835306..>837615
FT                   /locus_tag="AGOS_ACR264W"
FT                   /old_locus_tag="ACR264W"
FT                   /product="ACR264Wp"
FT   CDS_pept        835306..837615
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR264W"
FT                   /old_locus_tag="ACR264W"
FT                   /product="ACR264Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR113W
FT                   (AZF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR264W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51490"
FT                   /db_xref="GOA:Q75BK7"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BK7"
FT                   /protein_id="AAS51490.1"
FT                   NPSGTEVQFKNVFSSS"
FT   gene            complement(<837774..>838475)
FT                   /locus_tag="AGOS_ACR265C"
FT                   /old_locus_tag="ACR265C"
FT   mRNA            complement(<837774..>838475)
FT                   /locus_tag="AGOS_ACR265C"
FT                   /old_locus_tag="ACR265C"
FT                   /product="ACR265Cp"
FT   CDS_pept        complement(837774..838475)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR265C"
FT                   /old_locus_tag="ACR265C"
FT                   /product="ACR265Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR115C
FT                   (TRS33)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR265C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51491"
FT                   /db_xref="GOA:Q75BK6"
FT                   /db_xref="InterPro:IPR007194"
FT                   /db_xref="InterPro:IPR024096"
FT                   /db_xref="InterPro:IPR037992"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BK6"
FT                   /protein_id="AAS51491.2"
FT                   GVNFNVQIAGK"
FT   gene            <838682..>840562
FT                   /locus_tag="AGOS_ACR266W"
FT                   /old_locus_tag="ACR266W"
FT   mRNA            <838682..>840562
FT                   /locus_tag="AGOS_ACR266W"
FT                   /old_locus_tag="ACR266W"
FT                   /product="ACR266Wp"
FT   CDS_pept        838682..840562
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR266W"
FT                   /old_locus_tag="ACR266W"
FT                   /product="ACR266Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR114W
FT                   (BZZ1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR266W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51492"
FT                   /db_xref="GOA:Q75BK5"
FT                   /db_xref="InterPro:IPR001060"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR027267"
FT                   /db_xref="InterPro:IPR031160"
FT                   /db_xref="InterPro:IPR035459"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BK5"
FT                   /protein_id="AAS51492.2"
FT   gene            complement(<841316..>842719)
FT                   /locus_tag="AGOS_ACR267C"
FT                   /old_locus_tag="ACR267C"
FT   mRNA            complement(<841316..>842719)
FT                   /locus_tag="AGOS_ACR267C"
FT                   /old_locus_tag="ACR267C"
FT                   /product="ACR267Cp"
FT   CDS_pept        complement(841316..842719)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR267C"
FT                   /old_locus_tag="ACR267C"
FT                   /product="ACR267Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL116W
FT                   (DMA2) and YHR115C (DMA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR267C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51493"
FT                   /db_xref="GOA:Q75BK4"
FT                   /db_xref="InterPro:IPR000253"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR008984"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BK4"
FT                   /protein_id="AAS51493.1"
FT                   NEEDIQMLS"
FT   gene            complement(<843117..>844775)
FT                   /locus_tag="AGOS_ACR268C"
FT                   /old_locus_tag="ACR268C"
FT   mRNA            complement(<843117..>844775)
FT                   /locus_tag="AGOS_ACR268C"
FT                   /old_locus_tag="ACR268C"
FT                   /product="ACR268Cp"
FT   CDS_pept        complement(843117..844775)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR268C"
FT                   /old_locus_tag="ACR268C"
FT                   /product="ACR268Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL117W
FT                   (MLS1) and Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIR031C (DAL7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR268C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51494"
FT                   /db_xref="GOA:Q75BK3"
FT                   /db_xref="InterPro:IPR001465"
FT                   /db_xref="InterPro:IPR006252"
FT                   /db_xref="InterPro:IPR011076"
FT                   /db_xref="InterPro:IPR019830"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BK3"
FT                   /protein_id="AAS51494.2"
FT   gene            complement(<845055..>845963)
FT                   /locus_tag="AGOS_ACR269C"
FT                   /old_locus_tag="ACR269C"
FT   mRNA            complement(<845055..>845963)
FT                   /locus_tag="AGOS_ACR269C"
FT                   /old_locus_tag="ACR269C"
FT                   /product="ACR269Cp"
