(data stored in SCRATCH zone)

EMBL: AE016818

ID   AE016818; SV 2; linear; genomic DNA; STD; FUN; 1519140 BP.
AC   AE016818; AE016894-AE016898;
PR   Project:PRJNA13834;
DT   08-SEP-2004 (Rel. 81, Created)
DT   19-SEP-2017 (Rel. 134, Last updated, Version 13)
DE   Ashbya gossypii ATCC 10895 chromosome V, complete sequence.
KW   .
OS   Eremothecium gossypii ATCC 10895
OC   Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes;
OC   Saccharomycetales; Saccharomycetaceae; Eremothecium.
RN   [1]
RP   1-1519140
RX   DOI; 10.1126/science.1095781.
RX   PUBMED; 15001715.
RA   Dietrich F.S., Voegeli S., Brachat S., Lerch A., Gates K., Steiner S.,
RA   Mohr C., Pohlmann R., Luedi P., Choi S., Wing R.A., Flavier A.,
RA   Gaffney T.D., Philippsen P.;
RT   "The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces
RT   cerevisiae genome";
RL   Science, e1252229 304(5668):304-307(2004).
RN   [2]
RP   1-1519140
RA   Lerch A., Brachat S., Voegeli S.E., Gaffney T., Philippsen P.,
RA   Dietrich F.S.;
RT   ;
RL   Submitted (20-DEC-2002) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [3]
RC   Sequence update by submitter
RP   1-1519140
RA   Lerch A., Brachat S., Voegeli S.E., Gaffney T., Philippsen P.,
RA   Dietrich F.S.;
RT   ;
RL   Submitted (09-AUG-2007) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [4]
RC   Sequence update by submitter
RP   1-1519140
RA   Dietrich F.S., Voegeli S., Philippsen P.;
RT   ;
RL   Submitted (03-JUN-2010) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [5]
RC   Protein update by submitter
RP   1-1519140
RA   Dietrich F.S., Voegeli S., Philippsen P.;
RT   ;
RL   Submitted (02-FEB-2012) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
DR   MD5; c21e879ff20b3c8686fafe90e4b3ea60.
DR   BioSample; SAMN03081415.
DR   EnsemblGenomes-Gn; EFAGOG00000000002.
DR   EnsemblGenomes-Gn; EFAGOG00000000009.
DR   EnsemblGenomes-Gn; EFAGOG00000000012.
DR   EnsemblGenomes-Gn; EFAGOG00000000041.
DR   EnsemblGenomes-Gn; EFAGOG00000000047.
DR   EnsemblGenomes-Gn; EFAGOG00000000055.
DR   EnsemblGenomes-Gn; EFAGOG00000000056.
DR   EnsemblGenomes-Gn; EFAGOG00000000063.
DR   EnsemblGenomes-Gn; EFAGOG00000000066.
DR   EnsemblGenomes-Gn; EFAGOG00000000071.
DR   EnsemblGenomes-Gn; EFAGOG00000000075.
DR   EnsemblGenomes-Gn; EFAGOG00000000092.
DR   EnsemblGenomes-Gn; EFAGOG00000000117.
DR   EnsemblGenomes-Gn; EFAGOG00000000128.
DR   EnsemblGenomes-Gn; EFAGOG00000000129.
DR   EnsemblGenomes-Gn; EFAGOG00000000139.
DR   EnsemblGenomes-Gn; EFAGOG00000000140.
DR   EnsemblGenomes-Gn; EFAGOG00000000149.
DR   EnsemblGenomes-Gn; EFAGOG00000000171.
DR   EnsemblGenomes-Gn; EFAGOG00000000175.
DR   EnsemblGenomes-Gn; EFAGOG00000000176.
DR   EnsemblGenomes-Gn; EFAGOG00000000203.
DR   EnsemblGenomes-Gn; EFAGOG00000000204.
DR   EnsemblGenomes-Gn; EFAGOG00000000220.
DR   EnsemblGenomes-Gn; EFAGOG00000000225.
DR   EnsemblGenomes-Gn; EFAGOG00000000244.
DR   EnsemblGenomes-Gn; EFAGOG00000000254.
DR   EnsemblGenomes-Gn; EFAGOG00000000256.
DR   EnsemblGenomes-Gn; EFAGOG00000000258.
DR   EnsemblGenomes-Gn; EFAGOG00000000262.
DR   EnsemblGenomes-Gn; EFAGOG00000000263.
DR   EnsemblGenomes-Gn; EFAGOG00000000264.
DR   EnsemblGenomes-Gn; EFAGOG00000000270.
DR   EnsemblGenomes-Gn; EFAGOG00000000280.
DR   EnsemblGenomes-Gn; EFAGOG00000000285.
DR   EnsemblGenomes-Gn; EFAGOG00000000289.
DR   EnsemblGenomes-Gn; EFAGOG00000000328.
DR   EnsemblGenomes-Gn; EFAGOG00000000337.
DR   EnsemblGenomes-Gn; EFAGOG00000000363.
DR   EnsemblGenomes-Gn; EFAGOG00000000367.
DR   EnsemblGenomes-Gn; EFAGOG00000000369.
DR   EnsemblGenomes-Gn; EFAGOG00000000370.
DR   EnsemblGenomes-Gn; EFAGOG00000000377.
DR   EnsemblGenomes-Gn; EFAGOG00000000381.
DR   EnsemblGenomes-Gn; EFAGOG00000000389.
DR   EnsemblGenomes-Gn; EFAGOG00000000401.
DR   EnsemblGenomes-Gn; EFAGOG00000000405.
DR   EnsemblGenomes-Gn; ENSRNA049495852.
DR   EnsemblGenomes-Gn; ENSRNA049495858.
DR   EnsemblGenomes-Gn; ENSRNA049495865.
DR   EnsemblGenomes-Gn; ENSRNA049495871.
DR   EnsemblGenomes-Gn; ENSRNA049495877.
DR   EnsemblGenomes-Gn; ENSRNA049495885.
DR   EnsemblGenomes-Gn; ENSRNA049495890.
DR   EnsemblGenomes-Gn; ENSRNA049495895.
DR   EnsemblGenomes-Gn; ENSRNA049521642.
DR   EnsemblGenomes-Gn; ENSRNA049521677.
DR   EnsemblGenomes-Gn; ENSRNA049521708.
DR   EnsemblGenomes-Gn; ENSRNA049521730.
DR   EnsemblGenomes-Gn; ENSRNA049521759.
DR   EnsemblGenomes-Gn; ENSRNA049521772.
DR   EnsemblGenomes-Gn; ENSRNA049521816.
DR   EnsemblGenomes-Gn; ENSRNA049521846.
DR   EnsemblGenomes-Gn; ENSRNA049521869.
DR   EnsemblGenomes-Gn; ENSRNA049521897.
DR   EnsemblGenomes-Gn; ENSRNA049521927.
DR   EnsemblGenomes-Gn; ENSRNA049521950.
DR   EnsemblGenomes-Gn; ENSRNA049521964.
DR   EnsemblGenomes-Gn; ENSRNA049522005.
DR   EnsemblGenomes-Gn; ENSRNA049522042.
DR   EnsemblGenomes-Gn; ENSRNA049522084.
DR   EnsemblGenomes-Gn; ENSRNA049522130.
DR   EnsemblGenomes-Gn; ENSRNA049522165.
DR   EnsemblGenomes-Gn; ENSRNA049522199.
DR   EnsemblGenomes-Gn; ENSRNA049522228.
DR   EnsemblGenomes-Gn; ENSRNA049522257.
DR   EnsemblGenomes-Gn; ENSRNA049522283.
DR   EnsemblGenomes-Gn; ENSRNA049522307.
DR   EnsemblGenomes-Gn; ENSRNA049522335.
DR   EnsemblGenomes-Gn; ENSRNA049522363.
DR   EnsemblGenomes-Gn; ENSRNA049522393.
DR   EnsemblGenomes-Gn; ENSRNA049522424.
DR   EnsemblGenomes-Gn; ENSRNA049522458.
DR   EnsemblGenomes-Gn; ENSRNA049522499.
DR   EnsemblGenomes-Gn; ENSRNA049522534.
DR   EnsemblGenomes-Gn; ENSRNA049522556.
DR   EnsemblGenomes-Gn; ENSRNA049522586.
DR   EnsemblGenomes-Gn; ENSRNA049522616.
DR   EnsemblGenomes-Gn; ENSRNA049522646.
DR   EnsemblGenomes-Gn; ENSRNA049522677.
DR   EnsemblGenomes-Gn; ENSRNA049522699.
DR   EnsemblGenomes-Gn; ENSRNA049522739.
DR   EnsemblGenomes-Gn; ENSRNA049522774.
DR   EnsemblGenomes-Tr; EFAGOT00000000002.
DR   EnsemblGenomes-Tr; EFAGOT00000000009.
DR   EnsemblGenomes-Tr; EFAGOT00000000012.
DR   EnsemblGenomes-Tr; EFAGOT00000000041.
DR   EnsemblGenomes-Tr; EFAGOT00000000047.
DR   EnsemblGenomes-Tr; EFAGOT00000000055.
DR   EnsemblGenomes-Tr; EFAGOT00000000056.
DR   EnsemblGenomes-Tr; EFAGOT00000000063.
DR   EnsemblGenomes-Tr; EFAGOT00000000066.
DR   EnsemblGenomes-Tr; EFAGOT00000000071.
DR   EnsemblGenomes-Tr; EFAGOT00000000075.
DR   EnsemblGenomes-Tr; EFAGOT00000000092.
DR   EnsemblGenomes-Tr; EFAGOT00000000117.
DR   EnsemblGenomes-Tr; EFAGOT00000000128.
DR   EnsemblGenomes-Tr; EFAGOT00000000129.
DR   EnsemblGenomes-Tr; EFAGOT00000000139.
DR   EnsemblGenomes-Tr; EFAGOT00000000140.
DR   EnsemblGenomes-Tr; EFAGOT00000000149.
DR   EnsemblGenomes-Tr; EFAGOT00000000171.
DR   EnsemblGenomes-Tr; EFAGOT00000000175.
DR   EnsemblGenomes-Tr; EFAGOT00000000176.
DR   EnsemblGenomes-Tr; EFAGOT00000000203.
DR   EnsemblGenomes-Tr; EFAGOT00000000204.
DR   EnsemblGenomes-Tr; EFAGOT00000000220.
DR   EnsemblGenomes-Tr; EFAGOT00000000225.
DR   EnsemblGenomes-Tr; EFAGOT00000000244.
DR   EnsemblGenomes-Tr; EFAGOT00000000254.
DR   EnsemblGenomes-Tr; EFAGOT00000000256.
DR   EnsemblGenomes-Tr; EFAGOT00000000258.
DR   EnsemblGenomes-Tr; EFAGOT00000000262.
DR   EnsemblGenomes-Tr; EFAGOT00000000263.
DR   EnsemblGenomes-Tr; EFAGOT00000000264.
DR   EnsemblGenomes-Tr; EFAGOT00000000270.
DR   EnsemblGenomes-Tr; EFAGOT00000000280.
DR   EnsemblGenomes-Tr; EFAGOT00000000285.
DR   EnsemblGenomes-Tr; EFAGOT00000000289.
DR   EnsemblGenomes-Tr; EFAGOT00000000328.
DR   EnsemblGenomes-Tr; EFAGOT00000000337.
DR   EnsemblGenomes-Tr; EFAGOT00000000363.
DR   EnsemblGenomes-Tr; EFAGOT00000000367.
DR   EnsemblGenomes-Tr; EFAGOT00000000369.
DR   EnsemblGenomes-Tr; EFAGOT00000000370.
DR   EnsemblGenomes-Tr; EFAGOT00000000377.
DR   EnsemblGenomes-Tr; EFAGOT00000000381.
DR   EnsemblGenomes-Tr; EFAGOT00000000389.
DR   EnsemblGenomes-Tr; EFAGOT00000000401.
DR   EnsemblGenomes-Tr; EFAGOT00000000405.
DR   RFAM; RF00005; tRNA.
DR   RFAM; RF00009; RNaseP_nuc.
DR   RFAM; RF00473; snosnR54.
DR   RFAM; RF01201; snR40.
DR   RFAM; RF01248; snR8.
DR   RFAM; RF01250; snR189.
DR   RFAM; RF01251; snR3.
DR   RFAM; RF01254; snR34.
DR   RFAM; RF01257; snR31.
DR   StrainInfo; 195190; 0.
CC   On Jun 29, 2010 this sequence version replaced AE016818.1.
CC   This genome has been completely resequenced to high accuracy (derf)
CC   and reannotated. Gene names have been  maintained, though some
CC   genes have been added, and many protein sequences have been
CC   corrected.
FH   Key             Location/Qualifiers
FT   source          1..1519140
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /chromosome="V"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /db_xref="taxon:284811"
FT                   /culture_collection="ATCC:10895"
FT   source          48859..92111
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1539"
FT                   /db_xref="taxon:284811"
FT   source          62602..126444
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1581"
FT                   /db_xref="taxon:284811"
FT   source          102567..180841
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1047"
FT                   /db_xref="taxon:284811"
FT   source          168565..223717
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1442"
FT                   /db_xref="taxon:284811"
FT   source          209885..269862
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1767"
FT                   /db_xref="taxon:284811"
FT   source          233180..294714
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1771"
FT                   /db_xref="taxon:284811"
FT   source          294653..343542
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1653"
FT                   /db_xref="taxon:284811"
FT   source          296827..378526
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1722"
FT                   /db_xref="taxon:284811"
FT   source          371608..436193
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1441"
FT                   /db_xref="taxon:284811"
FT   source          374022..441571
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1662"
FT                   /db_xref="taxon:284811"
FT   source          479895..545835
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1262"
FT                   /db_xref="taxon:284811"
FT   source          506880..571542
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1720"
FT                   /db_xref="taxon:284811"
FT   source          668747..720871
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1242"
FT                   /db_xref="taxon:284811"
FT   source          680470..747540
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1318"
FT                   /db_xref="taxon:284811"
FT   source          722038..794830
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1543"
FT                   /db_xref="taxon:284811"
FT   source          758101..818503
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1180"
FT                   /db_xref="taxon:284811"
FT   source          828715..898210
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1702"
FT                   /db_xref="taxon:284811"
FT   source          880616..928951
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1578"
FT                   /db_xref="taxon:284811"
FT   source          916851..984111
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1134"
FT                   /db_xref="taxon:284811"
FT   source          966873..1018621
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1350"
FT                   /db_xref="taxon:284811"
FT   source          1018507..1051617
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1186"
FT                   /db_xref="taxon:284811"
FT   source          1020719..1073725
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1073"
FT                   /db_xref="taxon:284811"
FT   source          1055917..1102834
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1424"
FT                   /db_xref="taxon:284811"
FT   source          1073651..1126289
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1537"
FT                   /db_xref="taxon:284811"
FT   source          1094137..1152805
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1250"
FT                   /db_xref="taxon:284811"
FT   source          1165404..1236932
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1515"
FT                   /db_xref="taxon:284811"
FT   source          1220381..1274323
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1624"
FT                   /db_xref="taxon:284811"
FT   source          1238302..1307320
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1078"
FT                   /db_xref="taxon:284811"
FT   source          1312695..1355042
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1191"
FT                   /db_xref="taxon:284811"
FT   source          1358114..1431418
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1362"
FT                   /db_xref="taxon:284811"
FT   source          1408764..1474572
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1577"
FT                   /db_xref="taxon:284811"
FT   source          1448685..1516268
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1474"
FT                   /db_xref="taxon:284811"
FT   telomere        complement(1..508)
FT                   /rpt_type=DIRECT
FT                   /rpt_unit_range=1..24
FT                   /rpt_unit_seq="ggtgtggtgtatgggtctctcagc"
FT                   /note="Chromosome V left end terminal telomere repeat.
FT                   Composed of approximately 20 copies of a 24 base repeat
FT                   unit, and occasionally sequence varients of this repeat."
FT   telomere        complement(509..1860)
FT                   /note="Chromosome V left subtelomeric sequence. Shares some
FT                   sequence similarity with other subtelomeric regions."
FT   gene            <1960..>3897
FT                   /locus_tag="AGOS_AEL345W"
FT                   /old_locus_tag="AEL345W"
FT   mRNA            <1960..>3897
FT                   /locus_tag="AGOS_AEL345W"
FT                   /old_locus_tag="AEL345W"
FT                   /product="AEL345Wp"
FT   CDS_pept        1960..3897
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL345W"
FT                   /old_locus_tag="AEL345W"
FT                   /product="AEL345Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIL014W (MNT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL345W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52339"
FT                   /db_xref="GOA:Q758U7"
FT                   /db_xref="InterPro:IPR022751"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q758U7"
FT                   /protein_id="AAS52339.1"
FT                   SKAPYLSSIA"
FT   gene            <5877..>7499
FT                   /locus_tag="AGOS_AEL344W"
FT                   /old_locus_tag="AEL344W"
FT   mRNA            <5877..>7499
FT                   /locus_tag="AGOS_AEL344W"
FT                   /old_locus_tag="AEL344W"
FT                   /product="AEL344Wp"
FT   CDS_pept        5877..7499
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL344W"
FT                   /old_locus_tag="AEL344W"
FT                   /product="AEL344Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL013W
FT                   (DEP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL344W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52340"
FT                   /db_xref="GOA:Q758U6"
FT                   /db_xref="InterPro:IPR013907"
FT                   /db_xref="UniProtKB/TrEMBL:Q758U6"
FT                   /protein_id="AAS52340.2"
FT   gene            complement(<7769..>8197)
FT                   /locus_tag="AGOS_AEL343C"
FT                   /old_locus_tag="AEL343C"
FT   mRNA            complement(<7769..>8197)
FT                   /locus_tag="AGOS_AEL343C"
FT                   /old_locus_tag="AEL343C"
FT                   /product="AEL343Cp"
FT   CDS_pept        complement(7769..8197)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL343C"
FT                   /old_locus_tag="AEL343C"
FT                   /product="AEL343Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL040C
FT                   (RPS15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL343C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52341"
FT                   /db_xref="GOA:Q758U5"
FT                   /db_xref="InterPro:IPR002222"
FT                   /db_xref="InterPro:IPR005713"
FT                   /db_xref="InterPro:IPR020934"
FT                   /db_xref="InterPro:IPR023575"
FT                   /db_xref="UniProtKB/TrEMBL:Q758U5"
FT                   /protein_id="AAS52341.1"
FT   gene            <8703..>9020
FT                   /locus_tag="AGOS_AEL342W"
FT                   /old_locus_tag="AEL342W"
FT   mRNA            <8703..>9020
FT                   /locus_tag="AGOS_AEL342W"
FT                   /old_locus_tag="AEL342W"
FT                   /product="AEL342Wp"
FT   CDS_pept        8703..9020
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL342W"
FT                   /old_locus_tag="AEL342W"
FT                   /product="AEL342Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL039W
FT                   (RPP2A)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL342W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52342"
FT                   /db_xref="GOA:Q758U4"
FT                   /db_xref="InterPro:IPR001859"
FT                   /db_xref="InterPro:IPR027534"
FT                   /db_xref="InterPro:IPR038716"
FT                   /db_xref="UniProtKB/TrEMBL:Q758U4"
FT                   /protein_id="AAS52342.1"
FT                   D"
FT   gene            <9427..>10608
FT                   /locus_tag="AGOS_AEL341W"
FT                   /old_locus_tag="AEL341W"
FT   mRNA            <9427..>10608
FT                   /locus_tag="AGOS_AEL341W"
FT                   /old_locus_tag="AEL341W"
FT                   /product="AEL341Wp"
FT   CDS_pept        9427..10608
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL341W"
FT                   /old_locus_tag="AEL341W"
FT                   /product="AEL341Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL012W
FT                   (CYS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL341W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52343"
FT                   /db_xref="GOA:Q758U3"
FT                   /db_xref="InterPro:IPR000277"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="UniProtKB/TrEMBL:Q758U3"
FT                   /protein_id="AAS52343.1"
FT   gene            <10760..>11911
FT                   /locus_tag="AGOS_AEL340W"
FT                   /old_locus_tag="AEL340W"
FT   mRNA            <10760..>11911
FT                   /locus_tag="AGOS_AEL340W"
FT                   /old_locus_tag="AEL340W"
FT                   /product="AEL340Wp"
FT   CDS_pept        10760..11911
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL340W"
FT                   /old_locus_tag="AEL340W"
FT                   /product="AEL340Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL031C
FT                   (SIL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL340W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52344"
FT                   /db_xref="GOA:Q758U2"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR031884"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758U2"
FT                   /protein_id="AAS52344.1"
FT   gene            complement(<11942..>12643)
FT                   /locus_tag="AGOS_AEL339C"
FT                   /old_locus_tag="AEL339C"
FT   mRNA            complement(<11942..>12643)
FT                   /locus_tag="AGOS_AEL339C"
FT                   /old_locus_tag="AEL339C"
FT                   /product="AEL339Cp"
FT   CDS_pept        complement(11942..12643)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL339C"
FT                   /old_locus_tag="AEL339C"
FT                   /product="AEL339Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL032W
FT                   (OPI10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL339C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52345"
FT                   /db_xref="GOA:Q758U1"
FT                   /db_xref="InterPro:IPR008493"
FT                   /db_xref="InterPro:IPR031318"
FT                   /db_xref="UniProtKB/TrEMBL:Q758U1"
FT                   /protein_id="AAS52345.1"
FT                   DATFIDEVTSE"
FT   gene            complement(<12869..>14470)
FT                   /locus_tag="AGOS_AEL338C"
FT                   /old_locus_tag="AEL338C"
FT   mRNA            complement(<12869..>14470)
FT                   /locus_tag="AGOS_AEL338C"
FT                   /old_locus_tag="AEL338C"
FT                   /product="AEL338Cp"
FT   CDS_pept        complement(12869..14470)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL338C"
FT                   /old_locus_tag="AEL338C"
FT                   /product="AEL338Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL033W
FT                   (MSE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL338C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52346"
FT                   /db_xref="GOA:Q758U0"
FT                   /db_xref="InterPro:IPR000924"
FT                   /db_xref="InterPro:IPR004527"
FT                   /db_xref="InterPro:IPR008925"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR020058"
FT                   /db_xref="InterPro:IPR020751"
FT                   /db_xref="InterPro:IPR033910"
FT                   /db_xref="UniProtKB/TrEMBL:Q758U0"
FT                   /protein_id="AAS52346.1"
FT                   EETKARLNEAAQYLVT"
FT   gene            complement(<14612..>17905)
FT                   /locus_tag="AGOS_AEL337C"
FT                   /old_locus_tag="AEL337C"
FT   mRNA            complement(<14612..>17905)
FT                   /locus_tag="AGOS_AEL337C"
FT                   /old_locus_tag="AEL337C"
FT                   /product="AEL337Cp"
FT   CDS_pept        complement(14612..17905)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL337C"
FT                   /old_locus_tag="AEL337C"
FT                   /product="AEL337Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL034W
FT                   (SMC5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL337C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52347"
FT                   /db_xref="GOA:Q758T9"
FT                   /db_xref="InterPro:IPR003395"
FT                   /db_xref="InterPro:IPR027131"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q758T9"
FT                   /protein_id="AAS52347.2"
FT   gene            <18240..>20306
FT                   /locus_tag="AGOS_AEL336W"
FT                   /old_locus_tag="AEL336W"
FT   mRNA            <18240..>20306
FT                   /locus_tag="AGOS_AEL336W"
FT                   /old_locus_tag="AEL336W"
FT                   /product="AEL336Wp"
FT   CDS_pept        18240..20306
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL336W"
FT                   /old_locus_tag="AEL336W"
FT                   /product="AEL336Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL011W
FT                   (SWC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL336W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52348"
FT                   /db_xref="GOA:Q758T8"
FT                   /db_xref="InterPro:IPR037651"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758T8"
FT                   /protein_id="AAS52348.2"
FT   gene            complement(<20342..>21739)
FT                   /locus_tag="AGOS_AEL335C"
FT                   /old_locus_tag="AEL335C"
FT   mRNA            complement(<20342..>21739)
FT                   /locus_tag="AGOS_AEL335C"
FT                   /old_locus_tag="AEL335C"
FT                   /product="AEL335Cp"
FT   CDS_pept        complement(20342..21739)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL335C"
FT                   /old_locus_tag="AEL335C"
FT                   /product="AEL335Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL010C
FT                   (MDM10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL335C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52349"
FT                   /db_xref="GOA:Q758T7"
FT                   /db_xref="InterPro:IPR027539"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758T7"
FT                   /protein_id="AAS52349.2"
FT                   IQIQYST"
FT   gene            <21873..>22847
FT                   /locus_tag="AGOS_AEL334W"
FT                   /old_locus_tag="AEL334W"
FT   mRNA            <21873..>22847
FT                   /locus_tag="AGOS_AEL334W"
FT                   /old_locus_tag="AEL334W"
FT                   /product="AEL334Wp"
FT   CDS_pept        21873..22847
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL334W"
FT                   /old_locus_tag="AEL334W"
FT                   /product="AEL334Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL009W
FT                   (SPO7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL334W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52350"
FT                   /db_xref="GOA:Q758T6"
FT                   /db_xref="InterPro:IPR005605"
FT                   /db_xref="UniProtKB/TrEMBL:Q758T6"
FT                   /protein_id="AAS52350.1"
FT   gene            complement(22986..23002)
FT                   /locus_tag="AGOS_AgSNR50"
FT   ncRNA           complement(22986..23002)
FT                   /locus_tag="AGOS_AgSNR50"
FT                   /product="AgSNR50"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR50; start and end coordinates are approximate;
FT                   similarity is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            <23514..>25474
FT                   /locus_tag="AGOS_AEL333W"
FT                   /old_locus_tag="AEL333W"
FT   mRNA            join(<23514..23537,23606..>25474)
FT                   /locus_tag="AGOS_AEL333W"
FT                   /old_locus_tag="AEL333W"
FT                   /product="AEL333Wp"
FT   CDS_pept        join(23514..23537,23606..25474)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL333W"
FT                   /old_locus_tag="AEL333W"
FT                   /product="AEL333Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR014W
FT                   (RTS1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL333W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52351"
FT                   /db_xref="GOA:Q758T5"
FT                   /db_xref="InterPro:IPR002554"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q758T5"
FT                   /protein_id="AAS52351.2"
FT   gene            <25995..>26612
FT                   /locus_tag="AGOS_AEL332W"
FT                   /old_locus_tag="AEL332W"
FT   mRNA            <25995..>26612
FT                   /locus_tag="AGOS_AEL332W"
FT                   /old_locus_tag="AEL332W"
FT                   /product="AEL332Wp"
FT   CDS_pept        25995..26612
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL332W"
FT                   /old_locus_tag="AEL332W"
FT                   /product="AEL332Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL008W
FT                   (FUN14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL332W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52352"
FT                   /db_xref="GOA:Q758T4"
FT                   /db_xref="InterPro:IPR007014"
FT                   /db_xref="UniProtKB/TrEMBL:Q758T4"
FT                   /protein_id="AAS52352.1"
FT   gene            <26839..>27468
FT                   /locus_tag="AGOS_AEL331W"
FT                   /old_locus_tag="AEL331W"
FT   mRNA            <26839..>27468
FT                   /locus_tag="AGOS_AEL331W"
FT                   /old_locus_tag="AEL331W"
FT                   /product="AEL331Wp"
FT   CDS_pept        26839..27468
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL331W"
FT                   /old_locus_tag="AEL331W"
FT                   /product="AEL331Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR107C
FT                   (YTH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL331W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52353"
FT                   /db_xref="GOA:Q758T3"
FT                   /db_xref="InterPro:IPR000571"
FT                   /db_xref="InterPro:IPR036855"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758T3"
FT                   /protein_id="AAS52353.1"
FT   gene            complement(<27520..>28548)
FT                   /locus_tag="AGOS_AEL330C"
FT                   /old_locus_tag="AEL330C"
FT   mRNA            complement(<27520..>28548)
FT                   /locus_tag="AGOS_AEL330C"
FT                   /old_locus_tag="AEL330C"
FT                   /product="AEL330Cp"
FT   CDS_pept        complement(27520..28548)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL330C"
FT                   /old_locus_tag="AEL330C"
FT                   /product="AEL330Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR106W
FT                   (ISR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL330C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52354"
FT                   /db_xref="GOA:Q758T2"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758T2"
FT                   /protein_id="AAS52354.2"
FT                   AF"
FT   gene            <29316..>30224
FT                   /locus_tag="AGOS_AEL329W"
FT                   /old_locus_tag="AEL329W"
FT   mRNA            <29316..>30224
FT                   /locus_tag="AGOS_AEL329W"
FT                   /old_locus_tag="AEL329W"
FT                   /product="AEL329Wp"
FT   CDS_pept        29316..30224
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL329W"
FT                   /old_locus_tag="AEL329W"
FT                   /product="AEL329Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR086C
FT                   (PIL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL329W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52355"
FT                   /db_xref="GOA:Q758T1"
FT                   /db_xref="InterPro:IPR027267"
FT                   /db_xref="InterPro:IPR028245"
FT                   /db_xref="UniProtKB/TrEMBL:Q758T1"
FT                   /protein_id="AAS52355.1"
FT   gene            <30723..>33212
FT                   /locus_tag="AGOS_AEL328W"
FT                   /old_locus_tag="AEL328W"
FT   mRNA            <30723..>33212
FT                   /locus_tag="AGOS_AEL328W"
FT                   /old_locus_tag="AEL328W"
FT                   /product="AEL328Wp"
FT   CDS_pept        30723..33212
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL328W"
FT                   /old_locus_tag="AEL328W"
FT                   /product="AEL328Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR105C
FT                   (COG4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL328W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52356"
FT                   /db_xref="GOA:Q758T0"
FT                   /db_xref="InterPro:IPR013167"
FT                   /db_xref="UniProtKB/TrEMBL:Q758T0"
FT                   /protein_id="AAS52356.1"
FT                   SAPERVRARNMRVDKRS"
FT   gene            <33827..>37231
FT                   /locus_tag="AGOS_AEL327W"
FT                   /old_locus_tag="AEL327W"
FT   mRNA            <33827..>37231
FT                   /locus_tag="AGOS_AEL327W"
FT                   /old_locus_tag="AEL327W"
FT                   /product="AEL327Wp"
FT   CDS_pept        33827..37231
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL327W"
FT                   /old_locus_tag="AEL327W"
FT                   /product="AEL327Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR104C
FT                   (FHL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL327W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52357"
FT                   /db_xref="GOA:Q758S9"
FT                   /db_xref="InterPro:IPR000253"
FT                   /db_xref="InterPro:IPR001766"
FT                   /db_xref="InterPro:IPR008984"
FT                   /db_xref="InterPro:IPR030456"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="UniProtKB/TrEMBL:Q758S9"
FT                   /protein_id="AAS52357.2"
FT   gene            complement(<37423..>38280)
FT                   /locus_tag="AGOS_AEL326C"
FT                   /old_locus_tag="AEL326C"
FT   mRNA            complement(<37423..>38280)
FT                   /locus_tag="AGOS_AEL326C"
FT                   /old_locus_tag="AEL326C"
FT                   /product="AEL326Cp"
FT   CDS_pept        complement(37423..38280)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL326C"
FT                   /old_locus_tag="AEL326C"
FT                   /product="AEL326Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR103W
FT                   (PRE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL326C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52358"
FT                   /db_xref="GOA:Q758S8"
FT                   /db_xref="InterPro:IPR000243"
FT                   /db_xref="InterPro:IPR001353"
FT                   /db_xref="InterPro:IPR016050"
FT                   /db_xref="InterPro:IPR023333"
FT                   /db_xref="InterPro:IPR029055"
FT                   /db_xref="UniProtKB/TrEMBL:Q758S8"
FT                   /protein_id="AAS52358.2"
FT                   NVLG"
FT   gene            <38620..>39144
FT                   /locus_tag="AGOS_AEL325W"
FT                   /old_locus_tag="AEL325W"
FT   mRNA            <38620..>39144
FT                   /locus_tag="AGOS_AEL325W"
FT                   /old_locus_tag="AEL325W"
FT                   /product="AEL325Wp"
FT   CDS_pept        38620..39144
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL325W"
FT                   /old_locus_tag="AEL325W"
FT                   /product="AEL325Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR102C
FT                   (RPL11A) and YGR085C (RPL11B)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL325W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52359"
FT                   /db_xref="GOA:Q758S7"
FT                   /db_xref="InterPro:IPR002132"
FT                   /db_xref="InterPro:IPR020929"
FT                   /db_xref="InterPro:IPR022803"
FT                   /db_xref="InterPro:IPR031309"
FT                   /db_xref="InterPro:IPR031310"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758S7"
FT                   /protein_id="AAS52359.1"
FT                   KQRYDADVLDK"
FT   gene            complement(<39212..>39805)
FT                   /locus_tag="AGOS_AEL324C"
FT                   /old_locus_tag="AEL324C"
FT   mRNA            complement(<39212..>39805)
FT                   /locus_tag="AGOS_AEL324C"
FT                   /old_locus_tag="AEL324C"
FT                   /product="AEL324Cp"
FT   CDS_pept        complement(39212..39805)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL324C"
FT                   /old_locus_tag="AEL324C"
FT                   /product="AEL324Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR101W
FT                   (SNT309)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL324C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52360"
FT                   /db_xref="GOA:Q758S6"
FT                   /db_xref="InterPro:IPR008409"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758S6"
FT                   /protein_id="AAS52360.1"
FT   gene            <39991..>40905
FT                   /locus_tag="AGOS_AEL323W"
FT                   /old_locus_tag="AEL323W"
FT   mRNA            <39991..>40905
FT                   /locus_tag="AGOS_AEL323W"
FT                   /old_locus_tag="AEL323W"
FT                   /product="AEL323Wp"
FT   CDS_pept        39991..40905
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL323W"
FT                   /old_locus_tag="AEL323W"
FT                   /product="AEL323Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR084C
FT                   (MRP13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL323W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52361"
FT                   /db_xref="UniProtKB/TrEMBL:Q758S5"
FT                   /protein_id="AAS52361.1"
FT   gene            <41234..>43048
FT                   /locus_tag="AGOS_AEL322W"
FT                   /old_locus_tag="AEL322W"
FT   mRNA            <41234..>43048
FT                   /locus_tag="AGOS_AEL322W"
FT                   /old_locus_tag="AEL322W"
FT                   /product="AEL322Wp"
FT   CDS_pept        41234..43048
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL322W"
FT                   /old_locus_tag="AEL322W"
FT                   /product="AEL322Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR083C
FT                   (GCD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL322W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52362"
FT                   /db_xref="GOA:Q758S4"
FT                   /db_xref="InterPro:IPR000649"
FT                   /db_xref="InterPro:IPR037171"
FT                   /db_xref="InterPro:IPR042529"
FT                   /db_xref="UniProtKB/TrEMBL:Q758S4"
FT                   /protein_id="AAS52362.1"
FT   gene            complement(<43119..>43547)
FT                   /locus_tag="AGOS_AEL321C"
FT                   /old_locus_tag="AEL321C"
FT   mRNA            complement(<43119..>43547)
FT                   /locus_tag="AGOS_AEL321C"
FT                   /old_locus_tag="AEL321C"
FT                   /product="AEL321Cp"
FT   CDS_pept        complement(43119..43547)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL321C"
FT                   /old_locus_tag="AEL321C"
FT                   /product="AEL321Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR100W
FT                   (MRPL51)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL321C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52363"
FT                   /db_xref="GOA:Q758S3"
FT                   /db_xref="InterPro:IPR007741"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="InterPro:IPR039927"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758S3"
FT                   /protein_id="AAS52363.1"
FT   gene            <44085..>47045
FT                   /locus_tag="AGOS_AEL320W"
FT                   /old_locus_tag="AEL320W"
FT   mRNA            <44085..>47045
FT                   /locus_tag="AGOS_AEL320W"
FT                   /old_locus_tag="AEL320W"
FT                   /product="AEL320Wp"
FT   CDS_pept        44085..47045
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL320W"
FT                   /old_locus_tag="AEL320W"
FT                   /product="AEL320Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPR097W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL320W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52364"
FT                   /db_xref="GOA:Q758V6"
FT                   /db_xref="InterPro:IPR001683"
FT                   /db_xref="InterPro:IPR024554"
FT                   /db_xref="InterPro:IPR024555"
FT                   /db_xref="InterPro:IPR036871"
FT                   /db_xref="UniProtKB/TrEMBL:Q758V6"
FT                   /protein_id="AAS52364.1"
FT   gene            complement(<47139..>47705)
FT                   /locus_tag="AGOS_AEL319C"
FT                   /old_locus_tag="AEL319C"
FT   mRNA            complement(<47139..>47705)
FT                   /locus_tag="AGOS_AEL319C"
FT                   /old_locus_tag="AEL319C"
FT                   /product="AEL319Cp"
FT   CDS_pept        complement(47139..47705)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL319C"
FT                   /old_locus_tag="AEL319C"
FT                   /product="AEL319Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR081C
FT                   (SLX9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL319C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52365"
FT                   /db_xref="GOA:Q758S2"
FT                   /db_xref="InterPro:IPR028160"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758S2"
FT                   /protein_id="AAS52365.1"
FT   gene            <48135..>48680
FT                   /locus_tag="AGOS_AEL318W"
FT                   /old_locus_tag="AEL318W"
FT   mRNA            <48135..>48680
FT                   /locus_tag="AGOS_AEL318W"
FT                   /old_locus_tag="AEL318W"
FT                   /product="AEL318Wp"
FT   CDS_pept        48135..48680
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL318W"
FT                   /old_locus_tag="AEL318W"
FT                   /product="AEL318Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR082W
FT                   (TOM20)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL318W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52366"
FT                   /db_xref="GOA:Q758S1"
FT                   /db_xref="InterPro:IPR002056"
FT                   /db_xref="InterPro:IPR023392"
FT                   /db_xref="UniProtKB/TrEMBL:Q758S1"
FT                   /protein_id="AAS52366.1"
FT                   ASTASVHAQPQEAVGIDE"
FT   gene            complement(<48857..>49398)
FT                   /locus_tag="AGOS_AEL317C"
FT                   /old_locus_tag="AEL317C"
FT   mRNA            complement(join(<48857..49298,49352..>49398))
FT                   /locus_tag="AGOS_AEL317C"
FT                   /old_locus_tag="AEL317C"
FT                   /product="AEL317Cp"
FT   CDS_pept        complement(join(48857..49298,49352..49398))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL317C"
FT                   /old_locus_tag="AEL317C"
FT                   /product="AEL317Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPR098C; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL317C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52367"
FT                   /db_xref="GOA:Q758S0"
FT                   /db_xref="InterPro:IPR025423"
FT                   /db_xref="UniProtKB/TrEMBL:Q758S0"
FT                   /protein_id="AAS52367.2"
FT   gene            49710..49783
FT                   /locus_tag="AGOS_t0089"
FT   tRNA            49710..49783
FT                   /locus_tag="AGOS_t0089"
FT                   /product="tRNA-Val"
FT                   /note="codon recognized: GUU"
FT   gene            50062..50133
FT                   /locus_tag="AGOS_t0090"
FT   tRNA            50062..50133
FT                   /locus_tag="AGOS_t0090"
FT                   /product="tRNA-Asp"
FT                   /note="codon recognized: GAC"
FT   gene            <50307..>51464
FT                   /locus_tag="AGOS_AEL316W"
FT                   /old_locus_tag="AEL316W"
FT   mRNA            <50307..>51464
FT                   /locus_tag="AGOS_AEL316W"
FT                   /old_locus_tag="AEL316W"
FT                   /product="AEL316Wp"
FT   CDS_pept        50307..51464
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL316W"
FT                   /old_locus_tag="AEL316W"
FT                   /product="AEL316Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR038C
FT                   (KAE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL316W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52368"
FT                   /db_xref="GOA:Q758R9"
FT                   /db_xref="InterPro:IPR000905"
FT                   /db_xref="InterPro:IPR017860"
FT                   /db_xref="InterPro:IPR017861"
FT                   /db_xref="InterPro:IPR034680"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758R9"
FT                   /protein_id="AAS52368.1"
FT   gene            <51726..>52598
FT                   /locus_tag="AGOS_AEL315W"
FT                   /old_locus_tag="AEL315W"
FT   mRNA            <51726..>52598
FT                   /locus_tag="AGOS_AEL315W"
FT                   /old_locus_tag="AEL315W"
FT                   /product="AEL315Wp"
FT   CDS_pept        51726..52598
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL315W"
FT                   /old_locus_tag="AEL315W"
FT                   /product="AEL315Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR037C
FT                   (SPC34)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL315W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52369"
FT                   /db_xref="GOA:Q758R8"
FT                   /db_xref="InterPro:IPR013966"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758R8"
FT                   /protein_id="AAS52369.1"
FT                   EQLRRDSRT"
FT   gene            <52979..>55126
FT                   /locus_tag="AGOS_AEL314W"
FT                   /old_locus_tag="AEL314W"
FT   mRNA            <52979..>55126
FT                   /locus_tag="AGOS_AEL314W"
FT                   /old_locus_tag="AEL314W"
FT                   /product="AEL314Wp"
FT   CDS_pept        52979..55126
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL314W"
FT                   /old_locus_tag="AEL314W"
FT                   /product="AEL314Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL112W
FT                   (MDV1) and YKR036C (CAF4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL314W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52370"
FT                   /db_xref="GOA:Q758R7"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758R7"
FT                   /protein_id="AAS52370.1"
FT   gene            complement(55373..55483)
FT                   /locus_tag="AGOS_t0091"
FT   tRNA            complement(join(55373..55416,55446..55483))
FT                   /locus_tag="AGOS_t0091"
FT                   /product="tRNA-Leu"
FT                   /note="codon recognized: UUG"
FT   gene            complement(<56360..>56692)
FT                   /locus_tag="AGOS_AEL313C"
FT                   /old_locus_tag="AEL313C"
FT   mRNA            complement(<56360..>56692)
FT                   /locus_tag="AGOS_AEL313C"
FT                   /old_locus_tag="AEL313C"
FT                   /product="AEL313Cp"
FT   CDS_pept        complement(56360..56692)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL313C"
FT                   /old_locus_tag="AEL313C"
FT                   /product="AEL313Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR244C-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL313C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52371"
FT                   /db_xref="GOA:Q758R6"
FT                   /db_xref="InterPro:IPR003213"
FT                   /db_xref="InterPro:IPR036549"
FT                   /db_xref="UniProtKB/TrEMBL:Q758R6"
FT                   /protein_id="AAS52371.1"
FT                   YVPPSK"
FT   gene            complement(<57124..>58110)
FT                   /locus_tag="AGOS_AEL312C"
FT                   /old_locus_tag="AEL312C"
FT   mRNA            complement(<57124..>58110)
FT                   /locus_tag="AGOS_AEL312C"
FT                   /old_locus_tag="AEL312C"
FT                   /product="AEL312Cp"
FT   CDS_pept        complement(57124..58110)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL312C"
FT                   /old_locus_tag="AEL312C"
FT                   /product="AEL312Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR244W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL312C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52372"
FT                   /db_xref="InterPro:IPR005556"
FT                   /db_xref="UniProtKB/TrEMBL:Q758R5"
FT                   /protein_id="AAS52372.1"
FT   gene            59814..59895
FT                   /locus_tag="AGOS_t0092"
FT   tRNA            59814..59895
FT                   /locus_tag="AGOS_t0092"
FT                   /product="tRNA-Ser"
FT                   /note="codon recognized: UCU"
FT   gene            59901..59972
FT                   /locus_tag="AGOS_t0093"
FT   tRNA            59901..59972
FT                   /locus_tag="AGOS_t0093"
FT                   /product="tRNA-Asp"
FT                   /note="codon recognized: GAC"
FT   gene            <60023..>60913
FT                   /locus_tag="AGOS_AEL311W"
FT                   /old_locus_tag="AEL311W"
FT   mRNA            <60023..>60913
FT                   /locus_tag="AGOS_AEL311W"
FT                   /old_locus_tag="AEL311W"
FT                   /product="AEL311Wp"
FT   CDS_pept        60023..60913
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL311W"
FT                   /old_locus_tag="AEL311W"
FT                   /product="AEL311Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR114C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL311W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52373"
FT                   /db_xref="InterPro:IPR003738"
FT                   /db_xref="InterPro:IPR036590"
FT                   /db_xref="UniProtKB/TrEMBL:Q758R4"
FT                   /protein_id="AAS52373.1"
FT                   APCSDEPLPQRPRRP"
FT   gene            complement(<60741..>61961)
FT                   /locus_tag="AGOS_AEL310C"
FT                   /old_locus_tag="AEL310C"
FT   mRNA            complement(<60741..>61961)
FT                   /locus_tag="AGOS_AEL310C"
FT                   /old_locus_tag="AEL310C"
FT                   /product="AEL310Cp"
FT   CDS_pept        complement(60741..61961)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL310C"
FT                   /old_locus_tag="AEL310C"
FT                   /product="AEL310Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR113W
FT                   (FOL3) and YKL132C (RMA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL310C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52374"
FT                   /db_xref="GOA:Q758R3"
FT                   /db_xref="InterPro:IPR001645"
FT                   /db_xref="InterPro:IPR013221"
FT                   /db_xref="InterPro:IPR018109"
FT                   /db_xref="InterPro:IPR036565"
FT                   /db_xref="InterPro:IPR036615"
FT                   /db_xref="UniProtKB/TrEMBL:Q758R3"
FT                   /protein_id="AAS52374.1"
FT                   ELLRREH"
FT   gene            <62036..>62377
FT                   /locus_tag="AGOS_AEL309W"
FT                   /old_locus_tag="AEL309W"
FT   mRNA            <62036..>62377
FT                   /locus_tag="AGOS_AEL309W"
FT                   /old_locus_tag="AEL309W"
FT                   /product="AEL309Wp"
FT   CDS_pept        62036..62377
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL309W"
FT                   /old_locus_tag="AEL309W"
FT                   /product="AEL309Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR112C
FT                   (MED11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL309W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52375"
FT                   /db_xref="GOA:Q758R2"
FT                   /db_xref="InterPro:IPR019404"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758R2"
FT                   /protein_id="AAS52375.2"
FT                   QMDKYVGSM"
FT   gene            <62529..>63713
FT                   /locus_tag="AGOS_AEL308W"
FT                   /old_locus_tag="AEL308W"
FT   mRNA            <62529..>63713
FT                   /locus_tag="AGOS_AEL308W"
FT                   /old_locus_tag="AEL308W"
FT                   /product="AEL308Wp"
FT   CDS_pept        62529..63713
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL308W"
FT                   /old_locus_tag="AEL308W"
FT                   /product="AEL308Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR111C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL308W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52376"
FT                   /db_xref="GOA:Q758R1"
FT                   /db_xref="InterPro:IPR022210"
FT                   /db_xref="UniProtKB/TrEMBL:Q758R1"
FT                   /protein_id="AAS52376.1"
FT   gene            complement(<63871..>64710)
FT                   /locus_tag="AGOS_AEL307C"
FT                   /old_locus_tag="AEL307C"
FT   mRNA            complement(<63871..>64710)
FT                   /locus_tag="AGOS_AEL307C"
FT                   /old_locus_tag="AEL307C"
FT                   /product="AEL307Cp"
FT   CDS_pept        complement(63871..64710)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL307C"
FT                   /old_locus_tag="AEL307C"
FT                   /product="AEL307Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL130C
FT                   (SHE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL307C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52377"
FT                   /db_xref="GOA:Q758R0"
FT                   /db_xref="InterPro:IPR024261"
FT                   /db_xref="InterPro:IPR036827"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758R0"
FT                   /protein_id="AAS52377.1"
FT   gene            complement(<65142..>69020)
FT                   /locus_tag="AGOS_AEL306C"
FT                   /old_locus_tag="AEL306C"
FT   mRNA            complement(<65142..>69020)
FT                   /locus_tag="AGOS_AEL306C"
FT                   /old_locus_tag="AEL306C"
FT                   /product="AEL306Cp"
FT   CDS_pept        complement(65142..69020)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL306C"
FT                   /old_locus_tag="AEL306C"
FT                   /product="AEL306Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR109W
FT                   (MYO5) and YKL129C (MYO3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL306C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52378"
FT                   /db_xref="GOA:Q758Q9"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR001609"
FT                   /db_xref="InterPro:IPR010926"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR035535"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="InterPro:IPR036072"
FT                   /db_xref="InterPro:IPR036961"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758Q9"
FT                   /protein_id="AAS52378.2"
FT                   DDNADDDW"
FT   gene            complement(<69382..>71388)
FT                   /locus_tag="AGOS_AEL305C"
FT                   /old_locus_tag="AEL305C"
FT   mRNA            complement(<69382..>71388)
FT                   /locus_tag="AGOS_AEL305C"
FT                   /old_locus_tag="AEL305C"
FT                   /product="AEL305Cp"
FT   CDS_pept        complement(69382..71388)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL305C"
FT                   /old_locus_tag="AEL305C"
FT                   /product="AEL305Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR108W
FT                   (ILV2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL305C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52379"
FT                   /db_xref="GOA:Q758Q8"
FT                   /db_xref="InterPro:IPR000399"
FT                   /db_xref="InterPro:IPR011766"
FT                   /db_xref="InterPro:IPR012000"
FT                   /db_xref="InterPro:IPR012001"
FT                   /db_xref="InterPro:IPR012846"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="InterPro:IPR029061"
FT                   /db_xref="InterPro:IPR039368"
FT                   /db_xref="UniProtKB/TrEMBL:Q758Q8"
FT                   /protein_id="AAS52379.1"
FT   gene            complement(<71671..>72582)
FT                   /locus_tag="AGOS_AEL304C"
FT                   /old_locus_tag="AEL304C"
FT   mRNA            complement(<71671..>72582)
FT                   /locus_tag="AGOS_AEL304C"
FT                   /old_locus_tag="AEL304C"
FT                   /product="AEL304Cp"
FT   CDS_pept        complement(71671..72582)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL304C"
FT                   /old_locus_tag="AEL304C"
FT                   /product="AEL304Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL128C
FT                   (PMU1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL304C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52380"
FT                   /db_xref="InterPro:IPR013078"
FT                   /db_xref="InterPro:IPR029033"
FT                   /db_xref="UniProtKB/TrEMBL:Q758Q7"
FT                   /protein_id="AAS52380.1"
FT   gene            complement(<72783..>73112)
FT                   /locus_tag="AGOS_AEL303C"
FT                   /old_locus_tag="AEL303C"
FT   mRNA            complement(<72783..>73112)
FT                   /locus_tag="AGOS_AEL303C"
FT                   /old_locus_tag="AEL303C"
FT                   /product="AEL303Cp"
FT   CDS_pept        complement(72783..73112)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL303C"
FT                   /old_locus_tag="AEL303C"
FT                   /product="AEL303Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR107W
FT                   (SPG4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL303C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52381"
FT                   /db_xref="InterPro:IPR020485"
FT                   /db_xref="UniProtKB/TrEMBL:Q758Q6"
FT                   /protein_id="AAS52381.1"
FT                   NRVNF"
FT   gene            <73455..>74783
FT                   /locus_tag="AGOS_AEL302W"
FT                   /old_locus_tag="AEL302W"
FT   mRNA            <73455..>74783
FT                   /locus_tag="AGOS_AEL302W"
FT                   /old_locus_tag="AEL302W"
FT                   /product="AEL302Wp"
FT   CDS_pept        73455..74783
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL302W"
FT                   /old_locus_tag="AEL302W"
FT                   /product="AEL302Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR332W
FT                   (MID2) and YGR023W (MTL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL302W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52382"
FT                   /db_xref="GOA:Q758Q5"
FT                   /db_xref="InterPro:IPR007567"
FT                   /db_xref="UniProtKB/TrEMBL:Q758Q5"
FT                   /protein_id="AAS52382.1"
FT   gene            <75105..>77978
FT                   /locus_tag="AGOS_AEL301W"
FT                   /old_locus_tag="AEL301W"
FT   mRNA            <75105..>77978
FT                   /locus_tag="AGOS_AEL301W"
FT                   /old_locus_tag="AEL301W"
FT                   /product="AEL301Wp"
FT   CDS_pept        75105..77978
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL301W"
FT                   /old_locus_tag="AEL301W"
FT                   /product="AEL301Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL167C
FT                   (PMR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL301W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52383"
FT                   /db_xref="GOA:Q758Q4"
FT                   /db_xref="InterPro:IPR001757"
FT                   /db_xref="InterPro:IPR004014"
FT                   /db_xref="InterPro:IPR006068"
FT                   /db_xref="InterPro:IPR006413"
FT                   /db_xref="InterPro:IPR008250"
FT                   /db_xref="InterPro:IPR018303"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR023298"
FT                   /db_xref="InterPro:IPR023299"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q758Q4"
FT                   /protein_id="AAS52383.2"
FT   gene            complement(<78173..>79429)