FT   CDS_pept        complement(845055..845963)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR269C"
FT                   /old_locus_tag="ACR269C"
FT                   /product="ACR269Cp"
FT                   /note="NOHBY333; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0E10868"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR269C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51495"
FT                   /db_xref="InterPro:IPR015168"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BK2"
FT                   /protein_id="AAS51495.1"
FT   gene            <846320..>848962
FT                   /locus_tag="AGOS_ACR270W"
FT                   /old_locus_tag="ACR270W"
FT   mRNA            <846320..>848962
FT                   /locus_tag="AGOS_ACR270W"
FT                   /old_locus_tag="ACR270W"
FT                   /product="ACR270Wp"
FT   CDS_pept        846320..848962
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR270W"
FT                   /old_locus_tag="ACR270W"
FT                   /product="ACR270Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL118C
FT                   (DCP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR270W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51496"
FT                   /db_xref="GOA:Q75BK1"
FT                   /db_xref="InterPro:IPR000086"
FT                   /db_xref="InterPro:IPR007722"
FT                   /db_xref="InterPro:IPR015797"
FT                   /db_xref="InterPro:IPR020084"
FT                   /db_xref="InterPro:IPR036189"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BK1"
FT                   /protein_id="AAS51496.1"
FT                   MLRKSRVVP"
FT   gene            complement(<849040..>850425)
FT                   /locus_tag="AGOS_ACR271C"
FT                   /old_locus_tag="ACR271C"
FT   mRNA            complement(<849040..>850425)
FT                   /locus_tag="AGOS_ACR271C"
FT                   /old_locus_tag="ACR271C"
FT                   /product="ACR271Cp"
FT   CDS_pept        complement(849040..850425)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR271C"
FT                   /old_locus_tag="ACR271C"
FT                   /product="ACR271Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL119W
FT                   (NCS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR271C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51497"
FT                   /db_xref="GOA:Q75BK0"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR019407"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BK0"
FT                   /protein_id="AAS51497.1"
FT                   DEE"
FT   gene            complement(<850922..>851371)
FT                   /locus_tag="AGOS_ACR272C"
FT                   /old_locus_tag="ACR272C"
FT   mRNA            complement(<850922..>851371)
FT                   /locus_tag="AGOS_ACR272C"
FT                   /old_locus_tag="ACR272C"
FT                   /product="ACR272Cp"
FT   CDS_pept        complement(850922..851371)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR272C"
FT                   /old_locus_tag="ACR272C"
FT                   /product="ACR272Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YKL096W (CWP1); Tandem gene duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR272C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51498"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BJ9"
FT                   /protein_id="AAS51498.1"
FT   gene            <853038..>853493
FT                   /locus_tag="AGOS_ACR273W"
FT                   /old_locus_tag="ACR273W"
FT   mRNA            <853038..>853493
FT                   /locus_tag="AGOS_ACR273W"
FT                   /old_locus_tag="ACR273W"
FT                   /product="ACR273Wp"
FT   CDS_pept        853038..853493
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR273W"
FT                   /old_locus_tag="ACR273W"
FT                   /product="ACR273Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YKL096W (CWP1); Tandem gene duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR273W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51499"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BJ8"
FT                   /protein_id="AAS51499.1"
FT   gene            <854580..>855860
FT                   /locus_tag="AGOS_ACR274W"
FT                   /old_locus_tag="ACR274W"
FT   mRNA            <854580..>855860
FT                   /locus_tag="AGOS_ACR274W"
FT                   /old_locus_tag="ACR274W"
FT                   /product="ACR274Wp"
FT   CDS_pept        854580..855860
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR274W"
FT                   /old_locus_tag="ACR274W"
FT                   /product="ACR274Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL041C
FT                   (NOP12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR274W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51500"
FT                   /db_xref="GOA:Q75BJ7"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR034777"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BJ7"
FT                   /protein_id="AAS51500.1"
FT   gene            <856127..>856918
FT                   /locus_tag="AGOS_ACR275W"
FT                   /old_locus_tag="ACR275W"
FT   mRNA            <856127..>856918
FT                   /locus_tag="AGOS_ACR275W"
FT                   /old_locus_tag="ACR275W"
FT                   /product="ACR275Wp"
FT   CDS_pept        856127..856918
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR275W"
FT                   /old_locus_tag="ACR275W"
FT                   /product="ACR275Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL014C
FT                   (SYN8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR275W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51501"
FT                   /db_xref="GOA:Q75BJ6"
FT                   /db_xref="InterPro:IPR000727"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BJ6"
FT                   /protein_id="AAS51501.1"
FT   gene            complement(<857242..>857733)
FT                   /locus_tag="AGOS_ACR276C"
FT                   /old_locus_tag="ACR276C"
FT   mRNA            complement(<857242..>857733)
FT                   /locus_tag="AGOS_ACR276C"
FT                   /old_locus_tag="ACR276C"
FT                   /product="ACR276Cp"
FT   CDS_pept        complement(857242..857733)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR276C"
FT                   /old_locus_tag="ACR276C"
FT                   /product="ACR276Cp"
FT                   /note="NOHBY334; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F07755g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR276C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51502"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BJ5"
FT                   /protein_id="AAS51502.1"
FT                   "
FT   gene            complement(<857929..>859065)
FT                   /locus_tag="AGOS_ACR277C"
FT                   /old_locus_tag="ACR277C"
FT   mRNA            complement(<857929..>859065)
FT                   /locus_tag="AGOS_ACR277C"
FT                   /old_locus_tag="ACR277C"
FT                   /product="ACR277Cp"
FT   CDS_pept        complement(857929..859065)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR277C"
FT                   /old_locus_tag="ACR277C"
FT                   /product="ACR277Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL042W
FT                   (NGL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR277C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51503"
FT                   /db_xref="GOA:Q75BJ4"
FT                   /db_xref="InterPro:IPR005135"
FT                   /db_xref="InterPro:IPR036691"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BJ4"
FT                   /protein_id="AAS51503.2"
FT   gene            <859350..>860453
FT                   /locus_tag="AGOS_ACR278W"
FT                   /old_locus_tag="ACR278W"
FT   mRNA            <859350..>860453
FT                   /locus_tag="AGOS_ACR278W"
FT                   /old_locus_tag="ACR278W"
FT                   /product="ACR278Wp"
FT   CDS_pept        859350..860453
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR278W"
FT                   /old_locus_tag="ACR278W"
FT                   /product="ACR278Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL043C
FT                   (NTG2) and YAL015C (NTG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR278W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51504"
FT                   /db_xref="GOA:Q75BJ3"
FT                   /db_xref="InterPro:IPR003265"
FT                   /db_xref="InterPro:IPR011257"
FT                   /db_xref="InterPro:IPR023170"
FT                   /db_xref="InterPro:IPR030841"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BJ3"
FT                   /protein_id="AAS51504.1"
FT   gene            complement(<860591..>862402)
FT                   /locus_tag="AGOS_ACR279C"
FT                   /old_locus_tag="ACR279C"
FT   mRNA            complement(<860591..>862402)
FT                   /locus_tag="AGOS_ACR279C"
FT                   /old_locus_tag="ACR279C"
FT                   /product="ACR279Cp"
FT   CDS_pept        complement(860591..862402)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR279C"
FT                   /old_locus_tag="ACR279C"
FT                   /product="ACR279Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL016W
FT                   (TPD3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR279C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51505"
FT                   /db_xref="GOA:Q75BJ2"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR021133"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BJ2"
FT                   /protein_id="AAS51505.1"
FT   gene            complement(<862856..>863929)
FT                   /locus_tag="AGOS_ACR280C"
FT                   /old_locus_tag="ACR280C"
FT   mRNA            complement(<862856..>863929)
FT                   /locus_tag="AGOS_ACR280C"
FT                   /old_locus_tag="ACR280C"
FT                   /product="ACR280Cp"
FT   CDS_pept        complement(862856..863929)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR280C"
FT                   /old_locus_tag="ACR280C"
FT                   /product="ACR280Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL044W
FT                   (PEX15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR280C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51506"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BJ1"
FT                   /protein_id="AAS51506.2"
FT                   SHGLVHIRTIFNAARGL"
FT   gene            complement(<864520..>868299)