FT                   /locus_tag="AGOS_AEL300C"
FT                   /old_locus_tag="AEL300C"
FT   mRNA            complement(<78173..>79429)
FT                   /locus_tag="AGOS_AEL300C"
FT                   /old_locus_tag="AEL300C"
FT                   /product="AEL300Cp"
FT   CDS_pept        complement(78173..79429)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL300C"
FT                   /old_locus_tag="AEL300C"
FT                   /product="AEL300Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL169W
FT                   (SUA5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL300C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52384"
FT                   /db_xref="GOA:Q758Q3"
FT                   /db_xref="InterPro:IPR005145"
FT                   /db_xref="InterPro:IPR006070"
FT                   /db_xref="InterPro:IPR010923"
FT                   /db_xref="InterPro:IPR017945"
FT                   /db_xref="InterPro:IPR038385"
FT                   /db_xref="UniProtKB/TrEMBL:Q758Q3"
FT                   /protein_id="AAS52384.1"
FT   gene            80103..80173
FT                   /locus_tag="AGOS_t0094"
FT   tRNA            80103..80173
FT                   /locus_tag="AGOS_t0094"
FT                   /product="tRNA-Gly"
FT                   /note="codon recognized: GGC"
FT   gene            <80283..>81032
FT                   /locus_tag="AGOS_AEL299W"
FT                   /old_locus_tag="AEL299W"
FT   mRNA            <80283..>81032
FT                   /locus_tag="AGOS_AEL299W"
FT                   /old_locus_tag="AEL299W"
FT                   /product="AEL299Wp"
FT   CDS_pept        80283..81032
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL299W"
FT                   /old_locus_tag="AEL299W"
FT                   /product="AEL299Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL161C
FT                   (YIP5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL299W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52385"
FT                   /db_xref="GOA:Q758Q2"
FT                   /db_xref="InterPro:IPR039765"
FT                   /db_xref="UniProtKB/TrEMBL:Q758Q2"
FT                   /protein_id="AAS52385.1"
FT   gene            complement(<81183..>82196)
FT                   /locus_tag="AGOS_AEL298C"
FT                   /old_locus_tag="AEL298C"
FT   mRNA            complement(<81183..>82196)
FT                   /locus_tag="AGOS_AEL298C"
FT                   /old_locus_tag="AEL298C"
FT                   /product="AEL298Cp"
FT   CDS_pept        complement(81183..82196)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL298C"
FT                   /old_locus_tag="AEL298C"
FT                   /product="AEL298Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR009W
FT                   (SUT2) and YGL162W (SUT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL298C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52386"
FT                   /db_xref="GOA:Q758Q1"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q758Q1"
FT                   /protein_id="AAS52386.2"
FT   gene            <83369..>86056
FT                   /locus_tag="AGOS_AEL297W"
FT                   /old_locus_tag="AEL297W"
FT   mRNA            <83369..>86056
FT                   /locus_tag="AGOS_AEL297W"
FT                   /old_locus_tag="AEL297W"
FT                   /product="AEL297Wp"
FT   CDS_pept        83369..86056
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL297W"
FT                   /old_locus_tag="AEL297W"
FT                   /product="AEL297Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL163C
FT                   (RAD54)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL297W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52387"
FT                   /db_xref="GOA:Q758Q0"
FT                   /db_xref="InterPro:IPR000330"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR013967"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR038718"
FT                   /db_xref="UniProtKB/TrEMBL:Q758Q0"
FT                   /protein_id="AAS52387.2"
FT   gene            <86308..>87627
FT                   /locus_tag="AGOS_AEL296W"
FT                   /old_locus_tag="AEL296W"
FT   mRNA            <86308..>87627
FT                   /locus_tag="AGOS_AEL296W"
FT                   /old_locus_tag="AEL296W"
FT                   /product="AEL296Wp"
FT   CDS_pept        86308..87627
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL296W"
FT                   /old_locus_tag="AEL296W"
FT                   /product="AEL296Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL164C
FT                   (YRB30)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL296W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52388"
FT                   /db_xref="GOA:Q758P9"
FT                   /db_xref="InterPro:IPR008812"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P9"
FT                   /protein_id="AAS52388.1"
FT   gene            complement(<88055..>89689)
FT                   /locus_tag="AGOS_AEL295C"
FT                   /old_locus_tag="AEL295C"
FT   mRNA            complement(<88055..>89689)
FT                   /locus_tag="AGOS_AEL295C"
FT                   /old_locus_tag="AEL295C"
FT                   /product="AEL295Cp"
FT   CDS_pept        complement(88055..89689)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL295C"
FT                   /old_locus_tag="AEL295C"
FT                   /product="AEL295Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR008W
FT                   (HAA1) and YGL166W (CUP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL295C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52389"
FT                   /db_xref="GOA:Q758P8"
FT                   /db_xref="InterPro:IPR001083"
FT                   /db_xref="InterPro:IPR036395"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P8"
FT                   /protein_id="AAS52389.1"
FT   gene            complement(<89998..>91098)
FT                   /locus_tag="AGOS_AEL294C"
FT                   /old_locus_tag="AEL294C"
FT   mRNA            complement(<89998..>91098)
FT                   /locus_tag="AGOS_AEL294C"
FT                   /old_locus_tag="AEL294C"
FT                   /product="AEL294Cp"
FT   CDS_pept        complement(89998..91098)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL294C"
FT                   /old_locus_tag="AEL294C"
FT                   /product="AEL294Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YER145C (FTR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL294C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52390"
FT                   /db_xref="GOA:Q758P7"
FT                   /db_xref="InterPro:IPR004923"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P7"
FT                   /protein_id="AAS52390.1"
FT   gene            complement(91402..91472)
FT                   /locus_tag="AGOS_t0095"
FT   tRNA            complement(91402..91472)
FT                   /locus_tag="AGOS_t0095"
FT                   /product="tRNA-Gly"
FT                   /note="codon recognized: GGC"
FT   gene            complement(<91553..>92110)
FT                   /locus_tag="AGOS_AEL293C"
FT                   /old_locus_tag="AEL293C"
FT   mRNA            complement(<91553..>92110)
FT                   /locus_tag="AGOS_AEL293C"
FT                   /old_locus_tag="AEL293C"
FT                   /product="AEL293Cp"
FT   CDS_pept        complement(91553..92110)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL293C"
FT                   /old_locus_tag="AEL293C"
FT                   /product="AEL293Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR008W
FT                   (FAR7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL293C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52391"
FT                   /db_xref="GOA:Q758P6"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P6"
FT                   /protein_id="AAS52391.2"
FT   gene            <92361..>94250
FT                   /locus_tag="AGOS_AEL292W"
FT                   /old_locus_tag="AEL292W"
FT   mRNA            <92361..>94250
FT                   /locus_tag="AGOS_AEL292W"
FT                   /old_locus_tag="AEL292W"
FT                   /product="AEL292Wp"
FT   CDS_pept        92361..94250
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL292W"
FT                   /old_locus_tag="AEL292W"
FT                   /product="AEL292Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR007C
FT                   (REC8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL292W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52392"
FT                   /db_xref="GOA:Q758P5"
FT                   /db_xref="InterPro:IPR006910"
FT                   /db_xref="InterPro:IPR039781"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P5"
FT                   /protein_id="AAS52392.2"
FT   gene            complement(<94484..>96139)
FT                   /locus_tag="AGOS_AEL291C"
FT                   /old_locus_tag="AEL291C"
FT   mRNA            complement(<94484..>96139)
FT                   /locus_tag="AGOS_AEL291C"
FT                   /old_locus_tag="AEL291C"
FT                   /product="AEL291Cp"
FT   CDS_pept        complement(94484..96139)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL291C"
FT                   /old_locus_tag="AEL291C"
FT                   /product="AEL291Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR008W
FT                   (RSC4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL291C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52393"
FT                   /db_xref="GOA:Q758P4"
FT                   /db_xref="InterPro:IPR001487"
FT                   /db_xref="InterPro:IPR027180"
FT                   /db_xref="InterPro:IPR036427"
FT                   /db_xref="InterPro:IPR037382"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P4"
FT                   /protein_id="AAS52393.1"
FT   gene            complement(<96325..>96744)
FT                   /locus_tag="AGOS_AEL290C"
FT                   /old_locus_tag="AEL290C"
FT   mRNA            complement(<96325..>96744)
FT                   /locus_tag="AGOS_AEL290C"
FT                   /old_locus_tag="AEL290C"
FT                   /product="AEL290Cp"
FT   CDS_pept        complement(96325..96744)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL290C"
FT                   /old_locus_tag="AEL290C"
FT                   /product="AEL290Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR007W
FT                   (MEH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL290C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52394"
FT                   /db_xref="GOA:Q758P3"
FT                   /db_xref="InterPro:IPR028209"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P3"
FT                   /protein_id="AAS52394.2"
FT   gene            <97074..>97817
FT                   /locus_tag="AGOS_AEL289W"
FT                   /old_locus_tag="AEL289W"
FT   mRNA            <97074..>97817
FT                   /locus_tag="AGOS_AEL289W"
FT                   /old_locus_tag="AEL289W"
FT                   /product="AEL289Wp"
FT   CDS_pept        97074..97817
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL289W"
FT                   /old_locus_tag="AEL289W"
FT                   /product="AEL289Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR006C
FT                   (MRPL13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL289W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52395"
FT                   /db_xref="GOA:Q758P2"
FT                   /db_xref="InterPro:IPR018305"
FT                   /db_xref="InterPro:IPR036736"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P2"
FT                   /protein_id="AAS52395.1"
FT   gene            <98045..>98974
FT                   /locus_tag="AGOS_AEL289WA"
FT   mRNA            <98045..>98974
FT                   /locus_tag="AGOS_AEL289WA"
FT                   /product="AEL289W-Ap"
FT   CDS_pept        98045..98974
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL289WA"
FT                   /product="AEL289W-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKR005C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL289WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41767"
FT                   /db_xref="GOA:D8FGC4"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGC4"
FT                   /protein_id="ADJ41767.1"
FT   gene            <99089..>100180
FT                   /locus_tag="AGOS_AEL288W"
FT                   /old_locus_tag="AEL288W"
FT   mRNA            <99089..>100180
FT                   /locus_tag="AGOS_AEL288W"
FT                   /old_locus_tag="AEL288W"
FT                   /product="AEL288Wp"
FT   CDS_pept        99089..100180
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL288W"
FT                   /old_locus_tag="AEL288W"
FT                   /product="AEL288Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR004C
FT                   (ECM9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL288W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52396"
FT                   /db_xref="GOA:Q758V5"
FT                   /db_xref="UniProtKB/TrEMBL:Q758V5"
FT                   /protein_id="AAS52396.1"
FT   gene            complement(<100320..>101669)
FT                   /locus_tag="AGOS_AEL287C"
FT                   /old_locus_tag="AEL287C"
FT   mRNA            complement(<100320..>101669)
FT                   /locus_tag="AGOS_AEL287C"
FT                   /old_locus_tag="AEL287C"
FT                   /product="AEL287Cp"
FT   CDS_pept        complement(100320..101669)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL287C"
FT                   /old_locus_tag="AEL287C"
FT                   /product="AEL287Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR001W
FT                   (OSH7) and YKR003W (OSH6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL287C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52397"
FT                   /db_xref="GOA:Q758V4"
FT                   /db_xref="InterPro:IPR000648"
FT                   /db_xref="InterPro:IPR037239"
FT                   /db_xref="UniProtKB/TrEMBL:Q758V4"
FT                   /protein_id="AAS52397.2"
FT   gene            102290..102383
FT                   /locus_tag="AGOS_t0098"
FT   tRNA            join(102290..102326,102349..102383)
FT                   /locus_tag="AGOS_t0098"
FT                   /product="tRNA-Gln"
FT                   /note="codon recognized: CAG"
FT   gene            complement(<102552..>104429)
FT                   /locus_tag="AGOS_AEL286C"
FT                   /old_locus_tag="AEL286C"
FT   mRNA            complement(<102552..>104429)
FT                   /locus_tag="AGOS_AEL286C"
FT                   /old_locus_tag="AEL286C"
FT                   /product="AEL286Cp"
FT   CDS_pept        complement(102552..104429)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL286C"
FT                   /old_locus_tag="AEL286C"
FT                   /product="AEL286Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR054W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL286C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52398"
FT                   /db_xref="GOA:Q758P1"
FT                   /db_xref="InterPro:IPR011387"
FT                   /db_xref="InterPro:IPR013979"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P1"
FT                   /protein_id="AAS52398.2"
FT   gene            <104700..>105572
FT                   /locus_tag="AGOS_AEL285W"
FT                   /old_locus_tag="AEL285W"
FT   mRNA            <104700..>105572
FT                   /locus_tag="AGOS_AEL285W"
FT                   /old_locus_tag="AEL285W"
FT                   /product="AEL285Wp"
FT   CDS_pept        104700..105572
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL285W"
FT                   /old_locus_tag="AEL285W"
FT                   /product="AEL285Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR053C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL285W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52399"
FT                   /db_xref="UniProtKB/TrEMBL:Q758P0"
FT                   /protein_id="AAS52399.1"
FT                   GAKKGAFAV"
FT   gene            complement(<105716..>107155)
FT                   /locus_tag="AGOS_AEL284C"
FT                   /old_locus_tag="AEL284C"
FT   mRNA            complement(<105716..>107155)
FT                   /locus_tag="AGOS_AEL284C"
FT                   /old_locus_tag="AEL284C"
FT                   /product="AEL284Cp"
FT   CDS_pept        complement(105716..107155)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL284C"
FT                   /old_locus_tag="AEL284C"
FT                   /product="AEL284Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR052W
FT                   (FMP48)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL284C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52400"
FT                   /db_xref="GOA:Q758N9"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q758N9"
FT                   /protein_id="AAS52400.2"
FT   gene            complement(<107858..>108463)
FT                   /locus_tag="AGOS_AEL283C"
FT                   /old_locus_tag="AEL283C"
FT   mRNA            complement(<107858..>108463)
FT                   /locus_tag="AGOS_AEL283C"
FT                   /old_locus_tag="AEL283C"
FT                   /product="AEL283Cp"
FT   CDS_pept        complement(107858..108463)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL283C"
FT                   /old_locus_tag="AEL283C"
FT                   /product="AEL283Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR356W
FT                   (ATG33) and YGR049W (SCM4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL283C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52401"
FT                   /db_xref="GOA:Q758N8"
FT                   /db_xref="UniProtKB/TrEMBL:Q758N8"
FT                   /protein_id="AAS52401.1"
FT   gene            <108796..>110706
FT                   /locus_tag="AGOS_AEL282W"
FT                   /old_locus_tag="AEL282W"
FT   mRNA            <108796..>110706
FT                   /locus_tag="AGOS_AEL282W"
FT                   /old_locus_tag="AEL282W"
FT                   /product="AEL282Wp"
FT   CDS_pept        108796..110706
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL282W"
FT                   /old_locus_tag="AEL282W"
FT                   /product="AEL282Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR190C
FT                   (RPC82)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL282W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52402"
FT                   /db_xref="GOA:Q758N7"
FT                   /db_xref="InterPro:IPR008806"
FT                   /db_xref="InterPro:IPR013197"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="InterPro:IPR039748"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758N7"
FT                   /protein_id="AAS52402.1"
FT                   L"
FT   gene            complement(<110771..>114943)
FT                   /locus_tag="AGOS_AEL281C"
FT                   /old_locus_tag="AEL281C"
FT   mRNA            complement(<110771..>114943)
FT                   /locus_tag="AGOS_AEL281C"
FT                   /old_locus_tag="AEL281C"
FT                   /product="AEL281Cp"
FT   CDS_pept        complement(110771..114943)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL281C"
FT                   /old_locus_tag="AEL281C"
FT                   /product="AEL281Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR189W
FT                   (SKI3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL281C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52403"
FT                   /db_xref="GOA:Q758N6"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="InterPro:IPR013105"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="InterPro:IPR039226"
FT                   /db_xref="InterPro:IPR040962"
FT                   /db_xref="UniProtKB/TrEMBL:Q758N6"
FT                   /protein_id="AAS52403.2"
FT   gene            <115074..>115550
FT                   /locus_tag="AGOS_AEL280W"
FT                   /old_locus_tag="AEL280W"
FT   mRNA            <115074..>115550
FT                   /locus_tag="AGOS_AEL280W"
FT                   /old_locus_tag="AEL280W"
FT                   /product="AEL280Wp"
FT   CDS_pept        115074..115550
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL280W"
FT                   /old_locus_tag="AEL280W"
FT                   /product="AEL280Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR188C
FT                   (MLC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL280W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52404"
FT                   /db_xref="GOA:Q758N5"
FT                   /db_xref="InterPro:IPR002048"
FT                   /db_xref="InterPro:IPR011992"
FT                   /db_xref="InterPro:IPR018247"
FT                   /db_xref="UniProtKB/TrEMBL:Q758N5"
FT                   /protein_id="AAS52404.1"
FT   gene            complement(<115594..>116115)
FT                   /locus_tag="AGOS_AEL279C"
FT                   /old_locus_tag="AEL279C"
FT   mRNA            complement(join(<115594..116038,116096..>116115))
FT                   /locus_tag="AGOS_AEL279C"
FT                   /old_locus_tag="AEL279C"
FT                   /product="AEL279Cp"
FT   CDS_pept        complement(join(115594..116038,116096..116115))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL279C"
FT                   /old_locus_tag="AEL279C"
FT                   /product="AEL279Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR187W
FT                   (RPO26); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL279C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52405"
FT                   /db_xref="GOA:Q758N4"
FT                   /db_xref="InterPro:IPR006110"
FT                   /db_xref="InterPro:IPR006111"
FT                   /db_xref="InterPro:IPR012293"
FT                   /db_xref="InterPro:IPR020708"
FT                   /db_xref="InterPro:IPR028363"
FT                   /db_xref="InterPro:IPR036161"
FT                   /db_xref="UniProtKB/TrEMBL:Q758N4"
FT                   /protein_id="AAS52405.1"
FT   gene            <116279..>117709
FT                   /locus_tag="AGOS_AEL278W"
FT                   /old_locus_tag="AEL278W"
FT   mRNA            <116279..>117709
FT                   /locus_tag="AGOS_AEL278W"
FT                   /old_locus_tag="AEL278W"
FT                   /product="AEL278Wp"
FT   CDS_pept        116279..117709
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL278W"
FT                   /old_locus_tag="AEL278W"
FT                   /product="AEL278Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR186C
FT                   (PZF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL278W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52406"
FT                   /db_xref="GOA:Q758N3"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q758N3"
FT                   /protein_id="AAS52406.2"
FT                   LEDKLKTEAAAGKDPACG"
FT   gene            complement(<117929..>119908)
FT                   /locus_tag="AGOS_AEL277C"
FT                   /old_locus_tag="AEL277C"
FT   mRNA            complement(<117929..>119908)
FT                   /locus_tag="AGOS_AEL277C"
FT                   /old_locus_tag="AEL277C"
FT                   /product="AEL277Cp"
FT   CDS_pept        complement(117929..119908)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL277C"
FT                   /old_locus_tag="AEL277C"
FT                   /product="AEL277Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR185W
FT                   (ATG13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL277C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52407"
FT                   /db_xref="GOA:Q758N2"
FT                   /db_xref="InterPro:IPR018731"
FT                   /db_xref="InterPro:IPR036570"
FT                   /db_xref="InterPro:IPR040182"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758N2"
FT                   /protein_id="AAS52407.1"
FT   gene            complement(<120334..>124890)
FT                   /locus_tag="AGOS_AEL276C"
FT                   /old_locus_tag="AEL276C"
FT   mRNA            complement(<120334..>124890)
FT                   /locus_tag="AGOS_AEL276C"
FT                   /old_locus_tag="AEL276C"
FT                   /product="AEL276Cp"
FT   CDS_pept        complement(120334..124890)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL276C"
FT                   /old_locus_tag="AEL276C"
FT                   /product="AEL276Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR184W
FT                   (GDB1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL276C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52408"
FT                   /db_xref="GOA:Q758N1"
FT                   /db_xref="InterPro:IPR006421"
FT                   /db_xref="InterPro:IPR008928"
FT                   /db_xref="InterPro:IPR010401"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="InterPro:IPR029436"
FT                   /db_xref="InterPro:IPR032788"
FT                   /db_xref="InterPro:IPR032790"
FT                   /db_xref="InterPro:IPR032792"
FT                   /db_xref="UniProtKB/TrEMBL:Q758N1"
FT                   /protein_id="AAS52408.1"
FT   gene            complement(<125220..>126017)
FT                   /locus_tag="AGOS_AEL275C"
FT                   /old_locus_tag="AEL275C"
FT   mRNA            complement(<125220..>126017)
FT                   /locus_tag="AGOS_AEL275C"
FT                   /old_locus_tag="AEL275C"
FT                   /product="AEL275Cp"
FT   CDS_pept        complement(125220..126017)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL275C"
FT                   /old_locus_tag="AEL275C"
FT                   /product="AEL275Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR183W
FT                   (DPM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL275C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52409"
FT                   /db_xref="GOA:Q758N0"
FT                   /db_xref="InterPro:IPR001173"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="InterPro:IPR039528"
FT                   /db_xref="UniProtKB/TrEMBL:Q758N0"
FT                   /protein_id="AAS52409.1"
FT   gene            complement(<126262..>126570)
FT                   /locus_tag="AGOS_AEL274C"
FT                   /old_locus_tag="AEL274C"
FT   mRNA            complement(join(<126262..126513,126562..>126570))
FT                   /locus_tag="AGOS_AEL274C"
FT                   /old_locus_tag="AEL274C"
FT                   /product="AEL274Cp"
FT   CDS_pept        complement(join(126262..126513,126562..126570))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL274C"
FT                   /old_locus_tag="AEL274C"
FT                   /product="AEL274Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR182W
FT                   (SMX3); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL274C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52410"
FT                   /db_xref="GOA:Q758M9"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR016487"
FT                   /db_xref="InterPro:IPR034100"
FT                   /db_xref="UniProtKB/TrEMBL:Q758M9"
FT                   /protein_id="AAS52410.1"
FT   gene            complement(<126705..>127877)
FT                   /locus_tag="AGOS_AEL273C"
FT                   /old_locus_tag="AEL273C"
FT   mRNA            complement(<126705..>127877)
FT                   /locus_tag="AGOS_AEL273C"
FT                   /old_locus_tag="AEL273C"
FT                   /product="AEL273Cp"
FT   CDS_pept        complement(126705..127877)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL273C"
FT                   /old_locus_tag="AEL273C"
FT                   /product="AEL273Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR459W
FT                   (GAB1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL273C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52411"
FT                   /db_xref="GOA:Q758M8"
FT                   /db_xref="InterPro:IPR009600"
FT                   /db_xref="UniProtKB/TrEMBL:Q758M8"
FT                   /protein_id="AAS52411.1"
FT   gene            <128350..>130620
FT                   /locus_tag="AGOS_AEL272W"
FT                   /old_locus_tag="AEL272W"
FT   mRNA            <128350..>130620
FT                   /locus_tag="AGOS_AEL272W"
FT                   /old_locus_tag="AEL272W"
FT                   /product="AEL272Wp"
FT   CDS_pept        128350..130620
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL272W"
FT                   /old_locus_tag="AEL272W"
FT                   /product="AEL272Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR181C
FT                   (SEC23)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL272W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52412"
FT                   /db_xref="GOA:Q758M7"
FT                   /db_xref="InterPro:IPR006895"
FT                   /db_xref="InterPro:IPR006896"
FT                   /db_xref="InterPro:IPR006900"
FT                   /db_xref="InterPro:IPR007123"
FT                   /db_xref="InterPro:IPR012990"
FT                   /db_xref="InterPro:IPR029006"
FT                   /db_xref="InterPro:IPR036174"
FT                   /db_xref="InterPro:IPR036175"
FT                   /db_xref="InterPro:IPR036180"
FT                   /db_xref="InterPro:IPR036465"
FT                   /db_xref="InterPro:IPR037364"
FT                   /db_xref="InterPro:IPR037550"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758M7"
FT                   /protein_id="AAS52412.1"
FT                   GQN"
FT   gene            complement(<130780..>131871)
FT                   /locus_tag="AGOS_AEL271C"
FT                   /old_locus_tag="AEL271C"
FT   mRNA            complement(<130780..>131871)
FT                   /locus_tag="AGOS_AEL271C"
FT                   /old_locus_tag="AEL271C"
FT                   /product="AEL271Cp"
FT   CDS_pept        complement(130780..131871)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL271C"
FT                   /old_locus_tag="AEL271C"
FT                   /product="AEL271Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR180W
FT                   (AOS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL271C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52413"
FT                   /db_xref="GOA:Q758M6"
FT                   /db_xref="InterPro:IPR000594"
FT                   /db_xref="InterPro:IPR035985"
FT                   /db_xref="UniProtKB/TrEMBL:Q758M6"
FT                   /protein_id="AAS52413.2"
FT   gene            <132026..>133939
FT                   /locus_tag="AGOS_AEL270W"
FT                   /old_locus_tag="AEL270W"
FT   mRNA            <132026..>133939
FT                   /locus_tag="AGOS_AEL270W"
FT                   /old_locus_tag="AEL270W"
FT                   /product="AEL270Wp"
FT   CDS_pept        132026..133939
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL270W"
FT                   /old_locus_tag="AEL270W"
FT                   /product="AEL270Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR179C
FT                   (HDA3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL270W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52414"
FT                   /db_xref="GOA:Q758V8"
FT                   /db_xref="InterPro:IPR021006"
FT                   /db_xref="InterPro:IPR026216"
FT                   /db_xref="InterPro:IPR038609"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758V8"
FT                   /protein_id="AAS52414.2"
FT                   YV"
FT   gene            complement(<133996..>135363)
FT                   /locus_tag="AGOS_AEL269C"
FT                   /old_locus_tag="AEL269C"
FT   mRNA            complement(<133996..>135363)
FT                   /locus_tag="AGOS_AEL269C"
FT                   /old_locus_tag="AEL269C"
FT                   /product="AEL269Cp"
FT   CDS_pept        complement(133996..135363)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL269C"
FT                   /old_locus_tag="AEL269C"
FT                   /product="AEL269Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR178W
FT                   (PRP4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL269C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52415"
FT                   /db_xref="GOA:Q758V7"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036285"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q758V7"
FT                   /protein_id="AAS52415.1"
FT   gene            <135460..>136428
FT                   /locus_tag="AGOS_AEL268W"
FT                   /old_locus_tag="AEL268W"
FT   mRNA            <135460..>136428
FT                   /locus_tag="AGOS_AEL268W"
FT                   /old_locus_tag="AEL268W"
FT                   /product="AEL268Wp"
FT   CDS_pept        135460..136428
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL268W"
FT                   /old_locus_tag="AEL268W"
FT                   /product="AEL268Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR176C
FT                   (BET2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL268W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52416"
FT                   /db_xref="GOA:Q758V2"
FT                   /db_xref="InterPro:IPR001330"
FT                   /db_xref="InterPro:IPR008930"
FT                   /db_xref="InterPro:IPR026873"
FT                   /db_xref="UniProtKB/TrEMBL:Q758V2"
FT                   /protein_id="AAS52416.1"
FT   gene            complement(<136477..>138510)
FT                   /locus_tag="AGOS_AEL267C"
FT                   /old_locus_tag="AEL267C"
FT   mRNA            complement(<136477..>138510)
FT                   /locus_tag="AGOS_AEL267C"
FT                   /old_locus_tag="AEL267C"
FT                   /product="AEL267Cp"
FT   CDS_pept        complement(136477..138510)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL267C"
FT                   /old_locus_tag="AEL267C"
FT                   /product="AEL267Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR175W
FT                   (DPB2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL267C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52417"
FT                   /db_xref="GOA:Q758V1"
FT                   /db_xref="InterPro:IPR007185"
FT                   /db_xref="InterPro:IPR016266"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758V1"
FT                   /protein_id="AAS52417.1"
FT   gene            <138834..>139820
FT                   /locus_tag="AGOS_AEL266W"
FT                   /old_locus_tag="AEL266W"
FT   mRNA            <138834..>139820
FT                   /locus_tag="AGOS_AEL266W"
FT                   /old_locus_tag="AEL266W"
FT                   /product="AEL266Wp"
FT   CDS_pept        138834..139820
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL266W"
FT                   /old_locus_tag="AEL266W"
FT                   /product="AEL266Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR457C
FT                   (NBP1) and YPR174C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL266W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52418"
FT                   /db_xref="InterPro:IPR013743"
FT                   /db_xref="UniProtKB/TrEMBL:Q758V0"
FT                   /protein_id="AAS52418.1"
FT   gene            <140033..>141328
FT                   /locus_tag="AGOS_AEL265W"
FT                   /old_locus_tag="AEL265W"
FT   mRNA            <140033..>141328
FT                   /locus_tag="AGOS_AEL265W"
FT                   /old_locus_tag="AEL265W"
FT                   /product="AEL265Wp"
FT   CDS_pept        140033..141328
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL265W"
FT                   /old_locus_tag="AEL265W"
FT                   /product="AEL265Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR173C
FT                   (VPS4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL265W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52419"
FT                   /db_xref="GOA:Q758U9"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR007330"
FT                   /db_xref="InterPro:IPR015415"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036181"
FT                   /db_xref="UniProtKB/TrEMBL:Q758U9"
FT                   /protein_id="AAS52419.1"
FT   gene            complement(<141450..>142025)
FT                   /locus_tag="AGOS_AEL264C"
FT                   /old_locus_tag="AEL264C"
FT   mRNA            complement(<141450..>142025)
FT                   /locus_tag="AGOS_AEL264C"
FT                   /old_locus_tag="AEL264C"
FT                   /product="AEL264Cp"
FT   CDS_pept        complement(141450..142025)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL264C"
FT                   /old_locus_tag="AEL264C"
FT                   /product="AEL264Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR172W
FT                   and YLR456W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL264C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52420"
FT                   /db_xref="InterPro:IPR011576"
FT                   /db_xref="UniProtKB/TrEMBL:Q758U8"
FT                   /protein_id="AAS52420.2"
FT   gene            complement(<142263..>143264)
FT                   /locus_tag="AGOS_AEL263C"
FT                   /old_locus_tag="AEL263C"
FT   mRNA            complement(<142263..>143264)
FT                   /locus_tag="AGOS_AEL263C"
FT                   /old_locus_tag="AEL263C"
FT                   /product="AEL263Cp"
FT   CDS_pept        complement(142263..143264)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL263C"
FT                   /old_locus_tag="AEL263C"
FT                   /product="AEL263Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR455W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL263C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52421"
FT                   /db_xref="InterPro:IPR000313"
FT                   /db_xref="InterPro:IPR035503"
FT                   /db_xref="UniProtKB/TrEMBL:Q758M5"
FT                   /protein_id="AAS52421.1"
FT   gene            complement(<144491..>146908)
FT                   /locus_tag="AGOS_AEL262C"
FT                   /old_locus_tag="AEL262C"
FT   mRNA            complement(<144491..>146908)
FT                   /locus_tag="AGOS_AEL262C"
FT                   /old_locus_tag="AEL262C"
FT                   /product="AEL262Cp"
FT   CDS_pept        complement(144491..146908)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL262C"
FT                   /old_locus_tag="AEL262C"
FT                   /product="AEL262Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR171W
FT                   (BSP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL262C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52422"
FT                   /db_xref="UniProtKB/TrEMBL:Q758M4"
FT                   /protein_id="AAS52422.2"
FT   gene            complement(<147147..>147518)
FT                   /locus_tag="AGOS_AEL262CA"
FT                   /old_locus_tag="AEL262C-A"
FT   mRNA            complement(join(<147147..147255,147312..147442,
FT                   147501..>147518))
FT                   /locus_tag="AGOS_AEL262CA"
FT                   /old_locus_tag="AEL262C-A"
FT                   /product="AEL262C-Ap"
FT   CDS_pept        complement(join(147147..147255,147312..147442,
FT                   147501..147518))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL262CA"
FT                   /old_locus_tag="AEL262C-A"
FT                   /product="AEL262C-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPR170W-B; 2-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL262CA"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52423"
FT                   /db_xref="GOA:Q758M3"
FT                   /db_xref="InterPro:IPR026770"
FT                   /db_xref="UniProtKB/TrEMBL:Q758M3"
FT                   /protein_id="AAS52423.1"
FT   gene            147668..147741
FT                   /locus_tag="AGOS_t0099"
FT   tRNA            147668..147741
FT                   /locus_tag="AGOS_t0099"
FT                   /product="tRNA-Ile"
FT                   /note="codon recognized: AUU"
FT   gene            complement(<147826..>149352)
FT                   /locus_tag="AGOS_AEL261C"
FT                   /old_locus_tag="AEL261C"
FT   mRNA            complement(<147826..>149352)
FT                   /locus_tag="AGOS_AEL261C"
FT                   /old_locus_tag="AEL261C"
FT                   /product="AEL261Cp"
FT   CDS_pept        complement(147826..149352)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL261C"
FT                   /old_locus_tag="AEL261C"
FT                   /product="AEL261Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR169W
FT                   (JIP5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL261C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52424"
FT                   /db_xref="GOA:Q758M2"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017422"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758M2"
FT                   /protein_id="AAS52424.2"
FT   gene            complement(<149467..>149922)
FT                   /locus_tag="AGOS_AEL260C"
FT                   /old_locus_tag="AEL260C"
FT   mRNA            complement(<149467..>149922)
FT                   /locus_tag="AGOS_AEL260C"
FT                   /old_locus_tag="AEL260C"
FT                   /product="AEL260Cp"
FT   CDS_pept        complement(149467..149922)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL260C"
FT                   /old_locus_tag="AEL260C"
FT                   /product="AEL260Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR168W
FT                   (NUT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL260C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52425"
FT                   /db_xref="GOA:Q758M1"
FT                   /db_xref="InterPro:IPR019145"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758M1"
FT                   /protein_id="AAS52425.2"
FT   gene            <150321..>151118
FT                   /locus_tag="AGOS_AEL259W"
FT                   /old_locus_tag="AEL259W"
FT   mRNA            <150321..>151118
FT                   /locus_tag="AGOS_AEL259W"
FT                   /old_locus_tag="AEL259W"
FT                   /product="AEL259Wp"
FT   CDS_pept        150321..151118
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL259W"
FT                   /old_locus_tag="AEL259W"
FT                   /product="AEL259Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR167C
FT                   (MET16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL259W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52426"
FT                   /db_xref="GOA:Q758M0"
FT                   /db_xref="InterPro:IPR002500"
FT                   /db_xref="InterPro:IPR004511"
FT                   /db_xref="InterPro:IPR011800"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="UniProtKB/TrEMBL:Q758M0"
FT                   /protein_id="AAS52426.1"
FT   gene            complement(151141..151212)
FT                   /locus_tag="AGOS_t0100"
FT   tRNA            complement(151141..151212)
FT                   /locus_tag="AGOS_t0100"
FT                   /product="tRNA-Glu"
FT                   /note="codon recognized: GAG"
FT   gene            <151679..>153314
FT                   /locus_tag="AGOS_AEL258W"
FT                   /old_locus_tag="AEL258W"
FT   mRNA            join(<151679..153139,153195..>153314)
FT                   /locus_tag="AGOS_AEL258W"
FT                   /old_locus_tag="AEL258W"
FT                   /product="AEL258Wp"
FT   CDS_pept        join(151679..153139,153195..153314)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL258W"
FT                   /old_locus_tag="AEL258W"
FT                   /product="AEL258Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR186W
FT                   (PCH2); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL258W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52427"
FT                   /db_xref="GOA:Q758L9"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q758L9"
FT                   /protein_id="AAS52427.2"
FT                   FIVALASVI"
FT   gene            <153596..>154429
FT                   /locus_tag="AGOS_AEL257W"
FT                   /old_locus_tag="AEL257W"
FT   mRNA            <153596..>154429
FT                   /locus_tag="AGOS_AEL257W"
FT                   /old_locus_tag="AEL257W"
FT                   /product="AEL257Wp"
FT   CDS_pept        153596..154429
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL257W"
FT                   /old_locus_tag="AEL257W"
FT                   /product="AEL257Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR187W
FT                   (GDT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL257W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52428"
FT                   /db_xref="GOA:Q758L8"
FT                   /db_xref="InterPro:IPR001727"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q758L8"
FT                   /protein_id="AAS52428.1"
FT   gene            complement(<154535..>155050)
FT                   /locus_tag="AGOS_AEL256CA"
FT                   /old_locus_tag="AEL256C-A"
FT   mRNA            complement(<154535..>155050)
FT                   /locus_tag="AGOS_AEL256CA"
FT                   /old_locus_tag="AEL256C-A"
FT                   /product="AEL256C-Ap"
FT   CDS_pept        complement(154535..155050)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL256CA"
FT                   /old_locus_tag="AEL256C-A"
FT                   /product="AEL256C-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR188C
FT                   (NTC20)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL256CA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41768"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGC5"
FT                   /protein_id="ADJ41768.1"
FT                   SSGYDRSS"
FT   gene            complement(<155337..>160937)
FT                   /locus_tag="AGOS_AEL256C"
FT                   /old_locus_tag="AEL256C"
FT   mRNA            complement(<155337..>160937)
FT                   /locus_tag="AGOS_AEL256C"
FT                   /old_locus_tag="AEL256C"
FT                   /product="AEL256Cp"
FT   CDS_pept        complement(155337..160937)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL256C"
FT                   /old_locus_tag="AEL256C"
FT                   /product="AEL256Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL082C
FT                   (MOT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL256C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52429"
FT                   /db_xref="GOA:Q758L7"
FT                   /db_xref="InterPro:IPR000330"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR022707"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR038718"
FT                   /db_xref="UniProtKB/TrEMBL:Q758L7"
FT                   /protein_id="AAS52429.2"
FT   gene            <161376..>162143
FT                   /locus_tag="AGOS_AEL255W"
FT                   /old_locus_tag="AEL255W"
FT   mRNA            join(<161376..161382,161584..>162143)
FT                   /locus_tag="AGOS_AEL255W"
FT                   /old_locus_tag="AEL255W"
FT                   /product="AEL255Wp"
FT   CDS_pept        join(161376..161382,161584..162143)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL255W"
FT                   /old_locus_tag="AEL255W"
FT                   /product="AEL255Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR189W
FT                   (RPS9B) and YPL081W (RPS9A); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL255W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52430"
FT                   /db_xref="GOA:Q758L6"
FT                   /db_xref="InterPro:IPR001912"
FT                   /db_xref="InterPro:IPR002942"
FT                   /db_xref="InterPro:IPR005710"
FT                   /db_xref="InterPro:IPR018079"
FT                   /db_xref="InterPro:IPR022801"
FT                   /db_xref="InterPro:IPR036986"
FT                   /db_xref="UniProtKB/TrEMBL:Q758L6"
FT                   /protein_id="AAS52430.1"
FT   gene            <162786..>163440
FT                   /locus_tag="AGOS_AEL254W"
FT                   /old_locus_tag="AEL254W"
FT   mRNA            join(<162786..162796,162969..>163440)
FT                   /locus_tag="AGOS_AEL254W"
FT                   /old_locus_tag="AEL254W"
FT                   /product="AEL254Wp"
FT   CDS_pept        join(162786..162796,162969..163440)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL254W"
FT                   /old_locus_tag="AEL254W"
FT                   /product="AEL254Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR191W
FT                   (RPL21A) and YPL079W (RPL21B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL254W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52431"
FT                   /db_xref="GOA:Q758L5"
FT                   /db_xref="InterPro:IPR001147"
FT                   /db_xref="InterPro:IPR008991"
FT                   /db_xref="InterPro:IPR018259"
FT                   /db_xref="InterPro:IPR036948"
FT                   /db_xref="UniProtKB/TrEMBL:Q758L5"
FT                   /protein_id="AAS52431.1"
FT   gene            <163893..>164990
FT                   /locus_tag="AGOS_AEL253W"
FT                   /old_locus_tag="AEL253W"
FT   mRNA            <163893..>164990
FT                   /locus_tag="AGOS_AEL253W"
FT                   /old_locus_tag="AEL253W"
FT                   /product="AEL253Wp"
FT   CDS_pept        163893..164990
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL253W"
FT                   /old_locus_tag="AEL253W"
FT                   /product="AEL253Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR192W
FT                   (RIM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL253W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52432"
FT                   /db_xref="GOA:Q758L4"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q758L4"
FT                   /protein_id="AAS52432.1"
FT   gene            complement(<165107..>165778)
FT                   /locus_tag="AGOS_AEL252C"
FT                   /old_locus_tag="AEL252C"
FT   mRNA            complement(<165107..>165778)
FT                   /locus_tag="AGOS_AEL252C"
FT                   /old_locus_tag="AEL252C"
FT                   /product="AEL252Cp"
FT   CDS_pept        complement(165107..165778)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL252C"
FT                   /old_locus_tag="AEL252C"
FT                   /product="AEL252Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR193C
FT                   (MED8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL252C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52433"
FT                   /db_xref="GOA:Q758L3"
FT                   /db_xref="InterPro:IPR019364"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758L3"
FT                   /protein_id="AAS52433.1"
FT                   K"
FT   gene            complement(<166113..>166971)
FT                   /locus_tag="AGOS_AEL251C"
FT                   /old_locus_tag="AEL251C"
FT   mRNA            complement(join(<166113..166752,166901..>166971))
FT                   /locus_tag="AGOS_AEL251C"
FT                   /old_locus_tag="AEL251C"
FT                   /product="AEL251Cp"
FT   CDS_pept        complement(join(166113..166752,166901..166971))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL251C"
FT                   /old_locus_tag="AEL251C"
FT                   /product="AEL251Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL078C
FT                   (ATP4); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL251C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52434"
FT                   /db_xref="GOA:Q758L2"
FT                   /db_xref="InterPro:IPR008688"
FT                   /db_xref="InterPro:IPR013837"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758L2"
FT                   /protein_id="AAS52434.2"
FT                   QSVADVEKLFASLK"
FT   gene            complement(<167239..>168492)
FT                   /locus_tag="AGOS_AEL250C"
FT                   /old_locus_tag="AEL250C"
FT   mRNA            complement(<167239..>168492)
FT                   /locus_tag="AGOS_AEL250C"
FT                   /old_locus_tag="AEL250C"
FT                   /product="AEL250Cp"
FT   CDS_pept        complement(167239..168492)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL250C"
FT                   /old_locus_tag="AEL250C"
FT                   /product="AEL250Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR195C
FT                   (MSI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL250C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52435"
FT                   /db_xref="GOA:Q758L1"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR022052"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q758L1"
FT                   /protein_id="AAS52435.1"
FT                   NDNSVHVWKPAANLVQAK"
FT   gene            complement(<168790..>170457)
FT                   /locus_tag="AGOS_AEL249C"
FT                   /old_locus_tag="AEL249C"
FT   mRNA            complement(<168790..>170457)
FT                   /locus_tag="AGOS_AEL249C"
FT                   /old_locus_tag="AEL249C"
FT                   /product="AEL249Cp"
FT   CDS_pept        complement(168790..170457)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL249C"
FT                   /old_locus_tag="AEL249C"
FT                   /product="AEL249Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR196C
FT                   (PGI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL249C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52436"
FT                   /db_xref="GOA:Q758L0"
FT                   /db_xref="InterPro:IPR001672"
FT                   /db_xref="InterPro:IPR018189"
FT                   /db_xref="InterPro:IPR023096"
FT                   /db_xref="InterPro:IPR035476"
FT                   /db_xref="InterPro:IPR035482"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758L0"
FT                   /protein_id="AAS52436.1"
FT   gene            complement(<170668..>171039)
FT                   /locus_tag="AGOS_AEL248C"
FT                   /old_locus_tag="AEL248C"
FT   mRNA            complement(<170668..>171039)
FT                   /locus_tag="AGOS_AEL248C"
FT                   /old_locus_tag="AEL248C"
FT                   /product="AEL248Cp"
FT   CDS_pept        complement(170668..171039)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL248C"
FT                   /old_locus_tag="AEL248C"
FT                   /product="AEL248Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL077C
FT                   and YBR197C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL248C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52437"
FT                   /db_xref="UniProtKB/TrEMBL:Q758K9"
FT                   /protein_id="AAS52437.1"
FT   gene            <171150..>171992
FT                   /locus_tag="AGOS_AEL247W"
FT                   /old_locus_tag="AEL247W"
FT   mRNA            <171150..>171992
FT                   /locus_tag="AGOS_AEL247W"
FT                   /old_locus_tag="AEL247W"
FT                   /product="AEL247Wp"
FT   CDS_pept        171150..171992
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL247W"
FT                   /old_locus_tag="AEL247W"
FT                   /product="AEL247Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL076W
FT                   (GPI2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL247W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52438"
FT                   /db_xref="GOA:Q758K8"
FT                   /db_xref="InterPro:IPR009450"
FT                   /db_xref="UniProtKB/TrEMBL:Q758K8"
FT                   /protein_id="AAS52438.1"
FT   gene            complement(<172078..>174525)
FT                   /locus_tag="AGOS_AEL246C"
FT                   /old_locus_tag="AEL246C"
FT   mRNA            complement(<172078..>174525)
FT                   /locus_tag="AGOS_AEL246C"
FT                   /old_locus_tag="AEL246C"
FT                   /product="AEL246Cp"
FT   CDS_pept        complement(172078..174525)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL246C"
FT                   /old_locus_tag="AEL246C"
FT                   /product="AEL246Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR198C
FT                   (TAF5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL246C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52439"
FT                   /db_xref="GOA:Q758K7"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR006594"
FT                   /db_xref="InterPro:IPR007582"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR037264"
FT                   /db_xref="InterPro:IPR037783"
FT                   /db_xref="UniProtKB/TrEMBL:Q758K7"
FT                   /protein_id="AAS52439.1"
FT                   FTE"
FT   gene            <175276..>177414
FT                   /locus_tag="AGOS_AEL245W"
FT                   /old_locus_tag="AEL245W"
FT   mRNA            <175276..>177414
FT                   /locus_tag="AGOS_AEL245W"
FT                   /old_locus_tag="AEL245W"
FT                   /product="AEL245Wp"
FT   CDS_pept        175276..177414
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL245W"
FT                   /old_locus_tag="AEL245W"
FT                   /product="AEL245Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL075W
FT                   (GCR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL245W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52440"
FT                   /db_xref="GOA:Q758V3"
FT                   /db_xref="InterPro:IPR022210"
FT                   /db_xref="UniProtKB/TrEMBL:Q758V3"
FT                   /protein_id="AAS52440.1"
FT                   PEEEKTKYCKRKQGSSSE"
FT   gene            <177892..>179964
FT                   /locus_tag="AGOS_AEL244W"
FT                   /old_locus_tag="AEL244W"
FT   mRNA            <177892..>179964
FT                   /locus_tag="AGOS_AEL244W"
FT                   /old_locus_tag="AEL244W"
FT                   /product="AEL244Wp"
FT   CDS_pept        177892..179964
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL244W"
FT                   /old_locus_tag="AEL244W"
FT                   /product="AEL244Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL074W