FT                   /locus_tag="AGOS_ACR281C"
FT                   /old_locus_tag="ACR281C"
FT   mRNA            complement(<864520..>868299)
FT                   /locus_tag="AGOS_ACR281C"
FT                   /old_locus_tag="ACR281C"
FT                   /product="ACR281Cp"
FT   CDS_pept        complement(864520..868299)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR281C"
FT                   /old_locus_tag="ACR281C"
FT                   /product="ACR281Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL045W
FT                   (PSK2) and YAL017W (PSK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR281C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51507"
FT                   /db_xref="GOA:Q75BJ0"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BJ0"
FT                   /protein_id="AAS51507.2"
FT   gene            complement(<868706..>869981)
FT                   /locus_tag="AGOS_ACR282C"
FT                   /old_locus_tag="ACR282C"
FT   mRNA            complement(join(<868706..869812,869862..>869981))
FT                   /locus_tag="AGOS_ACR282C"
FT                   /old_locus_tag="ACR282C"
FT                   /product="ACR282Cp"
FT   CDS_pept        complement(join(868706..869812,869862..869981))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR282C"
FT                   /old_locus_tag="ACR282C"
FT                   /product="ACR282Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL018C
FT                   and YOL047C; Tandem gene duplication in Saccharomyces
FT                   cerevisiae; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR282C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51508"
FT                   /db_xref="GOA:Q75BI9"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BI9"
FT                   /protein_id="AAS51508.2"
FT                   VIQRSRSRT"
FT   gene            <870387..>871067
FT                   /locus_tag="AGOS_ACR283W"
FT                   /old_locus_tag="ACR283W"
FT   mRNA            <870387..>871067
FT                   /locus_tag="AGOS_ACR283W"
FT                   /old_locus_tag="ACR283W"
FT                   /product="ACR283Wp"
FT   CDS_pept        870387..871067
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR283W"
FT                   /old_locus_tag="ACR283W"
FT                   /product="ACR283Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL018C
FT                   and YOL048C (RRT8) (RRT8); Tandem gene duplication in
FT                   Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR283W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51509"
FT                   /db_xref="GOA:Q75BI8"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BI8"
FT                   /protein_id="AAS51509.1"
FT                   SITE"
FT   gene            complement(<871134..>872585)
FT                   /locus_tag="AGOS_ACR284C"
FT                   /old_locus_tag="ACR284C"
FT   mRNA            complement(<871134..>872585)
FT                   /locus_tag="AGOS_ACR284C"
FT                   /old_locus_tag="ACR284C"
FT                   /product="ACR284Cp"
FT   CDS_pept        complement(871134..872585)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR284C"
FT                   /old_locus_tag="ACR284C"
FT                   /product="ACR284Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL049W
FT                   (GSH2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR284C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51510"
FT                   /db_xref="GOA:Q75BI7"
FT                   /db_xref="InterPro:IPR004887"
FT                   /db_xref="InterPro:IPR005615"
FT                   /db_xref="InterPro:IPR014042"
FT                   /db_xref="InterPro:IPR014049"
FT                   /db_xref="InterPro:IPR014709"
FT                   /db_xref="InterPro:IPR016185"
FT                   /db_xref="InterPro:IPR037013"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BI7"
FT                   /protein_id="AAS51510.1"
FT   gene            complement(<873071..>877033)
FT                   /locus_tag="AGOS_ACR285C"
FT                   /old_locus_tag="ACR285C"
FT   mRNA            complement(<873071..>877033)
FT                   /locus_tag="AGOS_ACR285C"
FT                   /old_locus_tag="ACR285C"
FT                   /product="ACR285Cp"
FT   CDS_pept        complement(873071..877033)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR285C"
FT                   /old_locus_tag="ACR285C"
FT                   /product="ACR285Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL051W
FT                   (GAL11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR285C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51511"
FT                   /db_xref="GOA:Q75BI6"
FT                   /db_xref="InterPro:IPR008626"
FT                   /db_xref="InterPro:IPR033789"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BI6"
FT                   /protein_id="AAS51511.2"
FT   gene            complement(<877334..>880393)
FT                   /locus_tag="AGOS_ACR286C"
FT                   /old_locus_tag="ACR286C"
FT   mRNA            complement(<877334..>880393)
FT                   /locus_tag="AGOS_ACR286C"
FT                   /old_locus_tag="ACR286C"
FT                   /product="ACR286Cp"