FT                   (YTA6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL244W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52441"
FT                   /db_xref="GOA:Q758K6"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR041569"
FT                   /db_xref="UniProtKB/TrEMBL:Q758K6"
FT                   /protein_id="AAS52441.1"
FT   gene            <180186..>181547
FT                   /locus_tag="AGOS_AEL243W"
FT                   /old_locus_tag="AEL243W"
FT   mRNA            <180186..>181547
FT                   /locus_tag="AGOS_AEL243W"
FT                   /old_locus_tag="AEL243W"
FT                   /product="AEL243Wp"
FT   CDS_pept        180186..181547
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL243W"
FT                   /old_locus_tag="AEL243W"
FT                   /product="AEL243Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR199W
FT                   (KTR4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL243W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52442"
FT                   /db_xref="GOA:Q758K5"
FT                   /db_xref="InterPro:IPR002685"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q758K5"
FT                   /protein_id="AAS52442.1"
FT   gene            <181838..>183679
FT                   /locus_tag="AGOS_AEL242W"
FT                   /old_locus_tag="AEL242W"
FT   mRNA            <181838..>183679
FT                   /locus_tag="AGOS_AEL242W"
FT                   /old_locus_tag="AEL242W"
FT                   /product="AEL242Wp"
FT   CDS_pept        181838..183679
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL242W"
FT                   /old_locus_tag="AEL242W"
FT                   /product="AEL242Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL072W
FT                   (UBP16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL242W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52443"
FT                   /db_xref="GOA:Q758K4"
FT                   /db_xref="InterPro:IPR001394"
FT                   /db_xref="InterPro:IPR018200"
FT                   /db_xref="InterPro:IPR028889"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/TrEMBL:Q758K4"
FT                   /protein_id="AAS52443.1"
FT   gene            <183867..>185704
FT                   /locus_tag="AGOS_AEL241W"
FT                   /old_locus_tag="AEL241W"
FT   mRNA            join(<183867..183875,184064..>185704)
FT                   /locus_tag="AGOS_AEL241W"
FT                   /old_locus_tag="AEL241W"
FT                   /product="AEL241Wp"
FT   CDS_pept        join(183867..183875,184064..185704)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL241W"
FT                   /old_locus_tag="AEL241W"
FT                   /product="AEL241Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR200W
FT                   (BEM1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL241W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52444"
FT                   /db_xref="GOA:Q758K3"
FT                   /db_xref="InterPro:IPR000270"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR001683"
FT                   /db_xref="InterPro:IPR030507"
FT                   /db_xref="InterPro:IPR035548"
FT                   /db_xref="InterPro:IPR035549"
FT                   /db_xref="InterPro:IPR035550"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="InterPro:IPR036871"
FT                   /db_xref="UniProtKB/TrEMBL:Q758K3"
FT                   /protein_id="AAS52444.1"
FT   gene            complement(<185853..>186323)
FT                   /locus_tag="AGOS_AEL240C"
FT                   /old_locus_tag="AEL240C"
FT   mRNA            complement(<185853..>186323)
FT                   /locus_tag="AGOS_AEL240C"
FT                   /old_locus_tag="AEL240C"
FT                   /product="AEL240Cp"
FT   CDS_pept        complement(185853..186323)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL240C"
FT                   /old_locus_tag="AEL240C"
FT                   /product="AEL240Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL071C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL240C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52445"
FT                   /db_xref="UniProtKB/TrEMBL:Q758K2"
FT                   /protein_id="AAS52445.1"
FT   gene            <186675..>188330
FT                   /locus_tag="AGOS_AEL239W"
FT                   /old_locus_tag="AEL239W"
FT   mRNA            <186675..>188330
FT                   /locus_tag="AGOS_AEL239W"
FT                   /old_locus_tag="AEL239W"
FT                   /product="AEL239Wp"
FT   CDS_pept        186675..188330
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL239W"
FT                   /old_locus_tag="AEL239W"
FT                   /product="AEL239Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL070W
FT                   (MUK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL239W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52446"
FT                   /db_xref="GOA:Q758K1"
FT                   /db_xref="InterPro:IPR003123"
FT                   /db_xref="InterPro:IPR037191"
FT                   /db_xref="UniProtKB/TrEMBL:Q758K1"
FT                   /protein_id="AAS52446.2"
FT   gene            complement(<188371..>189333)
FT                   /locus_tag="AGOS_AEL238C"
FT                   /old_locus_tag="AEL238C"
FT   mRNA            complement(<188371..>189333)
FT                   /locus_tag="AGOS_AEL238C"
FT                   /old_locus_tag="AEL238C"
FT                   /product="AEL238Cp"
FT   CDS_pept        complement(188371..189333)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL238C"
FT                   /old_locus_tag="AEL238C"
FT                   /product="AEL238Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL069C
FT                   (BTS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL238C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52447"
FT                   /db_xref="GOA:Q758K0"
FT                   /db_xref="InterPro:IPR000092"
FT                   /db_xref="InterPro:IPR008949"
FT                   /db_xref="InterPro:IPR033749"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758K0"
FT                   /protein_id="AAS52447.1"
FT   gene            <189550..>190152
FT                   /locus_tag="AGOS_AEL237W"
FT                   /old_locus_tag="AEL237W"
FT   mRNA            <189550..>190152
FT                   /locus_tag="AGOS_AEL237W"
FT                   /old_locus_tag="AEL237W"
FT                   /product="AEL237Wp"
FT   CDS_pept        189550..190152
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL237W"
FT                   /old_locus_tag="AEL237W"
FT                   /product="AEL237Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR201W
FT                   (DER1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL237W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52448"
FT                   /db_xref="GOA:Q758J9"
FT                   /db_xref="InterPro:IPR007599"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J9"
FT                   /protein_id="AAS52448.2"
FT   gene            complement(<190213..>191040)
FT                   /locus_tag="AGOS_AEL236C"
FT                   /old_locus_tag="AEL236C"
FT   mRNA            complement(<190213..>191040)
FT                   /locus_tag="AGOS_AEL236C"
FT                   /old_locus_tag="AEL236C"
FT                   /product="AEL236Cp"
FT   CDS_pept        complement(190213..191040)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL236C"
FT                   /old_locus_tag="AEL236C"
FT                   /product="AEL236Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL068C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL236C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52449"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J8"
FT                   /protein_id="AAS52449.2"
FT   gene            <191225..>191539
FT                   /locus_tag="AGOS_AEL235W"
FT                   /old_locus_tag="AEL235W"
FT   mRNA            <191225..>191539
FT                   /locus_tag="AGOS_AEL235W"
FT                   /old_locus_tag="AEL235W"
FT                   /product="AEL235Wp"
FT   CDS_pept        191225..191539
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL235W"
FT                   /old_locus_tag="AEL235W"
FT                   /product="AEL235Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR020C
FT                   (HSP10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL235W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52450"
FT                   /db_xref="GOA:Q758J7"
FT                   /db_xref="InterPro:IPR011032"
FT                   /db_xref="InterPro:IPR018369"
FT                   /db_xref="InterPro:IPR020818"
FT                   /db_xref="InterPro:IPR037124"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J7"
FT                   /protein_id="AAS52450.2"
FT                   "
FT   gene            complement(<191568..>192773)
FT                   /locus_tag="AGOS_AEL234C"
FT                   /old_locus_tag="AEL234C"
FT   mRNA            complement(<191568..>192773)
FT                   /locus_tag="AGOS_AEL234C"
FT                   /old_locus_tag="AEL234C"
FT                   /product="AEL234Cp"
FT   CDS_pept        complement(191568..192773)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL234C"
FT                   /old_locus_tag="AEL234C"
FT                   /product="AEL234Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR473C
FT                   (PRP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL234C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52451"
FT                   /db_xref="GOA:Q758J6"
FT                   /db_xref="InterPro:IPR010541"
FT                   /db_xref="InterPro:IPR013881"
FT                   /db_xref="InterPro:IPR027104"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J6"
FT                   /protein_id="AAS52451.2"
FT                   PS"
FT   gene            complement(<192980..>195361)
FT                   /locus_tag="AGOS_AEL233C"
FT                   /old_locus_tag="AEL233C"
FT   mRNA            complement(<192980..>195361)
FT                   /locus_tag="AGOS_AEL233C"
FT                   /old_locus_tag="AEL233C"
FT                   /product="AEL233Cp"
FT   CDS_pept        complement(192980..195361)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL233C"
FT                   /old_locus_tag="AEL233C"
FT                   /product="AEL233Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR475C
FT                   (JIP4) and YOR019W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL233C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52452"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J5"
FT                   /protein_id="AAS52452.2"
FT   gene            complement(<195584..>196515)
FT                   /locus_tag="AGOS_AEL232C"
FT                   /old_locus_tag="AEL232C"
FT   mRNA            complement(join(<195584..196309,196357..>196515))
FT                   /locus_tag="AGOS_AEL232C"
FT                   /old_locus_tag="AEL232C"
FT                   /product="AEL232Cp"
FT   CDS_pept        complement(join(195584..196309,196357..196515))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL232C"
FT                   /old_locus_tag="AEL232C"
FT                   /product="AEL232Cp"
FT                   /note="NOHBY512; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F02662g;
FT                   1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL232C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52453"
FT                   /db_xref="GOA:Q758J4"
FT                   /db_xref="InterPro:IPR006689"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J4"
FT                   /protein_id="AAS52453.2"
FT                   TGISDVIEWLMQL"
FT   gene            complement(<196551..>197366)
FT                   /locus_tag="AGOS_AEL231C"
FT                   /old_locus_tag="AEL231C"
FT   mRNA            complement(<196551..>197366)
FT                   /locus_tag="AGOS_AEL231C"
FT                   /old_locus_tag="AEL231C"
FT                   /product="AEL231Cp"
FT   CDS_pept        complement(196551..197366)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL231C"
FT                   /old_locus_tag="AEL231C"
FT                   /product="AEL231Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR476C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL231C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52454"
FT                   /db_xref="InterPro:IPR019595"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J3"
FT                   /protein_id="AAS52454.1"
FT   gene            <197631..>199457
FT                   /locus_tag="AGOS_AEL230W"
FT                   /old_locus_tag="AEL230W"
FT   mRNA            <197631..>199457
FT                   /locus_tag="AGOS_AEL230W"
FT                   /old_locus_tag="AEL230W"
FT                   /product="AEL230Wp"
FT   CDS_pept        197631..199457
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL230W"
FT                   /old_locus_tag="AEL230W"
FT                   /product="AEL230Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR477W
FT                   (SNF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL230W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52455"
FT                   /db_xref="GOA:Q758J2"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013896"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR028375"
FT                   /db_xref="InterPro:IPR032270"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J2"
FT                   /protein_id="AAS52455.1"
FT   gene            <199823..>201340
FT                   /locus_tag="AGOS_AEL229W"
FT                   /old_locus_tag="AEL229W"
FT   mRNA            <199823..>201340
FT                   /locus_tag="AGOS_AEL229W"
FT                   /old_locus_tag="AEL229W"
FT                   /product="AEL229Wp"
FT   CDS_pept        199823..201340
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL229W"
FT                   /old_locus_tag="AEL229W"
FT                   /product="AEL229Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR025W
FT                   (HST3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL229W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52456"
FT                   /db_xref="GOA:Q758J1"
FT                   /db_xref="InterPro:IPR003000"
FT                   /db_xref="InterPro:IPR026590"
FT                   /db_xref="InterPro:IPR026591"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J1"
FT                   /protein_id="AAS52456.2"
FT   gene            <201524..>202108
FT                   /locus_tag="AGOS_AEL228W"
FT                   /old_locus_tag="AEL228W"
FT   mRNA            <201524..>202108
FT                   /locus_tag="AGOS_AEL228W"
FT                   /old_locus_tag="AEL228W"
FT                   /product="AEL228Wp"
FT   CDS_pept        201524..202108
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL228W"
FT                   /old_locus_tag="AEL228W"
FT                   /product="AEL228Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR478W
FT                   (SNM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL228W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52457"
FT                   /db_xref="GOA:Q758J0"
FT                   /db_xref="InterPro:IPR007175"
FT                   /db_xref="UniProtKB/TrEMBL:Q758J0"
FT                   /protein_id="AAS52457.1"
FT   gene            complement(<202256..>203830)
FT                   /locus_tag="AGOS_AEL227C"
FT                   /old_locus_tag="AEL227C"
FT   mRNA            complement(<202256..>203830)
FT                   /locus_tag="AGOS_AEL227C"
FT                   /old_locus_tag="AEL227C"
FT                   /product="AEL227Cp"
FT   CDS_pept        complement(202256..203830)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL227C"
FT                   /old_locus_tag="AEL227C"
FT                   /product="AEL227Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR479C
FT                   (PEX29)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL227C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52458"
FT                   /db_xref="GOA:Q758I9"
FT                   /db_xref="InterPro:IPR010482"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I9"
FT                   /protein_id="AAS52458.2"
FT                   DFLNING"
FT   gene            <204042..>205016
FT                   /locus_tag="AGOS_AEL226W"
FT                   /old_locus_tag="AEL226W"
FT   mRNA            <204042..>205016
FT                   /locus_tag="AGOS_AEL226W"
FT                   /old_locus_tag="AEL226W"
FT                   /product="AEL226Wp"
FT   CDS_pept        204042..205016
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL226W"
FT                   /old_locus_tag="AEL226W"
FT                   /product="AEL226Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR026W
FT                   (BUB3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL226W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52459"
FT                   /db_xref="GOA:Q758I8"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I8"
FT                   /protein_id="AAS52459.1"
FT   gene            complement(<205065..>206498)
FT                   /locus_tag="AGOS_AEL225C"
FT                   /old_locus_tag="AEL225C"
FT   mRNA            complement(<205065..>206498)
FT                   /locus_tag="AGOS_AEL225C"
FT                   /old_locus_tag="AEL225C"
FT                   /product="AEL225Cp"
FT   CDS_pept        complement(205065..206498)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL225C"
FT                   /old_locus_tag="AEL225C"
FT                   /product="AEL225Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR257C
FT                   (RKM4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL225C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52460"
FT                   /db_xref="GOA:Q758I7"
FT                   /db_xref="InterPro:IPR001214"
FT                   /db_xref="InterPro:IPR011383"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I7"
FT                   /protein_id="AAS52460.2"
FT   gene            <206940..>208682
FT                   /locus_tag="AGOS_AEL224W"
FT                   /old_locus_tag="AEL224W"
FT   mRNA            <206940..>208682
FT                   /locus_tag="AGOS_AEL224W"
FT                   /old_locus_tag="AEL224W"
FT                   /product="AEL224Wp"
FT   CDS_pept        206940..208682
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL224W"
FT                   /old_locus_tag="AEL224W"
FT                   /product="AEL224Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR027W
FT                   (STI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL224W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52461"
FT                   /db_xref="GOA:Q758I6"
FT                   /db_xref="InterPro:IPR001440"
FT                   /db_xref="InterPro:IPR006636"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="InterPro:IPR041243"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I6"
FT                   /protein_id="AAS52461.2"
FT                   IRTR"
FT   gene            complement(<209080..>211491)
FT                   /locus_tag="AGOS_AEL223C"
FT                   /old_locus_tag="AEL223C"
FT   mRNA            complement(<209080..>211491)
FT                   /locus_tag="AGOS_AEL223C"
FT                   /old_locus_tag="AEL223C"
FT                   /product="AEL223Cp"
FT   CDS_pept        complement(209080..211491)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL223C"
FT                   /old_locus_tag="AEL223C"
FT                   /product="AEL223Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR258C
FT                   (HSP78)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL223C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52462"
FT                   /db_xref="GOA:Q758I5"
FT                   /db_xref="InterPro:IPR001270"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR018368"
FT                   /db_xref="InterPro:IPR019489"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR028299"
FT                   /db_xref="InterPro:IPR041546"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I5"
FT                   /protein_id="AAS52462.2"
FT   gene            complement(<212965..>213669)
FT                   /locus_tag="AGOS_AEL222C"
FT                   /old_locus_tag="AEL222C"
FT   mRNA            complement(<212965..>213669)
FT                   /locus_tag="AGOS_AEL222C"
FT                   /old_locus_tag="AEL222C"
FT                   /product="AEL222Cp"
FT   CDS_pept        complement(212965..213669)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL222C"
FT                   /old_locus_tag="AEL222C"
FT                   /product="AEL222Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR028C
FT                   (CIN5) and YDR259C (YAP6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL222C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52463"
FT                   /db_xref="GOA:Q758I4"
FT                   /db_xref="InterPro:IPR004827"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I4"
FT                   /protein_id="AAS52463.1"
FT                   LKMRLADIEKLT"
FT   gene            complement(<214099..>214527)
FT                   /locus_tag="AGOS_AEL221C"
FT                   /old_locus_tag="AEL221C"
FT   mRNA            complement(<214099..>214527)
FT                   /locus_tag="AGOS_AEL221C"
FT                   /old_locus_tag="AEL221C"
FT                   /product="AEL221Cp"
FT   CDS_pept        complement(214099..214527)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL221C"
FT                   /old_locus_tag="AEL221C"
FT                   /product="AEL221Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR260C
FT                   (SWM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL221C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52464"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I3"
FT                   /protein_id="AAS52464.1"
FT   gene            complement(<214585..>216090)
FT                   /locus_tag="AGOS_AEL220C"
FT                   /old_locus_tag="AEL220C"
FT   mRNA            complement(<214585..>216090)
FT                   /locus_tag="AGOS_AEL220C"
FT                   /old_locus_tag="AEL220C"
FT                   /product="AEL220Cp"
FT   CDS_pept        complement(214585..216090)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL220C"
FT                   /old_locus_tag="AEL220C"
FT                   /product="AEL220Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR261C
FT                   (EXG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL220C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52465"
FT                   /db_xref="GOA:Q758I2"
FT                   /db_xref="InterPro:IPR001547"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I2"
FT                   /protein_id="AAS52465.1"
FT   gene            <217560..>219053
FT                   /locus_tag="AGOS_AEL219W"
FT                   /old_locus_tag="AEL219W"
FT   mRNA            <217560..>219053
FT                   /locus_tag="AGOS_AEL219W"
FT                   /old_locus_tag="AEL219W"
FT                   /product="AEL219Wp"
FT   CDS_pept        217560..219053
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL219W"
FT                   /old_locus_tag="AEL219W"
FT                   /product="AEL219Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR030W
FT                   (DFG16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL219W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52466"
FT                   /db_xref="GOA:Q758I1"
FT                   /db_xref="InterPro:IPR014844"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I1"
FT                   /protein_id="AAS52466.1"
FT   gene            <219380..>223795
FT                   /locus_tag="AGOS_AEL218W"
FT                   /old_locus_tag="AEL218W"
FT   mRNA            <219380..>223795
FT                   /locus_tag="AGOS_AEL218W"
FT                   /old_locus_tag="AEL218W"
FT                   /product="AEL218Wp"
FT   CDS_pept        219380..223795
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL218W"
FT                   /old_locus_tag="AEL218W"
FT                   /product="AEL218Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR164C
FT                   (DNA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL218W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52467"
FT                   /db_xref="GOA:Q758I0"
FT                   /db_xref="InterPro:IPR014808"
FT                   /db_xref="InterPro:IPR026851"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR041677"
FT                   /db_xref="InterPro:IPR041679"
FT                   /db_xref="UniProtKB/TrEMBL:Q758I0"
FT                   /protein_id="AAS52467.1"
FT                   VYTLSPSTYP"
FT   gene            <224445..>226949
FT                   /locus_tag="AGOS_AEL217W"
FT                   /old_locus_tag="AEL217W"
FT   mRNA            <224445..>226949
FT                   /locus_tag="AGOS_AEL217W"
FT                   /old_locus_tag="AEL217W"
FT                   /product="AEL217Wp"
FT   CDS_pept        224445..226949
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL217W"
FT                   /old_locus_tag="AEL217W"
FT                   /product="AEL217Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR250C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL217W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52468"
FT                   /db_xref="GOA:Q758H9"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q758H9"
FT                   /protein_id="AAS52468.1"
FT   gene            complement(<227661..>229013)
FT                   /locus_tag="AGOS_AEL216C"
FT                   /old_locus_tag="AEL216C"
FT   mRNA            complement(<227661..>229013)
FT                   /locus_tag="AGOS_AEL216C"
FT                   /old_locus_tag="AEL216C"
FT                   /product="AEL216Cp"
FT   CDS_pept        complement(227661..229013)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL216C"
FT                   /old_locus_tag="AEL216C"
FT                   /product="AEL216Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR249W
FT                   (MGA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL216C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52469"
FT                   /db_xref="GOA:Q758H8"
FT                   /db_xref="InterPro:IPR000232"
FT                   /db_xref="InterPro:IPR027725"
FT                   /db_xref="InterPro:IPR033049"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="UniProtKB/TrEMBL:Q758H8"
FT                   /protein_id="AAS52469.1"
FT   gene            complement(<229443..>230489)
FT                   /locus_tag="AGOS_AEL215C"
FT                   /old_locus_tag="AEL215C"
FT   mRNA            complement(<229443..>230489)
FT                   /locus_tag="AGOS_AEL215C"
FT                   /old_locus_tag="AEL215C"
FT                   /product="AEL215Cp"
FT   CDS_pept        complement(229443..230489)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL215C"
FT                   /old_locus_tag="AEL215C"
FT                   /product="AEL215Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR163W
FT                   (SOL3) and YGR248W (SOL4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL215C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52470"
FT                   /db_xref="GOA:Q758H7"
FT                   /db_xref="InterPro:IPR005900"
FT                   /db_xref="InterPro:IPR006148"
FT                   /db_xref="InterPro:IPR037171"
FT                   /db_xref="InterPro:IPR039104"
FT                   /db_xref="UniProtKB/TrEMBL:Q758H7"
FT                   /protein_id="AAS52470.1"
FT                   AYCASSRT"
FT   gene            complement(<230731..>231381)
FT                   /locus_tag="AGOS_AEL214C"
FT                   /old_locus_tag="AEL214C"
FT   mRNA            complement(<230731..>231381)
FT                   /locus_tag="AGOS_AEL214C"
FT                   /old_locus_tag="AEL214C"
FT                   /product="AEL214Cp"
FT   CDS_pept        complement(230731..231381)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL214C"
FT                   /old_locus_tag="AEL214C"
FT                   /product="AEL214Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR247W
FT                   (CPD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL214C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52471"
FT                   /db_xref="GOA:Q758H6"
FT                   /db_xref="InterPro:IPR009097"
FT                   /db_xref="InterPro:IPR012386"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758H6"
FT                   /protein_id="AAS52471.1"
FT   gene            <231601..>233316
FT                   /locus_tag="AGOS_AEL213W"
FT                   /old_locus_tag="AEL213W"
FT   mRNA            <231601..>233316
FT                   /locus_tag="AGOS_AEL213W"
FT                   /old_locus_tag="AEL213W"
FT                   /product="AEL213Wp"
FT   CDS_pept        231601..233316
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL213W"
FT                   /old_locus_tag="AEL213W"
FT                   /product="AEL213Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR246C
FT                   (BRF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL213W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52472"
FT                   /db_xref="GOA:Q758H5"
FT                   /db_xref="InterPro:IPR000812"
FT                   /db_xref="InterPro:IPR011665"
FT                   /db_xref="InterPro:IPR013137"
FT                   /db_xref="InterPro:IPR013150"
FT                   /db_xref="InterPro:IPR013763"
FT                   /db_xref="InterPro:IPR023486"
FT                   /db_xref="InterPro:IPR029529"
FT                   /db_xref="InterPro:IPR036915"
FT                   /db_xref="UniProtKB/TrEMBL:Q758H5"
FT                   /protein_id="AAS52472.1"
FT   gene            <233566..>235737
FT                   /locus_tag="AGOS_AEL212W"
FT                   /old_locus_tag="AEL212W"
FT   mRNA            <233566..>235737
FT                   /locus_tag="AGOS_AEL212W"
FT                   /old_locus_tag="AEL212W"
FT                   /product="AEL212Wp"
FT   CDS_pept        233566..235737
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL212W"
FT                   /old_locus_tag="AEL212W"
FT                   /product="AEL212Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR245C
FT                   (SDA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL212W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52473"
FT                   /db_xref="GOA:Q758H4"
FT                   /db_xref="InterPro:IPR007949"
FT                   /db_xref="InterPro:IPR012977"
FT                   /db_xref="InterPro:IPR027312"
FT                   /db_xref="UniProtKB/TrEMBL:Q758H4"
FT                   /protein_id="AAS52473.1"
FT   gene            <236041..>237294
FT                   /locus_tag="AGOS_AEL211W"
FT                   /old_locus_tag="AEL211W"
FT   mRNA            <236041..>237294
FT                   /locus_tag="AGOS_AEL211W"
FT                   /old_locus_tag="AEL211W"
FT                   /product="AEL211Wp"
FT   CDS_pept        236041..237294
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL211W"
FT                   /old_locus_tag="AEL211W"
FT                   /product="AEL211Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR244C
FT                   (LSC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL211W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52474"
FT                   /db_xref="GOA:Q758H3"
FT                   /db_xref="InterPro:IPR005809"
FT                   /db_xref="InterPro:IPR005811"
FT                   /db_xref="InterPro:IPR011761"
FT                   /db_xref="InterPro:IPR013650"
FT                   /db_xref="InterPro:IPR013815"
FT                   /db_xref="InterPro:IPR016102"
FT                   /db_xref="InterPro:IPR017866"
FT                   /db_xref="UniProtKB/TrEMBL:Q758H3"
FT                   /protein_id="AAS52474.1"
FT                   FDELDPAAEKVVGLAASS"
FT   gene            complement(<237342..>237722)
FT                   /locus_tag="AGOS_AEL210C"
FT                   /old_locus_tag="AEL210C"
FT   mRNA            complement(<237342..>237722)
FT                   /locus_tag="AGOS_AEL210C"
FT                   /old_locus_tag="AEL210C"
FT                   /product="AEL210Cp"
FT   CDS_pept        complement(237342..237722)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL210C"
FT                   /old_locus_tag="AEL210C"
FT                   /product="AEL210Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR243W
FT                   (FMP43) and YHR162W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL210C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52475"
FT                   /db_xref="GOA:Q758H2"
FT                   /db_xref="InterPro:IPR005336"
FT                   /db_xref="UniProtKB/TrEMBL:Q758H2"
FT                   /protein_id="AAS52475.1"
FT   gene            <238290..>239702
FT                   /locus_tag="AGOS_AEL209W"
FT                   /old_locus_tag="AEL209W"
FT   mRNA            <238290..>239702
FT                   /locus_tag="AGOS_AEL209W"
FT                   /old_locus_tag="AEL209W"
FT                   /product="AEL209Wp"
FT   CDS_pept        238290..239702
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL209W"
FT                   /old_locus_tag="AEL209W"
FT                   /product="AEL209Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR161C
FT                   (YAP1801) and YGR241C (YAP1802)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL209W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52476"
FT                   /db_xref="GOA:Q758H1"
FT                   /db_xref="InterPro:IPR008942"
FT                   /db_xref="InterPro:IPR011417"
FT                   /db_xref="InterPro:IPR013809"
FT                   /db_xref="InterPro:IPR014712"
FT                   /db_xref="UniProtKB/TrEMBL:Q758H1"
FT                   /protein_id="AAS52476.1"
FT                   QLGYLNQNLIDI"
FT   gene            <240008..>242971
FT                   /locus_tag="AGOS_AEL208W"
FT                   /old_locus_tag="AEL208W"
FT   mRNA            <240008..>242971
FT                   /locus_tag="AGOS_AEL208W"
FT                   /old_locus_tag="AEL208W"
FT                   /product="AEL208Wp"
FT   CDS_pept        240008..242971
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL208W"
FT                   /old_locus_tag="AEL208W"
FT                   /product="AEL208Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR240C
FT                   (PFK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL208W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52477"
FT                   /db_xref="GOA:Q758H0"
FT                   /db_xref="InterPro:IPR000023"
FT                   /db_xref="InterPro:IPR009161"
FT                   /db_xref="InterPro:IPR015912"
FT                   /db_xref="InterPro:IPR022953"
FT                   /db_xref="InterPro:IPR035966"
FT                   /db_xref="InterPro:IPR040712"
FT                   /db_xref="UniProtKB/TrEMBL:Q758H0"
FT                   /protein_id="AAS52477.1"
FT   gene            <243295..>245175
FT                   /locus_tag="AGOS_AEL207W"
FT                   /old_locus_tag="AEL207W"
FT   mRNA            <243295..>245175
FT                   /locus_tag="AGOS_AEL207W"
FT                   /old_locus_tag="AEL207W"
FT                   /product="AEL207Wp"
FT   CDS_pept        243295..245175
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL207W"
FT                   /old_locus_tag="AEL207W"
FT                   /product="AEL207Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL299W
FT                   (TRF5) and YOL115W (PAP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL207W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52478"
FT                   /db_xref="GOA:Q9HFW3"
FT                   /db_xref="InterPro:IPR002058"
FT                   /db_xref="InterPro:IPR002934"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9HFW3"
FT                   /protein_id="AAS52478.1"
FT   gene            complement(<245238..>245780)
FT                   /locus_tag="AGOS_AEL206C"
FT                   /old_locus_tag="AEL206C"
FT   mRNA            complement(<245238..>245780)
FT                   /locus_tag="AGOS_AEL206C"
FT                   /old_locus_tag="AEL206C"
FT                   /product="AEL206Cp"
FT   CDS_pept        complement(245238..245780)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL206C"
FT                   /old_locus_tag="AEL206C"
FT                   /product="AEL206Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOL114C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL206C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52479"
FT                   /db_xref="GOA:Q758G8"
FT                   /db_xref="InterPro:IPR000352"
FT                   /db_xref="UniProtKB/TrEMBL:Q758G8"
FT                   /protein_id="AAS52479.1"
FT                   GKRRQGERKRLRGRVEY"
FT   gene            <246099..>248480
FT                   /locus_tag="AGOS_AEL205W"
FT                   /old_locus_tag="AEL205W"
FT   mRNA            <246099..>248480
FT                   /locus_tag="AGOS_AEL205W"
FT                   /old_locus_tag="AEL205W"
FT                   /product="AEL205Wp"
FT   CDS_pept        246099..248480
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL205W"
FT                   /old_locus_tag="AEL205W"
FT                   /product="AEL205Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL298W
FT                   (CLA4) and YOL113W (SKM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL205W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52480"
FT                   /db_xref="GOA:Q9HFW2"
FT                   /db_xref="InterPro:IPR000095"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001849"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR011993"
FT                   /db_xref="InterPro:IPR033923"
FT                   /db_xref="InterPro:IPR036936"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9HFW2"
FT                   /protein_id="AAS52480.1"
FT   gene            complement(<248759..>253534)
FT                   /locus_tag="AGOS_AEL204C"
FT                   /old_locus_tag="AEL204C"
FT   mRNA            complement(<248759..>253534)
FT                   /locus_tag="AGOS_AEL204C"
FT                   /old_locus_tag="AEL204C"
FT                   /product="AEL204Cp"
FT   CDS_pept        complement(248759..253534)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL204C"
FT                   /old_locus_tag="AEL204C"
FT                   /product="AEL204Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL297C
FT                   (MON2)"
FT                   /db_xref="GOA:E7FHV0"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR026829"
FT                   /db_xref="InterPro:IPR032629"
FT                   /db_xref="InterPro:IPR032691"
FT                   /db_xref="InterPro:IPR032817"
FT                   /db_xref="UniProtKB/TrEMBL:E7FHV0"
FT                   /protein_id="AAS52481.1"
FT                   QKLSLRFNVLYT"
FT   gene            <253865..>255121
FT                   /locus_tag="AGOS_AEL203W"
FT                   /old_locus_tag="AEL203W"
FT   mRNA            <253865..>255121
FT                   /locus_tag="AGOS_AEL203W"
FT                   /old_locus_tag="AEL203W"
FT                   /product="AEL203Wp"
FT   CDS_pept        253865..255121
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL203W"
FT                   /old_locus_tag="AEL203W"
FT                   /product="AEL203Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YNL295W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL203W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52482"
FT                   /db_xref="UniProtKB/TrEMBL:Q758G5"
FT                   /protein_id="AAS52482.1"
FT   gene            complement(<255180..>256688)
FT                   /locus_tag="AGOS_AEL202C"
FT                   /old_locus_tag="AEL202C"
FT   mRNA            complement(<255180..>256688)
FT                   /locus_tag="AGOS_AEL202C"
FT                   /old_locus_tag="AEL202C"
FT                   /product="AEL202Cp"
FT   CDS_pept        complement(255180..256688)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL202C"
FT                   /old_locus_tag="AEL202C"
FT                   /product="AEL202Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL294C
FT                   (RIM21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL202C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52483"
FT                   /db_xref="GOA:Q758G4"
FT                   /db_xref="InterPro:IPR014844"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758G4"
FT                   /protein_id="AAS52483.1"
FT   gene            <257168..>258892
FT                   /locus_tag="AGOS_AEL201W"
FT                   /old_locus_tag="AEL201W"
FT   mRNA            <257168..>258892
FT                   /locus_tag="AGOS_AEL201W"
FT                   /old_locus_tag="AEL201W"
FT                   /product="AEL201Wp"
FT   CDS_pept        257168..258892
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL201W"
FT                   /old_locus_tag="AEL201W"
FT                   /product="AEL201Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL293W
FT                   (MSB3) and YOL112W (MSB4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL201W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52484"
FT                   /db_xref="GOA:Q758G3"
FT                   /db_xref="InterPro:IPR000195"
FT                   /db_xref="InterPro:IPR035969"
FT                   /db_xref="UniProtKB/TrEMBL:Q758G3"
FT                   /protein_id="AAS52484.1"
FT   gene            complement(<258942..>259553)
FT                   /locus_tag="AGOS_AEL200C"
FT                   /old_locus_tag="AEL200C"
FT   mRNA            complement(<258942..>259553)
FT                   /locus_tag="AGOS_AEL200C"
FT                   /old_locus_tag="AEL200C"
FT                   /product="AEL200Cp"
FT   CDS_pept        complement(258942..259553)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL200C"
FT                   /old_locus_tag="AEL200C"
FT                   /product="AEL200Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL111C
FT                   (MDY2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL200C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52485"
FT                   /db_xref="GOA:Q758G2"
FT                   /db_xref="InterPro:IPR000626"
FT                   /db_xref="InterPro:IPR029071"
FT                   /db_xref="InterPro:IPR031765"
FT                   /db_xref="InterPro:IPR040474"
FT                   /db_xref="UniProtKB/TrEMBL:Q758G2"
FT                   /protein_id="AAS52485.1"
FT   gene            <259707..>260472
FT                   /locus_tag="AGOS_AEL199W"
FT                   /old_locus_tag="AEL199W"
FT   mRNA            join(<259707..260372,260425..>260472)
FT                   /locus_tag="AGOS_AEL199W"
FT                   /old_locus_tag="AEL199W"
FT                   /product="AEL199Wp"
FT   CDS_pept        join(259707..260372,260425..260472)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL199W"
FT                   /old_locus_tag="AEL199W"
FT                   /product="AEL199Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL110W
FT                   (SHR5); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL199W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52486"
FT                   /db_xref="GOA:Q758G1"
FT                   /db_xref="InterPro:IPR019383"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758G1"
FT                   /protein_id="AAS52486.2"
FT                   LDIQIPRPVPPAARS"
FT   gene            <260693..>261910
FT                   /locus_tag="AGOS_AEL198W"
FT                   /old_locus_tag="AEL198W"
FT   mRNA            <260693..>261910
FT                   /locus_tag="AGOS_AEL198W"
FT                   /old_locus_tag="AEL198W"
FT                   /product="AEL198Wp"
FT   CDS_pept        260693..261910
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL198W"
FT                   /old_locus_tag="AEL198W"
FT                   /product="AEL198Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL292W
FT                   (PUS4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL198W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52487"
FT                   /db_xref="GOA:Q758G0"
FT                   /db_xref="InterPro:IPR002501"
FT                   /db_xref="InterPro:IPR014780"
FT                   /db_xref="InterPro:IPR020103"
FT                   /db_xref="UniProtKB/TrEMBL:Q758G0"
FT                   /protein_id="AAS52487.1"
FT                   DIDSIV"
FT   gene            complement(<261981..>263585)
FT                   /locus_tag="AGOS_AEL197C"
FT                   /old_locus_tag="AEL197C"
FT   mRNA            complement(<261981..>263585)
FT                   /locus_tag="AGOS_AEL197C"
FT                   /old_locus_tag="AEL197C"
FT                   /product="AEL197Cp"
FT   CDS_pept        complement(261981..263585)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL197C"
FT                   /old_locus_tag="AEL197C"
FT                   /product="AEL197Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL291C
FT                   (MID1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL197C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52488"
FT                   /db_xref="GOA:Q758F9"
FT                   /db_xref="InterPro:IPR024338"
FT                   /db_xref="InterPro:IPR036790"
FT                   /db_xref="UniProtKB/TrEMBL:Q758F9"
FT                   /protein_id="AAS52488.2"
FT                   SEALNCNYIGNAEIIST"
FT   gene            <263972..>264973
FT                   /locus_tag="AGOS_AEL196W"
FT                   /old_locus_tag="AEL196W"
FT   mRNA            <263972..>264973
FT                   /locus_tag="AGOS_AEL196W"
FT                   /old_locus_tag="AEL196W"
FT                   /product="AEL196Wp"
FT   CDS_pept        263972..264973
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL196W"
FT                   /old_locus_tag="AEL196W"
FT                   /product="AEL196Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL290W
FT                   (RFC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL196W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52489"
FT                   /db_xref="GOA:Q758F8"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR008921"
FT                   /db_xref="InterPro:IPR013748"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q758F8"
FT                   /protein_id="AAS52489.1"
FT   gene            <265575..>266288
FT                   /locus_tag="AGOS_AEL195W"
FT                   /old_locus_tag="AEL195W"
FT   mRNA            <265575..>266288
FT                   /locus_tag="AGOS_AEL195W"
FT                   /old_locus_tag="AEL195W"
FT                   /product="AEL195Wp"
FT   CDS_pept        265575..266288
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL195W"
FT                   /old_locus_tag="AEL195W"
FT                   /product="AEL195Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL289W
FT                   (PCL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL195W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52490"
FT                   /db_xref="GOA:Q758F7"
FT                   /db_xref="InterPro:IPR006671"
FT                   /db_xref="InterPro:IPR013763"
FT                   /db_xref="InterPro:IPR036915"
FT                   /db_xref="UniProtKB/TrEMBL:Q758F7"
FT                   /protein_id="AAS52490.1"
FT                   LQAPAPLYSIPGHIL"
FT   gene            266474..266565
FT                   /locus_tag="AGOS_AgSNR40"
FT                   /old_locus_tag="AgSNR40"
FT   ncRNA           266474..266565
FT                   /locus_tag="AGOS_AgSNR40"
FT                   /old_locus_tag="AgSNR40"
FT                   /product="AgSNR40"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR40; start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <266969..>267253
FT                   /locus_tag="AGOS_AEL194WA"
FT   mRNA            <266969..>267253
FT                   /locus_tag="AGOS_AEL194WA"
FT                   /product="AEL194W-Ap"
FT   CDS_pept        266969..267253
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL194WA"
FT                   /product="AEL194W-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL109W
FT                   (ZEO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL194WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41769"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGC6"
FT                   /protein_id="ADJ41769.1"
FT   gene            <267514..>268635
FT                   /locus_tag="AGOS_AEL194W"
FT                   /old_locus_tag="AEL194W"
FT   mRNA            <267514..>268635
FT                   /locus_tag="AGOS_AEL194W"
FT                   /old_locus_tag="AEL194W"
FT                   /product="AEL194Wp"
FT   CDS_pept        267514..268635
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL194W"
FT                   /old_locus_tag="AEL194W"
FT                   /product="AEL194Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL288W
FT                   (CAF40)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL194W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52491"
FT                   /db_xref="GOA:Q758F6"
FT                   /db_xref="InterPro:IPR007216"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q758F6"
FT                   /protein_id="AAS52491.1"
FT   gene            <268941..>271739
FT                   /locus_tag="AGOS_AEL193W"
FT                   /old_locus_tag="AEL193W"
FT   mRNA            <268941..>271739
FT                   /locus_tag="AGOS_AEL193W"
FT                   /old_locus_tag="AEL193W"
FT                   /product="AEL193Wp"
FT   CDS_pept        268941..271739
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL193W"
FT                   /old_locus_tag="AEL193W"
FT                   /product="AEL193Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL287W
FT                   (SEC21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL193W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52492"
FT                   /db_xref="GOA:Q758F5"
FT                   /db_xref="InterPro:IPR002553"
FT                   /db_xref="InterPro:IPR009028"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR012295"
FT                   /db_xref="InterPro:IPR013040"
FT                   /db_xref="InterPro:IPR013041"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR017106"
FT                   /db_xref="InterPro:IPR032154"
FT                   /db_xref="InterPro:IPR037067"
FT                   /db_xref="UniProtKB/TrEMBL:Q758F5"
FT                   /protein_id="AAS52492.1"
FT                   VL"
FT   gene            complement(271895..271966)
FT                   /locus_tag="AGOS_t0101"
FT   tRNA            complement(271895..271966)
FT                   /locus_tag="AGOS_t0101"
FT                   /product="tRNA-Gly"
FT                   /note="codon recognized: GGA"
FT   gene            <272327..>273508
FT                   /locus_tag="AGOS_AEL192W"
FT                   /old_locus_tag="AEL192W"
FT   mRNA            <272327..>273508
FT                   /locus_tag="AGOS_AEL192W"
FT                   /old_locus_tag="AEL192W"
FT                   /product="AEL192Wp"
FT   CDS_pept        272327..273508
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL192W"
FT                   /old_locus_tag="AEL192W"
FT                   /product="AEL192Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR025C
FT                   (OLA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL192W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52493"
FT                   /db_xref="GOA:Q758F4"
FT                   /db_xref="InterPro:IPR004396"
FT                   /db_xref="InterPro:IPR006073"
FT                   /db_xref="InterPro:IPR012675"
FT                   /db_xref="InterPro:IPR012676"
FT                   /db_xref="InterPro:IPR013029"
FT                   /db_xref="InterPro:IPR023192"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR031167"
FT                   /db_xref="InterPro:IPR041706"
FT                   /db_xref="UniProtKB/TrEMBL:Q758F4"
FT                   /protein_id="AAS52493.1"
FT   gene            complement(<273618..>274502)
FT                   /locus_tag="AGOS_AEL191C"
FT                   /old_locus_tag="AEL191C"
FT   mRNA            complement(<273618..>274502)
FT                   /locus_tag="AGOS_AEL191C"
FT                   /old_locus_tag="AEL191C"
FT                   /product="AEL191Cp"
FT   CDS_pept        complement(273618..274502)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL191C"
FT                   /old_locus_tag="AEL191C"
FT                   /product="AEL191Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR037C
FT                   (SCO1) and YBR024W (SCO2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL191C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52494"
FT                   /db_xref="GOA:Q758F3"
FT                   /db_xref="InterPro:IPR003782"
FT                   /db_xref="InterPro:IPR013766"
FT                   /db_xref="InterPro:IPR017276"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q758F3"
FT                   /protein_id="AAS52494.2"
FT                   REKRKEKWYSFLF"
FT   gene            <275085..>277739
FT                   /locus_tag="AGOS_AEL190W"
FT                   /old_locus_tag="AEL190W"
FT   mRNA            <275085..>277739
FT                   /locus_tag="AGOS_AEL190W"
FT                   /old_locus_tag="AEL190W"
FT                   /product="AEL190Wp"
FT   CDS_pept        275085..277739
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL190W"
FT                   /old_locus_tag="AEL190W"
FT                   /product="AEL190Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR038W
FT                   (CHS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL190W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52495"
FT                   /db_xref="GOA:Q758F2"
FT                   /db_xref="InterPro:IPR004834"
FT                   /db_xref="InterPro:IPR004835"
FT                   /db_xref="InterPro:IPR013616"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q758F2"
FT                   /protein_id="AAS52495.1"
FT                   IVKWKRKSAQIAK"
FT   gene            <278326..>281757
FT                   /locus_tag="AGOS_AEL189W"
FT                   /old_locus_tag="AEL189W"
FT   mRNA            <278326..>281757
FT                   /locus_tag="AGOS_AEL189W"
FT                   /old_locus_tag="AEL189W"
FT                   /product="AEL189Wp"
FT   CDS_pept        278326..281757
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL189W"
FT                   /old_locus_tag="AEL189W"
FT                   /product="AEL189Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR023C
FT                   (CHS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL189W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52496"
FT                   /db_xref="GOA:Q758F1"
FT                   /db_xref="InterPro:IPR004835"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q758F1"
FT                   /protein_id="AAS52496.2"
FT   gene            complement(281872..281944)
FT                   /locus_tag="AGOS_t0102"
FT   tRNA            complement(281872..281944)
FT                   /locus_tag="AGOS_t0102"
FT                   /product="tRNA-Thr"
FT                   /note="codon recognized: ACU"
FT   gene            <282642..>284135
FT                   /locus_tag="AGOS_AEL188W"
FT                   /old_locus_tag="AEL188W"
FT   mRNA            <282642..>284135
FT                   /locus_tag="AGOS_AEL188W"
FT                   /old_locus_tag="AEL188W"
FT                   /product="AEL188Wp"
FT   CDS_pept        282642..284135
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL188W"
FT                   /old_locus_tag="AEL188W"
FT                   /product="AEL188Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR263W
FT                   (SHM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL188W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52497"
FT                   /db_xref="GOA:Q758F0"
FT                   /db_xref="InterPro:IPR001085"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="InterPro:IPR019798"
FT                   /db_xref="InterPro:IPR039429"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758F0"
FT                   /protein_id="AAS52497.1"
FT   gene            complement(<284212..>284838)
FT                   /locus_tag="AGOS_AEL187C"
FT                   /old_locus_tag="AEL187C"
FT   mRNA            complement(<284212..>284838)
FT                   /locus_tag="AGOS_AEL187C"
FT                   /old_locus_tag="AEL187C"
FT                   /product="AEL187Cp"
FT   CDS_pept        complement(284212..284838)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL187C"
FT                   /old_locus_tag="AEL187C"
FT                   /product="AEL187Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR264C
FT                   (YPT10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL187C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52498"
FT                   /db_xref="GOA:Q758E9"
FT                   /db_xref="InterPro:IPR001806"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q758E9"
FT                   /protein_id="AAS52498.1"
FT   gene            <285036..>290222
FT                   /locus_tag="AGOS_AEL186W"
FT                   /old_locus_tag="AEL186W"
FT   mRNA            <285036..>290222
FT                   /locus_tag="AGOS_AEL186W"
FT                   /old_locus_tag="AEL186W"
FT                   /product="AEL186Wp"
FT   CDS_pept        285036..290222
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL186W"
FT                   /old_locus_tag="AEL186W"
FT                   /product="AEL186Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR275C