FT   CDS_pept        complement(877334..880393)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR286C"
FT                   /old_locus_tag="ACR286C"
FT                   /product="ACR286Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL019W
FT                   (FUN30)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR286C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51512"
FT                   /db_xref="GOA:Q75BI5"
FT                   /db_xref="InterPro:IPR000330"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR038718"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BI5"
FT                   /protein_id="AAS51512.1"
FT   gene            <880743..>881769
FT                   /locus_tag="AGOS_ACR287W"
FT                   /old_locus_tag="ACR287W"
FT   mRNA            <880743..>881769
FT                   /locus_tag="AGOS_ACR287W"
FT                   /old_locus_tag="ACR287W"
FT                   /product="ACR287Wp"
FT   CDS_pept        join(880743..880787,880789..881769)
FT                   /codon_start=1
FT                   /ribosomal_slippage
FT                   /locus_tag="AGOS_ACR287W"
FT                   /old_locus_tag="ACR287W"
FT                   /product="ACR287Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL020C
FT                   (ATS1); no intron; ribosomal slippage at consensus CTTAGGC
FT                   site; ACR287WpmRNA"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR287W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51513"
FT                   /db_xref="GOA:Q75BI4"
FT                   /db_xref="InterPro:IPR000408"
FT                   /db_xref="InterPro:IPR009091"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BI4"
FT                   /protein_id="AAS51513.2"
FT                   C"
FT   gene            <882342..>884552
FT                   /locus_tag="AGOS_ACR288W"
FT                   /old_locus_tag="ACR288W"
FT   mRNA            <882342..>884552
FT                   /locus_tag="AGOS_ACR288W"
FT                   /old_locus_tag="ACR288W"
FT                   /product="ACR288Wp"
FT   CDS_pept        882342..884552
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR288W"
FT                   /old_locus_tag="ACR288W"
FT                   /product="ACR288Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL021C
FT                   (CCR4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR288W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51514"
FT                   /db_xref="GOA:Q75BI3"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR003591"
FT                   /db_xref="InterPro:IPR005135"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="InterPro:IPR036691"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75BI3"
FT                   /protein_id="AAS51514.1"
FT   gene            <884847..>886100
FT                   /locus_tag="AGOS_ACR289W"
FT                   /old_locus_tag="ACR289W"
FT   mRNA            <884847..>886100
FT                   /locus_tag="AGOS_ACR289W"
FT                   /old_locus_tag="ACR289W"
FT                   /product="ACR289Wp"
FT   CDS_pept        884847..886100
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR289W"
FT                   /old_locus_tag="ACR289W"
FT                   /product="ACR289Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL022C
FT                   (FUN26)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR289W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51515"
FT                   /db_xref="GOA:Q75BI2"
FT                   /db_xref="InterPro:IPR002259"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BI2"
FT                   /protein_id="AAS51515.1"
FT                   TCGSIFSYLVVFLLPSVH"
FT   gene            <886522..>888789
FT                   /locus_tag="AGOS_ACR290W"
FT                   /old_locus_tag="ACR290W"
FT   mRNA            <886522..>888789
FT                   /locus_tag="AGOS_ACR290W"
FT                   /old_locus_tag="ACR290W"
FT                   /product="ACR290Wp"
FT   CDS_pept        886522..888789
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR290W"
FT                   /old_locus_tag="ACR290W"
FT                   /product="ACR290Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL023C
FT                   (PMT2) and YOR321W (PMT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_ACR290W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS51516"
FT                   /db_xref="GOA:Q75BI1"
FT                   /db_xref="InterPro:IPR003342"
FT                   /db_xref="InterPro:IPR016093"
FT                   /db_xref="InterPro:IPR027005"
FT                   /db_xref="InterPro:IPR032421"
FT                   /db_xref="InterPro:IPR036300"
FT                   /db_xref="UniProtKB/TrEMBL:Q75BI1"
FT                   /protein_id="AAS51516.1"
FT                   IA"
FT   gene            complement(<888924..>890978)
FT                   /locus_tag="AGOS_ACR291C"
FT                   /old_locus_tag="ACR291C"
FT   mRNA            complement(<888924..>890978)
FT                   /locus_tag="AGOS_ACR291C"
FT                   /old_locus_tag="ACR291C"
FT                   /product="ACR291Cp"
FT   CDS_pept        complement(888924..890978)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_ACR291C"
FT                   /old_locus_tag="ACR291C"
FT                   /produ