FT                   (RIF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL186W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52499"
FT                   /db_xref="GOA:Q758E8"
FT                   /db_xref="InterPro:IPR022031"
FT                   /db_xref="UniProtKB/TrEMBL:Q758E8"
FT                   /protein_id="AAS52499.1"
FT   gene            complement(<290357..>291904)
FT                   /locus_tag="AGOS_AEL185C"
FT                   /old_locus_tag="AEL185C"
FT   mRNA            complement(<290357..>291904)
FT                   /locus_tag="AGOS_AEL185C"
FT                   /old_locus_tag="AEL185C"
FT                   /product="AEL185Cp"
FT   CDS_pept        complement(290357..291904)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL185C"
FT                   /old_locus_tag="AEL185C"
FT                   /product="AEL185Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR274W
FT                   (CHK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL185C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52500"
FT                   /db_xref="GOA:Q758E7"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q758E7"
FT                   /protein_id="AAS52500.1"
FT   gene            <292107..>292991
FT                   /locus_tag="AGOS_AEL184W"
FT                   /old_locus_tag="AEL184W"
FT   mRNA            <292107..>292991
FT                   /locus_tag="AGOS_AEL184W"
FT                   /old_locus_tag="AEL184W"
FT                   /product="AEL184Wp"
FT   CDS_pept        292107..292991
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL184W"
FT                   /old_locus_tag="AEL184W"
FT                   /product="AEL184Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR273C
FT                   (UBX7) and YJL048C (UBX6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL184W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52501"
FT                   /db_xref="InterPro:IPR001012"
FT                   /db_xref="InterPro:IPR029071"
FT                   /db_xref="UniProtKB/TrEMBL:Q758E6"
FT                   /protein_id="AAS52501.1"
FT                   APSARKFQSPDRR"
FT   gene            complement(<293068..>294321)
FT                   /locus_tag="AGOS_AEL183C"
FT                   /old_locus_tag="AEL183C"
FT   mRNA            complement(<293068..>294321)
FT                   /locus_tag="AGOS_AEL183C"
FT                   /old_locus_tag="AEL183C"
FT                   /product="AEL183Cp"
FT   CDS_pept        complement(293068..294321)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL183C"
FT                   /old_locus_tag="AEL183C"
FT                   /product="AEL183Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL049W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL183C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52502"
FT                   /db_xref="GOA:Q758E5"
FT                   /db_xref="InterPro:IPR005024"
FT                   /db_xref="UniProtKB/TrEMBL:Q758E5"
FT                   /protein_id="AAS52502.2"
FT                   ALARSASPAKLAEPPQTL"
FT   gene            <294427..>295854
FT                   /locus_tag="AGOS_AEL182W"
FT                   /old_locus_tag="AEL182W"
FT   mRNA            <294427..>295854
FT                   /locus_tag="AGOS_AEL182W"
FT                   /old_locus_tag="AEL182W"
FT                   /product="AEL182Wp"
FT   CDS_pept        294427..295854
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL182W"
FT                   /old_locus_tag="AEL182W"
FT                   /product="AEL182Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR272C
FT                   (HSM3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL182W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52503"
FT                   /db_xref="GOA:Q758E4"
FT                   /db_xref="InterPro:IPR040752"
FT                   /db_xref="InterPro:IPR041335"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758E4"
FT                   /protein_id="AAS52503.1"
FT                   CSGKTSFVRTEVVDMYL"
FT   gene            complement(<296010..>299225)
FT                   /locus_tag="AGOS_AEL181C"
FT                   /old_locus_tag="AEL181C"
FT   mRNA            complement(<296010..>299225)
FT                   /locus_tag="AGOS_AEL181C"
FT                   /old_locus_tag="AEL181C"
FT                   /product="AEL181Cp"
FT   CDS_pept        complement(296010..299225)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL181C"
FT                   /old_locus_tag="AEL181C"
FT                   /product="AEL181Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL050W
FT                   (MTR4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL181C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52504"
FT                   /db_xref="GOA:Q758E3"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011254"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR012961"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR016438"
FT                   /db_xref="InterPro:IPR025696"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q758E3"
FT                   /protein_id="AAS52504.2"
FT   gene            complement(<299576..>301528)
FT                   /locus_tag="AGOS_AEL180C"
FT                   /old_locus_tag="AEL180C"
FT   mRNA            complement(<299576..>301528)
FT                   /locus_tag="AGOS_AEL180C"
FT                   /old_locus_tag="AEL180C"
FT                   /product="AEL180Cp"
FT   CDS_pept        complement(299576..301528)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL180C"
FT                   /old_locus_tag="AEL180C"
FT                   /product="AEL180Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL051W
FT                   (IRC8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL180C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52505"
FT                   /db_xref="GOA:Q758D2"
FT                   /db_xref="UniProtKB/TrEMBL:Q758D2"
FT                   /protein_id="AAS52505.1"
FT                   SAERKHFLTVKSAFN"
FT   gene            <302174..>303043
FT                   /locus_tag="AGOS_AEL179W"
FT                   /old_locus_tag="AEL179W"
FT   mRNA            <302174..>303043
FT                   /locus_tag="AGOS_AEL179W"
FT                   /old_locus_tag="AEL179W"
FT                   /product="AEL179Wp"
FT   CDS_pept        302174..303043
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL179W"
FT                   /old_locus_tag="AEL179W"
FT                   /product="AEL179Wp"
FT                   /note="NOHBY510; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F01408g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL179W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52506"
FT                   /db_xref="GOA:Q758D1"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q758D1"
FT                   /protein_id="AAS52506.1"
FT                   QKFWGTYM"
FT   gene            complement(<303110..>304033)
FT                   /locus_tag="AGOS_AEL178C"
FT                   /old_locus_tag="AEL178C"
FT   mRNA            complement(<303110..>304033)
FT                   /locus_tag="AGOS_AEL178C"
FT                   /old_locus_tag="AEL178C"
FT                   /product="AEL178Cp"
FT   CDS_pept        complement(303110..304033)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL178C"
FT                   /old_locus_tag="AEL178C"
FT                   /product="AEL178Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL053W
FT                   (PEP8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL178C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52507"
FT                   /db_xref="GOA:Q758D0"
FT                   /db_xref="InterPro:IPR014752"
FT                   /db_xref="InterPro:IPR014756"
FT                   /db_xref="InterPro:IPR028934"
FT                   /db_xref="UniProtKB/TrEMBL:Q758D0"
FT                   /protein_id="AAS52507.1"
FT   gene            complement(<304264..>305682)
FT                   /locus_tag="AGOS_AEL177C"
FT                   /old_locus_tag="AEL177C"
FT   mRNA            complement(<304264..>305682)
FT                   /locus_tag="AGOS_AEL177C"
FT                   /old_locus_tag="AEL177C"
FT                   /product="AEL177Cp"
FT   CDS_pept        complement(304264..305682)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL177C"
FT                   /old_locus_tag="AEL177C"
FT                   /product="AEL177Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL054W
FT                   (TIM54)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL177C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52508"
FT                   /db_xref="GOA:Q758C9"
FT                   /db_xref="InterPro:IPR021056"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758C9"
FT                   /protein_id="AAS52508.2"
FT                   PALMADLAATMNLN"
FT   gene            complement(<306792..>307727)
FT                   /locus_tag="AGOS_AEL176C"
FT                   /old_locus_tag="AEL176C"
FT   mRNA            complement(<306792..>307727)
FT                   /locus_tag="AGOS_AEL176C"
FT                   /old_locus_tag="AEL176C"
FT                   /product="AEL176Cp"
FT   CDS_pept        complement(306792..307727)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL176C"
FT                   /old_locus_tag="AEL176C"
FT                   /product="AEL176Cp"
FT                   /note="NOHBY509; No homolog in Saccharomyces cerevisiae;
FT                   Non-syntenic homolog of Kluyveromyces lactis KLLA0D04158g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL176C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52509"
FT                   /db_xref="GOA:Q758C8"
FT                   /db_xref="InterPro:IPR001005"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR015495"
FT                   /db_xref="InterPro:IPR017930"
FT                   /db_xref="UniProtKB/TrEMBL:Q758C8"
FT                   /protein_id="AAS52509.1"
FT   gene            complement(<308933..>309640)
FT                   /locus_tag="AGOS_AEL175C"
FT                   /old_locus_tag="AEL175C"
FT   mRNA            complement(<308933..>309640)
FT                   /locus_tag="AGOS_AEL175C"
FT                   /old_locus_tag="AEL175C"
FT                   /product="AEL175Cp"
FT   CDS_pept        complement(308933..309640)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL175C"
FT                   /old_locus_tag="AEL175C"
FT                   /product="AEL175Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL055W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL175C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52510"
FT                   /db_xref="GOA:Q758C7"
FT                   /db_xref="InterPro:IPR005269"
FT                   /db_xref="InterPro:IPR031100"
FT                   /db_xref="UniProtKB/TrEMBL:Q758C7"
FT                   /protein_id="AAS52510.1"
FT                   VPDGRFNLRWADM"
FT   gene            <310175..>312160
FT                   /locus_tag="AGOS_AEL174W"
FT                   /old_locus_tag="AEL174W"
FT   mRNA            <310175..>312160
FT                   /locus_tag="AGOS_AEL174W"
FT                   /old_locus_tag="AEL174W"
FT                   /product="AEL174Wp"
FT   CDS_pept        310175..312160
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL174W"
FT                   /old_locus_tag="AEL174W"
FT                   /product="AEL174Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL056C
FT                   (ZAP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL174W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52511"
FT                   /db_xref="GOA:Q758C6"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="InterPro:IPR040792"
FT                   /db_xref="UniProtKB/TrEMBL:Q758C6"
FT                   /protein_id="AAS52511.2"
FT   gene            <312486..>314081
FT                   /locus_tag="AGOS_AEL173W"
FT                   /old_locus_tag="AEL173W"
FT   mRNA            <312486..>314081
FT                   /locus_tag="AGOS_AEL173W"
FT                   /old_locus_tag="AEL173W"
FT                   /product="AEL173Wp"
FT   CDS_pept        312486..314081
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL173W"
FT                   /old_locus_tag="AEL173W"
FT                   /product="AEL173Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL057C
FT                   (IKS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL173W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52512"
FT                   /db_xref="GOA:Q758C5"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q758C5"
FT                   /protein_id="AAS52512.1"
FT                   RPYLLAITLALFLM"
FT   gene            <314143..>315762
FT                   /locus_tag="AGOS_AEL172W"
FT                   /old_locus_tag="AEL172W"
FT   mRNA            <314143..>315762
FT                   /locus_tag="AGOS_AEL172W"
FT                   /old_locus_tag="AEL172W"
FT                   /product="AEL172Wp"
FT   CDS_pept        314143..315762
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL172W"
FT                   /old_locus_tag="AEL172W"
FT                   /product="AEL172Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR270C
FT                   (BIT2) and YJL058C (BIT61)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL172W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52513"
FT                   /db_xref="GOA:Q758C4"
FT                   /db_xref="InterPro:IPR013745"
FT                   /db_xref="UniProtKB/TrEMBL:Q758C4"
FT                   /protein_id="AAS52513.1"
FT   gene            complement(<315831..>317069)
FT                   /locus_tag="AGOS_AEL171C"
FT                   /old_locus_tag="AEL171C"
FT   mRNA            complement(<315831..>317069)
FT                   /locus_tag="AGOS_AEL171C"
FT                   /old_locus_tag="AEL171C"
FT                   /product="AEL171Cp"
FT   CDS_pept        complement(315831..317069)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL171C"
FT                   /old_locus_tag="AEL171C"
FT                   /product="AEL171Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL059W
FT                   (YHC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL171C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52514"
FT                   /db_xref="GOA:Q758C3"
FT                   /db_xref="InterPro:IPR003492"
FT                   /db_xref="InterPro:IPR018460"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758C3"
FT                   /protein_id="AAS52514.1"
FT                   HQVKTGRPWCQLE"
FT   gene            complement(<317257..>318633)
FT                   /locus_tag="AGOS_AEL170C"
FT                   /old_locus_tag="AEL170C"
FT   mRNA            complement(<317257..>318633)
FT                   /locus_tag="AGOS_AEL170C"
FT                   /old_locus_tag="AEL170C"
FT                   /product="AEL170Cp"
FT   CDS_pept        complement(317257..318633)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL170C"
FT                   /old_locus_tag="AEL170C"
FT                   /product="AEL170Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL060W
FT                   (BNA3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL170C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52515"
FT                   /db_xref="GOA:Q758C2"
FT                   /db_xref="InterPro:IPR004838"
FT                   /db_xref="InterPro:IPR004839"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="UniProtKB/TrEMBL:Q758C2"
FT                   /protein_id="AAS52515.1"
FT                   "
FT   gene            <318805..>319312
FT                   /locus_tag="AGOS_AEL169W"
FT                   /old_locus_tag="AEL169W"
FT   mRNA            join(<318805..318814,318911..>319312)
FT                   /locus_tag="AGOS_AEL169W"
FT                   /old_locus_tag="AEL169W"
FT                   /product="AEL169Wp"
FT                   /note="5'UTR intron"
FT   CDS_pept        318914..319312
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL169W"
FT                   /old_locus_tag="AEL169W"
FT                   /product="AEL169Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR269C
FT                   (FMP21); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL169W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52516"
FT                   /db_xref="GOA:Q758C1"
FT                   /db_xref="InterPro:IPR012875"
FT                   /db_xref="UniProtKB/TrEMBL:Q758C1"
FT                   /protein_id="AAS52516.1"
FT   gene            complement(<319346..>321367)
FT                   /locus_tag="AGOS_AEL168C"
FT                   /old_locus_tag="AEL168C"
FT   mRNA            complement(<319346..>321367)
FT                   /locus_tag="AGOS_AEL168C"
FT                   /old_locus_tag="AEL168C"
FT                   /product="AEL168Cp"
FT   CDS_pept        complement(319346..321367)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL168C"
FT                   /old_locus_tag="AEL168C"
FT                   /product="AEL168Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL061W
FT                   (NUP82)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL168C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52517"
FT                   /db_xref="GOA:Q758C0"
FT                   /db_xref="InterPro:IPR011044"
FT                   /db_xref="InterPro:IPR037700"
FT                   /db_xref="UniProtKB/TrEMBL:Q758C0"
FT                   /protein_id="AAS52517.2"
FT   gene            complement(<321588..>321893)
FT                   /locus_tag="AGOS_AEL167C"
FT                   /old_locus_tag="AEL167C"
FT   mRNA            complement(<321588..>321893)
FT                   /locus_tag="AGOS_AEL167C"
FT                   /old_locus_tag="AEL167C"
FT                   /product="AEL167Cp"
FT   CDS_pept        complement(321588..321893)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL167C"
FT                   /old_locus_tag="AEL167C"
FT                   /product="AEL167Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR268W
FT                   (MRPL37)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL167C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52518"
FT                   /db_xref="GOA:Q758B9"
FT                   /db_xref="InterPro:IPR013870"
FT                   /db_xref="UniProtKB/TrEMBL:Q758B9"
FT                   /protein_id="AAS52518.1"
FT   gene            complement(<322078..>324498)
FT                   /locus_tag="AGOS_AEL166C"
FT                   /old_locus_tag="AEL166C"
FT   mRNA            complement(<322078..>324498)
FT                   /locus_tag="AGOS_AEL166C"
FT                   /old_locus_tag="AEL166C"
FT                   /product="AEL166Cp"
FT   CDS_pept        complement(322078..324498)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL166C"
FT                   /old_locus_tag="AEL166C"
FT                   /product="AEL166Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL062W
FT                   (LAS21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL166C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52519"
FT                   /db_xref="GOA:Q758B8"
FT                   /db_xref="InterPro:IPR002591"
FT                   /db_xref="InterPro:IPR017850"
FT                   /db_xref="InterPro:IPR037674"
FT                   /db_xref="InterPro:IPR039527"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758B8"
FT                   /protein_id="AAS52519.2"
FT   gene            complement(<324648..>325796)
FT                   /locus_tag="AGOS_AEL165C"
FT                   /old_locus_tag="AEL165C"
FT   mRNA            complement(<324648..>325796)
FT                   /locus_tag="AGOS_AEL165C"
FT                   /old_locus_tag="AEL165C"
FT                   /product="AEL165Cp"
FT   CDS_pept        complement(324648..325796)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL165C"
FT                   /old_locus_tag="AEL165C"
FT                   /product="AEL165Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR267W
FT                   (REI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL165C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52520"
FT                   /db_xref="GOA:Q758B7"
FT                   /db_xref="InterPro:IPR003604"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="InterPro:IPR040025"
FT                   /db_xref="InterPro:IPR041661"
FT                   /db_xref="UniProtKB/TrEMBL:Q758B7"
FT                   /protein_id="AAS52520.1"
FT   gene            complement(<326059..>326982)
FT                   /locus_tag="AGOS_AEL164C"
FT                   /old_locus_tag="AEL164C"
FT   mRNA            complement(<326059..>326982)
FT                   /locus_tag="AGOS_AEL164C"
FT                   /old_locus_tag="AEL164C"
FT                   /product="AEL164Cp"
FT   CDS_pept        complement(326059..326982)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL164C"
FT                   /old_locus_tag="AEL164C"
FT                   /product="AEL164Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR265W
FT                   (TSC10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL164C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52521"
FT                   /db_xref="GOA:Q758B6"
FT                   /db_xref="InterPro:IPR002347"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758B6"
FT                   /protein_id="AAS52521.1"
FT   gene            complement(<327149..>327418)
FT                   /locus_tag="AGOS_AEL163C"
FT                   /old_locus_tag="AEL163C"
FT   mRNA            complement(<327149..>327418)
FT                   /locus_tag="AGOS_AEL163C"
FT                   /old_locus_tag="AEL163C"
FT                   /product="AEL163Cp"
FT   CDS_pept        complement(327149..327418)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL163C"
FT                   /old_locus_tag="AEL163C"
FT                   /product="AEL163Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL062W-A (COA3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL163C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52522"
FT                   /db_xref="GOA:Q758B5"
FT                   /db_xref="InterPro:IPR041752"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758B5"
FT                   /protein_id="AAS52522.1"
FT   gene            <327583..>328293
FT                   /locus_tag="AGOS_AEL162W"
FT                   /old_locus_tag="AEL162W"
FT   mRNA            <327583..>328293
FT                   /locus_tag="AGOS_AEL162W"
FT                   /old_locus_tag="AEL162W"
FT                   /product="AEL162Wp"
FT   CDS_pept        327583..328293
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL162W"
FT                   /old_locus_tag="AEL162W"
FT                   /product="AEL162Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL063C
FT                   (MRPL8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL162W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52523"
FT                   /db_xref="GOA:Q758B4"
FT                   /db_xref="InterPro:IPR000456"
FT                   /db_xref="InterPro:IPR036373"
FT                   /db_xref="InterPro:IPR040894"
FT                   /db_xref="UniProtKB/TrEMBL:Q758B4"
FT                   /protein_id="AAS52523.1"
FT                   ARKRYEFAPRPARN"
FT   gene            <328508..>329578
FT                   /locus_tag="AGOS_AEL161W"
FT                   /old_locus_tag="AEL161W"
FT   mRNA            <328508..>329578
FT                   /locus_tag="AGOS_AEL161W"
FT                   /old_locus_tag="AEL161W"
FT                   /product="AEL161Wp"
FT   CDS_pept        328508..329578
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL161W"
FT                   /old_locus_tag="AEL161W"
FT                   /product="AEL161Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YGR012W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL161W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52524"
FT                   /db_xref="GOA:Q758B3"
FT                   /db_xref="InterPro:IPR001216"
FT                   /db_xref="InterPro:IPR001926"
FT                   /db_xref="InterPro:IPR036052"
FT                   /db_xref="UniProtKB/TrEMBL:Q758B3"
FT                   /protein_id="AAS52524.1"
FT                   LYDEIPDSLKKYVTLE"
FT   gene            complement(<329648..>332029)
FT                   /locus_tag="AGOS_AEL160C"
FT                   /old_locus_tag="AEL160C"
FT   mRNA            complement(<329648..>332029)
FT                   /locus_tag="AGOS_AEL160C"
FT                   /old_locus_tag="AEL160C"
FT                   /product="AEL160Cp"
FT   CDS_pept        complement(329648..332029)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL160C"
FT                   /old_locus_tag="AEL160C"
FT                   /product="AEL160Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR276C
FT                   (PPS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL160C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52525"
FT                   /db_xref="GOA:Q758B2"
FT                   /db_xref="InterPro:IPR000340"
FT                   /db_xref="InterPro:IPR000387"
FT                   /db_xref="InterPro:IPR016130"
FT                   /db_xref="InterPro:IPR020422"
FT                   /db_xref="InterPro:IPR029021"
FT                   /db_xref="UniProtKB/TrEMBL:Q758B2"
FT                   /protein_id="AAS52525.1"
FT   gene            <332422..>332973
FT                   /locus_tag="AGOS_AEL159W"
FT                   /old_locus_tag="AEL159W"
FT   mRNA            <332422..>332973
FT                   /locus_tag="AGOS_AEL159W"
FT                   /old_locus_tag="AEL159W"
FT                   /product="AEL159Wp"
FT   CDS_pept        332422..332973
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL159W"
FT                   /old_locus_tag="AEL159W"
FT                   /product="AEL159Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL065C
FT                   (DLS1) and YBR278W (DPB3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL159W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52526"
FT                   /db_xref="GOA:Q758B1"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="UniProtKB/TrEMBL:Q758B1"
FT                   /protein_id="AAS52526.1"
FT   gene            <333130..>334077
FT                   /locus_tag="AGOS_AEL158W"
FT                   /old_locus_tag="AEL158W"
FT   mRNA            <333130..>334077
FT                   /locus_tag="AGOS_AEL158W"
FT                   /old_locus_tag="AEL158W"
FT                   /product="AEL158Wp"
FT   CDS_pept        333130..334077
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL158W"
FT                   /old_locus_tag="AEL158W"
FT                   /product="AEL158Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL066C
FT                   (MPM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL158W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52527"
FT                   /db_xref="InterPro:IPR035187"
FT                   /db_xref="UniProtKB/TrEMBL:Q758B0"
FT                   /protein_id="AAS52527.2"
FT   gene            <334437..>335672
FT                   /locus_tag="AGOS_AEL157W"
FT                   /old_locus_tag="AEL157W"
FT   mRNA            <334437..>335672
FT                   /locus_tag="AGOS_AEL157W"
FT                   /old_locus_tag="AEL157W"
FT                   /product="AEL157Wp"
FT   CDS_pept        334437..335672
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL157W"
FT                   /old_locus_tag="AEL157W"
FT                   /product="AEL157Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR279W
FT                   (PAF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL157W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52528"
FT                   /db_xref="GOA:Q758A9"
FT                   /db_xref="InterPro:IPR007133"
FT                   /db_xref="UniProtKB/TrEMBL:Q758A9"
FT                   /protein_id="AAS52528.2"
FT                   SLKATEEQDAPM"
FT   gene            <336243..>337148
FT                   /locus_tag="AGOS_AEL156W"
FT                   /old_locus_tag="AEL156W"
FT   mRNA            <336243..>337148
FT                   /locus_tag="AGOS_AEL156W"
FT                   /old_locus_tag="AEL156W"
FT                   /product="AEL156Wp"
FT   CDS_pept        336243..337148
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL156W"
FT                   /old_locus_tag="AEL156W"
FT                   /product="AEL156Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL068C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL156W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52529"
FT                   /db_xref="GOA:Q758A8"
FT                   /db_xref="InterPro:IPR000801"
FT                   /db_xref="InterPro:IPR014186"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/TrEMBL:Q758A8"
FT                   /protein_id="AAS52529.1"
FT   gene            complement(<337207..>339003)
FT                   /locus_tag="AGOS_AEL155C"
FT                   /old_locus_tag="AEL155C"
FT   mRNA            complement(<337207..>339003)
FT                   /locus_tag="AGOS_AEL155C"
FT                   /old_locus_tag="AEL155C"
FT                   /product="AEL155Cp"
FT   CDS_pept        complement(337207..339003)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL155C"
FT                   /old_locus_tag="AEL155C"
FT                   /product="AEL155Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR280C
FT                   (SAF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL155C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52530"
FT                   /db_xref="GOA:Q758A7"
FT                   /db_xref="InterPro:IPR000408"
FT                   /db_xref="InterPro:IPR001810"
FT                   /db_xref="InterPro:IPR009091"
FT                   /db_xref="InterPro:IPR036047"
FT                   /db_xref="UniProtKB/TrEMBL:Q758A7"
FT                   /protein_id="AAS52530.1"
FT   gene            complement(<339187..>341853)
FT                   /locus_tag="AGOS_AEL154C"
FT                   /old_locus_tag="AEL154C"
FT   mRNA            complement(<339187..>341853)
FT                   /locus_tag="AGOS_AEL154C"
FT                   /old_locus_tag="AEL154C"
FT                   /product="AEL154Cp"
FT   CDS_pept        complement(339187..341853)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL154C"
FT                   /old_locus_tag="AEL154C"
FT                   /product="AEL154Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR281C
FT                   (DUG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL154C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52531"
FT                   /db_xref="GOA:Q758A6"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR002933"
FT                   /db_xref="InterPro:IPR011650"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017149"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q758A6"
FT                   /protein_id="AAS52531.1"
FT                   KNWYNMRAILTKVFNRL"
FT   gene            <342472..>344175
FT                   /locus_tag="AGOS_AEL153W"
FT                   /old_locus_tag="AEL153W"
FT   mRNA            <342472..>344175
FT                   /locus_tag="AGOS_AEL153W"
FT                   /old_locus_tag="AEL153W"
FT                   /product="AEL153Wp"
FT   CDS_pept        342472..344175
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL153W"
FT                   /old_locus_tag="AEL153W"
FT                   /product="AEL153Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL069C
FT                   (UTP18)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL153W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52532"
FT                   /db_xref="GOA:Q758A5"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q758A5"
FT                   /protein_id="AAS52532.1"
FT   gene            344513..344570
FT                   /locus_tag="AGOS_AgSNR189"
FT                   /old_locus_tag="AgSNR189"
FT   ncRNA           344513..344570
FT                   /locus_tag="AGOS_AgSNR189"
FT                   /old_locus_tag="AgSNR189"
FT                   /product="AgSNR189"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR189; start and end coordinates are approximate;
FT                   similarity is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            <344968..>345759
FT                   /locus_tag="AGOS_AEL152W"
FT                   /old_locus_tag="AEL152W"
FT   mRNA            join(<344968..344977,345353..>345759)
FT                   /locus_tag="AGOS_AEL152W"
FT                   /old_locus_tag="AEL152W"
FT                   /product="AEL152Wp"
FT   CDS_pept        join(344968..344977,345353..345759)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL152W"
FT                   /old_locus_tag="AEL152W"
FT                   /product="AEL152Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL191W
FT                   (RPS14B) and YCR031C (RPS14A); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL152W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52533"
FT                   /db_xref="GOA:Q758E0"
FT                   /db_xref="InterPro:IPR001971"
FT                   /db_xref="InterPro:IPR018102"
FT                   /db_xref="InterPro:IPR036967"
FT                   /db_xref="UniProtKB/TrEMBL:Q758E0"
FT                   /protein_id="AAS52533.1"
FT   gene            complement(<345944..>346336)
FT                   /locus_tag="AGOS_AEL151C"
FT                   /old_locus_tag="AEL151C"
FT   mRNA            complement(<345944..>346336)
FT                   /locus_tag="AGOS_AEL151C"
FT                   /old_locus_tag="AEL151C"
FT                   /product="AEL151Cp"
FT   CDS_pept        complement(345944..346336)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL151C"
FT                   /old_locus_tag="AEL151C"
FT                   /product="AEL151Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL190C
FT                   (RPS22A)"
FT                   /db_xref="GOA:Q752J5"
FT                   /db_xref="InterPro:IPR000630"
FT                   /db_xref="InterPro:IPR035987"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q752J5"
FT                   /protein_id="AAS52534.1"
FT   gene            <346738..>347042
FT                   /locus_tag="AGOS_AEL150W"
FT                   /old_locus_tag="AEL150W"
FT   mRNA            join(<346738..346743,346893..>347042)
FT                   /locus_tag="AGOS_AEL150W"
FT                   /old_locus_tag="AEL150W"
FT                   /product="AEL150Wp"
FT   CDS_pept        join(346738..346743,346893..347042)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL150W"
FT                   /old_locus_tag="AEL150W"
FT                   /product="AEL150Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL189W
FT                   (RPL39); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL150W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52535"
FT                   /db_xref="GOA:Q758D8"
FT                   /db_xref="InterPro:IPR000077"
FT                   /db_xref="InterPro:IPR020083"
FT                   /db_xref="InterPro:IPR023626"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758D8"
FT                   /protein_id="AAS52535.1"
FT                   RTKMGI"
FT   gene            complement(347175..347264)
FT                   /locus_tag="AGOS_AgSNR65"
FT                   /old_locus_tag="AgSNR65"
FT   ncRNA           complement(347175..347264)
FT                   /locus_tag="AGOS_AgSNR65"
FT                   /old_locus_tag="AgSNR65"
FT                   /product="AgSNR65"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR65; start and end coordinates are approximate;
FT                   similarity is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<347575..>349758)
FT                   /locus_tag="AGOS_AEL149C"
FT                   /old_locus_tag="AEL149C"
FT   mRNA            complement(<347575..>349758)
FT                   /locus_tag="AGOS_AEL149C"
FT                   /old_locus_tag="AEL149C"
FT                   /product="AEL149Cp"
FT   CDS_pept        complement(347575..349758)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL149C"
FT                   /old_locus_tag="AEL149C"
FT                   /product="AEL149Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL187C
FT                   (SWE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL149C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52536"
FT                   /db_xref="GOA:Q758D5"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q758D5"
FT                   /protein_id="AAS52536.1"
FT   gene            <350314..>352035
FT                   /locus_tag="AGOS_AEL148W"
FT                   /old_locus_tag="AEL148W"
FT   mRNA            <350314..>352035
FT                   /locus_tag="AGOS_AEL148W"
FT                   /old_locus_tag="AEL148W"
FT                   /product="AEL148Wp"
FT   CDS_pept        350314..352035
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL148W"
FT                   /old_locus_tag="AEL148W"
FT                   /product="AEL148Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL186W
FT                   (MNN5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL148W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52537"
FT                   /db_xref="GOA:Q758D4"
FT                   /db_xref="InterPro:IPR022751"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q758D4"
FT                   /protein_id="AAS52537.2"
FT   gene            <352298..>354760
FT                   /locus_tag="AGOS_AEL147W"
FT                   /old_locus_tag="AEL147W"
FT   mRNA            <352298..>354760
FT                   /locus_tag="AGOS_AEL147W"
FT                   /old_locus_tag="AEL147W"
FT                   /product="AEL147Wp"
FT   CDS_pept        352298..354760
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL147W"
FT                   /old_locus_tag="AEL147W"
FT                   /product="AEL147Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR030C
FT                   (SYP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL147W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52538"
FT                   /db_xref="GOA:Q758D3"
FT                   /db_xref="InterPro:IPR018808"
FT                   /db_xref="InterPro:IPR027267"
FT                   /db_xref="InterPro:IPR028565"
FT                   /db_xref="UniProtKB/TrEMBL:Q758D3"
FT                   /protein_id="AAS52538.1"
FT                   GAYYGLST"
FT   gene            complement(<354986..>355915)
FT                   /locus_tag="AGOS_AEL146C"
FT                   /old_locus_tag="AEL146C"
FT   mRNA            complement(<354986..>355915)
FT                   /locus_tag="AGOS_AEL146C"
FT                   /old_locus_tag="AEL146C"
FT                   /product="AEL146Cp"
FT   CDS_pept        complement(354986..355915)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL146C"
FT                   /old_locus_tag="AEL146C"
FT                   /product="AEL146Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL185C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL146C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52539"
FT                   /db_xref="UniProtKB/TrEMBL:Q758D7"
FT                   /protein_id="AAS52539.1"
FT   gene            <356465..>356944
FT                   /locus_tag="AGOS_AEL145W"
FT                   /old_locus_tag="AEL145W"
FT   mRNA            join(<356465..356700,356748..356836,356886..>356944)
FT                   /locus_tag="AGOS_AEL145W"
FT                   /old_locus_tag="AEL145W"
FT                   /product="AEL145Wp"
FT   CDS_pept        join(356465..356700,356748..356836,356886..356944)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL145W"
FT                   /old_locus_tag="AEL145W"
FT                   /product="AEL145Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YCR028C-A (RIM1); 2-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL145W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52540"
FT                   /db_xref="GOA:Q758D6"
FT                   /db_xref="InterPro:IPR000424"
FT                   /db_xref="InterPro:IPR011344"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="UniProtKB/TrEMBL:Q758D6"
FT                   /protein_id="AAS52540.2"
FT   gene            <357311..>357652
FT                   /locus_tag="AGOS_AEL144W"
FT                   /old_locus_tag="AEL144W"
FT   mRNA            <357311..>357652
FT                   /locus_tag="AGOS_AEL144W"
FT                   /old_locus_tag="AEL144W"
FT                   /product="AEL144Wp"
FT   CDS_pept        357311..357652
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL144W"
FT                   /old_locus_tag="AEL144W"
FT                   /product="AEL144Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL184W
FT                   (GON7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL144W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52541"
FT                   /db_xref="GOA:Q758A4"
FT                   /db_xref="InterPro:IPR014849"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758A4"
FT                   /protein_id="AAS52541.1"
FT                   RATGGSTAA"
FT   gene            <357761..>359320
FT                   /locus_tag="AGOS_AEL143W"
FT                   /old_locus_tag="AEL143W"
FT   mRNA            <357761..>359320
FT                   /locus_tag="AGOS_AEL143W"
FT                   /old_locus_tag="AEL143W"
FT                   /product="AEL143Wp"
FT   CDS_pept        357761..359320
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL143W"
FT                   /old_locus_tag="AEL143W"
FT                   /product="AEL143Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR028C
FT                   (FEN2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL143W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52542"
FT                   /db_xref="GOA:Q758A3"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q758A3"
FT                   /protein_id="AAS52542.2"
FT                   SP"
FT   gene            <359614..>360852
FT                   /locus_tag="AGOS_AEL142W"
FT                   /old_locus_tag="AEL142W"
FT   mRNA            <359614..>360852
FT                   /locus_tag="AGOS_AEL142W"
FT                   /old_locus_tag="AEL142W"
FT                   /product="AEL142Wp"
FT   CDS_pept        359614..360852
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL142W"
FT                   /old_locus_tag="AEL142W"
FT                   /product="AEL142Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL183W
FT                   (MNN11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL142W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52543"
FT                   /db_xref="GOA:Q758A2"
FT                   /db_xref="InterPro:IPR008630"
FT                   /db_xref="UniProtKB/TrEMBL:Q758A2"
FT                   /protein_id="AAS52543.1"
FT                   PADIEKFSTKKSS"
FT   gene            <361378..>363000
FT                   /locus_tag="AGOS_AEL141W"
FT                   /old_locus_tag="AEL141W"
FT   mRNA            <361378..>363000
FT                   /locus_tag="AGOS_AEL141W"
FT                   /old_locus_tag="AEL141W"
FT                   /product="AEL141Wp"
FT   CDS_pept        361378..363000
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL141W"
FT                   /old_locus_tag="AEL141W"
FT                   /product="AEL141Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YJR030C and Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL181W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL141W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52544"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q758A1"
FT                   /protein_id="AAS52544.2"
FT   gene            complement(<363224..>364192)
FT                   /locus_tag="AGOS_AEL140C"
FT                   /old_locus_tag="AEL140C"
FT   mRNA            complement(<363224..>364192)
FT                   /locus_tag="AGOS_AEL140C"
FT                   /old_locus_tag="AEL140C"
FT                   /product="AEL140Cp"
FT   CDS_pept        complement(363224..364192)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL140C"
FT                   /old_locus_tag="AEL140C"
FT                   /product="AEL140Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL180C
FT                   (ATP12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL140C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52545"
FT                   /db_xref="GOA:Q758A0"
FT                   /db_xref="InterPro:IPR011419"
FT                   /db_xref="InterPro:IPR023335"
FT                   /db_xref="InterPro:IPR042272"
FT                   /db_xref="UniProtKB/TrEMBL:Q758A0"
FT                   /protein_id="AAS52545.1"
FT   gene            <364312..>364650
FT                   /locus_tag="AGOS_AEL139W"
FT                   /old_locus_tag="AEL139W"
FT   mRNA            <364312..>364650
FT                   /locus_tag="AGOS_AEL139W"
FT                   /old_locus_tag="AEL139W"
FT                   /product="AEL139Wp"
FT   CDS_pept        364312..364650
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL139W"
FT                   /old_locus_tag="AEL139W"
FT                   /product="AEL139Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL179W
FT                   (PFD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL139W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52546"
FT                   /db_xref="GOA:Q757Z9"
FT                   /db_xref="InterPro:IPR002777"
FT                   /db_xref="InterPro:IPR009053"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Z9"
FT                   /protein_id="AAS52546.1"
FT                   ALKKAVQR"
FT   gene            complement(<364717..>365472)
FT                   /locus_tag="AGOS_AEL138C"
FT                   /old_locus_tag="AEL138C"
FT   mRNA            complement(<364717..>365472)
FT                   /locus_tag="AGOS_AEL138C"
FT                   /old_locus_tag="AEL138C"
FT                   /product="AEL138Cp"
FT   CDS_pept        complement(364717..365472)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL138C"
FT                   /old_locus_tag="AEL138C"
FT                   /product="AEL138Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL178C
FT                   (ATG27)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL138C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52547"
FT                   /db_xref="GOA:Q757Z8"
FT                   /db_xref="InterPro:IPR018939"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757Z8"
FT                   /protein_id="AAS52547.2"
FT   gene            <365895..>366449
FT                   /locus_tag="AGOS_AEL137W"
FT                   /old_locus_tag="AEL137W"
FT   mRNA            <365895..>366449
FT                   /locus_tag="AGOS_AEL137W"
FT                   /old_locus_tag="AEL137W"
FT                   /product="AEL137Wp"
FT   CDS_pept        365895..366449
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL137W"
FT                   /old_locus_tag="AEL137W"
FT                   /product="AEL137Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL180W
FT                   (RPL17A) and YJL177W (RPL17B)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL137W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52548"
FT                   /db_xref="GOA:Q757Z7"
FT                   /db_xref="InterPro:IPR001063"
FT                   /db_xref="InterPro:IPR005721"
FT                   /db_xref="InterPro:IPR018260"
FT                   /db_xref="InterPro:IPR036394"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Z7"
FT                   /protein_id="AAS52548.2"
FT   gene            complement(<366664..>368592)
FT                   /locus_tag="AGOS_AEL136C"
FT                   /old_locus_tag="AEL136C"
FT   mRNA            complement(<366664..>368592)
FT                   /locus_tag="AGOS_AEL136C"
FT                   /old_locus_tag="AEL136C"
FT                   /product="AEL136Cp"
FT   CDS_pept        complement(366664..368592)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL136C"
FT                   /old_locus_tag="AEL136C"
FT                   /product="AEL136Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL179C
FT                   (COY1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL136C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52549"
FT                   /db_xref="GOA:Q757Z6"
FT                   /db_xref="InterPro:IPR012955"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Z6"
FT                   /protein_id="AAS52549.1"
FT                   ATRAVGM"
FT   gene            complement(<368960..>371023)
FT                   /locus_tag="AGOS_AEL135C"
FT                   /old_locus_tag="AEL135C"
FT   mRNA            complement(<368960..>371023)
FT                   /locus_tag="AGOS_AEL135C"
FT                   /old_locus_tag="AEL135C"
FT                   /product="AEL135Cp"
FT   CDS_pept        complement(368960..371023)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL135C"
FT                   /old_locus_tag="AEL135C"
FT                   /product="AEL135Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL176C
FT                   (SWI3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL135C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52550"
FT                   /db_xref="GOA:Q757Z5"
FT                   /db_xref="InterPro:IPR001005"
FT                   /db_xref="InterPro:IPR007526"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR017884"
FT                   /db_xref="InterPro:IPR032451"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Z5"
FT                   /protein_id="AAS52550.2"
FT   gene            <371713..>372555
FT                   /locus_tag="AGOS_AEL134W"
FT                   /old_locus_tag="AEL134W"
FT   mRNA            <371713..>372555
FT                   /locus_tag="AGOS_AEL134W"
FT                   /old_locus_tag="AEL134W"
FT                   /product="AEL134Wp"
FT   CDS_pept        371713..372555
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL134W"
FT                   /old_locus_tag="AEL134W"
FT                   /product="AEL134Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL174W
FT                   (KRE9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL134W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52551"
FT                   /db_xref="GOA:Q757Z4"
FT                   /db_xref="InterPro:IPR008659"
FT                   /db_xref="InterPro:IPR018466"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Z4"
FT                   /protein_id="AAS52551.2"
FT   gene            complement(<372632..>372982)
FT                   /locus_tag="AGOS_AEL133C"
FT                   /old_locus_tag="AEL133C"
FT   mRNA            complement(<372632..>372982)
FT                   /locus_tag="AGOS_AEL133C"
FT                   /old_locus_tag="AEL133C"
FT                   /product="AEL133Cp"
FT   CDS_pept        complement(372632..372982)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL133C"
FT                   /old_locus_tag="AEL133C"
FT                   /product="AEL133Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL173C
FT                   (RFA3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL133C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52552"
FT                   /db_xref="GOA:Q757Z3"
FT                   /db_xref="InterPro:IPR013970"
FT                   /db_xref="InterPro:IPR016588"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Z3"
FT                   /protein_id="AAS52552.1"
FT                   LQQLCSKFPEMY"
FT   gene            complement(<373295..>373948)
FT                   /locus_tag="AGOS_AEL133CA"
FT   mRNA            complement(<373295..>373948)
FT                   /locus_tag="AGOS_AEL133CA"
FT                   /product="AEL133C-Ap"
FT   CDS_pept        complement(373295..373948)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL133CA"
FT                   /product="AEL133C-Ap"
FT                   /note="NOHBY537; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL133CA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41770"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGC7"
FT                   /protein_id="ADJ41770.1"
FT   gene            <374828..>376546
FT                   /locus_tag="AGOS_AEL132W"
FT                   /old_locus_tag="AEL132W"
FT   mRNA            <374828..>376546
FT                   /locus_tag="AGOS_AEL132W"
FT                   /old_locus_tag="AEL132W"
FT                   /product="AEL132Wp"
FT   CDS_pept        374828..376546
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL132W"
FT                   /old_locus_tag="AEL132W"
FT                   /product="AEL132Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL172W
FT                   (CPS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL132W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52553"
FT                   /db_xref="GOA:Q757Z2"
FT                   /db_xref="InterPro:IPR001261"
FT                   /db_xref="InterPro:IPR002933"
FT                   /db_xref="InterPro:IPR011650"
FT                   /db_xref="InterPro:IPR017141"
FT                   /db_xref="InterPro:IPR036264"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Z2"
FT                   /protein_id="AAS52553.1"
FT   gene            complement(<376667..>378034)
FT                   /locus_tag="AGOS_AEL131C"
FT                   /old_locus_tag="AEL131C"
FT   mRNA            complement(<376667..>378034)
FT                   /locus_tag="AGOS_AEL131C"
FT                   /old_locus_tag="AEL131C"
FT                   /product="AEL131Cp"
FT   CDS_pept        complement(376667..378034)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL131C"
FT                   /old_locus_tag="AEL131C"
FT                   /product="AEL131Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL178C
FT                   (STE3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL131C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52554"
FT                   /db_xref="GOA:Q757Z1"
FT                   /db_xref="InterPro:IPR001499"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Z1"
FT                   /protein_id="AAS52554.1"
FT   gene            complement(<378403..>379623)
FT                   /locus_tag="AGOS_AEL130C"
FT                   /old_locus_tag="AEL130C"
FT   mRNA            complement(<378403..>379623)
FT                   /locus_tag="AGOS_AEL130C"
FT                   /old_locus_tag="AEL130C"
FT                   /product="AEL130Cp"
FT   CDS_pept        complement(378403..379623)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL130C"
FT                   /old_locus_tag="AEL130C"
FT                   /product="AEL130Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL171C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL130C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52555"
FT                   /db_xref="GOA:Q757Z0"
FT                   /db_xref="InterPro:IPR018805"
FT                   /db_xref="InterPro:IPR018807"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Z0"
FT                   /protein_id="AAS52555.2"
FT                   SLVYLII"
FT   gene            complement(<380043..>380618)
FT                   /locus_tag="AGOS_AEL129C"
FT                   /old_locus_tag="AEL129C"
FT   mRNA            complement(<380043..>380618)
FT                   /locus_tag="AGOS_AEL129C"
FT                   /old_locus_tag="AEL129C"
FT                   /product="AEL129Cp"
FT   CDS_pept        complement(380043..380618)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL129C"
FT                   /old_locus_tag="AEL129C"
FT                   /product="AEL129Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL170C
FT                   (ASG7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL129C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52556"
FT                   /db_xref="GOA:Q757Y9"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Y9"
FT                   /protein_id="AAS52556.1"
FT   gene            complement(<380885..>382939)
FT                   /locus_tag="AGOS_AEL128C"
FT                   /old_locus_tag="AEL128C"
FT   mRNA            complement(<380885..>382939)
FT                   /locus_tag="AGOS_AEL128C"
FT                   /old_locus_tag="AEL128C"
FT                   /product="AEL128Cp"
FT   CDS_pept        complement(380885..382939)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL128C"
FT                   /old_locus_tag="AEL128C"
FT                   /product="AEL128Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL168C
FT                   (SET2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL128C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52557"
FT                   /db_xref="GOA:Q757Y8"
FT                   /db_xref="InterPro:IPR001202"
FT                   /db_xref="InterPro:IPR001214"
FT                   /db_xref="InterPro:IPR003616"
FT                   /db_xref="InterPro:IPR006560"
FT                   /db_xref="InterPro:IPR013257"
FT                   /db_xref="InterPro:IPR025788"
FT                   /db_xref="InterPro:IPR036020"
FT                   /db_xref="InterPro:IPR038190"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757Y8"
FT                   /protein_id="AAS52557.2"
FT   gene            complement(<383265..>385340)
FT                   /locus_tag="AGOS_AEL127C"
FT                   /old_locus_tag="AEL127C"
FT   mRNA            complement(<383265..>385340)
FT                   /locus_tag="AGOS_AEL127C"
FT                   /old_locus_tag="AEL127C"
FT                   /product="AEL127Cp"
FT   CDS_pept        complement(383265..385340)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL127C"
FT                   /old_locus_tag="AEL127C"
FT                   /product="AEL127Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL176C
FT                   (LST4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL127C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52558"
FT                   /db_xref="GOA:Q757Y7"
FT                   /db_xref="InterPro:IPR037545"
FT                   /db_xref="InterPro:IPR041153"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757Y7"
FT                   /protein_id="AAS52558.2"
FT   gene            <385617..>386819
FT                   /locus_tag="AGOS_AEL126W"
FT                   /old_locus_tag="AEL126W"
FT   mRNA            <385617..>386819
FT                   /locus_tag="AGOS_AEL126W"
FT                   /old_locus_tag="AEL126W"
FT                   /product="AEL126Wp"
FT   CDS_pept        385617..386819
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL126W"
FT                   /old_locus_tag="AEL126W"
FT                   /product="AEL126Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL175W
FT                   (ZRT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL126W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52559"
FT                   /db_xref="GOA:Q757Y6"
FT                   /db_xref="InterPro:IPR003689"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Y6"
FT                   /protein_id="AAS52559.2"
FT                   S"
FT   gene            complement(<386970..>388697)
FT                   /locus_tag="AGOS_AEL125C"
FT                   /old_locus_tag="AEL125C"
FT   mRNA            complement(<386970..>388697)
FT                   /locus_tag="AGOS_AEL125C"
FT                   /old_locus_tag="AEL125C"
FT                   /product="AEL125Cp"
FT   CDS_pept        complement(386970..388697)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL125C"
FT                   /old_locus_tag="AEL125C"
FT                   /product="AEL125Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL174C
FT                   (TPO5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL125C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52560"
FT                   /db_xref="GOA:Q757Y5"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Y5"
FT                   /protein_id="AAS52560.1"
FT   gene            <389294..>392116
FT                   /locus_tag="AGOS_AEL124W"
FT                   /old_locus_tag="AEL124W"
FT   mRNA            <389294..>392116
FT                   /locus_tag="AGOS_AEL124W"
FT                   /old_locus_tag="AEL124W"
FT                   /product="AEL124Wp"
FT   CDS_pept        389294..392116
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL124W"
FT                   /old_locus_tag="AEL124W"
FT                   /product="AEL124Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL173W
FT                   (SNU114)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL124W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52561"
FT                   /db_xref="GOA:Q757Y4"
FT                   /db_xref="InterPro:IPR000640"
FT                   /db_xref="InterPro:IPR000795"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR005517"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR035647"
FT                   /db_xref="InterPro:IPR035655"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Y4"
FT                   /protein_id="AAS52561.1"
FT                   YAKLRERGLV"
FT   gene            <392304..>393491
FT                   /locus_tag="AGOS_AEL123W"
FT                   /old_locus_tag="AEL123W"
FT   mRNA            <392304..>393491
FT                   /locus_tag="AGOS_AEL123W"
FT                   /old_locus_tag="AEL123W"
FT                   /product="AEL123Wp"
FT   CDS_pept        392304..393491
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL123W"
FT                   /old_locus_tag="AEL123W"
FT                   /product="AEL123Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL172W
FT                   (EBP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL123W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52562"
FT                   /db_xref="GOA:Q757Y3"
FT                   /db_xref="InterPro:IPR008610"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Y3"
FT                   /protein_id="AAS52562.2"
FT   gene            <393863..>394918
FT                   /locus_tag="AGOS_AEL122W"
FT                   /old_locus_tag="AEL122W"
FT   mRNA            <393863..>394918
FT                   /locus_tag="AGOS_AEL122W"
FT                   /old_locus_tag="AEL122W"
FT                   /product="AEL122Wp"
FT   CDS_pept        393863..394918
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL122W"
FT                   /old_locus_tag="AEL122W"
FT                   /product="AEL122Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL167W
FT                   (ERG20)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL122W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52563"
FT                   /db_xref="GOA:Q757Y2"
FT                   /db_xref="InterPro:IPR000092"
FT                   /db_xref="InterPro:IPR008949"
FT                   /db_xref="InterPro:IPR033749"
FT                   /db_xref="InterPro:IPR039702"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Y2"
FT                   /protein_id="AAS52563.1"
FT                   SFLDKVYRRKK"
FT   gene            <395120..>395404
FT                   /locus_tag="AGOS_AEL121W"
FT                   /old_locus_tag="AEL121W"
FT   mRNA            <395120..>395404
FT                   /locus_tag="AGOS_AEL121W"
FT                   /old_locus_tag="AEL121W"
FT                   /product="AEL121Wp"
FT   CDS_pept        395120..395404
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL121W"
FT                   /old_locus_tag="AEL121W"
FT                   /product="AEL121Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL166W
FT                   (QCR8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL121W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52564"
FT                   /db_xref="GOA:Q757Y1"
FT                   /db_xref="InterPro:IPR004205"
FT                   /db_xref="InterPro:IPR036642"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Y1"
FT                   /protein_id="AAS52564.1"
FT   gene            <395600..>397921
FT                   /locus_tag="AGOS_AEL120W"
FT                   /old_locus_tag="AEL120W"
FT   mRNA            <395600..>397921
FT                   /locus_tag="AGOS_AEL120W"
FT                   /old_locus_tag="AEL120W"
FT                   /product="AEL120Wp"
FT   CDS_pept        395600..397921
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL120W"
FT                   /old_locus_tag="AEL120W"
FT                   /product="AEL120Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL171W
FT                   (NNK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL120W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52565"
FT                   /db_xref="GOA:Q757Y0"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR016241"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Y0"
FT                   /protein_id="AAS52565.1"
FT   gene            <398358..>398774
FT                   /locus_tag="AGOS_AEL119W"
FT                   /old_locus_tag="AEL119W"
FT   mRNA            <398358..>398774
FT                   /locus_tag="AGOS_AEL119W"
FT                   /old_locus_tag="AEL119W"
FT                   /product="AEL119Wp"
FT   CDS_pept        398358..398774
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL119W"
FT                   /old_locus_tag="AEL119W"
FT                   /product="AEL119Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL170W
FT                   (MRPL38)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL119W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52566"
FT                   /db_xref="GOA:Q757X9"
FT                   /db_xref="InterPro:IPR000218"
FT                   /db_xref="InterPro:IPR005745"
FT                   /db_xref="InterPro:IPR019972"
FT                   /db_xref="InterPro:IPR036853"
FT                   /db_xref="UniProtKB/TrEMBL:Q757X9"
FT                   /protein_id="AAS52566.1"
FT   gene            complement(<398944..>400995)
FT                   /locus_tag="AGOS_AEL118C"
FT                   /old_locus_tag="AEL118C"
FT   mRNA            complement(<398944..>400995)
FT                   /locus_tag="AGOS_AEL118C"
FT                   /old_locus_tag="AEL118C"
FT                   /product="AEL118Cp"
FT   CDS_pept        complement(398944..400995)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL118C"
FT                   /old_locus_tag="AEL118C"
FT                   /product="AEL118Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL168C
FT                   (KKQ8) and YJL165C (HAL5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL118C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52567"
FT                   /db_xref="GOA:Q757X8"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757X8"
FT                   /protein_id="AAS52567.1"
FT   gene            complement(<401437..>403272)
FT                   /locus_tag="AGOS_AEL117C"
FT                   /old_locus_tag="AEL117C"
FT   mRNA            complement(<401437..>403272)
FT                   /locus_tag="AGOS_AEL117C"
FT                   /old_locus_tag="AEL117C"
FT                   /product="AEL117Cp"
FT   CDS_pept        complement(401437..403272)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL117C"
FT                   /old_locus_tag="AEL117C"
FT                   /product="AEL117Cp"
FT                   /note="NOHBY508; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0A06842g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL117C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52568"
FT                   /db_xref="GOA:Q757X7"
FT                   /db_xref="InterPro:IPR007300"
FT                   /db_xref="UniProtKB/TrEMBL:Q757X7"
FT                   /protein_id="AAS52568.2"
FT   gene            complement(<403531..>403920)
FT                   /locus_tag="AGOS_AEL116C"
FT                   /old_locus_tag="AEL116C"
FT   mRNA            complement(<403531..>403920)
FT                   /locus_tag="AGOS_AEL116C"
FT                   /old_locus_tag="AEL116C"
FT                   /product="AEL116Cp"
FT   CDS_pept        complement(403531..403920)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL116C"
FT                   /old_locus_tag="AEL116C"
FT                   /product="AEL116Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL167C
FT                   (MRP49)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL116C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52569"
FT                   /db_xref="GOA:Q758E2"
FT                   /db_xref="InterPro:IPR007741"
FT                   /db_xref="InterPro:IPR040049"
FT                   /db_xref="UniProtKB/TrEMBL:Q758E2"
FT                   /protein_id="AAS52569.1"
FT   gene            complement(<404268..>405428)
FT                   /locus_tag="AGOS_AEL115C"
FT                   /old_locus_tag="AEL115C"
FT   mRNA            complement(<404268..>405428)
FT                   /locus_tag="AGOS_AEL115C"
FT                   /old_locus_tag="AEL115C"
FT                   /product="AEL115Cp"
FT   CDS_pept        complement(404268..405428)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL115C"
FT                   /old_locus_tag="AEL115C"
FT                   /product="AEL115Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL166C
FT                   (TPK3) and YJL164C (TPK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL115C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52570"
FT                   /db_xref="GOA:Q758E1"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR000961"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q758E1"
FT                   /protein_id="AAS52570.2"
FT   gene            complement(<406336..>408108)
FT                   /locus_tag="AGOS_AEL114C"
FT                   /old_locus_tag="AEL114C"
FT   mRNA            complement(<406336..>408108)
FT                   /locus_tag="AGOS_AEL114C"
FT                   /old_locus_tag="AEL114C"
FT                   /product="AEL114Cp"
FT   CDS_pept        complement(406336..408108)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL114C"
FT                   /old_locus_tag="AEL114C"
FT                   /product="AEL114Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL163C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL114C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52571"
FT                   /db_xref="GOA:Q757X6"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q757X6"
FT                   /protein_id="AAS52571.1"
FT                   MTLCTASGHFLKES"
FT   gene            complement(<408301..>411078)
FT                   /locus_tag="AGOS_AEL113C"
FT                   /old_locus_tag="AEL113C"
FT   mRNA            complement(<408301..>411078)
FT                   /locus_tag="AGOS_AEL113C"
FT                   /old_locus_tag="AEL113C"
FT                   /product="AEL113Cp"
FT   CDS_pept        complement(408301..411078)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL113C"
FT                   /old_locus_tag="AEL113C"
FT                   /product="AEL113Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL165C
FT                   (MCD4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL113C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52572"
FT                   /db_xref="GOA:Q757X5"
FT                   /db_xref="InterPro:IPR000917"
FT                   /db_xref="InterPro:IPR007070"
FT                   /db_xref="InterPro:IPR017850"
FT                   /db_xref="InterPro:IPR017852"
FT                   /db_xref="InterPro:IPR037671"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757X5"
FT                   /protein_id="AAS52572.2"
FT   gene            complement(<411321..>412928)
FT                   /locus_tag="AGOS_AEL112C"
FT                   /old_locus_tag="AEL112C"
FT   mRNA            complement(<411321..>412928)
FT                   /locus_tag="AGOS_AEL112C"
FT                   /old_locus_tag="AEL112C"
FT                   /product="AEL112Cp"
FT   CDS_pept        complement(411321..412928)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL112C"
FT                   /old_locus_tag="AEL112C"
FT                   /product="AEL112Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL162C
FT                   (JJJ2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL112C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52573"
FT                   /db_xref="GOA:Q757X4"
FT                   /db_xref="InterPro:IPR001623"
FT                   /db_xref="InterPro:IPR018253"
FT                   /db_xref="InterPro:IPR036869"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757X4"
FT                   /protein_id="AAS52573.1"
FT                   VAESFTNLMRSAYASGTF"
FT   gene            complement(413047..413120)
FT                   /locus_tag="AGOS_t0103"
FT   tRNA            complement(413047..413120)
FT                   /locus_tag="AGOS_t0103"
FT                   /product="tRNA-Asn"
FT                   /note="codon recognized: AAC"
FT   gene            <413543..>414073
FT                   /locus_tag="AGOS_AEL111WA"
FT   mRNA            <413543..>414073
FT                   /locus_tag="AGOS_AEL111WA"
FT                   /product="AEL111W-Ap"
FT   CDS_pept        413543..414073
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL111WA"
FT                   /product="AEL111W-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL161W
FT                   (FMP33)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL111WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41771"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGC8"
FT                   /protein_id="ADJ41771.1"
FT                   LQGAAVSFAAEFY"
FT   gene            complement(<414629..>415675)
FT                   /locus_tag="AGOS_AEL111C"
FT                   /old_locus_tag="AEL111C"
FT   mRNA            complement(<414629..>415675)
FT                   /locus_tag="AGOS_AEL111C"
FT                   /old_locus_tag="AEL111C"
FT                   /product="AEL111Cp"
FT   CDS_pept        complement(414629..415675)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL111C"
FT                   /old_locus_tag="AEL111C"
FT                   /product="AEL111Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL163W
FT                   (PIR3) and YJL160C; Inverted gene duplication in this
FT                   genome; Inverted gene duplication in Saccharomyces
FT                   cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL111C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52574"
FT                   /db_xref="GOA:Q757X3"
FT                   /db_xref="InterPro:IPR000420"
FT                   /db_xref="UniProtKB/TrEMBL:Q757X3"
FT                   /protein_id="AAS52574.1"
FT                   QAIDLVTC"
FT   gene            <416817..>417563
FT                   /locus_tag="AGOS_AEL110W"
FT                   /old_locus_tag="AEL110W"
FT   mRNA            <416817..>417563
FT                   /locus_tag="AGOS_AEL110W"
FT                   /old_locus_tag="AEL110W"
FT                   /product="AEL110Wp"
FT   CDS_pept        416817..417563
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL110W"
FT                   /old_locus_tag="AEL110W"
FT                   /product="AEL110Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL164C
FT                   (PIR1) and YJL159W (HSP150); Inverted gene duplication in
FT                   this genome; Inverted gene duplication in Saccharomyces
FT                   cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL110W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52575"
FT                   /db_xref="GOA:Q757X2"
FT                   /db_xref="InterPro:IPR000420"
FT                   /db_xref="UniProtKB/TrEMBL:Q757X2"
FT                   /protein_id="AAS52575.1"
FT   gene            complement(417636..417707)
FT                   /locus_tag="AGOS_t0104"
FT   tRNA            complement(417636..417707)
FT                   /locus_tag="AGOS_t0104"
FT                   /product="tRNA-Cys"
FT                   /note="codon recognized: UGC"
FT   gene            <419410..>420699
FT                   /locus_tag="AGOS_AEL109W"
FT                   /old_locus_tag="AEL109W"
FT   mRNA            <419410..>420699
FT                   /locus_tag="AGOS_AEL109W"
FT                   /old_locus_tag="AEL109W"
FT                   /product="AEL109Wp"
FT   CDS_pept        419410..420699
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL109W"
FT                   /old_locus_tag="AEL109W"
FT                   /product="AEL109Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR048C
FT                   (NAP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL109W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52576"
FT                   /db_xref="GOA:Q757X1"
FT                   /db_xref="InterPro:IPR002164"
FT                   /db_xref="InterPro:IPR037231"
FT                   /db_xref="UniProtKB/TrEMBL:Q757X1"
FT                   /protein_id="AAS52576.2"
FT   gene            <420989..>421975
FT                   /locus_tag="AGOS_AEL108W"
FT                   /old_locus_tag="AEL108W"
FT   mRNA            <420989..>421975
FT                   /locus_tag="AGOS_AEL108W"
FT                   /old_locus_tag="AEL108W"
FT                   /product="AEL108Wp"
FT   CDS_pept        420989..421975
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL108W"
FT                   /old_locus_tag="AEL108W"
FT                   /product="AEL108Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR046C
FT                   (PET10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL108W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52577"
FT                   /db_xref="GOA:Q757X0"
FT                   /db_xref="InterPro:IPR035294"
FT                   /db_xref="UniProtKB/TrEMBL:Q757X0"
FT                   /protein_id="AAS52577.1"
FT   gene            <423112..>425781
FT                   /locus_tag="AGOS_AEL107W"
FT                   /old_locus_tag="AEL107W"
FT   mRNA            <423112..>425781
FT                   /locus_tag="AGOS_AEL107W"
FT                   /old_locus_tag="AEL107W"
FT                   /product="AEL107Wp"
FT   CDS_pept        423112..425781
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL107W"
FT                   /old_locus_tag="AEL107W"
FT                   /product="AEL107Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL154C
FT                   (VPS35)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL107W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52578"
FT                   /db_xref="GOA:Q757W9"
FT                   /db_xref="InterPro:IPR005378"
FT                   /db_xref="InterPro:IPR042491"
FT                   /db_xref="UniProtKB/TrEMBL:Q757W9"
FT                   /protein_id="AAS52578.1"
FT                   NYIEDQKVVDDRFRAIIV"
FT   gene            <426105..>427472
FT                   /locus_tag="AGOS_AEL106W"
FT                   /old_locus_tag="AEL106W"
FT   mRNA            join(<426105..426128,426177..>427472)
FT                   /locus_tag="AGOS_AEL106W"
FT                   /old_locus_tag="AEL106W"
FT                   /product="AEL106Wp"
FT   CDS_pept        join(426105..426128,426177..427472)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL106W"
FT                   /old_locus_tag="AEL106W"
FT                   /product="AEL106Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL155C
FT                   (FBP26); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL106W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52579"
FT                   /db_xref="GOA:Q757W8"
FT                   /db_xref="InterPro:IPR001345"
FT                   /db_xref="InterPro:IPR003094"
FT                   /db_xref="InterPro:IPR013078"
FT                   /db_xref="InterPro:IPR013079"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR029033"
FT                   /db_xref="UniProtKB/TrEMBL:Q757W8"
FT                   /protein_id="AAS52579.2"
FT   gene            <427951..>429960
FT                   /locus_tag="AGOS_AEL105W"
FT                   /old_locus_tag="AEL105W"
FT   mRNA            <427951..>429960
FT                   /locus_tag="AGOS_AEL105W"
FT                   /old_locus_tag="AEL105W"
FT                   /product="AEL105Wp"
FT   CDS_pept        427951..429960
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL105W"
FT                   /old_locus_tag="AEL105W"
FT                   /product="AEL105Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL156C
FT                   (SSY5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL105W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52580"
FT                   /db_xref="GOA:Q757W7"
FT                   /db_xref="InterPro:IPR009003"
FT                   /db_xref="InterPro:IPR012985"
FT                   /db_xref="UniProtKB/TrEMBL:Q757W7"
FT                   /protein_id="AAS52580.1"
FT   gene            <430441..>433698
FT                   /locus_tag="AGOS_AEL104W"
FT                   /old_locus_tag="AEL104W"
FT   mRNA            <430441..>433698
FT                   /locus_tag="AGOS_AEL104W"
FT                   /old_locus_tag="AEL104W"
FT                   /product="AEL104Wp"
FT   CDS_pept        430441..433698
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL104W"
FT                   /old_locus_tag="AEL104W"
FT                   /product="AEL104Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL157C
FT                   (FAR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL104W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52581"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="UniProtKB/TrEMBL:Q757W6"
FT                   /protein_id="AAS52581.2"
FT   gene            <434357..>434932
FT                   /locus_tag="AGOS_AEL103W"
FT                   /old_locus_tag="AEL103W"
FT   mRNA            <434357..>434932
FT                   /locus_tag="AGOS_AEL103W"
FT                   /old_locus_tag="AEL103W"
FT                   /product="AEL103Wp"
FT   CDS_pept        434357..434932
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL103W"
FT                   /old_locus_tag="AEL103W"
FT                   /product="AEL103Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL158C
FT                   (CIS3), YKL164C (PIR1) and YKL163W (PIR3); Inverted gene
FT                   duplication in Saccharomyces cerevisiae'"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL103W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52582"
FT                   /db_xref="GOA:Q757W5"
FT                   /db_xref="UniProtKB/TrEMBL:Q757W5"
FT                   /protein_id="AAS52582.1"
FT   gene            435565..435664
FT                   /locus_tag="AGOS_t0105"
FT   tRNA            join(435565..435601,435620..435664)
FT                   /locus_tag="AGOS_t0105"
FT                   /product="tRNA-Ser"
FT                   /note="codon recognized: AGC"
FT   gene            <435787..>436356
FT                   /locus_tag="AGOS_AEL102W"
FT                   /old_locus_tag="AEL102W"
FT   mRNA            <435787..>436356
FT                   /locus_tag="AGOS_AEL102W"
FT                   /old_locus_tag="AEL102W"
FT                   /product="AEL102Wp"
FT   CDS_pept        435787..436356
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL102W"
FT                   /old_locus_tag="AEL102W"
FT                   /product="AEL102Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR339C
FT                   (FCF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL102W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52583"
FT                   /db_xref="GOA:Q757W4"
FT                   /db_xref="InterPro:IPR002716"
FT                   /db_xref="InterPro:IPR006984"
FT                   /db_xref="InterPro:IPR029060"
FT                   /db_xref="InterPro:IPR037503"
FT                   /db_xref="UniProtKB/TrEMBL:Q757W4"
FT                   /protein_id="AAS52583.1"
FT   gene            complement(<436424..>436963)
FT                   /locus_tag="AGOS_AEL101C"
FT                   /old_locus_tag="AEL101C"
FT   mRNA            complement(<436424..>436963)
FT                   /locus_tag="AGOS_AEL101C"
FT                   /old_locus_tag="AEL101C"
FT                   /product="AEL101Cp"
FT   CDS_pept        complement(436424..436963)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL101C"
FT                   /old_locus_tag="AEL101C"
FT                   /product="AEL101Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YLR326W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL101C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52584"
FT                   /db_xref="GOA:Q757W3"
FT                   /db_xref="InterPro:IPR025187"
FT                   /db_xref="UniProtKB/TrEMBL:Q757W3"
FT                   /protein_id="AAS52584.1"
FT                   VLERYLSQKYAKQHAD"
FT   gene            <437279..>438136
FT                   /locus_tag="AGOS_AEL100W"
FT                   /old_locus_tag="AEL100W"
FT   mRNA            <437279..>438136
FT                   /locus_tag="AGOS_AEL100W"
FT                   /old_locus_tag="AEL100W"
FT                   /product="AEL100Wp"
FT   CDS_pept        437279..438136
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL100W"
FT                   /old_locus_tag="AEL100W"
FT                   /product="AEL100Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR090C
FT                   (YNG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL100W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52585"
FT                   /db_xref="GOA:Q757W2"
FT                   /db_xref="InterPro:IPR001965"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR019786"
FT                   /db_xref="InterPro:IPR019787"
FT                   /db_xref="InterPro:IPR024610"
FT                   /db_xref="InterPro:IPR028651"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757W2"
FT                   /protein_id="AAS52585.1"
FT                   KKRV"
FT   gene            <438419..>440422
FT                   /locus_tag="AGOS_AEL099W"
FT                   /old_locus_tag="AEL099W"
FT   mRNA            <438419..>440422
FT                   /locus_tag="AGOS_AEL099W"
FT                   /old_locus_tag="AEL099W"
FT                   /product="AEL099Wp"
FT   CDS_pept        438419..440422
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL099W"
FT                   /old_locus_tag="AEL099W"
FT                   /product="AEL099Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR338C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL099W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52586"
FT                   /db_xref="GOA:Q757W1"
FT                   /db_xref="InterPro:IPR002528"
FT                   /db_xref="UniProtKB/TrEMBL:Q757W1"
FT                   /protein_id="AAS52586.2"
FT   gene            <440701..>442164
FT                   /locus_tag="AGOS_AEL098W"
FT                   /old_locus_tag="AEL098W"
FT   mRNA            <440701..>442164
FT                   /locus_tag="AGOS_AEL098W"
FT                   /old_locus_tag="AEL098W"
FT                   /product="AEL098Wp"
FT   CDS_pept        440701..442164
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL098W"
FT                   /old_locus_tag="AEL098W"
FT                   /product="AEL098Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YNL277W (MET2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL098W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52587"
FT                   /db_xref="GOA:Q757W0"
FT                   /db_xref="InterPro:IPR000073"
FT                   /db_xref="InterPro:IPR008220"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/TrEMBL:Q757W0"
FT                   /protein_id="AAS52587.2"
FT   gene            complement(<442327..>443172)
FT                   /locus_tag="AGOS_AEL097C"
FT                   /old_locus_tag="AEL097C"
FT   mRNA            complement(<442327..>443172)
FT                   /locus_tag="AGOS_AEL097C"
FT                   /old_locus_tag="AEL097C"
FT                   /product="AEL097Cp"
FT   CDS_pept        complement(442327..443172)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL097C"
FT                   /old_locus_tag="AEL097C"
FT                   /product="AEL097Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR337W
FT                   (MRPS28)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL097C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52588"
FT                   /db_xref="GOA:Q757V9"
FT                   /db_xref="InterPro:IPR000589"
FT                   /db_xref="InterPro:IPR005290"
FT                   /db_xref="InterPro:IPR009068"
FT                   /db_xref="UniProtKB/TrEMBL:Q757V9"
FT                   /protein_id="AAS52588.1"
FT                   "
FT   gene            <443823..>444461
FT                   /locus_tag="AGOS_AEL096W"
FT                   /old_locus_tag="AEL096W"
FT   mRNA            <443823..>444461
FT                   /locus_tag="AGOS_AEL096W"
FT                   /old_locus_tag="AEL096W"
FT                   /product="AEL096Wp"
FT   CDS_pept        443823..444461
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL096W"
FT                   /old_locus_tag="AEL096W"
FT                   /product="AEL096Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR089C
FT                   (GAR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL096W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52589"
FT                   /db_xref="GOA:Q757V8"
FT                   /db_xref="InterPro:IPR007504"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR038664"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757V8"
FT                   /protein_id="AAS52589.1"
FT   gene            complement(<444634..>445710)
FT                   /locus_tag="AGOS_AEL095C"
FT                   /old_locus_tag="AEL095C"
FT   mRNA            complement(<444634..>445710)
FT                   /locus_tag="AGOS_AEL095C"
FT                   /old_locus_tag="AEL095C"
FT                   /product="AEL095Cp"
FT   CDS_pept        complement(444634..445710)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL095C"
FT                   /old_locus_tag="AEL095C"
FT                   /product="AEL095Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR336W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL095C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52590"
FT                   /db_xref="GOA:Q757V7"
FT                   /db_xref="InterPro:IPR006073"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR030393"
FT                   /db_xref="UniProtKB/TrEMBL:Q757V7"
FT                   /protein_id="AAS52590.1"
FT                   FEACNIKPNTLPSKAYKQ"
FT   gene            complement(<445920..>449585)
FT                   /locus_tag="AGOS_AEL094C"
FT                   /old_locus_tag="AEL094C"
FT   mRNA            complement(<445920..>449585)
FT                   /locus_tag="AGOS_AEL094C"
FT                   /old_locus_tag="AEL094C"
FT                   /product="AEL094Cp"
FT   CDS_pept        complement(445920..449585)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL094C"
FT                   /old_locus_tag="AEL094C"
FT                   /product="AEL094Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR335W
FT                   (MSN5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL094C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52591"
FT                   /db_xref="GOA:Q757V6"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR040018"
FT                   /db_xref="UniProtKB/TrEMBL:Q757V6"
FT                   /protein_id="AAS52591.1"
FT   gene            complement(<449952..>450830)
FT                   /locus_tag="AGOS_AEL093C"
FT                   /old_locus_tag="AEL093C"
FT   mRNA            complement(<449952..>450830)
FT                   /locus_tag="AGOS_AEL093C"
FT                   /old_locus_tag="AEL093C"
FT                   /product="AEL093Cp"
FT   CDS_pept        complement(449952..450830)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL093C"
FT                   /old_locus_tag="AEL093C"
FT                   /product="AEL093Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR088W
FT                   (RPF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL093C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52592"
FT                   /db_xref="GOA:Q757V5"
FT                   /db_xref="InterPro:IPR007109"
FT                   /db_xref="UniProtKB/TrEMBL:Q757V5"
FT                   /protein_id="AAS52592.1"
FT                   EMDKDKKRFHL"
FT   gene            <451943..>453808
FT                   /locus_tag="AGOS_AEL092W"
FT                   /old_locus_tag="AEL092W"
FT   mRNA            <451943..>453808
FT                   /locus_tag="AGOS_AEL092W"
FT                   /old_locus_tag="AEL092W"
FT                   /product="AEL092Wp"
FT   CDS_pept        451943..453808
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL092W"
FT                   /old_locus_tag="AEL092W"
FT                   /product="AEL092Wp"
FT                   /note="NOHBY507; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F21714g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL092W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52593"
FT                   /db_xref="GOA:Q757V4"
FT                   /db_xref="InterPro:IPR000219"
FT                   /db_xref="InterPro:IPR035899"
FT                   /db_xref="UniProtKB/TrEMBL:Q757V4"
FT                   /protein_id="AAS52593.1"
FT   gene            complement(<454022..>455851)
FT                   /locus_tag="AGOS_AEL091C"
FT                   /old_locus_tag="AEL091C"
FT   mRNA            complement(<454022..>455851)
FT                   /locus_tag="AGOS_AEL091C"
FT                   /old_locus_tag="AEL091C"
FT                   /product="AEL091Cp"
FT   CDS_pept        complement(454022..455851)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL091C"
FT                   /old_locus_tag="AEL091C"
FT                   /product="AEL091Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL066C
FT                   (RIB2) and YDL036C (PUS9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL091C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52594"
FT                   /db_xref="GOA:Q757V3"
FT                   /db_xref="InterPro:IPR002125"
FT                   /db_xref="InterPro:IPR002942"
FT                   /db_xref="InterPro:IPR006145"
FT                   /db_xref="InterPro:IPR006224"
FT                   /db_xref="InterPro:IPR006225"
FT                   /db_xref="InterPro:IPR016193"
FT                   /db_xref="InterPro:IPR020103"
FT                   /db_xref="UniProtKB/TrEMBL:Q757V3"
FT                   /protein_id="AAS52594.2"
FT   gene            complement(<455933..>457219)
FT                   /locus_tag="AGOS_AEL090C"
FT                   /old_locus_tag="AEL090C"
FT   mRNA            complement(<455933..>457219)
FT                   /locus_tag="AGOS_AEL090C"
FT                   /old_locus_tag="AEL090C"
FT                   /product="AEL090Cp"
FT   CDS_pept        complement(455933..457219)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL090C"
FT                   /old_locus_tag="AEL090C"
FT                   /product="AEL090Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL065C
FT                   (INP54)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL090C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52595"
FT                   /db_xref="GOA:Q757V2"
FT                   /db_xref="InterPro:IPR000300"
FT                   /db_xref="InterPro:IPR036691"
FT                   /db_xref="UniProtKB/TrEMBL:Q757V2"
FT                   /protein_id="AAS52595.2"
FT   gene            complement(<457490..>460237)
FT                   /locus_tag="AGOS_AEL089C"
FT                   /old_locus_tag="AEL089C"
FT   mRNA            complement(<457490..>460237)
FT                   /locus_tag="AGOS_AEL089C"
FT                   /old_locus_tag="AEL089C"
FT                   /product="AEL089Cp"
FT   CDS_pept        complement(457490..460237)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL089C"
FT                   /old_locus_tag="AEL089C"
FT                   /product="AEL089Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL035C
FT                   (GPR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL089C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52596"
FT                   /db_xref="GOA:Q757V1"
FT                   /db_xref="InterPro:IPR001513"
FT                   /db_xref="InterPro:IPR022596"
FT                   /db_xref="InterPro:IPR023041"
FT                   /db_xref="UniProtKB/TrEMBL:Q757V1"
FT                   /protein_id="AAS52596.2"
FT   gene            complement(<460837..>461904)
FT                   /locus_tag="AGOS_AEL088C"
FT                   /old_locus_tag="AEL088C"
FT   mRNA            complement(<460837..>461904)
FT                   /locus_tag="AGOS_AEL088C"
FT                   /old_locus_tag="AEL088C"
FT                   /product="AEL088Cp"
FT   CDS_pept        complement(460837..461904)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL088C"
FT                   /old_locus_tag="AEL088C"
FT                   /product="AEL088Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL064C
FT                   (MET22)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL088C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52597"
FT                   /db_xref="GOA:Q757V0"
FT                   /db_xref="InterPro:IPR000760"
FT                   /db_xref="InterPro:IPR006239"
FT                   /db_xref="InterPro:IPR020550"
FT                   /db_xref="InterPro:IPR020583"
FT                   /db_xref="UniProtKB/TrEMBL:Q757V0"
FT                   /protein_id="AAS52597.1"
FT                   HEHVVSISSDVIKNR"
FT   gene            complement(<462124..>463356)
FT                   /locus_tag="AGOS_AEL087C"
FT                   /old_locus_tag="AEL087C"
FT   mRNA            complement(<462124..>463356)
FT                   /locus_tag="AGOS_AEL087C"
FT                   /old_locus_tag="AEL087C"
FT                   /product="AEL087Cp"
FT   CDS_pept        complement(462124..463356)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL087C"
FT                   /old_locus_tag="AEL087C"
FT                   /product="AEL087Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL033C
FT                   (SLM3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL087C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52598"
FT                   /db_xref="GOA:Q757U9"
FT                   /db_xref="InterPro:IPR004506"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR023382"
FT                   /db_xref="UniProtKB/TrEMBL:Q757U9"
FT                   /protein_id="AAS52598.2"
FT                   VLGSGTVRATF"
FT   gene            <463726..>466608
FT                   /locus_tag="AGOS_AEL086W"
FT                   /old_locus_tag="AEL086W"
FT   mRNA            <463726..>466608
FT                   /locus_tag="AGOS_AEL086W"
FT                   /old_locus_tag="AEL086W"
FT                   /product="AEL086Wp"
FT   CDS_pept        463726..466608
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL086W"
FT                   /old_locus_tag="AEL086W"
FT                   /product="AEL086Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL031W
FT                   (DBP10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL086W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52599"
FT                   /db_xref="GOA:Q757U8"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR012541"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR033517"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757U8"
FT                   /protein_id="AAS52599.1"
FT   gene            <466788..>468374
FT                   /locus_tag="AGOS_AEL085W"
FT                   /old_locus_tag="AEL085W"
FT   mRNA            <466788..>468374
FT                   /locus_tag="AGOS_AEL085W"
FT                   /old_locus_tag="AEL085W"
FT                   /product="AEL085Wp"
FT   CDS_pept        466788..468374
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL085W"
FT                   /old_locus_tag="AEL085W"
FT                   /product="AEL085Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL030W
FT                   (PRP9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL085W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52600"
FT                   /db_xref="GOA:Q757U7"
FT                   /db_xref="InterPro:IPR000690"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR024598"
FT                   /db_xref="InterPro:IPR031590"
FT                   /db_xref="InterPro:IPR031774"
FT                   /db_xref="InterPro:IPR031776"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q757U7"
FT                   /protein_id="AAS52600.2"
FT                   VYEDLKKQGLL"
FT   gene            <468542..>469843
FT                   /locus_tag="AGOS_AEL084W"
FT                   /old_locus_tag="AEL084W"
FT   mRNA            <468542..>469843
FT                   /locus_tag="AGOS_AEL084W"
FT                   /old_locus_tag="AEL084W"
FT                   /product="AEL084Wp"
FT   CDS_pept        468542..469843
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL084W"
FT                   /old_locus_tag="AEL084W"
FT                   /product="AEL084Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR029C
FT                   (CDS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL084W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52601"
FT                   /db_xref="GOA:Q757U6"
FT                   /db_xref="InterPro:IPR000374"
FT                   /db_xref="InterPro:IPR016720"
FT                   /db_xref="UniProtKB/TrEMBL:Q757U6"
FT                   /protein_id="AAS52601.1"
FT   gene            <470172..>471782
FT                   /locus_tag="AGOS_AEL083W"
FT                   /old_locus_tag="AEL083W"
FT   mRNA            <470172..>471782
FT                   /locus_tag="AGOS_AEL083W"
FT                   /old_locus_tag="AEL083W"
FT                   /product="AEL083Wp"
FT   CDS_pept        470172..471782
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL083W"
FT                   /old_locus_tag="AEL083W"
FT                   /product="AEL083Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR028C
FT                   (YPK3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL083W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52602"
FT                   /db_xref="GOA:Q757U5"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR000961"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q757U5"
FT                   /protein_id="AAS52602.1"
FT   gene            complement(<471962..>472540)
FT                   /locus_tag="AGOS_AEL083CA"
FT   mRNA            complement(<471962..>472540)
FT                   /locus_tag="AGOS_AEL083CA"
FT                   /product="AEL083C-Ap"
FT   CDS_pept        complement(471962..472540)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL083CA"
FT                   /product="AEL083C-Ap"
FT                   /note="NOHBY534; No homolog in Saccharomyces cerevisiae,
FT                   syntenic homolog of Kluyveromyces lactis KLLA0F24596g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL083CA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41772"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGC9"
FT                   /protein_id="ADJ41772.1"
FT   gene            <473280..>475325
FT                   /locus_tag="AGOS_AEL082W"
FT                   /old_locus_tag="AEL082W"
FT   mRNA            <473280..>475325
FT                   /locus_tag="AGOS_AEL082W"
FT                   /old_locus_tag="AEL082W"
FT                   /product="AEL082Wp"
FT   CDS_pept        473280..475325
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL082W"
FT                   /old_locus_tag="AEL082W"
FT                   /product="AEL082Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YBR015C (MNN2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL082W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52603"
FT                   /db_xref="GOA:Q757U4"
FT                   /db_xref="InterPro:IPR022751"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q757U4"
FT                   /protein_id="AAS52603.1"
FT   gene            <475573..>476703
FT                   /locus_tag="AGOS_AEL081W"
FT                   /old_locus_tag="AEL081W"
FT   mRNA            <475573..>476703
FT                   /locus_tag="AGOS_AEL081W"
FT                   /old_locus_tag="AEL081W"
FT                   /product="AEL081Wp"
FT   CDS_pept        475573..476703
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL081W"
FT                   /old_locus_tag="AEL081W"
FT                   /product="AEL081Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR026C
FT                   (ETR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL081W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52604"
FT                   /db_xref="GOA:Q757U3"
FT                   /db_xref="InterPro:IPR011032"
FT                   /db_xref="InterPro:IPR013149"
FT                   /db_xref="InterPro:IPR020843"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757U3"
FT                   /protein_id="AAS52604.2"
FT   gene            476920..476993
FT                   /locus_tag="AGOS_t0106"
FT   tRNA            476920..476993
FT                   /locus_tag="AGOS_t0106"
FT                   /product="tRNA-Asn"
FT                   /note="codon recognized: AAC"
FT   gene            complement(<477075..>477511)
FT                   /locus_tag="AGOS_AEL080C"
FT                   /old_locus_tag="AEL080C"
FT   mRNA            complement(join(<477075..477202,477253..>477511))
FT                   /locus_tag="AGOS_AEL080C"
FT                   /old_locus_tag="AEL080C"
FT                   /product="AEL080Cp"
FT   CDS_pept        complement(join(477075..477202,477253..477511))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL080C"
FT                   /old_locus_tag="AEL080C"
FT                   /product="AEL080Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL108C
FT                   (INO4); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL080C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52605"
FT                   /db_xref="GOA:Q757U2"
FT                   /db_xref="InterPro:IPR011598"
FT                   /db_xref="InterPro:IPR036638"
FT                   /db_xref="UniProtKB/TrEMBL:Q757U2"
FT                   /protein_id="AAS52605.1"
FT   gene            <478162..>479163
FT                   /locus_tag="AGOS_AEL079W"
FT                   /old_locus_tag="AEL079W"
FT   mRNA            <478162..>479163
FT                   /locus_tag="AGOS_AEL079W"
FT                   /old_locus_tag="AEL079W"
FT                   /product="AEL079Wp"
FT   CDS_pept        478162..479163
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL079W"
FT                   /old_locus_tag="AEL079W"
FT                   /product="AEL079Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOL107W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL079W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52606"
FT                   /db_xref="GOA:Q757U1"
FT                   /db_xref="InterPro:IPR013861"
FT                   /db_xref="UniProtKB/TrEMBL:Q757U1"
FT                   /protein_id="AAS52606.1"
FT   gene            complement(<479288..>480163)
FT                   /locus_tag="AGOS_AEL078C"
FT                   /old_locus_tag="AEL078C"
FT   mRNA            complement(<479288..>480163)
FT                   /locus_tag="AGOS_AEL078C"
FT                   /old_locus_tag="AEL078C"
FT                   /product="AEL078Cp"
FT   CDS_pept        complement(479288..480163)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL078C"
FT                   /old_locus_tag="AEL078C"
FT                   /product="AEL078Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL284C
FT                   (MRPL10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL078C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52607"
FT                   /db_xref="GOA:Q757U0"
FT                   /db_xref="InterPro:IPR005749"
FT                   /db_xref="InterPro:IPR021131"
FT                   /db_xref="InterPro:IPR030878"
FT                   /db_xref="InterPro:IPR036227"
FT                   /db_xref="UniProtKB/TrEMBL:Q757U0"
FT                   /protein_id="AAS52607.1"
FT                   AIISLQELQQ"
FT   gene            <482236..>483246
FT                   /locus_tag="AGOS_AEL077W"
FT                   /old_locus_tag="AEL077W"
FT   mRNA            <482236..>483246
FT                   /locus_tag="AGOS_AEL077W"
FT                   /old_locus_tag="AEL077W"
FT                   /product="AEL077Wp"
FT   CDS_pept        482236..483246
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL077W"
FT                   /old_locus_tag="AEL077W"
FT                   /product="AEL077Wp"
FT                   /note="NOHBY506; Weak homolog in Saccharomyces cerevisiae
FT                   YPR013C; Similar to Ashbya gossypii ADR308C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL077W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52608"
FT                   /db_xref="GOA:Q757T9"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q757T9"
FT                   /protein_id="AAS52608.1"
FT   gene            complement(<484363..>485310)
FT                   /locus_tag="AGOS_AEL076C"
FT                   /old_locus_tag="AEL076C"
FT   mRNA            complement(<484363..>485310)
FT                   /locus_tag="AGOS_AEL076C"
FT                   /old_locus_tag="AEL076C"
FT                   /product="AEL076Cp"
FT   CDS_pept        complement(484363..485310)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL076C"
FT                   /old_locus_tag="AEL076C"
FT                   /product="AEL076Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL029C
FT                   (BUD16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL076C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52609"
FT                   /db_xref="GOA:Q757T8"
FT                   /db_xref="InterPro:IPR004625"
FT                   /db_xref="InterPro:IPR013749"
FT                   /db_xref="InterPro:IPR029056"
FT                   /db_xref="UniProtKB/TrEMBL:Q757T8"
FT                   /protein_id="AAS52609.1"
FT   gene            485973..486044
FT                   /locus_tag="AGOS_t0107"
FT   tRNA            485973..486044
FT                   /locus_tag="AGOS_t0107"
FT                   /product="tRNA-Met"
FT                   /note="codon recognized: AUG; Initiator tRNA"
FT   gene            <486221..>487324
FT                   /locus_tag="AGOS_AEL075W"
FT                   /old_locus_tag="AEL075W"
FT   mRNA            <486221..>487324
FT                   /locus_tag="AGOS_AEL075W"
FT                   /old_locus_tag="AEL075W"
FT                   /product="AEL075Wp"
FT   CDS_pept        486221..487324
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL075W"
FT                   /old_locus_tag="AEL075W"
FT                   /product="AEL075Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR043C
FT                   (POL32)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL075W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52610"
FT                   /db_xref="UniProtKB/TrEMBL:Q757T7"
FT                   /protein_id="AAS52610.1"
FT   gene            <487577..>488059
FT                   /locus_tag="AGOS_AEL074W"
FT                   /old_locus_tag="AEL074W"
FT   mRNA            <487577..>488059
FT                   /locus_tag="AGOS_AEL074W"
FT                   /old_locus_tag="AEL074W"
FT                   /product="AEL074Wp"
FT   CDS_pept        487577..488059
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL074W"
FT                   /old_locus_tag="AEL074W"
FT                   /product="AEL074Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL027W
FT                   (VMA3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL074W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52611"
FT                   /db_xref="GOA:Q757T6"
FT                   /db_xref="InterPro:IPR000245"
FT                   /db_xref="InterPro:IPR002379"
FT                   /db_xref="InterPro:IPR011555"
FT                   /db_xref="InterPro:IPR035921"
FT                   /db_xref="UniProtKB/TrEMBL:Q757T6"
FT                   /protein_id="AAS52611.1"
FT   gene            complement(<488315..>490471)
FT                   /locus_tag="AGOS_AEL073C"
FT                   /old_locus_tag="AEL073C"
FT   mRNA            complement(<488315..>490471)
FT                   /locus_tag="AGOS_AEL073C"
FT                   /old_locus_tag="AEL073C"
FT                   /product="AEL073Cp"
FT   CDS_pept        complement(488315..490471)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL073C"
FT                   /old_locus_tag="AEL073C"
FT                   /product="AEL073Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR042W
FT                   (NUP85)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL073C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52612"
FT                   /db_xref="GOA:Q757T5"
FT                   /db_xref="InterPro:IPR011502"
FT                   /db_xref="UniProtKB/TrEMBL:Q757T5"
FT                   /protein_id="AAS52612.2"
FT   gene            <490812..>494228
FT                   /locus_tag="AGOS_AEL072W"
FT                   /old_locus_tag="AEL072W"
FT   mRNA            <490812..>494228
FT                   /locus_tag="AGOS_AEL072W"
FT                   /old_locus_tag="AEL072W"
FT                   /product="AEL072Wp"
FT   CDS_pept        490812..494228
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL072W"
FT                   /old_locus_tag="AEL072W"
FT                   /product="AEL072Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR041C
FT                   (URB2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL072W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52613"
FT                   /db_xref="GOA:Q757T4"
FT                   /db_xref="InterPro:IPR018849"
FT                   /db_xref="UniProtKB/TrEMBL:Q757T4"
FT                   /protein_id="AAS52613.1"
FT   gene            complement(<494324..>496582)
FT                   /locus_tag="AGOS_AEL071C"
FT                   /old_locus_tag="AEL071C"
FT   mRNA            complement(<494324..>496582)
FT                   /locus_tag="AGOS_AEL071C"
FT                   /old_locus_tag="AEL071C"
FT                   /product="AEL071Cp"
FT   CDS_pept        complement(494324..496582)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL071C"
FT                   /old_locus_tag="AEL071C"
FT                   /product="AEL071Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR040W
FT                   (GEF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL071C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52614"
FT                   /db_xref="GOA:Q757T3"
FT                   /db_xref="InterPro:IPR000644"
FT                   /db_xref="InterPro:IPR001807"
FT                   /db_xref="InterPro:IPR014743"
FT                   /db_xref="UniProtKB/TrEMBL:Q757T3"
FT                   /protein_id="AAS52614.2"
FT   gene            <497043..>497426
FT                   /locus_tag="AGOS_AEL070W"
FT                   /old_locus_tag="AEL070W"
FT   mRNA            <497043..>497426
FT                   /locus_tag="AGOS_AEL070W"
FT                   /old_locus_tag="AEL070W"
FT                   /product="AEL070Wp"
FT   CDS_pept        497043..497426
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL070W"
FT                   /old_locus_tag="AEL070W"
FT                   /product="AEL070Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL026W
FT                   (SNU13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL070W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52615"
FT                   /db_xref="GOA:Q757T2"
FT                   /db_xref="InterPro:IPR002415"
FT                   /db_xref="InterPro:IPR004037"
FT                   /db_xref="InterPro:IPR004038"
FT                   /db_xref="InterPro:IPR018492"
FT                   /db_xref="InterPro:IPR029064"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757T2"
FT                   /protein_id="AAS52615.1"
FT   gene            complement(<497453..>500689)
FT                   /locus_tag="AGOS_AEL069CA"
FT   mRNA            complement(<497453..>500689)
FT                   /locus_tag="AGOS_AEL069CA"
FT                   /product="AEL069C-Ap"
FT   CDS_pept        complement(497453..500689)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL069CA"
FT                   /product="AEL069C-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YEL025C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL069CA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41773"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGD0"
FT                   /protein_id="ADJ41773.1"
FT   gene            complement(<501030..>504221)
FT                   /locus_tag="AGOS_AEL069C"
FT                   /old_locus_tag="AEL069C"
FT   mRNA            complement(<501030..>504221)
FT                   /locus_tag="AGOS_AEL069C"
FT                   /old_locus_tag="AEL069C"
FT                   /product="AEL069Cp"
FT   CDS_pept        complement(501030..504221)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL069C"
FT                   /old_locus_tag="AEL069C"
FT                   /product="AEL069Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJR039W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL069C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52616"
FT                   /db_xref="UniProtKB/TrEMBL:Q757T1"
FT                   /protein_id="AAS52616.2"
FT                   YPCRPSIFSDPKFIK"
FT   gene            <504513..>507032
FT                   /locus_tag="AGOS_AEL068W"
FT                   /old_locus_tag="AEL068W"
FT   mRNA            <504513..>507032
FT                   /locus_tag="AGOS_AEL068W"
FT                   /old_locus_tag="AEL068W"
FT                   /product="AEL068Wp"
FT   CDS_pept        504513..507032
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL068W"
FT                   /old_locus_tag="AEL068W"
FT                   /product="AEL068Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR036C
FT                   (HUL4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL068W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52617"
FT                   /db_xref="GOA:Q757T0"
FT                   /db_xref="InterPro:IPR000569"
FT                   /db_xref="InterPro:IPR035983"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757T0"
FT                   /protein_id="AAS52617.1"
FT   gene            <507373..>508011
FT                   /locus_tag="AGOS_AEL067W"
FT                   /old_locus_tag="AEL067W"
FT   mRNA            <507373..>508011
FT                   /locus_tag="AGOS_AEL067W"
FT                   /old_locus_tag="AEL067W"
FT                   /product="AEL067Wp"
FT   CDS_pept        507373..508011
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL067W"
FT                   /old_locus_tag="AEL067W"
FT                   /product="AEL067Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL024W
FT                   (RIP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL067W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52618"
FT                   /db_xref="GOA:Q757S9"
FT                   /db_xref="InterPro:IPR004192"
FT                   /db_xref="InterPro:IPR005805"
FT                   /db_xref="InterPro:IPR006317"
FT                   /db_xref="InterPro:IPR014349"
FT                   /db_xref="InterPro:IPR017941"
FT                   /db_xref="InterPro:IPR036922"
FT                   /db_xref="InterPro:IPR037008"
FT                   /db_xref="UniProtKB/TrEMBL:Q757S9"
FT                   /protein_id="AAS52618.1"
FT   gene            complement(<508432..>510504)
FT                   /locus_tag="AGOS_AEL066C"
FT                   /old_locus_tag="AEL066C"
FT   mRNA            complement(<508432..>510504)
FT                   /locus_tag="AGOS_AEL066C"
FT                   /old_locus_tag="AEL066C"
FT                   /product="AEL066Cp"
FT   CDS_pept        complement(508432..510504)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL066C"
FT                   /old_locus_tag="AEL066C"
FT                   /product="AEL066Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YEL023C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL066C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52619"
FT                   /db_xref="InterPro:IPR018712"
FT                   /db_xref="UniProtKB/TrEMBL:Q757S8"
FT                   /protein_id="AAS52619.2"
FT   gene            complement(<510722..>513799)
FT                   /locus_tag="AGOS_AEL065C"
FT                   /old_locus_tag="AEL065C"
FT   mRNA            complement(<510722..>513799)
FT                   /locus_tag="AGOS_AEL065C"
FT                   /old_locus_tag="AEL065C"
FT                   /product="AEL065Cp"
FT   CDS_pept        complement(510722..513799)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL065C"
FT                   /old_locus_tag="AEL065C"
FT                   /product="AEL065Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR035W
FT                   (RAD26)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL065C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52620"
FT                   /db_xref="GOA:Q757S7"
FT                   /db_xref="InterPro:IPR000330"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR002048"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR038718"
FT                   /db_xref="UniProtKB/TrEMBL:Q757S7"
FT                   /protein_id="AAS52620.2"
FT   gene            complement(<514092..>514418)
FT                   /locus_tag="AGOS_AEL064C"
FT                   /old_locus_tag="AEL064C"
FT   mRNA            complement(<514092..>514418)
FT                   /locus_tag="AGOS_AEL064C"
FT                   /old_locus_tag="AEL064C"
FT                   /product="AEL064Cp"
FT   CDS_pept        complement(514092..514418)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL064C"
FT                   /old_locus_tag="AEL064C"
FT                   /product="AEL064Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR034W
FT                   (PET191)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL064C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52621"
FT                   /db_xref="GOA:Q757S6"
FT                   /db_xref="InterPro:IPR018793"
FT                   /db_xref="UniProtKB/TrEMBL:Q757S6"
FT                   /protein_id="AAS52621.1"
FT                   SNKT"
FT   gene            <514598..>518539
FT                   /locus_tag="AGOS_AEL063W"
FT                   /old_locus_tag="AEL063W"
FT   mRNA            <514598..>518539
FT                   /locus_tag="AGOS_AEL063W"
FT                   /old_locus_tag="AEL063W"
FT                   /product="AEL063Wp"
FT   CDS_pept        514598..518539
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL063W"
FT                   /old_locus_tag="AEL063W"
FT                   /product="AEL063Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR033C
FT                   (RAV1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL063W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52622"
FT                   /db_xref="GOA:Q757S5"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR022033"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q757S5"
FT                   /protein_id="AAS52622.2"
FT   gene            complement(<518615..>519766)
FT                   /locus_tag="AGOS_AEL062C"
FT                   /old_locus_tag="AEL062C"
FT   mRNA            complement(<518615..>519766)
FT                   /locus_tag="AGOS_AEL062C"
FT                   /old_locus_tag="AEL062C"
FT                   /product="AEL062Cp"
FT   CDS_pept        complement(518615..519766)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL062C"
FT                   /old_locus_tag="AEL062C"
FT                   /product="AEL062Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR032W
FT                   (CPR7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL062C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52623"
FT                   /db_xref="GOA:Q757S4"
FT                   /db_xref="InterPro:IPR002130"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="InterPro:IPR020892"
FT                   /db_xref="InterPro:IPR029000"
FT                   /db_xref="UniProtKB/TrEMBL:Q757S4"
FT                   /protein_id="AAS52623.1"
FT   gene            <520000..>524181
FT                   /locus_tag="AGOS_AEL061W"
FT                   /old_locus_tag="AEL061W"
FT   mRNA            <520000..>524181
FT                   /locus_tag="AGOS_AEL061W"
FT                   /old_locus_tag="AEL061W"
FT                   /product="AEL061Wp"
FT   CDS_pept        520000..524181
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL061W"
FT                   /old_locus_tag="AEL061W"
FT                   /product="AEL061Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL022W
FT                   (GEA2) and YJR031C (GEA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL061W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52624"
FT                   /db_xref="GOA:Q757S3"
FT                   /db_xref="InterPro:IPR000904"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR023394"
FT                   /db_xref="InterPro:IPR032691"
FT                   /db_xref="InterPro:IPR035999"
FT                   /db_xref="UniProtKB/TrEMBL:Q757S3"
FT                   /protein_id="AAS52624.2"
FT   gene            complement(<524268..>525557)
FT                   /locus_tag="AGOS_AEL060C"
FT                   /old_locus_tag="AEL060C"
FT   mRNA            complement(<524268..>525557)
FT                   /locus_tag="AGOS_AEL060C"
FT                   /old_locus_tag="AEL060C"
FT                   /product="AEL060Cp"
FT   CDS_pept        complement(524268..525557)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL060C"
FT                   /old_locus_tag="AEL060C"
FT                   /product="AEL060Cp"
FT                   /note="NOHBY505; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E22880g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL060C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52625"
FT                   /db_xref="GOA:Q757S2"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q757S2"
FT                   /protein_id="AAS52625.1"
FT   gene            <525979..>526782
FT                   /locus_tag="AGOS_AEL059W"
FT                   /old_locus_tag="AEL059W"
FT   mRNA            <525979..>526782
FT                   /locus_tag="AGOS_AEL059W"
FT                   /old_locus_tag="AEL059W"
FT                   /product="AEL059Wp"
FT   CDS_pept        525979..526782
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL059W"
FT                   /old_locus_tag="AEL059W"
FT                   /product="AEL059Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL021W
FT                   (URA3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL059W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52626"
FT                   /db_xref="GOA:Q757S1"
FT                   /db_xref="InterPro:IPR001754"
FT                   /db_xref="InterPro:IPR011060"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR014732"
FT                   /db_xref="InterPro:IPR018089"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757S1"
FT                   /protein_id="AAS52626.1"
FT   gene            <527133..>527396
FT                   /locus_tag="AGOS_AEL058W"
FT                   /old_locus_tag="AEL058W"
FT   mRNA            <527133..>527396
FT                   /locus_tag="AGOS_AEL058W"
FT                   /old_locus_tag="AEL058W"
FT                   /product="AEL058Wp"
FT   CDS_pept        527133..527396
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL058W"
FT                   /old_locus_tag="AEL058W"
FT                   /product="AEL058Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YEL020W-A (TIM9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL058W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52627"
FT                   /db_xref="GOA:Q757S0"
FT                   /db_xref="InterPro:IPR004217"
FT                   /db_xref="InterPro:IPR035427"
FT                   /db_xref="InterPro:IPR039094"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757S0"
FT                   /protein_id="AAS52627.1"
FT   gene            complement(<527582..>529255)
FT                   /locus_tag="AGOS_AEL057C"
FT                   /old_locus_tag="AEL057C"
FT   mRNA            complement(<527582..>529255)
FT                   /locus_tag="AGOS_AEL057C"
FT                   /old_locus_tag="AEL057C"
FT                   /product="AEL057Cp"
FT   CDS_pept        complement(527582..529255)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL057C"
FT                   /old_locus_tag="AEL057C"
FT                   /product="AEL057Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YCR023C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL057C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52628"
FT                   /db_xref="GOA:Q757R9"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q757R9"
FT                   /protein_id="AAS52628.1"
FT   gene            complement(529328..529816)
FT                   /locus_tag="AGOS_AgSNRRPR1"
FT                   /old_locus_tag="AgSNRRPR1"
FT   ncRNA           complement(529328..529816)
FT                   /locus_tag="AGOS_AgSNRRPR1"
FT                   /old_locus_tag="AgSNRRPR1"
FT                   /product="AgSNRRPR1"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNRRPR1; start and end coordinates are approximates. Not in
FT                   synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            <530788..>532752
FT                   /locus_tag="AGOS_AEL056W"
FT                   /old_locus_tag="AEL056W"
FT   mRNA            <530788..>532752
FT                   /locus_tag="AGOS_AEL056W"
FT                   /old_locus_tag="AEL056W"
FT                   /product="AEL056Wp"
FT   CDS_pept        530788..532752
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL056W"
FT                   /old_locus_tag="AEL056W"
FT                   /product="AEL056Wp"
FT                   /note="NOHBY504; No homolog in Saccharomyces cerevisiae;
FT                   Weak similarity to Ashbya gossypii ABL053W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL056W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52629"
FT                   /db_xref="UniProtKB/TrEMBL:Q757R8"
FT                   /protein_id="AAS52629.1"
FT   gene            complement(<533101..>534738)
FT                   /locus_tag="AGOS_AEL055C"
FT                   /old_locus_tag="AEL055C"
FT   mRNA            complement(<533101..>534738)
FT                   /locus_tag="AGOS_AEL055C"
FT                   /old_locus_tag="AEL055C"
FT                   /product="AEL055Cp"
FT   CDS_pept        complement(533101..534738)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL055C"
FT                   /old_locus_tag="AEL055C"
FT                   /product="AEL055Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YEL020C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL055C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52630"
FT                   /db_xref="GOA:Q757R7"
FT                   /db_xref="InterPro:IPR000399"
FT                   /db_xref="InterPro:IPR011766"
FT                   /db_xref="InterPro:IPR012000"
FT                   /db_xref="InterPro:IPR012001"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="InterPro:IPR029061"
FT                   /db_xref="UniProtKB/TrEMBL:Q757R7"
FT                   /protein_id="AAS52630.1"
FT   gene            complement(<534932..>536365)
FT                   /locus_tag="AGOS_AEL054C"
FT                   /old_locus_tag="AEL054C"
FT   mRNA            complement(<534932..>536365)
FT                   /locus_tag="AGOS_AEL054C"
FT                   /old_locus_tag="AEL054C"
FT                   /product="AEL054Cp"
FT   CDS_pept        complement(534932..536365)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL054C"
FT                   /old_locus_tag="AEL054C"
FT                   /product="AEL054Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR024C
FT                   (SLM5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL054C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52631"
FT                   /db_xref="GOA:Q757R6"
FT                   /db_xref="InterPro:IPR002312"
FT                   /db_xref="InterPro:IPR004364"
FT                   /db_xref="InterPro:IPR004522"
FT                   /db_xref="InterPro:IPR006195"
FT                   /db_xref="UniProtKB/TrEMBL:Q757R6"
FT                   /protein_id="AAS52631.1"
FT   gene            complement(<536582..>537217)
FT                   /locus_tag="AGOS_AEL053C"
FT                   /old_locus_tag="AEL053C"
FT   mRNA            complement(<536582..>537217)
FT                   /locus_tag="AGOS_AEL053C"
FT                   /old_locus_tag="AEL053C"
FT                   /product="AEL053Cp"
FT   CDS_pept        complement(536582..537217)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL053C"
FT                   /old_locus_tag="AEL053C"
FT                   /product="AEL053Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL019C
FT                   (MMS21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL053C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52632"
FT                   /db_xref="GOA:Q757R5"
FT                   /db_xref="InterPro:IPR004181"
FT                   /db_xref="InterPro:IPR026846"
FT                   /db_xref="UniProtKB/TrEMBL:Q757R5"
FT                   /protein_id="AAS52632.1"
FT   gene            <537446..>538213
FT                   /locus_tag="AGOS_AEL052W"
FT                   /old_locus_tag="AEL052W"
FT   mRNA            <537446..>538213
FT                   /locus_tag="AGOS_AEL052W"
FT                   /old_locus_tag="AEL052W"
FT                   /product="AEL052Wp"
FT   CDS_pept        537446..538213
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL052W"
FT                   /old_locus_tag="AEL052W"
FT                   /product="AEL052Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL018W
FT                   (EAF5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL052W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52633"
FT                   /db_xref="GOA:Q757R4"
FT                   /db_xref="InterPro:IPR026226"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757R4"
FT                   /protein_id="AAS52633.1"
FT   gene            complement(<538296..>538409)
FT                   /locus_tag="AGOS_AEL051CA"
FT                   /old_locus_tag="AEL051C-A"
FT   mRNA            complement(<538296..>538409)
FT                   /locus_tag="AGOS_AEL051CA"
FT                   /old_locus_tag="AEL051C-A"
FT                   /product="AEL051C-Ap"
FT   CDS_pept        complement(538296..538409)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL051CA"
FT                   /old_locus_tag="AEL051C-A"
FT                   /product="AEL051C-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YCR024C-A (PMP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL051CA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41774"
FT                   /db_xref="GOA:D8FGD1"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGD1"
FT                   /protein_id="ADJ41774.1"
FT   gene            <539150..>540052
FT                   /locus_tag="AGOS_AEL051W"
FT                   /old_locus_tag="AEL051W"
FT   mRNA            <539150..>540052
FT                   /locus_tag="AGOS_AEL051W"
FT                   /old_locus_tag="AEL051W"
FT                   /product="AEL051Wp"
FT   CDS_pept        539150..540052
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL051W"
FT                   /old_locus_tag="AEL051W"
FT                   /product="AEL051Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL017W
FT                   (GTT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL051W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52634"
FT                   /db_xref="GOA:Q757R3"
FT                   /db_xref="InterPro:IPR038872"
FT                   /db_xref="UniProtKB/TrEMBL:Q757R3"
FT                   /protein_id="AAS52634.1"
FT   gene            complement(<540314..>542467)
FT                   /locus_tag="AGOS_AEL050C"
FT                   /old_locus_tag="AEL050C"
FT   mRNA            complement(<540314..>542467)
FT                   /locus_tag="AGOS_AEL050C"
FT                   /old_locus_tag="AEL050C"
FT                   /product="AEL050Cp"
FT   CDS_pept        complement(540314..542467)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL050C"
FT                   /old_locus_tag="AEL050C"
FT                   /product="AEL050Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR026C
FT                   (NPP1) and YEL016C (NPP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL050C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52635"
FT                   /db_xref="GOA:Q757R2"
FT                   /db_xref="InterPro:IPR002591"
FT                   /db_xref="InterPro:IPR017850"
FT                   /db_xref="UniProtKB/TrEMBL:Q757R2"
FT                   /protein_id="AAS52635.1"
FT   gene            <542959..>544566
FT                   /locus_tag="AGOS_AEL049W"
FT                   /old_locus_tag="AEL049W"
FT   mRNA            <542959..>544566
FT                   /locus_tag="AGOS_AEL049W"
FT                   /old_locus_tag="AEL049W"
FT                   /product="AEL049Wp"
FT   CDS_pept        542959..544566
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL049W"
FT                   /old_locus_tag="AEL049W"
FT                   /product="AEL049Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL015W
FT                   (EDC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL049W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52636"
FT                   /db_xref="GOA:Q757R1"
FT                   /db_xref="InterPro:IPR004443"
FT                   /db_xref="InterPro:IPR019050"
FT                   /db_xref="InterPro:IPR025762"
FT                   /db_xref="InterPro:IPR036652"
FT                   /db_xref="UniProtKB/TrEMBL:Q757R1"
FT                   /protein_id="AAS52636.2"
FT                   FAAVRDVFVTEGVVQLTR"
FT   gene            <544884..>546590
FT                   /locus_tag="AGOS_AEL048W"
FT                   /old_locus_tag="AEL048W"
FT   mRNA            <544884..>546590
FT                   /locus_tag="AGOS_AEL048W"
FT                   /old_locus_tag="AEL048W"
FT                   /product="AEL048Wp"
FT   CDS_pept        544884..546590
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL048W"
FT                   /old_locus_tag="AEL048W"
FT                   /product="AEL048Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL013W
FT                   (VAC8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL048W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52637"
FT                   /db_xref="GOA:Q757R0"
FT                   /db_xref="InterPro:IPR000225"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757R0"
FT                   /protein_id="AAS52637.1"
FT   gene            547545..547616
FT                   /locus_tag="AGOS_t0108"
FT   tRNA            547545..547616
FT                   /locus_tag="AGOS_t0108"
FT                   /product="tRNA-Met"
FT                   /note="codon recognized: AUG; Initiator tRNA"
FT   gene            complement(<547669..>548007)
FT                   /locus_tag="AGOS_AEL047C"
FT                   /old_locus_tag="AEL047C"
FT   mRNA            complement(<547669..>548007)
FT                   /locus_tag="AGOS_AEL047C"
FT                   /old_locus_tag="AEL047C"
FT                   /product="AEL047Cp"
FT   CDS_pept        complement(547669..548007)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL047C"
FT                   /old_locus_tag="AEL047C"
FT                   /product="AEL047Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YCR020C-A (MAK31)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL047C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52638"
FT                   /db_xref="GOA:Q757Q9"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR034110"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Q9"
FT                   /protein_id="AAS52638.1"
FT                   SAFRRAVA"
FT   gene            <548086..>548292
FT                   /locus_tag="AGOS_AEL046W"
FT                   /old_locus_tag="AEL046W"
FT   mRNA            <548086..>548292
FT                   /locus_tag="AGOS_AEL046W"
FT                   /old_locus_tag="AEL046W"
FT                   /product="AEL046Wp"
FT   CDS_pept        548086..548292
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL046W"
FT                   /old_locus_tag="AEL046W"
FT                   /product="AEL046Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YCR020W-B (HTL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL046W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52639"
FT                   /db_xref="GOA:Q757Q8"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Q8"
FT                   /protein_id="AAS52639.1"
FT   gene            <548573..>549271
FT                   /locus_tag="AGOS_AEL045W"
FT                   /old_locus_tag="AEL045W"
FT   mRNA            join(<548573..548577,548641..>549271)
FT                   /locus_tag="AGOS_AEL045W"
FT                   /old_locus_tag="AEL045W"
FT                   /product="AEL045Wp"
FT   CDS_pept        join(548573..548577,548641..549271)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL045W"
FT                   /old_locus_tag="AEL045W"
FT                   /product="AEL045Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL012W
FT                   (UBC8); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL045W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52640"
FT                   /db_xref="GOA:Q757Q7"
FT                   /db_xref="InterPro:IPR000608"
FT                   /db_xref="InterPro:IPR016135"
FT                   /db_xref="InterPro:IPR023313"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Q7"
FT                   /protein_id="AAS52640.1"
FT   gene            <549753..>551864
FT                   /locus_tag="AGOS_AEL044W"
FT                   /old_locus_tag="AEL044W"
FT   mRNA            <549753..>551864
FT                   /locus_tag="AGOS_AEL044W"
FT                   /old_locus_tag="AEL044W"
FT                   /product="AEL044Wp"
FT   CDS_pept        549753..551864
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL044W"
FT                   /old_locus_tag="AEL044W"
FT                   /product="AEL044Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YEL011W
FT                   (GLC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL044W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52641"
FT                   /db_xref="GOA:Q757Q6"
FT                   /db_xref="InterPro:IPR004193"
FT                   /db_xref="InterPro:IPR006047"
FT                   /db_xref="InterPro:IPR006048"
FT                   /db_xref="InterPro:IPR013780"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR014756"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="InterPro:IPR037439"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757Q6"
FT                   /protein_id="AAS52641.1"
FT                   TALVLARNP"
FT   gene            complement(551994..552066)
FT                   /locus_tag="AGOS_t0109"
FT   tRNA            complement(551994..552066)
FT                   /locus_tag="AGOS_t0109"
FT                   /product="tRNA-Lys"
FT                   /note="codon recognized: AAG"
FT   gene            <552909..>555767
FT                   /locus_tag="AGOS_AEL043W"
FT                   /old_locus_tag="AEL043W"
FT   mRNA            <552909..>555767
FT                   /locus_tag="AGOS_AEL043W"
FT                   /old_locus_tag="AEL043W"
FT                   /product="AEL043Wp"
FT   CDS_pept        552909..555767
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL043W"
FT                   /old_locus_tag="AEL043W"
FT                   /product="AEL043Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR017C
FT                   (CWH43)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL043W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52642"
FT                   /db_xref="GOA:Q757Q5"
FT                   /db_xref="InterPro:IPR019402"
FT                   /db_xref="InterPro:IPR027317"
FT                   /db_xref="InterPro:IPR036691"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Q5"
FT                   /protein_id="AAS52642.2"
FT   gene            complement(<556385..>558028)
FT                   /locus_tag="AGOS_AEL042C"
FT                   /old_locus_tag="AEL042C"
FT   mRNA            complement(<556385..>558028)
FT                   /locus_tag="AGOS_AEL042C"
FT                   /old_locus_tag="AEL042C"
FT                   /product="AEL042Cp"
FT   CDS_pept        complement(556385..558028)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL042C"
FT                   /old_locus_tag="AEL042C"
FT                   /product="AEL042Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL156W
FT                   (HXT11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL042C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52643"
FT                   /db_xref="GOA:Q757Q4"
FT                   /db_xref="InterPro:IPR003663"
FT                   /db_xref="InterPro:IPR005828"
FT                   /db_xref="InterPro:IPR005829"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Q4"
FT                   /protein_id="AAS52643.1"
FT   gene            complement(<558296..>559015)
FT                   /locus_tag="AGOS_AEL041C"
FT                   /old_locus_tag="AEL041C"
FT   mRNA            complement(<558296..>559015)
FT                   /locus_tag="AGOS_AEL041C"
FT                   /old_locus_tag="AEL041C"
FT                   /product="AEL041Cp"
FT   CDS_pept        complement(558296..559015)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL041C"
FT                   /old_locus_tag="AEL041C"
FT                   /product="AEL041Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YCR016W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL041C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52644"
FT                   /db_xref="InterPro:IPR019327"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Q3"
FT                   /protein_id="AAS52644.2"
FT                   FEALSAQSSPSAAPDNI"
FT   gene            559176..559235
FT                   /locus_tag="AGOS_AgSNR33"
FT                   /old_locus_tag="AgSNR33"
FT   ncRNA           559176..559235
FT                   /locus_tag="AGOS_AgSNR33"
FT                   /old_locus_tag="AgSNR33"
FT                   /product="AgSNR33"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR33; start and end coordinates are approximate;
FT                   similarity is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            <559534..>560013
FT                   /locus_tag="AGOS_AEL040W"
FT                   /old_locus_tag="AEL040W"
FT   mRNA            <559534..>560013
FT                   /locus_tag="AGOS_AEL040W"
FT                   /old_locus_tag="AEL040W"
FT                   /product="AEL040Wp"
FT   CDS_pept        559534..560013
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL040W"
FT                   /old_locus_tag="AEL040W"
FT                   /product="AEL040Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YCR015C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL040W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52645"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Q2"
FT                   /protein_id="AAS52645.2"
FT   gene            <560028..>561554
FT                   /locus_tag="AGOS_AEL039W"
FT                   /old_locus_tag="AEL039W"
FT   mRNA            <560028..>561554
FT                   /locus_tag="AGOS_AEL039W"
FT                   /old_locus_tag="AEL039W"
FT                   /product="AEL039Wp"
FT   CDS_pept        560028..561554
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL039W"
FT                   /old_locus_tag="AEL039W"
FT                   /product="AEL039Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR014C
FT                   (POL4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL039W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52646"
FT                   /db_xref="GOA:Q757Q1"
FT                   /db_xref="InterPro:IPR001357"
FT                   /db_xref="InterPro:IPR002008"
FT                   /db_xref="InterPro:IPR002054"
FT                   /db_xref="InterPro:IPR010996"
FT                   /db_xref="InterPro:IPR018944"
FT                   /db_xref="InterPro:IPR022312"
FT                   /db_xref="InterPro:IPR027421"
FT                   /db_xref="InterPro:IPR028207"
FT                   /db_xref="InterPro:IPR029398"
FT                   /db_xref="InterPro:IPR036420"
FT                   /db_xref="InterPro:IPR037160"
FT                   /db_xref="UniProtKB/TrEMBL:Q757Q1"
FT                   /protein_id="AAS52646.1"
FT   gene            complement(<561627..>562973)
FT                   /locus_tag="AGOS_AEL038C"
FT                   /old_locus_tag="AEL038C"
FT   mRNA            complement(<561627..>562973)
FT                   /locus_tag="AGOS_AEL038C"
FT                   /old_locus_tag="AEL038C"
FT                   /product="AEL038Cp"
FT   CDS_pept        complement(561627..562973)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL038C"
FT                   /old_locus_tag="AEL038C"
FT                   /product="AEL038Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR012W
FT                   (PGK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL038C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52647"
FT                   /db_xref="GOA:Q757Q0"
FT                   /db_xref="InterPro:IPR001576"
FT                   /db_xref="InterPro:IPR015824"
FT                   /db_xref="InterPro:IPR015911"
FT                   /db_xref="InterPro:IPR036043"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757Q0"
FT                   /protein_id="AAS52647.2"
FT   gene            <563288..>565171
FT                   /locus_tag="AGOS_AEL037W"
FT   mRNA            <563288..>565171
FT                   /locus_tag="AGOS_AEL037W"
FT                   /product="AEL037Wp"
FT   CDS_pept        563288..565171
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL037W"
FT                   /product="AEL037Wp"
FT                   /note="NOHBY503; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0A10989g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL037W"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41775"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGD2"
FT                   /protein_id="ADJ41775.1"
FT   gene            <565382..>565807
FT                   /locus_tag="AGOS_AEL036W"
FT                   /old_locus_tag="AEL036W"
FT   mRNA            <565382..>565807
FT                   /locus_tag="AGOS_AEL036W"
FT                   /old_locus_tag="AEL036W"
FT                   /product="AEL036Wp"
FT   CDS_pept        565382..565807
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL036W"
FT                   /old_locus_tag="AEL036W"
FT                   /product="AEL036Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL017C
FT                   (GNA1) and YOL024W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL036W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52649"
FT                   /db_xref="UniProtKB/TrEMBL:Q757P8"
FT                   /protein_id="AAS52649.1"
FT   gene            <566014..>567252
FT                   /locus_tag="AGOS_AEL035W"
FT                   /old_locus_tag="AEL035W"
FT   mRNA            <566014..>567252
FT                   /locus_tag="AGOS_AEL035W"
FT                   /old_locus_tag="AEL035W"
FT                   /product="AEL035Wp"
FT   CDS_pept        566014..567252
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL035W"
FT                   /old_locus_tag="AEL035W"
FT                   /product="AEL035Wp"
FT                   /note="NOHBY501; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0A10945g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL035W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52650"
FT                   /db_xref="GOA:Q757P7"
FT                   /db_xref="InterPro:IPR003819"
FT                   /db_xref="InterPro:IPR010376"
FT                   /db_xref="InterPro:IPR012776"
FT                   /db_xref="InterPro:IPR038492"
FT                   /db_xref="InterPro:IPR042098"
FT                   /db_xref="UniProtKB/TrEMBL:Q757P7"
FT                   /protein_id="AAS52650.2"
FT                   VFDREAIKDEIYQ"
FT   gene            <567441..>569456
FT                   /locus_tag="AGOS_AEL034W"
FT                   /old_locus_tag="AEL034W"
FT   mRNA            <567441..>569456
FT                   /locus_tag="AGOS_AEL034W"
FT                   /old_locus_tag="AEL034W"
FT                   /product="AEL034Wp"
FT   CDS_pept        567441..569456
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL034W"
FT                   /old_locus_tag="AEL034W"
FT                   /product="AEL034Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL023W
FT                   (IFM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL034W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52651"
FT                   /db_xref="GOA:Q757P6"
FT                   /db_xref="InterPro:IPR000178"
FT                   /db_xref="InterPro:IPR000795"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR006847"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR015760"
FT                   /db_xref="InterPro:IPR023115"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036925"
FT                   /db_xref="UniProtKB/TrEMBL:Q757P6"
FT                   /protein_id="AAS52651.1"
FT   gene            complement(<569586..>570872)
FT                   /locus_tag="AGOS_AEL033C"
FT                   /old_locus_tag="AEL033C"
FT   mRNA            complement(<569586..>570872)
FT                   /locus_tag="AGOS_AEL033C"
FT                   /old_locus_tag="AEL033C"
FT                   /product="AEL033Cp"
FT   CDS_pept        complement(569586..570872)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL033C"
FT                   /old_locus_tag="AEL033C"
FT                   /product="AEL033Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL022C
FT                   (TSR4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL033C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52652"
FT                   /db_xref="GOA:Q757P5"
FT                   /db_xref="InterPro:IPR007320"
FT                   /db_xref="UniProtKB/TrEMBL:Q757P5"
FT                   /protein_id="AAS52652.2"
FT   gene            571199..571269
FT                   /locus_tag="AGOS_t0110"
FT   tRNA            571199..571269
FT                   /locus_tag="AGOS_t0110"
FT                   /product="tRNA-Gly"
FT                   /note="codon recognized: GGC"
FT   gene            <571391..>573652
FT                   /locus_tag="AGOS_AEL032W"
FT                   /old_locus_tag="AEL032W"
FT   mRNA            <571391..>573652
FT                   /locus_tag="AGOS_AEL032W"
FT                   /old_locus_tag="AEL032W"
FT                   /product="AEL032Wp"
FT   CDS_pept        571391..573652
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL032W"
FT                   /old_locus_tag="AEL032W"
FT                   /product="AEL032Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR009W
FT                   (GCN20)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL032W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52653"
FT                   /db_xref="GOA:Q757P4"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR032781"
FT                   /db_xref="UniProtKB/TrEMBL:Q757P4"
FT                   /protein_id="AAS52653.1"
FT                   "
FT   gene            complement(<573729..>576722)
FT                   /locus_tag="AGOS_AEL031C"
FT                   /old_locus_tag="AEL031C"
FT   mRNA            complement(<573729..>576722)
FT                   /locus_tag="AGOS_AEL031C"
FT                   /old_locus_tag="AEL031C"
FT                   /product="AEL031Cp"
FT   CDS_pept        complement(573729..576722)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL031C"
FT                   /old_locus_tag="AEL031C"
FT                   /product="AEL031Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL021C
FT                   (DIS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL031C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52654"
FT                   /db_xref="GOA:Q757P3"
FT                   /db_xref="InterPro:IPR001900"
FT                   /db_xref="InterPro:IPR002716"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR022966"
FT                   /db_xref="InterPro:IPR029060"
FT                   /db_xref="InterPro:IPR033770"
FT                   /db_xref="InterPro:IPR033771"
FT                   /db_xref="InterPro:IPR041505"
FT                   /db_xref="UniProtKB/TrEMBL:Q757P3"
FT                   /protein_id="AAS52654.1"
FT                   RKAQLLLK"
FT   gene            <576998..>578746
FT                   /locus_tag="AGOS_AEL030W"
FT                   /old_locus_tag="AEL030W"
FT   mRNA            <576998..>578746
FT                   /locus_tag="AGOS_AEL030W"
FT                   /old_locus_tag="AEL030W"
FT                   /product="AEL030Wp"
FT   CDS_pept        576998..578746
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL030W"
FT                   /old_locus_tag="AEL030W"
FT                   /product="AEL030Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL020W
FT                   (TAT2); Newly annotated start codon"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL030W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52655"
FT                   /db_xref="GOA:Q757P2"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="InterPro:IPR004762"
FT                   /db_xref="InterPro:IPR004840"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="UniProtKB/TrEMBL:Q757P2"
FT                   /experiment="RACE determination of 5' region of mRNA"
FT                   /protein_id="AAS52655.3"
FT                   YYHYWC"
FT   gene            <579017..>580597
FT                   /locus_tag="AGOS_AEL029W"
FT                   /old_locus_tag="AEL029W"
FT   mRNA            join(<579017..579032,579138..>580597)
FT                   /locus_tag="AGOS_AEL029W"
FT                   /old_locus_tag="AEL029W"
FT                   /product="AEL029Wp"
FT   CDS_pept        join(579017..579032,579138..580597)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL029W"
FT                   /old_locus_tag="AEL029W"
FT                   /product="AEL029Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR010W
FT                   (UBP6); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL029W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52656"
FT                   /db_xref="GOA:Q757P1"
FT                   /db_xref="InterPro:IPR000626"
FT                   /db_xref="InterPro:IPR001394"
FT                   /db_xref="InterPro:IPR018200"
FT                   /db_xref="InterPro:IPR028889"
FT                   /db_xref="InterPro:IPR029071"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/TrEMBL:Q757P1"
FT                   /protein_id="AAS52656.2"
FT   gene            complement(<580758..>581456)
FT                   /locus_tag="AGOS_AEL028C"
FT                   /old_locus_tag="AEL028C"
FT   mRNA            complement(<580758..>581456)
FT                   /locus_tag="AGOS_AEL028C"
FT                   /old_locus_tag="AEL028C"
FT                   /product="AEL028Cp"
FT   CDS_pept        complement(580758..581456)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL028C"
FT                   /old_locus_tag="AEL028C"
FT                   /product="AEL028Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR011C
FT                   (AIM13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL028C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52657"
FT                   /db_xref="InterPro:IPR012471"
FT                   /db_xref="UniProtKB/TrEMBL:Q757P0"
FT                   /protein_id="AAS52657.2"
FT                   EIQQFKKVAL"
FT   gene            <582081..>584108
FT                   /locus_tag="AGOS_AEL027W"
FT                   /old_locus_tag="AEL027W"
FT   mRNA            <582081..>584108
FT                   /locus_tag="AGOS_AEL027W"
FT                   /old_locus_tag="AEL027W"
FT                   /product="AEL027Wp"
FT   CDS_pept        582081..584108
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL027W"
FT                   /old_locus_tag="AEL027W"
FT                   /product="AEL027Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL019W
FT                   and YFR012W (DCV1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL027W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52658"
FT                   /db_xref="GOA:Q757N9"
FT                   /db_xref="InterPro:IPR009571"
FT                   /db_xref="UniProtKB/TrEMBL:Q757N9"
FT                   /protein_id="AAS52658.2"
FT   gene            complement(<584558..>585607)
FT                   /locus_tag="AGOS_AEL026C"
FT                   /old_locus_tag="AEL026C"
FT   mRNA            complement(<584558..>585607)
FT                   /locus_tag="AGOS_AEL026C"
FT                   /old_locus_tag="AEL026C"
FT                   /product="AEL026Cp"
FT   CDS_pept        complement(584558..585607)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL026C"
FT                   /old_locus_tag="AEL026C"
FT                   /product="AEL026Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL018C
FT                   (TLG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL026C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52659"
FT                   /db_xref="GOA:Q757N8"
FT                   /db_xref="InterPro:IPR000727"
FT                   /db_xref="InterPro:IPR006012"
FT                   /db_xref="InterPro:IPR010989"
FT                   /db_xref="InterPro:IPR028673"
FT                   /db_xref="UniProtKB/TrEMBL:Q757N8"
FT                   /protein_id="AAS52659.2"
FT                   EDRPAEDRN"
FT   gene            585729..585813
FT                   /locus_tag="AGOS_t0111"
FT   tRNA            join(585729..585767,585778..585813)
FT                   /locus_tag="AGOS_t0111"
FT                   /product="tRNA-Tyr"
FT                   /note="codon recognized: UAC"
FT   gene            <586077..>587687
FT                   /locus_tag="AGOS_AEL025W"
FT                   /old_locus_tag="AEL025W"
FT   mRNA            <586077..>587687
FT                   /locus_tag="AGOS_AEL025W"
FT                   /old_locus_tag="AEL025W"
FT                   /product="AEL025Wp"
FT   CDS_pept        586077..587687
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL025W"
FT                   /old_locus_tag="AEL025W"
FT                   /product="AEL025Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR028C
FT                   (CDC14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL025W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52660"
FT                   /db_xref="GOA:Q757N7"
FT                   /db_xref="InterPro:IPR000340"
FT                   /db_xref="InterPro:IPR000387"
FT                   /db_xref="InterPro:IPR016130"
FT                   /db_xref="InterPro:IPR020422"
FT                   /db_xref="InterPro:IPR026070"
FT                   /db_xref="InterPro:IPR029021"
FT                   /db_xref="InterPro:IPR029260"
FT                   /db_xref="UniProtKB/TrEMBL:Q757N7"
FT                   /protein_id="AAS52660.2"
FT   gene            complement(<587963..>588763)
FT                   /locus_tag="AGOS_AEL024C"
FT                   /old_locus_tag="AEL024C"
FT   mRNA            complement(<587963..>588763)
FT                   /locus_tag="AGOS_AEL024C"
FT                   /old_locus_tag="AEL024C"
FT                   /product="AEL024Cp"
FT   CDS_pept        complement(587963..588763)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL024C"
FT                   /old_locus_tag="AEL024C"
FT                   /product="AEL024Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR027W
FT                   (ECO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL024C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52661"
FT                   /db_xref="GOA:Q757N6"
FT                   /db_xref="InterPro:IPR000182"
FT                   /db_xref="InterPro:IPR016181"
FT                   /db_xref="InterPro:IPR028005"
FT                   /db_xref="InterPro:IPR028009"
FT                   /db_xref="InterPro:IPR033257"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757N6"
FT                   /protein_id="AAS52661.2"
FT   gene            complement(<589141..>593517)
FT                   /locus_tag="AGOS_AEL023C"
FT                   /old_locus_tag="AEL023C"
FT   mRNA            complement(<589141..>593517)
FT                   /locus_tag="AGOS_AEL023C"
FT                   /old_locus_tag="AEL023C"
FT                   /product="AEL023Cp"
FT   CDS_pept        complement(589141..593517)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL023C"
FT                   /old_locus_tag="AEL023C"
FT                   /product="AEL023Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIR019C (MUC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL023C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52662"
FT                   /db_xref="InterPro:IPR018789"
FT                   /db_xref="UniProtKB/TrEMBL:Q757N5"
FT                   /protein_id="AAS52662.2"
FT   gene            <594169..>595203
FT                   /locus_tag="AGOS_AEL022W"
FT                   /old_locus_tag="AEL022W"
FT   mRNA            <594169..>595203
FT                   /locus_tag="AGOS_AEL022W"
FT                   /old_locus_tag="AEL022W"
FT                   /product="AEL022Wp"
FT   CDS_pept        594169..595203
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL022W"
FT                   /old_locus_tag="AEL022W"
FT                   /product="AEL022Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR025C
FT                   (HIS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL022W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52663"
FT                   /db_xref="GOA:Q757N4"
FT                   /db_xref="InterPro:IPR004013"
FT                   /db_xref="InterPro:IPR010140"
FT                   /db_xref="InterPro:IPR016195"
FT                   /db_xref="UniProtKB/TrEMBL:Q757N4"
FT                   /protein_id="AAS52663.2"
FT                   RFWK"
FT   gene            complement(<595323..>597335)
FT                   /locus_tag="AGOS_AEL021C"
FT                   /old_locus_tag="AEL021C"
FT   mRNA            complement(<595323..>597335)
FT                   /locus_tag="AGOS_AEL021C"
FT                   /old_locus_tag="AEL021C"
FT                   /product="AEL021Cp"
FT   CDS_pept        complement(595323..597335)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL021C"
FT                   /old_locus_tag="AEL021C"
FT                   /product="AEL021Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHR020W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL021C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52664"
FT                   /db_xref="GOA:Q757N3"
FT                   /db_xref="InterPro:IPR002314"
FT                   /db_xref="InterPro:IPR002316"
FT                   /db_xref="InterPro:IPR004154"
FT                   /db_xref="InterPro:IPR004499"
FT                   /db_xref="InterPro:IPR006195"
FT                   /db_xref="InterPro:IPR016061"
FT                   /db_xref="InterPro:IPR017449"
FT                   /db_xref="InterPro:IPR033721"
FT                   /db_xref="InterPro:IPR036621"
FT                   /db_xref="InterPro:IPR036754"
FT                   /db_xref="UniProtKB/TrEMBL:Q757N3"
FT                   /protein_id="AAS52664.1"
FT   gene            <597558..>599213
FT                   /locus_tag="AGOS_AEL020W"
FT                   /old_locus_tag="AEL020W"
FT   mRNA            <597558..>599213
FT                   /locus_tag="AGOS_AEL020W"
FT                   /old_locus_tag="AEL020W"
FT                   /product="AEL020Wp"
FT   CDS_pept        597558..599213
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL020W"
FT                   /old_locus_tag="AEL020W"
FT                   /product="AEL020Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR019C
FT                   (DED81)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL020W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52665"
FT                   /db_xref="GOA:Q757N2"
FT                   /db_xref="InterPro:IPR002312"
FT                   /db_xref="InterPro:IPR004364"
FT                   /db_xref="InterPro:IPR004365"
FT                   /db_xref="InterPro:IPR004522"
FT                   /db_xref="InterPro:IPR006195"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="UniProtKB/TrEMBL:Q757N2"
FT                   /protein_id="AAS52665.2"
FT   gene            <599599..>601008
FT                   /locus_tag="AGOS_AEL019W"
FT                   /old_locus_tag="AEL019W"
FT   mRNA            <599599..>601008
FT                   /locus_tag="AGOS_AEL019W"
FT                   /old_locus_tag="AEL019W"
FT                   /product="AEL019Wp"
FT   CDS_pept        599599..601008
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL019W"
FT                   /old_locus_tag="AEL019W"
FT                   /product="AEL019Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR018C
FT                   (ARG4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL019W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52666"
FT                   /db_xref="GOA:Q757L9"
FT                   /db_xref="InterPro:IPR000362"
FT                   /db_xref="InterPro:IPR008948"
FT                   /db_xref="InterPro:IPR009049"
FT                   /db_xref="InterPro:IPR020557"
FT                   /db_xref="InterPro:IPR022761"
FT                   /db_xref="InterPro:IPR024083"
FT                   /db_xref="InterPro:IPR029419"
FT                   /db_xref="UniProtKB/TrEMBL:Q757L9"
FT                   /protein_id="AAS52666.1"
FT                   EEQLKRMHNNT"
FT   gene            complement(<601134..>602285)
FT                   /locus_tag="AGOS_AEL018C"
FT                   /old_locus_tag="AEL018C"
FT   mRNA            complement(<601134..>602285)
FT                   /locus_tag="AGOS_AEL018C"
FT                   /old_locus_tag="AEL018C"
FT                   /product="AEL018Cp"
FT   CDS_pept        complement(601134..602285)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL018C"
FT                   /old_locus_tag="AEL018C"
FT                   /product="AEL018Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR017W
FT                   (YSC83)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL018C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52667"
FT                   /db_xref="InterPro:IPR013952"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q757L8"
FT                   /protein_id="AAS52667.1"
FT   gene            <602492..>603843
FT                   /locus_tag="AGOS_AEL017W"
FT                   /old_locus_tag="AEL017W"
FT   mRNA            join(<602492..602538,602640..>603843)
FT                   /locus_tag="AGOS_AEL017W"
FT                   /old_locus_tag="AEL017W"
FT                   /product="AEL017Wp"
FT   CDS_pept        join(602492..602538,602640..603843)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL017W"
FT                   /old_locus_tag="AEL017W"
FT                   /product="AEL017Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YFR024C-A (LSB3) and YHR016C (YSC84); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL017W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52668"
FT                   /db_xref="GOA:Q757L7"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR007461"
FT                   /db_xref="InterPro:IPR033643"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="UniProtKB/TrEMBL:Q757L7"
FT                   /protein_id="AAS52668.1"
FT                   RINGQEGIFPANYVDLV"
FT   gene            complement(<604193..>606229)
FT                   /locus_tag="AGOS_AEL016C"
FT                   /old_locus_tag="AEL016C"
FT   mRNA            complement(<604193..>606229)
FT                   /locus_tag="AGOS_AEL016C"
FT                   /old_locus_tag="AEL016C"
FT                   /product="AEL016Cp"
FT   CDS_pept        complement(604193..606229)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL016C"
FT                   /old_locus_tag="AEL016C"
FT                   /product="AEL016Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR023W
FT                   (PES4) and YHR015W (MIP6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL016C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52669"
FT                   /db_xref="GOA:Q757M4"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q757M4"
FT                   /protein_id="AAS52669.2"
FT   gene            complement(607290..607362)
FT                   /locus_tag="AGOS_t0112"
FT   tRNA            complement(607290..607362)
FT                   /locus_tag="AGOS_t0112"
FT                   /product="tRNA-Ala"
FT                   /note="codon recognized: GCU"
FT   gene            <607707..>609074
FT                   /locus_tag="AGOS_AEL015W"
FT                   /old_locus_tag="AEL015W"
FT   mRNA            <607707..>609074
FT                   /locus_tag="AGOS_AEL015W"
FT                   /old_locus_tag="AEL015W"
FT                   /product="AEL015Wp"
FT   CDS_pept        607707..609074
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL015W"
FT                   /old_locus_tag="AEL015W"
FT                   /product="AEL015Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL069W
FT                   (NUF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL015W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52670"
FT                   /db_xref="GOA:Q757M3"
FT                   /db_xref="InterPro:IPR005549"
FT                   /db_xref="InterPro:IPR038275"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757M3"
FT                   /protein_id="AAS52670.1"
FT   gene            complement(<609119..>609886)
FT                   /locus_tag="AGOS_AEL014C"
FT                   /old_locus_tag="AEL014C"
FT   mRNA            complement(<609119..>609886)
FT                   /locus_tag="AGOS_AEL014C"
FT                   /old_locus_tag="AEL014C"
FT                   /product="AEL014Cp"
FT   CDS_pept        complement(609119..609886)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL014C"
FT                   /old_locus_tag="AEL014C"
FT                   /product="AEL014Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL043C
FT                   (PRP11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL014C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52671"
FT                   /db_xref="GOA:Q757M2"
FT                   /db_xref="InterPro:IPR003604"
FT                   /db_xref="InterPro:IPR031781"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q757M2"
FT                   /protein_id="AAS52671.1"
FT   gene            complement(<610209..>611888)
FT                   /locus_tag="AGOS_AEL013C"
FT                   /old_locus_tag="AEL013C"
FT   mRNA            complement(<610209..>611888)
FT                   /locus_tag="AGOS_AEL013C"
FT                   /old_locus_tag="AEL013C"
FT                   /product="AEL013Cp"
FT   CDS_pept        complement(610209..611888)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL013C"
FT                   /old_locus_tag="AEL013C"
FT                   /product="AEL013Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL042C
FT                   (SIR2) and YOL068C (HST1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL013C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52672"
FT                   /db_xref="GOA:Q757M7"
FT                   /db_xref="InterPro:IPR003000"
FT                   /db_xref="InterPro:IPR007654"
FT                   /db_xref="InterPro:IPR026590"
FT                   /db_xref="InterPro:IPR026591"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757M7"
FT                   /protein_id="AAS52672.1"
FT   gene            complement(<612182..>612748)
FT                   /locus_tag="AGOS_AEL012C"
FT                   /old_locus_tag="AEL012C"
FT   mRNA            complement(<612182..>612748)
FT                   /locus_tag="AGOS_AEL012C"
FT                   /old_locus_tag="AEL012C"
FT                   /product="AEL012Cp"
FT   CDS_pept        complement(612182..612748)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL012C"
FT                   /old_locus_tag="AEL012C"
FT                   /product="AEL012Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL067C
FT                   (RTG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL012C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52673"
FT                   /db_xref="GOA:Q757M6"
FT                   /db_xref="InterPro:IPR011598"
FT                   /db_xref="InterPro:IPR036638"
FT                   /db_xref="UniProtKB/TrEMBL:Q757M6"
FT                   /protein_id="AAS52673.1"
FT   gene            <612964..>614277
FT                   /locus_tag="AGOS_AEL011W"
FT                   /old_locus_tag="AEL011W"
FT   mRNA            <612964..>614277
FT                   /locus_tag="AGOS_AEL011W"
FT                   /old_locus_tag="AEL011W"
FT                   /product="AEL011Wp"
FT   CDS_pept        612964..614277
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL011W"
FT                   /old_locus_tag="AEL011W"
FT                   /product="AEL011Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL007W
FT                   (RPT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL011W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52674"
FT                   /db_xref="GOA:Q757M5"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR005937"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR032501"
FT                   /db_xref="InterPro:IPR035244"
FT                   /db_xref="InterPro:IPR041569"
FT                   /db_xref="UniProtKB/TrEMBL:Q757M5"
FT                   /protein_id="AAS52674.1"
FT   gene            <614734..>615753
FT                   /locus_tag="AGOS_AEL010W"
FT                   /old_locus_tag="AEL010W"
FT   mRNA            <614734..>615753
FT                   /locus_tag="AGOS_AEL010W"
FT                   /old_locus_tag="AEL010W"
FT                   /product="AEL010Wp"
FT   CDS_pept        614734..615753
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL010W"
FT                   /old_locus_tag="AEL010W"
FT                   /product="AEL010Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL006W
FT                   (PTC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL010W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52675"
FT                   /db_xref="GOA:Q757M1"
FT                   /db_xref="InterPro:IPR000222"
FT                   /db_xref="InterPro:IPR001932"
FT                   /db_xref="InterPro:IPR015655"
FT                   /db_xref="InterPro:IPR036457"
FT                   /db_xref="UniProtKB/TrEMBL:Q757M1"
FT                   /protein_id="AAS52675.2"
FT   gene            complement(<615924..>616955)
FT                   /locus_tag="AGOS_AEL009C"
FT                   /old_locus_tag="AEL009C"
FT   mRNA            complement(<615924..>616955)
FT                   /locus_tag="AGOS_AEL009C"
FT                   /old_locus_tag="AEL009C"
FT                   /product="AEL009Cp"
FT   CDS_pept        complement(615924..616955)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL009C"
FT                   /old_locus_tag="AEL009C"
FT                   /product="AEL009Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL005C
FT                   (MED2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL009C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52676"
FT                   /db_xref="GOA:Q757M0"
FT                   /db_xref="InterPro:IPR021017"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757M0"
FT                   /protein_id="AAS52676.1"
FT                   FNI"
FT   gene            <617521..>617997
FT                   /locus_tag="AGOS_AEL008W"
FT                   /old_locus_tag="AEL008W"
FT   mRNA            <617521..>617997
FT                   /locus_tag="AGOS_AEL008W"
FT                   /old_locus_tag="AEL008W"
FT                   /product="AEL008Wp"
FT   CDS_pept        617521..617997
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL008W"
FT                   /old_locus_tag="AEL008W"
FT                   /product="AEL008Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL004W
FT                   (ATP16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL008W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52677"
FT                   /db_xref="GOA:Q757N0"
FT                   /db_xref="InterPro:IPR001469"
FT                   /db_xref="InterPro:IPR020546"
FT                   /db_xref="InterPro:IPR036771"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757N0"
FT                   /protein_id="AAS52677.1"
FT   gene            <618517..>620310
FT                   /locus_tag="AGOS_AEL007W"
FT                   /old_locus_tag="AEL007W"
FT   mRNA            <618517..>620310
FT                   /locus_tag="AGOS_AEL007W"
FT                   /old_locus_tag="AEL007W"
FT                   /product="AEL007Wp"
FT   CDS_pept        618517..620310
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL007W"
FT                   /old_locus_tag="AEL007W"
FT                   /product="AEL007Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL003W
FT                   (MCD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL007W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52678"
FT                   /db_xref="GOA:Q757M9"
FT                   /db_xref="InterPro:IPR006909"
FT                   /db_xref="InterPro:IPR006910"
FT                   /db_xref="InterPro:IPR023093"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="InterPro:IPR039781"
FT                   /db_xref="UniProtKB/TrEMBL:Q757M9"
FT                   /protein_id="AAS52678.2"
FT   gene            <620573..>628048
FT                   /locus_tag="AGOS_AEL006W"
FT                   /old_locus_tag="AEL006W"
FT   mRNA            <620573..>628048
FT                   /locus_tag="AGOS_AEL006W"
FT                   /old_locus_tag="AEL006W"
FT                   /product="AEL006Wp"
FT   CDS_pept        620573..628048
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL006W"
FT                   /old_locus_tag="AEL006W"
FT                   /product="AEL006Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL004W
FT                   (UTP20)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL006W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52679"
FT                   /db_xref="GOA:Q757M8"
FT                   /db_xref="InterPro:IPR011430"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q757M8"
FT                   /protein_id="AAS52679.2"
FT   gene            complement(<628253..>628930)
FT                   /locus_tag="AGOS_AEL005C"
FT                   /old_locus_tag="AEL005C"
FT   mRNA            complement(<628253..>628930)
FT                   /locus_tag="AGOS_AEL005C"
FT                   /old_locus_tag="AEL005C"
FT                   /product="AEL005Cp"
FT   CDS_pept        complement(628253..628930)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL005C"
FT                   /old_locus_tag="AEL005C"
FT                   /product="AEL005Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL002C
FT                   (NHP10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL005C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52680"
FT                   /db_xref="GOA:Q757L6"
FT                   /db_xref="InterPro:IPR009071"
FT                   /db_xref="InterPro:IPR030483"
FT                   /db_xref="InterPro:IPR036910"
FT                   /db_xref="UniProtKB/TrEMBL:Q757L6"
FT                   /protein_id="AAS52680.2"
FT                   SEM"
FT   gene            <629314..>630741
FT                   /locus_tag="AGOS_AEL004W"
FT                   /old_locus_tag="AEL004W"
FT   mRNA            <629314..>630741
FT                   /locus_tag="AGOS_AEL004W"
FT                   /old_locus_tag="AEL004W"
FT                   /product="AEL004Wp"
FT   CDS_pept        629314..630741
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL004W"
FT                   /old_locus_tag="AEL004W"
FT                   /product="AEL004Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL001W
FT                   (RMD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL004W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52681"
FT                   /db_xref="GOA:Q757L5"
FT                   /db_xref="InterPro:IPR003734"
FT                   /db_xref="UniProtKB/TrEMBL:Q757L5"
FT                   /protein_id="AAS52681.1"
FT                   VLISVVNIIVDIVADTK"
FT   gene            complement(<630921..>631316)
FT                   /locus_tag="AGOS_AEL003C"
FT                   /old_locus_tag="AEL003C"
FT   mRNA            complement(<630921..>631316)
FT                   /locus_tag="AGOS_AEL003C"
FT                   /old_locus_tag="AEL003C"
FT                   /product="AEL003Cp"
FT   CDS_pept        complement(630921..631316)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL003C"
FT                   /old_locus_tag="AEL003C"
FT                   /product="AEL003Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL003C
FT                   (HTA2)"
FT                   /db_xref="GOA:Q757L4"
FT                   /db_xref="InterPro:IPR002119"
FT                   /db_xref="InterPro:IPR007125"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="InterPro:IPR032454"
FT                   /db_xref="InterPro:IPR032458"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757L4"
FT                   /protein_id="AAS52682.1"
FT   gene            <631902..>632285
FT                   /locus_tag="AGOS_AEL002W"
FT                   /old_locus_tag="AEL002W"
FT   mRNA            <631902..>632285
FT                   /locus_tag="AGOS_AEL002W"
FT                   /old_locus_tag="AEL002W"
FT                   /product="AEL002Wp"
FT   CDS_pept        631902..632285
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL002W"
FT                   /old_locus_tag="AEL002W"
FT                   /product="AEL002Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL002W
FT                   (HTB2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL002W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52683"
FT                   /db_xref="GOA:Q8J1F8"
FT                   /db_xref="InterPro:IPR000558"
FT                   /db_xref="InterPro:IPR007125"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8J1F8"
FT                   /protein_id="AAS52683.1"
FT   gene            complement(<632504..>632879)
FT                   /locus_tag="AGOS_AEL001C"
FT                   /old_locus_tag="AEL001C"
FT   mRNA            complement(join(<632504..632779,632838..>632879))
FT                   /locus_tag="AGOS_AEL001C"
FT                   /old_locus_tag="AEL001C"
FT                   /product="AEL001Cp"
FT   CDS_pept        complement(join(632504..632779,632838..632879))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AEL001C"
FT                   /old_locus_tag="AEL001C"
FT                   /product="AEL001Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL001C
FT                   (ECM15); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AEL001C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52684"
FT                   /db_xref="InterPro:IPR002767"
FT                   /db_xref="InterPro:IPR029756"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8J1F7"
FT                   /protein_id="AAS52684.1"
FT                   Y"
FT   centromere      633935..634125
FT                   /note="Chromosome V centromere"
FT   centromere      633935..633944
FT                   /note="Chromosome V centromere CDE I element"
FT   centromere      633945..634107
FT                   /note="Chromosome V centromere CDE II element"
FT   centromere      634108..634125
FT                   /note="Chromosome V centromere CDE III element"
FT   gene            complement(<634510..>636726)
FT                   /locus_tag="AGOS_AER001C"
FT                   /old_locus_tag="AER001C"
FT   mRNA            complement(<634510..>636726)
FT                   /locus_tag="AGOS_AER001C"
FT                   /old_locus_tag="AER001C"
FT                   /product="AER001Cp"
FT   CDS_pept        complement(634510..636726)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER001C"
FT                   /old_locus_tag="AER001C"
FT                   /product="AER001Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR001C
FT                   (NTH2) and YDR001C (NTH1)"
FT                   /db_xref="GOA:Q757L1"
FT                   /db_xref="InterPro:IPR001661"
FT                   /db_xref="InterPro:IPR008928"
FT                   /db_xref="InterPro:IPR011120"
FT                   /db_xref="InterPro:IPR012341"
FT                   /db_xref="InterPro:IPR018232"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757L1"
FT                   /protein_id="AAS52685.1"
FT   gene            <637287..>637919
FT                   /locus_tag="AGOS_AER002W"
FT                   /old_locus_tag="AER002W"
FT   mRNA            <637287..>637919
FT                   /locus_tag="AGOS_AER002W"
FT                   /old_locus_tag="AER002W"
FT                   /product="AER002Wp"
FT   CDS_pept        637287..637919
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER002W"
FT                   /old_locus_tag="AER002W"
FT                   /product="AER002Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR002W
FT                   (YRB1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER002W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52686"
FT                   /db_xref="GOA:Q757L0"
FT                   /db_xref="InterPro:IPR000156"
FT                   /db_xref="InterPro:IPR011993"
FT                   /db_xref="UniProtKB/TrEMBL:Q757L0"
FT                   /protein_id="AAS52686.2"
FT   gene            complement(<638023..>638847)
FT                   /locus_tag="AGOS_AER003C"
FT                   /old_locus_tag="AER003C"
FT   mRNA            complement(<638023..>638847)
FT                   /locus_tag="AGOS_AER003C"
FT                   /old_locus_tag="AER003C"
FT                   /product="AER003Cp"
FT   CDS_pept        complement(638023..638847)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER003C"
FT                   /old_locus_tag="AER003C"
FT                   /product="AER003Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR002C
FT                   (RER2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER003C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52687"
FT                   /db_xref="GOA:Q757K9"
FT                   /db_xref="InterPro:IPR001441"
FT                   /db_xref="InterPro:IPR018520"
FT                   /db_xref="InterPro:IPR036424"
FT                   /db_xref="UniProtKB/TrEMBL:Q757K9"
FT                   /protein_id="AAS52687.1"
FT   gene            <639098..>640525
FT                   /locus_tag="AGOS_AER004W"
FT                   /old_locus_tag="AER004W"
FT   mRNA            <639098..>640525
FT                   /locus_tag="AGOS_AER004W"
FT                   /old_locus_tag="AER004W"
FT                   /product="AER004Wp"
FT   CDS_pept        639098..640525
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER004W"
FT                   /old_locus_tag="AER004W"
FT                   /product="AER004Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR003W
FT                   (COQ1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER004W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52688"
FT                   /db_xref="GOA:Q757K8"
FT                   /db_xref="InterPro:IPR000092"
FT                   /db_xref="InterPro:IPR008949"
FT                   /db_xref="InterPro:IPR033749"
FT                   /db_xref="UniProtKB/TrEMBL:Q757K8"
FT                   /protein_id="AAS52688.2"
FT                   SRAALEFLTNSILTRRK"
FT   gene            complement(<640753..>642036)
FT                   /locus_tag="AGOS_AER005C"
FT                   /old_locus_tag="AER005C"
FT   mRNA            complement(<640753..>642036)
FT                   /locus_tag="AGOS_AER005C"
FT                   /old_locus_tag="AER005C"
FT                   /product="AER005Cp"
FT   CDS_pept        complement(640753..642036)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER005C"
FT                   /old_locus_tag="AER005C"
FT                   /product="AER005Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR004C
FT                   (GPI18)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER005C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52689"
FT                   /db_xref="GOA:Q757K7"
FT                   /db_xref="InterPro:IPR007315"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757K7"
FT                   /protein_id="AAS52689.1"
FT   gene            <642949..>643482
FT                   /locus_tag="AGOS_AER006W"
FT                   /old_locus_tag="AER006W"
FT   mRNA            <642949..>643482
FT                   /locus_tag="AGOS_AER006W"
FT                   /old_locus_tag="AER006W"
FT                   /product="AER006Wp"
FT   CDS_pept        642949..643482
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER006W"
FT                   /old_locus_tag="AER006W"
FT                   /product="AER006Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR005W
FT                   (RCR1) and YDR003W (RCR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER006W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52690"
FT                   /db_xref="GOA:Q757K6"
FT                   /db_xref="InterPro:IPR020999"
FT                   /db_xref="UniProtKB/TrEMBL:Q757K6"
FT                   /protein_id="AAS52690.1"
FT                   MPGVTDSGAHYYAP"
FT   gene            <643863..>645350
FT                   /locus_tag="AGOS_AER007W"
FT                   /old_locus_tag="AER007W"
FT   mRNA            <643863..>645350
FT                   /locus_tag="AGOS_AER007W"
FT                   /old_locus_tag="AER007W"
FT                   /product="AER007Wp"
FT   CDS_pept        643863..645350
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER007W"
FT                   /old_locus_tag="AER007W"
FT                   /product="AER007Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR006W
FT                   (UGA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER007W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52691"
FT                   /db_xref="GOA:Q757K5"
FT                   /db_xref="InterPro:IPR010102"
FT                   /db_xref="InterPro:IPR015590"
FT                   /db_xref="InterPro:IPR016161"
FT                   /db_xref="InterPro:IPR016162"
FT                   /db_xref="InterPro:IPR016163"
FT                   /db_xref="InterPro:IPR029510"
FT                   /db_xref="UniProtKB/TrEMBL:Q757K5"
FT                   /protein_id="AAS52691.1"
FT   gene            <645585..>647117
FT                   /locus_tag="AGOS_AER008W"
FT                   /old_locus_tag="AER008W"
FT   mRNA            <645585..>647117
FT                   /locus_tag="AGOS_AER008W"
FT                   /old_locus_tag="AER008W"
FT                   /product="AER008Wp"
FT   CDS_pept        645585..647117
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER008W"
FT                   /old_locus_tag="AER008W"
FT                   /product="AER008Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR004W
FT                   (RAD57)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER008W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52692"
FT                   /db_xref="GOA:Q757K4"
FT                   /db_xref="InterPro:IPR013632"
FT                   /db_xref="InterPro:IPR020588"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q757K4"
FT                   /protein_id="AAS52692.1"
FT   gene            complement(<647414..>648763)
FT                   /locus_tag="AGOS_AER009C"
FT                   /old_locus_tag="AER009C"
FT   mRNA            complement(join(<647414..648601,648758..>648763))
FT                   /locus_tag="AGOS_AER009C"
FT                   /old_locus_tag="AER009C"
FT                   /product="AER009Cp"
FT   CDS_pept        complement(join(647414..648601,648758..648763))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER009C"
FT                   /old_locus_tag="AER009C"
FT                   /product="AER009Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR005C
FT                   (MAF1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER009C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52693"
FT                   /db_xref="GOA:Q757K3"
FT                   /db_xref="InterPro:IPR015257"
FT                   /db_xref="InterPro:IPR038564"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757K3"
FT                   /protein_id="AAS52693.1"
FT   gene            649057..649128
FT                   /locus_tag="AGOS_t0113"
FT   tRNA            649057..649128
FT                   /locus_tag="AGOS_t0113"
FT                   /product="tRNA-Glu"
FT                   /note="codon recognized: GAG"
FT   gene            complement(<649250..>651544)
FT                   /locus_tag="AGOS_AER010C"
FT                   /old_locus_tag="AER010C"
FT   mRNA            complement(<649250..>651544)
FT                   /locus_tag="AGOS_AER010C"
FT                   /old_locus_tag="AER010C"
FT                   /product="AER010Cp"
FT   CDS_pept        complement(649250..651544)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER010C"
FT                   /old_locus_tag="AER010C"
FT                   /product="AER010Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR007C
FT                   (DSF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER010C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52694"
FT                   /db_xref="GOA:Q757K2"
FT                   /db_xref="InterPro:IPR006597"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/TrEMBL:Q757K2"
FT                   /protein_id="AAS52694.2"
FT                   ATPPVPTKHKP"
FT   gene            complement(<652495..>655164)
FT                   /locus_tag="AGOS_AER011C"
FT                   /old_locus_tag="AER011C"
FT   mRNA            complement(<652495..>655164)
FT                   /locus_tag="AGOS_AER011C"
FT                   /old_locus_tag="AER011C"
FT                   /product="AER011Cp"
FT   CDS_pept        complement(652495..655164)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER011C"
FT                   /old_locus_tag="AER011C"
FT                   /product="AER011Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR006C
FT                   (SOK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER011C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52695"
FT                   /db_xref="GOA:Q757K1"
FT                   /db_xref="InterPro:IPR008862"
FT                   /db_xref="UniProtKB/TrEMBL:Q757K1"
FT                   /protein_id="AAS52695.2"
FT                   SVFGCHYVEALGDNVERI"
FT   gene            complement(<655702..>656013)
FT                   /locus_tag="AGOS_AER012C"
FT                   /old_locus_tag="AER012C"
FT   mRNA            complement(<655702..>656013)
FT                   /locus_tag="AGOS_AER012C"
FT                   /old_locus_tag="AER012C"
FT                   /product="AER012Cp"
FT   CDS_pept        complement(655702..656013)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER012C"
FT                   /old_locus_tag="AER012C"
FT                   /product="AER012Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR009C
FT                   (HHF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER012C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52696"
FT                   /db_xref="GOA:Q75AX1"
FT                   /db_xref="InterPro:IPR001951"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="InterPro:IPR019809"
FT                   /db_xref="InterPro:IPR035425"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q75AX1"
FT                   /protein_id="AAS52696.2"
FT   gene            <656295..>656705
FT                   /locus_tag="AGOS_AER013W"
FT                   /old_locus_tag="AER013W"
FT   mRNA            <656295..>656705
FT                   /locus_tag="AGOS_AER013W"
FT                   /old_locus_tag="AER013W"
FT                   /product="AER013Wp"
FT   CDS_pept        656295..656705
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER013W"
FT                   /old_locus_tag="AER013W"
FT                   /product="AER013Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR010W
FT                   (HHT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER013W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52697"
FT                   /db_xref="GOA:Q757N1"
FT                   /db_xref="InterPro:IPR000164"
FT                   /db_xref="InterPro:IPR007125"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757N1"
FT                   /protein_id="AAS52697.1"
FT   gene            <656845..>657477
FT                   /locus_tag="AGOS_AER014W"
FT                   /old_locus_tag="AER014W"
FT   mRNA            <656845..>657477
FT                   /locus_tag="AGOS_AER014W"
FT                   /old_locus_tag="AER014W"
FT                   /product="AER014Wp"
FT   CDS_pept        656845..657477
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER014W"
FT                   /old_locus_tag="AER014W"
FT                   /product="AER014Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR007W
FT                   (TRP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER014W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52698"
FT                   /db_xref="GOA:Q757J9"
FT                   /db_xref="InterPro:IPR001240"
FT                   /db_xref="InterPro:IPR011060"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757J9"
FT                   /protein_id="AAS52698.1"
FT   gene            complement(<657500..>658363)
FT                   /locus_tag="AGOS_AER015C"
FT                   /old_locus_tag="AER015C"
FT   mRNA            complement(<657500..>658363)
FT                   /locus_tag="AGOS_AER015C"
FT                   /old_locus_tag="AER015C"
FT                   /product="AER015Cp"
FT   CDS_pept        complement(657500..658363)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER015C"
FT                   /old_locus_tag="AER015C"
FT                   /product="AER015Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR011C
FT                   (IPP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER015C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52699"
FT                   /db_xref="GOA:Q757J8"
FT                   /db_xref="InterPro:IPR008162"
FT                   /db_xref="InterPro:IPR036649"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757J8"
FT                   /protein_id="AAS52699.1"
FT                   FISGSA"
FT   gene            658655..658727
FT                   /locus_tag="AGOS_t0114"
FT   tRNA            658655..658727
FT                   /locus_tag="AGOS_t0114"
FT                   /product="tRNA-Thr"
FT                   /note="codon recognized: ACU"
FT   gene            complement(<658761..>659204)
FT                   /locus_tag="AGOS_AER016C"
FT                   /old_locus_tag="AER016C"
FT   mRNA            complement(<658761..>659204)
FT                   /locus_tag="AGOS_AER016C"
FT                   /old_locus_tag="AER016C"
FT                   /product="AER016Cp"
FT   CDS_pept        complement(658761..659204)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER016C"
FT                   /old_locus_tag="AER016C"
FT                   /product="AER016Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL008W
FT                   (APC11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER016C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52700"
FT                   /db_xref="GOA:Q757J7"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR024991"
FT                   /db_xref="UniProtKB/TrEMBL:Q757J7"
FT                   /protein_id="AAS52700.1"
FT   gene            complement(<659326..>659976)
FT                   /locus_tag="AGOS_AER017C"
FT                   /old_locus_tag="AER017C"
FT   mRNA            complement(<659326..>659976)
FT                   /locus_tag="AGOS_AER017C"
FT                   /old_locus_tag="AER017C"
FT                   /product="AER017Cp"
FT   CDS_pept        complement(659326..659976)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER017C"
FT                   /old_locus_tag="AER017C"
FT                   /product="AER017Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL010W
FT                   (GRX6) and YBR014C (GRX7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER017C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52701"
FT                   /db_xref="GOA:Q757J6"
FT                   /db_xref="InterPro:IPR002109"
FT                   /db_xref="InterPro:IPR014025"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q757J6"
FT                   /protein_id="AAS52701.2"
FT   gene            complement(<660224..>662044)
FT                   /locus_tag="AGOS_AER018C"
FT                   /old_locus_tag="AER018C"
FT   mRNA            complement(<660224..>662044)
FT                   /locus_tag="AGOS_AER018C"
FT                   /old_locus_tag="AER018C"
FT                   /product="AER018Cp"
FT   CDS_pept        complement(660224..662044)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER018C"
FT                   /old_locus_tag="AER018C"
FT                   /product="AER018Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR015C
FT                   (MNN2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER018C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52702"
FT                   /db_xref="GOA:Q757J5"
FT                   /db_xref="InterPro:IPR022751"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q757J5"
FT                   /protein_id="AAS52702.1"
FT   gene            <662958..>664064
FT                   /locus_tag="AGOS_AER018WA"
FT   mRNA            <662958..>664064
FT                   /locus_tag="AGOS_AER018WA"
FT                   /product="AER018W-Ap"
FT   CDS_pept        662958..664064
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER018WA"
FT                   /product="AER018W-Ap"
FT                   /note="NOHBY539; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER018WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41776"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGD3"
FT                   /protein_id="ADJ41776.1"
FT   gene            complement(<664087..>666411)
FT                   /locus_tag="AGOS_AER019C"
FT                   /old_locus_tag="AER019C"
FT   mRNA            complement(<664087..>666411)
FT                   /locus_tag="AGOS_AER019C"
FT                   /old_locus_tag="AER019C"
FT                   /product="AER019Cp"
FT   CDS_pept        complement(664087..666411)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER019C"
FT                   /old_locus_tag="AER019C"
FT                   /product="AER019Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL076W
FT                   (MDM20)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER019C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52703"
FT                   /db_xref="GOA:Q757J4"
FT                   /db_xref="InterPro:IPR019183"
FT                   /db_xref="UniProtKB/TrEMBL:Q757J4"
FT                   /protein_id="AAS52703.1"
FT   gene            <666836..>667714
FT                   /locus_tag="AGOS_AER020W"
FT                   /old_locus_tag="AER020W"
FT   mRNA            <666836..>667714
FT                   /locus_tag="AGOS_AER020W"
FT                   /old_locus_tag="AER020W"
FT                   /product="AER020Wp"
FT   CDS_pept        666836..667714
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER020W"
FT                   /old_locus_tag="AER020W"
FT                   /product="AER020Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL077C
FT                   (BRX1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER020W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52704"
FT                   /db_xref="GOA:Q757J3"
FT                   /db_xref="InterPro:IPR007109"
FT                   /db_xref="InterPro:IPR026532"
FT                   /db_xref="UniProtKB/TrEMBL:Q757J3"
FT                   /protein_id="AAS52704.1"
FT                   DPLSNDALFKN"
FT   gene            complement(<667792..>667989)
FT                   /locus_tag="AGOS_AER021C"
FT                   /old_locus_tag="AER021C"
FT   mRNA            complement(<667792..>667989)
FT                   /locus_tag="AGOS_AER021C"
FT                   /old_locus_tag="AER021C"
FT                   /product="AER021Cp"
FT   CDS_pept        complement(667792..667989)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER021C"
FT                   /old_locus_tag="AER021C"
FT                   /product="AER021Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOL077W-A (ATP19)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER021C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52705"
FT                   /db_xref="GOA:Q757J2"
FT                   /db_xref="InterPro:IPR021278"
FT                   /db_xref="UniProtKB/TrEMBL:Q757J2"
FT                   /protein_id="AAS52705.1"
FT   gene            complement(668114..668186)
FT                   /locus_tag="AGOS_t0115"
FT   tRNA            complement(668114..668186)
FT                   /locus_tag="AGOS_t0115"
FT                   /product="tRNA-Ala"
FT                   /note="codon recognized: GCU"
FT   gene            <668634..>670208
FT                   /locus_tag="AGOS_AER022W"
FT                   /old_locus_tag="AER022W"
FT   mRNA            <668634..>670208
FT                   /locus_tag="AGOS_AER022W"
FT                   /old_locus_tag="AER022W"
FT                   /product="AER022Wp"
FT   CDS_pept        668634..670208
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER022W"
FT                   /old_locus_tag="AER022W"
FT                   /product="AER022Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBR139W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER022W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52706"
FT                   /db_xref="GOA:Q757J1"
FT                   /db_xref="InterPro:IPR001563"
FT                   /db_xref="InterPro:IPR018202"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="InterPro:IPR033124"
FT                   /db_xref="UniProtKB/TrEMBL:Q757J1"
FT                   /protein_id="AAS52706.1"
FT                   YNLDYKV"
FT   gene            complement(<670299..>673418)
FT                   /locus_tag="AGOS_AER023C"
FT                   /old_locus_tag="AER023C"
FT   mRNA            complement(<670299..>673418)
FT                   /locus_tag="AGOS_AER023C"
FT                   /old_locus_tag="AER023C"
FT                   /product="AER023Cp"
FT   CDS_pept        complement(670299..673418)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER023C"
FT                   /old_locus_tag="AER023C"
FT                   /product="AER023Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL078W
FT                   (AVO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER023C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52707"
FT                   /db_xref="GOA:Q757J0"
FT                   /db_xref="InterPro:IPR011993"
FT                   /db_xref="InterPro:IPR031313"
FT                   /db_xref="InterPro:IPR031567"
FT                   /db_xref="UniProtKB/TrEMBL:Q757J0"
FT                   /protein_id="AAS52707.2"
FT   gene            <673637..>674494
FT                   /locus_tag="AGOS_AER024W"
FT                   /old_locus_tag="AER024W"
FT   mRNA            <673637..>674494
FT                   /locus_tag="AGOS_AER024W"
FT                   /old_locus_tag="AER024W"
FT                   /product="AER024Wp"
FT   CDS_pept        673637..674494
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER024W"
FT                   /old_locus_tag="AER024W"
FT                   /product="AER024Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL080C
FT                   (REX4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER024W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52708"
FT                   /db_xref="GOA:Q757I9"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR013520"
FT                   /db_xref="InterPro:IPR034920"
FT                   /db_xref="InterPro:IPR036397"
FT                   /db_xref="InterPro:IPR037431"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757I9"
FT                   /protein_id="AAS52708.1"
FT                   RRKA"
FT   gene            complement(<674619..>683354)
FT                   /locus_tag="AGOS_AER025C"
FT                   /old_locus_tag="AER025C"
FT   mRNA            complement(<674619..>683354)
FT                   /locus_tag="AGOS_AER025C"
FT                   /old_locus_tag="AER025C"
FT                   /product="AER025Cp"
FT   CDS_pept        complement(674619..683354)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER025C"
FT                   /old_locus_tag="AER025C"
FT                   /product="AER025Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL081W
FT                   (IRA2) and YBR140C (IRA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER025C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52709"
FT                   /db_xref="GOA:Q757I8"
FT                   /db_xref="InterPro:IPR001936"
FT                   /db_xref="InterPro:IPR008936"
FT                   /db_xref="InterPro:IPR023152"
FT                   /db_xref="InterPro:IPR036865"
FT                   /db_xref="InterPro:IPR039360"
FT                   /db_xref="UniProtKB/TrEMBL:Q757I8"
FT                   /protein_id="AAS52709.2"
FT   gene            complement(<683666..>684670)
FT                   /locus_tag="AGOS_AER026C"
FT                   /old_locus_tag="AER026C"
FT   mRNA            complement(<683666..>684670)
FT                   /locus_tag="AGOS_AER026C"
FT                   /old_locus_tag="AER026C"
FT                   /product="AER026Cp"
FT   CDS_pept        complement(683666..684670)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER026C"
FT                   /old_locus_tag="AER026C"
FT                   /product="AER026Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBR141C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER026C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52710"
FT                   /db_xref="GOA:Q757I7"
FT                   /db_xref="InterPro:IPR021867"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q757I7"
FT                   /protein_id="AAS52710.1"
FT   gene            <684897..>687155
FT                   /locus_tag="AGOS_AER027W"
FT                   /old_locus_tag="AER027W"
FT   mRNA            <684897..>687155
FT                   /locus_tag="AGOS_AER027W"
FT                   /old_locus_tag="AER027W"
FT                   /product="AER027Wp"
FT   CDS_pept        684897..687155
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER027W"
FT                   /old_locus_tag="AER027W"
FT                   /product="AER027Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR142W
FT                   (MAK5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER027W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52711"
FT                   /db_xref="GOA:Q757I6"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757I6"
FT                   /protein_id="AAS52711.1"
FT   gene            complement(<687320..>688636)
FT                   /locus_tag="AGOS_AER028C"
FT                   /old_locus_tag="AER028C"
FT   mRNA            complement(<687320..>688636)
FT                   /locus_tag="AGOS_AER028C"
FT                   /old_locus_tag="AER028C"
FT                   /product="AER028Cp"
FT   CDS_pept        complement(687320..688636)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER028C"
FT                   /old_locus_tag="AER028C"
FT                   /product="AER028Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR143C
FT                   (SUP45)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER028C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52712"
FT                   /db_xref="GOA:Q757I5"
FT                   /db_xref="InterPro:IPR004403"
FT                   /db_xref="InterPro:IPR005140"
FT                   /db_xref="InterPro:IPR005141"
FT                   /db_xref="InterPro:IPR005142"
FT                   /db_xref="InterPro:IPR024049"
FT                   /db_xref="InterPro:IPR029064"
FT                   /db_xref="InterPro:IPR042226"
FT                   /db_xref="UniProtKB/TrEMBL:Q757I5"
FT                   /protein_id="AAS52712.1"
FT   gene            complement(<689025..>690722)
FT                   /locus_tag="AGOS_AER029C"
FT                   /old_locus_tag="AER029C"
FT   mRNA            complement(<689025..>690722)
FT                   /locus_tag="AGOS_AER029C"
FT                   /old_locus_tag="AER029C"
FT                   /product="AER029Cp"
FT   CDS_pept        complement(689025..690722)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER029C"
FT                   /old_locus_tag="AER029C"
FT                   /product="AER029Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL082W
FT                   (ATG19) and YOL083W (ATG34); Tandem gene duplication in
FT                   Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER029C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52713"
FT                   /db_xref="GOA:Q757I4"
FT                   /db_xref="InterPro:IPR000433"
FT                   /db_xref="InterPro:IPR024543"
FT                   /db_xref="UniProtKB/TrEMBL:Q757I4"
FT                   /protein_id="AAS52713.2"
FT   gene            complement(<691116..>693743)
FT                   /locus_tag="AGOS_AER030C"
FT                   /old_locus_tag="AER030C"
FT   mRNA            complement(<691116..>693743)
FT                   /locus_tag="AGOS_AER030C"
FT                   /old_locus_tag="AER030C"
FT                   /product="AER030Cp"
FT   CDS_pept        complement(691116..693743)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER030C"
FT                   /old_locus_tag="AER030C"
FT                   /product="AER030Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL084W
FT                   (PHM7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER030C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52714"
FT                   /db_xref="GOA:Q757I3"
FT                   /db_xref="InterPro:IPR003864"
FT                   /db_xref="InterPro:IPR022257"
FT                   /db_xref="InterPro:IPR027815"
FT                   /db_xref="InterPro:IPR032880"
FT                   /db_xref="UniProtKB/TrEMBL:Q757I3"
FT                   /protein_id="AAS52714.1"
FT                   YVNH"
FT   gene            complement(<694421..>695416)
FT                   /locus_tag="AGOS_AER031C"
FT                   /old_locus_tag="AER031C"
FT   mRNA            complement(<694421..>695416)
FT                   /locus_tag="AGOS_AER031C"
FT                   /old_locus_tag="AER031C"
FT                   /product="AER031Cp"
FT   CDS_pept        complement(694421..695416)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER031C"
FT                   /old_locus_tag="AER031C"
FT                   /product="AER031Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YGR192C (TDH3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER031C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52715"
FT                   /db_xref="GOA:Q757I2"
FT                   /db_xref="InterPro:IPR006424"
FT                   /db_xref="InterPro:IPR020828"
FT                   /db_xref="InterPro:IPR020829"
FT                   /db_xref="InterPro:IPR020830"
FT                   /db_xref="InterPro:IPR020831"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757I2"
FT                   /protein_id="AAS52715.2"
FT   gene            <695995..>697050
FT                   /locus_tag="AGOS_AER032W"
FT                   /old_locus_tag="AER032W"
FT   mRNA            <695995..>697050
FT                   /locus_tag="AGOS_AER032W"
FT                   /old_locus_tag="AER032W"
FT                   /product="AER032Wp"
FT   CDS_pept        695995..697050
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER032W"
FT                   /old_locus_tag="AER032W"
FT                   /product="AER032Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL086C
FT                   (ADH1) and YBR145W (ADH5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER032W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52716"
FT                   /db_xref="GOA:Q757I1"
FT                   /db_xref="InterPro:IPR002328"
FT                   /db_xref="InterPro:IPR011032"
FT                   /db_xref="InterPro:IPR013149"
FT                   /db_xref="InterPro:IPR013154"
FT                   /db_xref="InterPro:IPR020843"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q757I1"
FT                   /protein_id="AAS52716.1"
FT                   VVGRYVVDTSM"
FT   gene            <697282..>698121
FT                   /locus_tag="AGOS_AER033W"
FT                   /old_locus_tag="AER033W"
FT   mRNA            <697282..>698121
FT                   /locus_tag="AGOS_AER033W"
FT                   /old_locus_tag="AER033W"
FT                   /product="AER033Wp"
FT   CDS_pept        697282..698121
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER033W"
FT                   /old_locus_tag="AER033W"
FT                   /product="AER033Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR146W
FT                   (MRPS9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER033W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52717"
FT                   /db_xref="GOA:Q757I0"
FT                   /db_xref="InterPro:IPR000754"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR020574"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757I0"
FT                   /protein_id="AAS52717.1"
FT   gene            complement(<698191..>698523)
FT                   /locus_tag="AGOS_AER034C"
FT                   /old_locus_tag="AER034C"
FT   mRNA            complement(<698191..>698523)
FT                   /locus_tag="AGOS_AER034C"
FT                   /old_locus_tag="AER034C"
FT                   /product="AER034Cp"
FT   CDS_pept        complement(698191..698523)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER034C"
FT                   /old_locus_tag="AER034C"
FT                   /product="AER034Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOL086W-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER034C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52718"
FT                   /db_xref="GOA:Q757H9"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="InterPro:IPR029003"
FT                   /db_xref="UniProtKB/TrEMBL:Q757H9"
FT                   /protein_id="AAS52718.1"
FT                   RTAQRR"
FT   gene            <698712..>701732
FT                   /locus_tag="AGOS_AER035W"
FT                   /old_locus_tag="AER035W"
FT   mRNA            <698712..>701732
FT                   /locus_tag="AGOS_AER035W"
FT                   /old_locus_tag="AER035W"
FT                   /product="AER035Wp"
FT   CDS_pept        698712..701732
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER035W"
FT                   /old_locus_tag="AER035W"
FT                   /product="AER035Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOL087C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER035W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52719"
FT                   /db_xref="GOA:Q757H8"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR021772"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q757H8"
FT                   /protein_id="AAS52719.2"
FT                   EIVLEYRRKVRQTSRKR"
FT   gene            <702063..>702710
FT                   /locus_tag="AGOS_AER036W"
FT                   /old_locus_tag="AER036W"
FT   mRNA            <702063..>702710
FT                   /locus_tag="AGOS_AER036W"
FT                   /old_locus_tag="AER036W"
FT                   /product="AER036Wp"
FT   CDS_pept        702063..702710
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER036W"
FT                   /old_locus_tag="AER036W"
FT                   /product="AER036Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR154C
FT                   (RPB5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER036W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52720"
FT                   /db_xref="GOA:Q757H7"
FT                   /db_xref="InterPro:IPR000783"
FT                   /db_xref="InterPro:IPR005571"
FT                   /db_xref="InterPro:IPR014381"
FT                   /db_xref="InterPro:IPR020608"
FT                   /db_xref="InterPro:IPR020609"
FT                   /db_xref="InterPro:IPR035913"
FT                   /db_xref="InterPro:IPR036710"
FT                   /db_xref="InterPro:IPR039531"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757H7"
FT                   /protein_id="AAS52720.1"
FT   gene            complement(<702856..>703596)
FT                   /locus_tag="AGOS_AER037C"
FT                   /old_locus_tag="AER037C"
FT   mRNA            complement(<702856..>703596)
FT                   /locus_tag="AGOS_AER037C"
FT                   /old_locus_tag="AER037C"
FT                   /product="AER037Cp"
FT   CDS_pept        complement(702856..703596)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER037C"
FT                   /old_locus_tag="AER037C"
FT                   /product="AER037Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR153W
FT                   (RIB7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER037C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52721"
FT                   /db_xref="GOA:Q757H6"
FT                   /db_xref="InterPro:IPR002734"
FT                   /db_xref="InterPro:IPR011549"
FT                   /db_xref="InterPro:IPR024072"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757H6"
FT                   /protein_id="AAS52721.1"
FT   gene            complement(<703680..>704474)
FT                   /locus_tag="AGOS_AER038C"
FT                   /old_locus_tag="AER038C"
FT   mRNA            complement(<703680..>704474)
FT                   /locus_tag="AGOS_AER038C"
FT                   /old_locus_tag="AER038C"
FT                   /product="AER038Cp"
FT   CDS_pept        complement(703680..704474)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER038C"
FT                   /old_locus_tag="AER038C"
FT                   /product="AER038Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR152W
FT                   (SPP381)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER038C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52722"
FT                   /db_xref="GOA:Q757H5"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757H5"
FT                   /protein_id="AAS52722.1"
FT   gene            <704810..>705556
FT                   /locus_tag="AGOS_AER039W"
FT                   /old_locus_tag="AER039W"
FT   mRNA            <704810..>705556
FT                   /locus_tag="AGOS_AER039W"
FT                   /old_locus_tag="AER039W"
FT                   /product="AER039Wp"
FT   CDS_pept        704810..705556
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER039W"
FT                   /old_locus_tag="AER039W"
FT                   /product="AER039Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL088C
FT                   (MPD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER039W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52723"
FT                   /db_xref="GOA:Q757H4"
FT                   /db_xref="InterPro:IPR013766"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q757H4"
FT                   /protein_id="AAS52723.2"
FT   gene            complement(<705634..>706539)
FT                   /locus_tag="AGOS_AER040C"
FT                   /old_locus_tag="AER040C"
FT   mRNA            complement(<705634..>706539)
FT                   /locus_tag="AGOS_AER040C"
FT                   /old_locus_tag="AER040C"
FT                   /product="AER040Cp"
FT   CDS_pept        complement(705634..706539)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER040C"
FT                   /old_locus_tag="AER040C"
FT                   /product="AER040Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR151W
FT                   (APD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER040C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52724"
FT                   /db_xref="InterPro:IPR009737"
FT                   /db_xref="InterPro:IPR030108"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q757H3"
FT                   /protein_id="AAS52724.1"
FT   gene            <707007..>708317
FT                   /locus_tag="AGOS_AER041W"
FT                   /old_locus_tag="AER041W"
FT   mRNA            <707007..>708317
FT                   /locus_tag="AGOS_AER041W"
FT                   /old_locus_tag="AER041W"
FT                   /product="AER041Wp"
FT   CDS_pept        707007..708317
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER041W"
FT                   /old_locus_tag="AER041W"
FT                   /product="AER041Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR380W
FT                   (CSR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER041W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52725"
FT                   /db_xref="GOA:Q757H2"
FT                   /db_xref="InterPro:IPR001251"
FT                   /db_xref="InterPro:IPR011074"
FT                   /db_xref="InterPro:IPR036273"
FT                   /db_xref="InterPro:IPR036865"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757H2"
FT                   /protein_id="AAS52725.2"
FT   gene            <708514..>710544
FT                   /locus_tag="AGOS_AER042W"
FT                   /old_locus_tag="AER042W"
FT   mRNA            <708514..>710544
FT                   /locus_tag="AGOS_AER042W"
FT                   /old_locus_tag="AER042W"
FT                   /product="AER042Wp"
FT   CDS_pept        708514..710544
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER042W"
FT                   /old_locus_tag="AER042W"
FT                   /product="AER042Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR381W
FT                   (CTF3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER042W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52726"
FT                   /db_xref="UniProtKB/TrEMBL:Q757H1"
FT                   /protein_id="AAS52726.1"
FT   gene            complement(<710604..>713225)
FT                   /locus_tag="AGOS_AER043C"
FT                   /old_locus_tag="AER043C"
FT   mRNA            complement(<710604..>713225)
FT                   /locus_tag="AGOS_AER043C"
FT                   /old_locus_tag="AER043C"
FT                   /product="AER043Cp"
FT   CDS_pept        complement(710604..713225)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER043C"
FT                   /old_locus_tag="AER043C"
FT                   /product="AER043Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR382C
FT                   (NAM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER043C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52727"
FT                   /db_xref="GOA:Q757H0"
FT                   /db_xref="InterPro:IPR001412"
FT                   /db_xref="InterPro:IPR002300"
FT                   /db_xref="InterPro:IPR002302"
FT                   /db_xref="InterPro:IPR009008"
FT                   /db_xref="InterPro:IPR009080"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR015413"
FT                   /db_xref="InterPro:IPR025709"
FT                   /db_xref="UniProtKB/TrEMBL:Q757H0"
FT                   /protein_id="AAS52727.1"
FT                   QK"
FT   gene            <713543..>716854
FT                   /locus_tag="AGOS_AER044W"
FT                   /old_locus_tag="AER044W"
FT   mRNA            <713543..>716854
FT                   /locus_tag="AGOS_AER044W"
FT                   /old_locus_tag="AER044W"
FT                   /product="AER044Wp"
FT   CDS_pept        713543..716854
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER044W"
FT                   /old_locus_tag="AER044W"
FT                   /product="AER044Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR383W
FT                   (SMC6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER044W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52728"
FT                   /db_xref="GOA:Q757G9"
FT                   /db_xref="InterPro:IPR003395"
FT                   /db_xref="InterPro:IPR027132"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q757G9"
FT                   /protein_id="AAS52728.1"
FT   gene            complement(<716959..>720837)
FT                   /locus_tag="AGOS_AER045C"
FT                   /old_locus_tag="AER045C"
FT   mRNA            complement(<716959..>720837)
FT                   /locus_tag="AGOS_AER045C"
FT                   /old_locus_tag="AER045C"
FT                   /product="AER045Cp"
FT   CDS_pept        complement(716959..720837)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER045C"
FT                   /old_locus_tag="AER045C"
FT                   /product="AER045Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL058W
FT                   (USO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER045C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52729"
FT                   /db_xref="GOA:Q757G8"
FT                   /db_xref="InterPro:IPR006953"
FT                   /db_xref="InterPro:IPR006955"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q757G8"
FT                   /protein_id="AAS52729.1"
FT                   DDNDEDED"
FT   gene            <721434..>722048
FT                   /locus_tag="AGOS_AER046W"
FT                   /old_locus_tag="AER046W"
FT   mRNA            <721434..>722048
FT                   /locus_tag="AGOS_AER046W"
FT                   /old_locus_tag="AER046W"
FT                   /product="AER046Wp"
FT   CDS_pept        721434..722048
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER046W"
FT                   /old_locus_tag="AER046W"
FT                   /product="AER046Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL059C
FT                   (RAD59)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER046W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52730"
FT                   /db_xref="GOA:Q757G7"
FT                   /db_xref="InterPro:IPR007232"
FT                   /db_xref="InterPro:IPR016810"
FT                   /db_xref="InterPro:IPR041247"
FT                   /db_xref="InterPro:IPR042525"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757G7"
FT                   /protein_id="AAS52730.1"
FT   gene            complement(<722152..>726126)
FT                   /locus_tag="AGOS_AER047C"
FT                   /old_locus_tag="AER047C"
FT   mRNA            complement(<722152..>726126)
FT                   /locus_tag="AGOS_AER047C"
FT                   /old_locus_tag="AER047C"
FT                   /product="AER047Cp"
FT   CDS_pept        complement(722152..726126)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER047C"
FT                   /old_locus_tag="AER047C"
FT                   /product="AER047Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR384C
FT                   (IKI3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER047C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52731"
FT                   /db_xref="GOA:Q757G6"
FT                   /db_xref="InterPro:IPR006849"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q757G6"
FT                   /protein_id="AAS52731.2"
FT   gene            complement(<726236..>726619)
FT                   /locus_tag="AGOS_AER048C"
FT                   /old_locus_tag="AER048C"
FT   mRNA            complement(<726236..>726619)
FT                   /locus_tag="AGOS_AER048C"
FT                   /old_locus_tag="AER048C"
FT                   /product="AER048Cp"
FT   CDS_pept        complement(726236..726619)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER048C"
FT                   /old_locus_tag="AER048C"
FT                   /product="AER048Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR385C
FT                   (SWC7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER048C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52732"
FT                   /db_xref="GOA:Q757G5"
FT                   /db_xref="InterPro:IPR020195"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757G5"
FT                   /protein_id="AAS52732.1"
FT   gene            <726846..>729475
FT                   /locus_tag="AGOS_AER049W"
FT                   /old_locus_tag="AER049W"
FT   mRNA            join(<726846..726849,726906..>729475)
FT                   /locus_tag="AGOS_AER049W"
FT                   /old_locus_tag="AER049W"
FT                   /product="AER049Wp"
FT   CDS_pept        join(726846..726849,726906..729475)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER049W"
FT                   /old_locus_tag="AER049W"
FT                   /product="AER049Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR386W
FT                   (VAC14); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER049W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52733"
FT                   /db_xref="GOA:Q757G4"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR021133"
FT                   /db_xref="InterPro:IPR021841"
FT                   /db_xref="InterPro:IPR026825"
FT                   /db_xref="InterPro:IPR032878"
FT                   /db_xref="UniProtKB/TrEMBL:Q757G4"
FT                   /protein_id="AAS52733.2"
FT   gene            complement(<729512..>730699)
FT                   /locus_tag="AGOS_AER050C"
FT                   /old_locus_tag="AER050C"
FT   mRNA            complement(<729512..>730699)
FT                   /locus_tag="AGOS_AER050C"
FT                   /old_locus_tag="AER050C"
FT                   /product="AER050Cp"
FT   CDS_pept        complement(729512..730699)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER050C"
FT                   /old_locus_tag="AER050C"
FT                   /product="AER050Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR387C
FT                   (REH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER050C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52734"
FT                   /db_xref="GOA:Q757G3"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="InterPro:IPR040025"
FT                   /db_xref="InterPro:IPR041661"
FT                   /db_xref="UniProtKB/TrEMBL:Q757G3"
FT                   /protein_id="AAS52734.1"
FT   gene            complement(<730981..>733314)
FT                   /locus_tag="AGOS_AER051C"
FT                   /old_locus_tag="AER051C"
FT   mRNA            complement(<730981..>733314)
FT                   /locus_tag="AGOS_AER051C"
FT                   /old_locus_tag="AER051C"
FT                   /product="AER051Cp"
FT   CDS_pept        complement(730981..733314)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER051C"
FT                   /old_locus_tag="AER051C"
FT                   /product="AER051Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL060W
FT                   (TSR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER051C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52735"
FT                   /db_xref="GOA:Q757G2"
FT                   /db_xref="InterPro:IPR007034"
FT                   /db_xref="InterPro:IPR012948"
FT                   /db_xref="InterPro:IPR030387"
FT                   /db_xref="InterPro:IPR039761"
FT                   /db_xref="UniProtKB/TrEMBL:Q757G2"
FT                   /protein_id="AAS52735.1"
FT   gene            <733644..>733985
FT                   /locus_tag="AGOS_AER052W"
FT                   /old_locus_tag="AER052W"
FT   mRNA            join(<733644..733653,733810..>733985)
FT                   /locus_tag="AGOS_AER052W"
FT                   /old_locus_tag="AER052W"
FT                   /product="AER052Wp"
FT                   /note="5'UTR intron"
FT   CDS_pept        733815..733985
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER052W"
FT                   /old_locus_tag="AER052W"
FT                   /product="AER052Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR388W
FT                   (RPS29A) and YDL061C (RPS29B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER052W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52736"
FT                   /db_xref="GOA:Q757G1"
FT                   /db_xref="InterPro:IPR001209"
FT                   /db_xref="InterPro:IPR018271"
FT                   /db_xref="InterPro:IPR039744"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757G1"
FT                   /protein_id="AAS52736.1"
FT                   KANDIGFHKYR"
FT   gene            734311..734501
FT                   /locus_tag="AGOS_AgSNR34"
FT                   /old_locus_tag="AgSNR34"
FT   ncRNA           734311..734501
FT                   /locus_tag="AGOS_AgSNR34"
FT                   /old_locus_tag="AgSNR34"
FT                   /product="AgSNR34"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR34; start and end coordinates are approximate;
FT                   similarity is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<734590..>737631)
FT                   /locus_tag="AGOS_AER053C"
FT                   /old_locus_tag="AER053C"
FT   mRNA            complement(<734590..>737631)
FT                   /locus_tag="AGOS_AER053C"
FT                   /old_locus_tag="AER053C"
FT                   /product="AER053Cp"
FT   CDS_pept        complement(734590..737631)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER053C"
FT                   /old_locus_tag="AER053C"
FT                   /product="AER053Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR389C
FT                   (STE23)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER053C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52737"
FT                   /db_xref="GOA:Q757G0"
FT                   /db_xref="InterPro:IPR001431"
FT                   /db_xref="InterPro:IPR007863"
FT                   /db_xref="InterPro:IPR011249"
FT                   /db_xref="InterPro:IPR011765"
FT                   /db_xref="InterPro:IPR032632"
FT                   /db_xref="UniProtKB/TrEMBL:Q757G0"
FT                   /protein_id="AAS52737.2"
FT   gene            <737957..>738211
FT                   /locus_tag="AGOS_AER054W"
FT                   /old_locus_tag="AER054W"
FT   mRNA            <737957..>738211
FT                   /locus_tag="AGOS_AER054W"
FT                   /old_locus_tag="AER054W"
FT                   /product="AER054Wp"
FT   CDS_pept        737957..738211
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER054W"
FT                   /old_locus_tag="AER054W"
FT                   /product="AER054Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR390W
FT                   (ECM19)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER054W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52738"
FT                   /db_xref="GOA:Q757F9"
FT                   /db_xref="UniProtKB/TrEMBL:Q757F9"
FT                   /protein_id="AAS52738.1"
FT   gene            <738431..>740272
FT                   /locus_tag="AGOS_AER055W"
FT                   /old_locus_tag="AER055W"
FT   mRNA            <738431..>740272
FT                   /locus_tag="AGOS_AER055W"
FT                   /old_locus_tag="AER055W"
FT                   /product="AER055Wp"
FT   CDS_pept        738431..740272
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER055W"
FT                   /old_locus_tag="AER055W"
FT                   /product="AER055Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDL063C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER055W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52739"
FT                   /db_xref="GOA:Q757F8"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q757F8"
FT                   /protein_id="AAS52739.1"
FT   gene            complement(<740412..>740943)
FT                   /locus_tag="AGOS_AER056C"
FT                   /old_locus_tag="AER056C"
FT   mRNA            complement(join(<740412..740847,740906..>740943))
FT                   /locus_tag="AGOS_AER056C"
FT                   /old_locus_tag="AER056C"
FT                   /product="AER056Cp"
FT   CDS_pept        complement(join(740412..740847,740906..740943))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER056C"
FT                   /old_locus_tag="AER056C"
FT                   /product="AER056Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL064W
FT                   (UBC9); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER056C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52740"
FT                   /db_xref="GOA:Q757F7"
FT                   /db_xref="InterPro:IPR000608"
FT                   /db_xref="InterPro:IPR016135"
FT                   /db_xref="InterPro:IPR023313"
FT                   /db_xref="InterPro:IPR027230"
FT                   /db_xref="UniProtKB/TrEMBL:Q757F7"
FT                   /protein_id="AAS52740.1"
FT   gene            <741145..>742083
FT                   /locus_tag="AGOS_AER057W"
FT                   /old_locus_tag="AER057W"
FT   mRNA            <741145..>742083
FT                   /locus_tag="AGOS_AER057W"
FT                   /old_locus_tag="AER057W"
FT                   /product="AER057Wp"
FT   CDS_pept        741145..742083
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER057W"
FT                   /old_locus_tag="AER057W"
FT                   /product="AER057Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL065C
FT                   (PEX19)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER057W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52741"
FT                   /db_xref="GOA:Q757F6"
FT                   /db_xref="InterPro:IPR006708"
FT                   /db_xref="InterPro:IPR038322"
FT                   /db_xref="UniProtKB/TrEMBL:Q757F6"
FT                   /protein_id="AAS52741.1"
FT   gene            <745294..>746022
FT                   /locus_tag="AGOS_AER058W"
FT                   /old_locus_tag="AER058W"
FT   mRNA            <745294..>746022
FT                   /locus_tag="AGOS_AER058W"
FT                   /old_locus_tag="AER058W"
FT                   /product="AER058Wp"
FT   CDS_pept        745294..746022
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER058W"
FT                   /old_locus_tag="AER058W"
FT                   /product="AER058Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR390W-A (CCW14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER058W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52742"
FT                   /db_xref="GOA:Q757F5"
FT                   /db_xref="UniProtKB/TrEMBL:Q757F5"
FT                   /protein_id="AAS52742.2"
FT   gene            complement(<746321..>747613)
FT                   /locus_tag="AGOS_AER059C"
FT                   /old_locus_tag="AER059C"
FT   mRNA            complement(<746321..>747613)
FT                   /locus_tag="AGOS_AER059C"
FT                   /old_locus_tag="AER059C"
FT                   /product="AER059Cp"
FT   CDS_pept        complement(746321..747613)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER059C"
FT                   /old_locus_tag="AER059C"
FT                   /product="AER059Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR392C
FT                   (ART10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER059C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52743"
FT                   /db_xref="GOA:Q757F4"
FT                   /db_xref="InterPro:IPR014752"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757F4"
FT                   /protein_id="AAS52743.1"
FT   gene            <747947..>748765
FT                   /locus_tag="AGOS_AER060W"
FT                   /old_locus_tag="AER060W"
FT   mRNA            <747947..>748765
FT                   /locus_tag="AGOS_AER060W"
FT                   /old_locus_tag="AER060W"
FT                   /product="AER060Wp"
FT   CDS_pept        747947..748765
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER060W"
FT                   /old_locus_tag="AER060W"
FT                   /product="AER060Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR393W
FT                   (ATP10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER060W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52744"
FT                   /db_xref="GOA:Q757F3"
FT                   /db_xref="InterPro:IPR007849"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757F3"
FT                   /protein_id="AAS52744.2"
FT   gene            complement(<748897..>750174)
FT                   /locus_tag="AGOS_AER061C"
FT                   /old_locus_tag="AER061C"
FT   mRNA            complement(<748897..>750174)
FT                   /locus_tag="AGOS_AER061C"
FT                   /old_locus_tag="AER061C"
FT                   /product="AER061Cp"
FT   CDS_pept        complement(748897..750174)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER061C"
FT                   /old_locus_tag="AER061C"
FT                   /product="AER061Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL066W
FT                   (IDP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER061C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52745"
FT                   /db_xref="GOA:Q757F2"
FT                   /db_xref="InterPro:IPR004790"
FT                   /db_xref="InterPro:IPR019818"
FT                   /db_xref="InterPro:IPR024084"
FT                   /db_xref="UniProtKB/TrEMBL:Q757F2"
FT                   /protein_id="AAS52745.1"
FT   gene            complement(<750338..>750553)
FT                   /locus_tag="AGOS_AER062C"
FT                   /old_locus_tag="AER062C"
FT   mRNA            complement(<750338..>750553)
FT                   /locus_tag="AGOS_AER062C"
FT                   /old_locus_tag="AER062C"
FT                   /product="AER062Cp"
FT   CDS_pept        complement(750338..750553)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER062C"
FT                   /old_locus_tag="AER062C"
FT                   /product="AER062Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR395C
FT                   (COX8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER062C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52746"
FT                   /db_xref="GOA:Q757F1"
FT                   /db_xref="InterPro:IPR004202"
FT                   /db_xref="InterPro:IPR036636"
FT                   /db_xref="UniProtKB/TrEMBL:Q757F1"
FT                   /protein_id="AAS52746.1"
FT   gene            <750765..>750947
FT                   /locus_tag="AGOS_AER063W"
FT                   /old_locus_tag="AER063W"
FT   mRNA            <750765..>750947
FT                   /locus_tag="AGOS_AER063W"
FT                   /old_locus_tag="AER063W"
FT                   /product="AER063Wp"
FT   CDS_pept        750765..750947
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER063W"
FT                   /old_locus_tag="AER063W"
FT                   /product="AER063Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL067C
FT                   (COX9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER063W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52747"
FT                   /db_xref="GOA:Q757F0"
FT                   /db_xref="InterPro:IPR014368"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757F0"
FT                   /protein_id="AAS52747.1"
FT                   ENYYTQLAEQKAAEE"
FT   gene            complement(<751009..>752955)
FT                   /locus_tag="AGOS_AER064C"
FT                   /old_locus_tag="AER064C"
FT   mRNA            complement(<751009..>752955)
FT                   /locus_tag="AGOS_AER064C"
FT                   /old_locus_tag="AER064C"
FT                   /product="AER064Cp"
FT   CDS_pept        complement(751009..752955)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER064C"
FT                   /old_locus_tag="AER064C"
FT                   /product="AER064Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR396C
FT                   (VPS33)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER064C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52748"
FT                   /db_xref="GOA:Q757E9"
FT                   /db_xref="InterPro:IPR001619"
FT                   /db_xref="InterPro:IPR027121"
FT                   /db_xref="InterPro:IPR027482"
FT                   /db_xref="InterPro:IPR036045"
FT                   /db_xref="UniProtKB/TrEMBL:Q757E9"
FT                   /protein_id="AAS52748.1"
FT                   VLADGLLRAAPPV"
FT   gene            complement(<753168..>755492)
FT                   /locus_tag="AGOS_AER065C"
FT                   /old_locus_tag="AER065C"
FT   mRNA            complement(<753168..>755492)
FT                   /locus_tag="AGOS_AER065C"
FT                   /old_locus_tag="AER065C"
FT                   /product="AER065Cp"
FT   CDS_pept        complement(753168..755492)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER065C"
FT                   /old_locus_tag="AER065C"
FT                   /product="AER065Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR397C
FT                   (AFG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER065C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52749"
FT                   /db_xref="GOA:Q757E8"
FT                   /db_xref="InterPro:IPR003338"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR041569"
FT                   /db_xref="UniProtKB/TrEMBL:Q757E8"
FT                   /protein_id="AAS52749.2"
FT   gene            <755657..>756337
FT                   /locus_tag="AGOS_AER066W"
FT                   /old_locus_tag="AER066W"
FT   mRNA            <755657..>756337
FT                   /locus_tag="AGOS_AER066W"
FT                   /old_locus_tag="AER066W"
FT                   /product="AER066Wp"
FT   CDS_pept        755657..756337
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER066W"
FT                   /old_locus_tag="AER066W"
FT                   /product="AER066Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL069C
FT                   (CBS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER066W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52750"
FT                   /db_xref="UniProtKB/TrEMBL:Q757E7"
FT                   /protein_id="AAS52750.1"
FT                   LSRY"
FT   gene            complement(<756351..>760199)
FT                   /locus_tag="AGOS_AER067C"
FT                   /old_locus_tag="AER067C"
FT   mRNA            complement(<756351..>760199)
FT                   /locus_tag="AGOS_AER067C"
FT                   /old_locus_tag="AER067C"
FT                   /product="AER067Cp"
FT   CDS_pept        complement(756351..760199)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER067C"
FT                   /old_locus_tag="AER067C"
FT                   /product="AER067Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR398C
FT                   (SKI2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER067C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52751"
FT                   /db_xref="GOA:Q757E6"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR012961"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR016438"
FT                   /db_xref="InterPro:IPR025696"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR040801"
FT                   /db_xref="UniProtKB/TrEMBL:Q757E6"
FT                   /protein_id="AAS52751.2"
FT   gene            complement(<760666..>762573)
FT                   /locus_tag="AGOS_AER068C"
FT                   /old_locus_tag="AER068C"
FT   mRNA            complement(<760666..>762573)
FT                   /locus_tag="AGOS_AER068C"
FT                   /old_locus_tag="AER068C"
FT                   /product="AER068Cp"
FT   CDS_pept        complement(760666..762573)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER068C"
FT                   /old_locus_tag="AER068C"
FT                   /product="AER068Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR399C
FT                   (BDF1) and YDL070W (BDF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER068C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52752"
FT                   /db_xref="GOA:Q757E5"
FT                   /db_xref="InterPro:IPR001487"
FT                   /db_xref="InterPro:IPR027353"
FT                   /db_xref="InterPro:IPR036427"
FT                   /db_xref="InterPro:IPR038336"
FT                   /db_xref="UniProtKB/TrEMBL:Q757E5"
FT                   /protein_id="AAS52752.2"
FT                   "
FT   gene            <763090..>763596
FT                   /locus_tag="AGOS_AER069W"
FT                   /old_locus_tag="AER069W"
FT   mRNA            <763090..>763596
FT                   /locus_tag="AGOS_AER069W"
FT                   /old_locus_tag="AER069W"
FT                   /product="AER069Wp"
FT   CDS_pept        763090..763596
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER069W"
FT                   /old_locus_tag="AER069W"
FT                   /product="AER069Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL072C
FT                   (YET3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER069W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52753"
FT                   /db_xref="GOA:Q757E4"
FT                   /db_xref="InterPro:IPR008417"
FT                   /db_xref="InterPro:IPR040463"
FT                   /db_xref="UniProtKB/TrEMBL:Q757E4"
FT                   /protein_id="AAS52753.1"
FT                   LAEDM"
FT   gene            complement(<763613..>765556)
FT                   /locus_tag="AGOS_AER070C"
FT                   /old_locus_tag="AER070C"
FT   mRNA            complement(<763613..>765556)
FT                   /locus_tag="AGOS_AER070C"
FT                   /old_locus_tag="AER070C"
FT                   /product="AER070Cp"
FT   CDS_pept        complement(763613..765556)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER070C"
FT                   /old_locus_tag="AER070C"
FT                   /product="AER070Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR401C
FT                   (DUS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER070C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52754"
FT                   /db_xref="GOA:Q757E3"
FT                   /db_xref="InterPro:IPR000571"
FT                   /db_xref="InterPro:IPR001269"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR018517"
FT                   /db_xref="InterPro:IPR035587"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757E3"
FT                   /protein_id="AAS52754.1"
FT                   KHKSNSYAPSVQ"
FT   gene            <766224..>768077
FT                   /locus_tag="AGOS_AER071W"
FT                   /old_locus_tag="AER071W"
FT   mRNA            <766224..>768077
FT                   /locus_tag="AGOS_AER071W"
FT                   /old_locus_tag="AER071W"
FT                   /product="AER071Wp"
FT   CDS_pept        766224..768077
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER071W"
FT                   /old_locus_tag="AER071W"
FT                   /product="AER071Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR403W
FT                   (SFP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER071W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52755"
FT                   /db_xref="GOA:Q757E2"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q757E2"
FT                   /protein_id="AAS52755.2"
FT   gene            <768675..>769460
FT                   /locus_tag="AGOS_AER072W"
FT                   /old_locus_tag="AER072W"
FT   mRNA            <768675..>769460
FT                   /locus_tag="AGOS_AER072W"
FT                   /old_locus_tag="AER072W"
FT                   /product="AER072Wp"
FT   CDS_pept        768675..769460
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER072W"
FT                   /old_locus_tag="AER072W"
FT                   /product="AER072Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR404W
FT                   (FLD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER072W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52756"
FT                   /db_xref="GOA:Q757E1"
FT                   /db_xref="UniProtKB/TrEMBL:Q757E1"
FT                   /protein_id="AAS52756.2"
FT   gene            complement(<769776..>772937)
FT                   /locus_tag="AGOS_AER073C"
FT                   /old_locus_tag="AER073C"
FT   mRNA            complement(<769776..>772937)
FT                   /locus_tag="AGOS_AER073C"
FT                   /old_locus_tag="AER073C"
FT                   /product="AER073Cp"
FT   CDS_pept        complement(769776..772937)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER073C"
FT                   /old_locus_tag="AER073C"
FT                   /product="AER073Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDL073W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER073C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52757"
FT                   /db_xref="InterPro:IPR013887"
FT                   /db_xref="UniProtKB/TrEMBL:Q757E0"
FT                   /protein_id="AAS52757.2"
FT                   HLRPN"
FT   gene            <774205..>776136
FT                   /locus_tag="AGOS_AER074W"
FT                   /old_locus_tag="AER074W"
FT   mRNA            <774205..>776136
FT                   /locus_tag="AGOS_AER074W"
FT                   /old_locus_tag="AER074W"
FT                   /product="AER074Wp"
FT   CDS_pept        774205..776136
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER074W"
FT                   /old_locus_tag="AER074W"
FT                   /product="AER074Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL074C
FT                   (BRE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER074W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52758"
FT                   /db_xref="GOA:Q757D9"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR013956"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757D9"
FT                   /protein_id="AAS52758.1"
FT                   NDLLVVHL"
FT   gene            <776506..>777564
FT                   /locus_tag="AGOS_AER075W"
FT                   /old_locus_tag="AER075W"
FT   mRNA            <776506..>777564
FT                   /locus_tag="AGOS_AER075W"
FT                   /old_locus_tag="AER075W"
FT                   /product="AER075Wp"
FT   CDS_pept        776506..777564
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER075W"
FT                   /old_locus_tag="AER075W"
FT                   /product="AER075Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR405W
FT                   (DUS4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER075W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52759"
FT                   /db_xref="GOA:Q757D8"
FT                   /db_xref="InterPro:IPR001269"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR018517"
FT                   /db_xref="InterPro:IPR035587"
FT                   /db_xref="UniProtKB/TrEMBL:Q757D8"
FT                   /protein_id="AAS52759.1"
FT                   PDIPYRHRAPRP"
FT   gene            777956..778010
FT                   /locus_tag="AGOS_AgSNR63"
FT                   /old_locus_tag="AgSNR63"
FT   ncRNA           777956..778010
FT                   /locus_tag="AGOS_AgSNR63"
FT                   /old_locus_tag="AgSNR63"
FT                   /product="AgSNR63"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR63; start and end coordinates are approximate;
FT                   similarity is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<778134..>778553)
FT                   /locus_tag="AGOS_AER076C"
FT                   /old_locus_tag="AER076C"
FT   mRNA            complement(join(<778134..778421,778497..>778553))
FT                   /locus_tag="AGOS_AER076C"
FT                   /old_locus_tag="AER076C"
FT                   /product="AER076Cp"
FT   CDS_pept        complement(join(778134..778421,778497..778553))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER076C"
FT                   /old_locus_tag="AER076C"
FT                   /product="AER076Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL075W
FT                   (RPL31A) and YLR406C (RPL31B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER076C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52760"
FT                   /db_xref="GOA:Q757D7"
FT                   /db_xref="InterPro:IPR000054"
FT                   /db_xref="InterPro:IPR020052"
FT                   /db_xref="InterPro:IPR023621"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757D7"
FT                   /protein_id="AAS52760.2"
FT                   HTVVVEEEEA"
FT   gene            <778959..>779804
FT                   /locus_tag="AGOS_AER077W"
FT                   /old_locus_tag="AER077W"
FT   mRNA            <778959..>779804
FT                   /locus_tag="AGOS_AER077W"
FT                   /old_locus_tag="AER077W"
FT                   /product="AER077Wp"
FT   CDS_pept        778959..779804
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER077W"
FT                   /old_locus_tag="AER077W"
FT                   /product="AER077Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL076C
FT                   (RXT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER077W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52761"
FT                   /db_xref="GOA:Q757D6"
FT                   /db_xref="InterPro:IPR013951"
FT                   /db_xref="UniProtKB/TrEMBL:Q757D6"
FT                   /protein_id="AAS52761.1"
FT                   "
FT   gene            <780087..>780740
FT                   /locus_tag="AGOS_AER078W"
FT                   /old_locus_tag="AER078W"
FT   mRNA            <780087..>780740
FT                   /locus_tag="AGOS_AER078W"
FT                   /old_locus_tag="AER078W"
FT                   /product="AER078Wp"
FT   CDS_pept        780087..780740
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER078W"
FT                   /old_locus_tag="AER078W"
FT                   /product="AER078Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR407W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER078W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52762"
FT                   /db_xref="InterPro:IPR025124"
FT                   /db_xref="UniProtKB/TrEMBL:Q757D5"
FT                   /protein_id="AAS52762.1"
FT   gene            complement(<780801..>781154)
FT                   /locus_tag="AGOS_AER079C"
FT                   /old_locus_tag="AER079C"
FT   mRNA            complement(<780801..>781154)
FT                   /locus_tag="AGOS_AER079C"
FT                   /old_locus_tag="AER079C"
FT                   /product="AER079Cp"
FT   CDS_pept        complement(780801..781154)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER079C"
FT                   /old_locus_tag="AER079C"
FT                   /product="AER079Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR408C
FT                   (BLS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER079C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52763"
FT                   /db_xref="GOA:Q757D4"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757D4"
FT                   /protein_id="AAS52763.1"
FT                   QAPGKGDRIFRSD"
FT   gene            <781322..>784420
FT                   /locus_tag="AGOS_AER080W"
FT                   /old_locus_tag="AER080W"
FT   mRNA            <781322..>784420
FT                   /locus_tag="AGOS_AER080W"
FT                   /old_locus_tag="AER080W"
FT                   /product="AER080Wp"
FT   CDS_pept        781322..784420
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER080W"
FT                   /old_locus_tag="AER080W"
FT                   /product="AER080Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL077C
FT                   (VAM6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER080W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52764"
FT                   /db_xref="GOA:Q757D3"
FT                   /db_xref="InterPro:IPR019452"
FT                   /db_xref="InterPro:IPR019453"
FT                   /db_xref="InterPro:IPR032914"
FT                   /db_xref="UniProtKB/TrEMBL:Q757D3"
FT                   /protein_id="AAS52764.1"
FT   gene            complement(<784487..>787558)
FT                   /locus_tag="AGOS_AER081C"
FT                   /old_locus_tag="AER081C"
FT   mRNA            complement(<784487..>787558)
FT                   /locus_tag="AGOS_AER081C"
FT                   /old_locus_tag="AER081C"
FT                   /product="AER081Cp"
FT   CDS_pept        complement(784487..787558)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER081C"
FT                   /old_locus_tag="AER081C"
FT                   /product="AER081Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR409C
FT                   (UTP21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER081C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52765"
FT                   /db_xref="GOA:Q757D2"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR007319"
FT                   /db_xref="InterPro:IPR011047"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR024977"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q757D2"
FT                   /protein_id="AAS52765.2"
FT   gene            <787876..>791304
FT                   /locus_tag="AGOS_AER082W"
FT                   /old_locus_tag="AER082W"
FT   mRNA            <787876..>791304
FT                   /locus_tag="AGOS_AER082W"
FT                   /old_locus_tag="AER082W"
FT                   /product="AER082Wp"
FT   CDS_pept        787876..791304
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER082W"
FT                   /old_locus_tag="AER082W"
FT                   /product="AER082Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR410W
FT                   (VIP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER082W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52766"
FT                   /db_xref="GOA:Q757D1"
FT                   /db_xref="InterPro:IPR000560"
FT                   /db_xref="InterPro:IPR013651"
FT                   /db_xref="InterPro:IPR029033"
FT                   /db_xref="InterPro:IPR037446"
FT                   /db_xref="InterPro:IPR040557"
FT                   /db_xref="UniProtKB/TrEMBL:Q757D1"
FT                   /protein_id="AAS52766.1"
FT   gene            complement(<791730..>793007)
FT                   /locus_tag="AGOS_AER083C"
FT                   /old_locus_tag="AER083C"
FT   mRNA            complement(<791730..>793007)
FT                   /locus_tag="AGOS_AER083C"
FT                   /old_locus_tag="AER083C"
FT                   /product="AER083Cp"
FT   CDS_pept        complement(791730..793007)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER083C"
FT                   /old_locus_tag="AER083C"
FT                   /product="AER083Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL181W
FT                   (PRS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER083C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52767"
FT                   /db_xref="GOA:Q757D0"
FT                   /db_xref="InterPro:IPR000836"
FT                   /db_xref="InterPro:IPR000842"
FT                   /db_xref="InterPro:IPR005946"
FT                   /db_xref="InterPro:IPR029057"
FT                   /db_xref="InterPro:IPR029099"
FT                   /db_xref="UniProtKB/TrEMBL:Q757D0"
FT                   /protein_id="AAS52767.1"
FT   gene            <793468..>794280
FT                   /locus_tag="AGOS_AER084W"
FT                   /old_locus_tag="AER084W"
FT   mRNA            <793468..>794280
FT                   /locus_tag="AGOS_AER084W"
FT                   /old_locus_tag="AER084W"
FT                   /product="AER084Wp"
FT   CDS_pept        793468..794280
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER084W"
FT                   /old_locus_tag="AER084W"
FT                   /product="AER084Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR412W
FT                   (BER1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER084W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52768"
FT                   /db_xref="GOA:Q757C9"
FT                   /db_xref="InterPro:IPR012942"
FT                   /db_xref="InterPro:IPR040044"
FT                   /db_xref="UniProtKB/TrEMBL:Q757C9"
FT                   /protein_id="AAS52768.1"
FT   gene            complement(<794379..>800694)
FT                   /locus_tag="AGOS_AER085C"
FT                   /old_locus_tag="AER085C"
FT   mRNA            complement(join(<794379..800546,800685..>800694))
FT                   /locus_tag="AGOS_AER085C"
FT                   /old_locus_tag="AER085C"
FT                   /product="AER085Cp"
FT                   /note="5'UTR intron"
FT   CDS_pept        complement(794379..800519)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER085C"
FT                   /old_locus_tag="AER085C"
FT                   /product="AER085Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL182W
FT                   (FAS1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER085C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52769"
FT                   /db_xref="GOA:Q757C8"
FT                   /db_xref="InterPro:IPR001227"
FT                   /db_xref="InterPro:IPR002539"
FT                   /db_xref="InterPro:IPR003965"
FT                   /db_xref="InterPro:IPR013565"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR014043"
FT                   /db_xref="InterPro:IPR016035"
FT                   /db_xref="InterPro:IPR016452"
FT                   /db_xref="InterPro:IPR020801"
FT                   /db_xref="InterPro:IPR029069"
FT                   /db_xref="InterPro:IPR032088"
FT                   /db_xref="InterPro:IPR039569"
FT                   /db_xref="InterPro:IPR040883"
FT                   /db_xref="InterPro:IPR041099"
FT                   /db_xref="UniProtKB/TrEMBL:Q757C8"
FT                   /protein_id="AAS52769.2"
FT   gene            complement(<800884..>801693)
FT                   /locus_tag="AGOS_AER086C"
FT                   /old_locus_tag="AER086C"
FT   mRNA            complement(<800884..>801693)
FT                   /locus_tag="AGOS_AER086C"
FT                   /old_locus_tag="AER086C"
FT                   /product="AER086Cp"
FT   CDS_pept        complement(800884..801693)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER086C"
FT                   /old_locus_tag="AER086C"
FT                   /product="AER086Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL183W
FT                   (LOT5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER086C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52770"
FT                   /db_xref="GOA:Q757C7"
FT                   /db_xref="InterPro:IPR039924"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757C7"
FT                   /protein_id="AAS52770.2"
FT   gene            complement(<801766..>803118)
FT                   /locus_tag="AGOS_AER087C"
FT                   /old_locus_tag="AER087C"
FT   mRNA            complement(<801766..>803118)
FT                   /locus_tag="AGOS_AER087C"
FT                   /old_locus_tag="AER087C"
FT                   /product="AER087Cp"
FT   CDS_pept        complement(801766..803118)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER087C"
FT                   /old_locus_tag="AER087C"
FT                   /product="AER087Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL184W
FT                   (SPE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER087C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52771"
FT                   /db_xref="GOA:Q757C6"
FT                   /db_xref="InterPro:IPR000183"
FT                   /db_xref="InterPro:IPR002433"
FT                   /db_xref="InterPro:IPR009006"
FT                   /db_xref="InterPro:IPR022643"
FT                   /db_xref="InterPro:IPR022644"
FT                   /db_xref="InterPro:IPR022653"
FT                   /db_xref="InterPro:IPR022657"
FT                   /db_xref="InterPro:IPR029066"
FT                   /db_xref="UniProtKB/TrEMBL:Q757C6"
FT                   /protein_id="AAS52771.2"
FT   gene            complement(<803518..>804765)
FT                   /locus_tag="AGOS_AER088C"
FT                   /old_locus_tag="AER088C"
FT   mRNA            complement(<803518..>804765)
FT                   /locus_tag="AGOS_AER088C"
FT                   /old_locus_tag="AER088C"
FT                   /product="AER088Cp"
FT   CDS_pept        complement(803518..804765)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER088C"
FT                   /old_locus_tag="AER088C"
FT                   /product="AER088Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL185W
FT                   (ASH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER088C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52772"
FT                   /db_xref="GOA:Q757C5"
FT                   /db_xref="InterPro:IPR000679"
FT                   /db_xref="InterPro:IPR013088"
FT                   /db_xref="UniProtKB/TrEMBL:Q757C5"
FT                   /protein_id="AAS52772.2"
FT                   EGLRCLFCNCVVETRD"
FT   gene            <805363..>805866
FT                   /locus_tag="AGOS_AER089W"
FT                   /old_locus_tag="AER089W"
FT   mRNA            <805363..>805866
FT                   /locus_tag="AGOS_AER089W"
FT                   /old_locus_tag="AER089W"
FT                   /product="AER089Wp"
FT   CDS_pept        805363..805866
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER089W"
FT                   /old_locus_tag="AER089W"
FT                   /product="AER089Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL186C
FT                   (MTR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER089W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52773"
FT                   /db_xref="GOA:Q757C4"
FT                   /db_xref="InterPro:IPR019488"
FT                   /db_xref="InterPro:IPR032710"
FT                   /db_xref="UniProtKB/TrEMBL:Q757C4"
FT                   /protein_id="AAS52773.1"
FT                   LMSI"
FT   gene            <806459..>808489
FT                   /locus_tag="AGOS_AER090W"
FT                   /old_locus_tag="AER090W"
FT   mRNA            <806459..>808489
FT                   /locus_tag="AGOS_AER090W"
FT                   /old_locus_tag="AER090W"
FT                   /product="AER090Wp"
FT   CDS_pept        806459..808489
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER090W"
FT                   /old_locus_tag="AER090W"
FT                   /product="AER090Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR413W
FT                   and YKL187C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER090W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52774"
FT                   /db_xref="GOA:Q757C3"
FT                   /db_xref="InterPro:IPR009571"
FT                   /db_xref="UniProtKB/TrEMBL:Q757C3"
FT                   /protein_id="AAS52774.1"
FT   gene            <808951..>811356
FT                   /locus_tag="AGOS_AER091W"
FT                   /old_locus_tag="AER091W"
FT   mRNA            <808951..>811356
FT                   /locus_tag="AGOS_AER091W"
FT                   /old_locus_tag="AER091W"
FT                   /product="AER091Wp"
FT   CDS_pept        808951..811356
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER091W"
FT                   /old_locus_tag="AER091W"
FT                   /product="AER091Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL188C
FT                   (PXA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER091W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52775"
FT                   /db_xref="GOA:Q757C2"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR011527"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR031238"
FT                   /db_xref="UniProtKB/TrEMBL:Q757C2"
FT                   /protein_id="AAS52775.1"
FT   gene            <811542..>813128
FT                   /locus_tag="AGOS_AER092W"
FT                   /old_locus_tag="AER092W"
FT   mRNA            <811542..>813128
FT                   /locus_tag="AGOS_AER092W"
FT                   /old_locus_tag="AER092W"
FT                   /product="AER092Wp"
FT   CDS_pept        811542..813128
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER092W"
FT                   /old_locus_tag="AER092W"
FT                   /product="AER092Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR417W
FT                   (VPS36)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER092W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52776"
FT                   /db_xref="GOA:Q757C1"
FT                   /db_xref="InterPro:IPR001876"
FT                   /db_xref="InterPro:IPR011993"
FT                   /db_xref="InterPro:IPR021648"
FT                   /db_xref="InterPro:IPR031558"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="InterPro:IPR036443"
FT                   /db_xref="InterPro:IPR037855"
FT                   /db_xref="InterPro:IPR040608"
FT                   /db_xref="UniProtKB/TrEMBL:Q757C1"
FT                   /protein_id="AAS52776.1"
FT                   IHYYINVCWRI"
FT   gene            complement(<813241..>814329)
FT                   /locus_tag="AGOS_AER093C"
FT                   /old_locus_tag="AER093C"
FT   mRNA            complement(<813241..>814329)
FT                   /locus_tag="AGOS_AER093C"
FT                   /old_locus_tag="AER093C"
FT                   /product="AER093Cp"
FT   CDS_pept        complement(813241..814329)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER093C"
FT                   /old_locus_tag="AER093C"
FT                   /product="AER093Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL189W
FT                   (HYM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER093C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52777"
FT                   /db_xref="GOA:Q757C0"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR013878"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q757C0"
FT                   /protein_id="AAS52777.1"
FT   gene            815576..815659
FT                   /locus_tag="AGOS_t0116"
FT   tRNA            815576..815659
FT                   /locus_tag="AGOS_t0116"
FT                   /product="tRNA-Leu"
FT                   /note="codon recognized: UUA"
FT   gene            complement(<815696..>819892)
FT                   /locus_tag="AGOS_AER094C"
FT                   /old_locus_tag="AER094C"
FT   mRNA            complement(<815696..>819892)
FT                   /locus_tag="AGOS_AER094C"
FT                   /old_locus_tag="AER094C"
FT                   /product="AER094Cp"
FT   CDS_pept        complement(815696..819892)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER094C"
FT                   /old_locus_tag="AER094C"
FT                   /product="AER094Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR419W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER094C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52778"
FT                   /db_xref="GOA:Q757B9"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR002464"
FT                   /db_xref="InterPro:IPR006575"
FT                   /db_xref="InterPro:IPR007502"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR011709"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR015940"
FT                   /db_xref="InterPro:IPR016135"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR035467"
FT                   /db_xref="UniProtKB/TrEMBL:Q757B9"
FT                   /protein_id="AAS52778.2"
FT   gene            <820095..>821162
FT                   /locus_tag="AGOS_AER095W"
FT                   /old_locus_tag="AER095W"
FT   mRNA            <820095..>821162
FT                   /locus_tag="AGOS_AER095W"
FT                   /old_locus_tag="AER095W"
FT                   /product="AER095Wp"
FT   CDS_pept        820095..821162
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER095W"
FT                   /old_locus_tag="AER095W"
FT                   /product="AER095Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR418C
FT                   (CDC73)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER095W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52779"
FT                   /db_xref="GOA:Q757B8"
FT                   /db_xref="InterPro:IPR007852"
FT                   /db_xref="InterPro:IPR031336"
FT                   /db_xref="InterPro:IPR038103"
FT                   /db_xref="UniProtKB/TrEMBL:Q757B8"
FT                   /protein_id="AAS52779.1"
FT                   FWTMMEKELLARGFH"
FT   gene            complement(<821575..>822166)
FT                   /locus_tag="AGOS_AER096C"
FT                   /old_locus_tag="AER096C"
FT   mRNA            complement(join(<821575..822050,822115..>822166))
FT                   /locus_tag="AGOS_AER096C"
FT                   /old_locus_tag="AER096C"
FT                   /product="AER096Cp"
FT   CDS_pept        complement(join(821575..822050,822115..822166))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER096C"
FT                   /old_locus_tag="AER096C"
FT                   /product="AER096Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL190W
FT                   (CNB1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER096C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52780"
FT                   /db_xref="GOA:Q757B7"
FT                   /db_xref="InterPro:IPR002048"
FT                   /db_xref="InterPro:IPR011992"
FT                   /db_xref="InterPro:IPR018247"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757B7"
FT                   /protein_id="AAS52780.1"
FT                   EVANSLTLQCDI"
FT   gene            complement(<822309..>824057)
FT                   /locus_tag="AGOS_AER097C"
FT                   /old_locus_tag="AER097C"
FT   mRNA            complement(<822309..>824057)
FT                   /locus_tag="AGOS_AER097C"
FT                   /old_locus_tag="AER097C"
FT                   /product="AER097Cp"
FT   CDS_pept        complement(822309..824057)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER097C"
FT                   /old_locus_tag="AER097C"
FT                   /product="AER097Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL191W
FT                   (DPH2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER097C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52781"
FT                   /db_xref="GOA:Q757B6"
FT                   /db_xref="InterPro:IPR010014"
FT                   /db_xref="InterPro:IPR016435"
FT                   /db_xref="InterPro:IPR042263"
FT                   /db_xref="InterPro:IPR042264"
FT                   /db_xref="InterPro:IPR042265"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757B6"
FT                   /protein_id="AAS52781.1"
FT                   GRVMNT"
FT   gene            <824360..>825445
FT                   /locus_tag="AGOS_AER098W"
FT                   /old_locus_tag="AER098W"
FT   mRNA            <824360..>825445
FT                   /locus_tag="AGOS_AER098W"
FT                   /old_locus_tag="AER098W"
FT                   /product="AER098Wp"
FT   CDS_pept        824360..825445
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER098W"
FT                   /old_locus_tag="AER098W"
FT                   /product="AER098Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR420W
FT                   (URA4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER098W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52782"
FT                   /db_xref="GOA:Q757B5"
FT                   /db_xref="InterPro:IPR002195"
FT                   /db_xref="InterPro:IPR004721"
FT                   /db_xref="InterPro:IPR006680"
FT                   /db_xref="InterPro:IPR032466"
FT                   /db_xref="UniProtKB/TrEMBL:Q757B5"
FT                   /protein_id="AAS52782.2"
FT   gene            complement(<825489..>825806)
FT                   /locus_tag="AGOS_AER099C"
FT                   /old_locus_tag="AER099C"
FT   mRNA            complement(<825489..>825806)
FT                   /locus_tag="AGOS_AER099C"
FT                   /old_locus_tag="AER099C"
FT                   /product="AER099Cp"
FT   CDS_pept        complement(825489..825806)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER099C"
FT                   /old_locus_tag="AER099C"
FT                   /product="AER099Cp"
FT                   /note="NOHBY514; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0D02904g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER099C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52783"
FT                   /db_xref="UniProtKB/TrEMBL:Q757B4"
FT                   /protein_id="AAS52783.1"
FT                   E"
FT   gene            complement(<825873..>826337)
FT                   /locus_tag="AGOS_AER100C"
FT                   /old_locus_tag="AER100C"
FT   mRNA            complement(<825873..>826337)
FT                   /locus_tag="AGOS_AER100C"
FT                   /old_locus_tag="AER100C"
FT                   /product="AER100Cp"
FT   CDS_pept        complement(825873..826337)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER100C"
FT                   /old_locus_tag="AER100C"
FT                   /product="AER100Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR421C
FT                   (RPN13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER100C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52784"
FT                   /db_xref="GOA:Q757B3"
FT                   /db_xref="InterPro:IPR006773"
FT                   /db_xref="InterPro:IPR038633"
FT                   /db_xref="UniProtKB/TrEMBL:Q757B3"
FT                   /protein_id="AAS52784.1"
FT   gene            <826523..>827095
FT                   /locus_tag="AGOS_AER101W"
FT                   /old_locus_tag="AER101W"
FT   mRNA            <826523..>827095
FT                   /locus_tag="AGOS_AER101W"
FT                   /old_locus_tag="AER101W"
FT                   /product="AER101Wp"
FT   CDS_pept        826523..827095
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER101W"
FT                   /old_locus_tag="AER101W"
FT                   /product="AER101Wp"
FT                   /note="NOHBY515; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0G16588g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER101W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52785"
FT                   /db_xref="InterPro:IPR008136"
FT                   /db_xref="InterPro:IPR036653"
FT                   /db_xref="UniProtKB/TrEMBL:Q757B2"
FT                   /protein_id="AAS52785.1"
FT   gene            <827372..>833080
FT                   /locus_tag="AGOS_AER102W"
FT                   /old_locus_tag="AER102W"
FT   mRNA            <827372..>833080
FT                   /locus_tag="AGOS_AER102W"
FT                   /old_locus_tag="AER102W"
FT                   /product="AER102Wp"
FT   CDS_pept        827372..833080
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER102W"
FT                   /old_locus_tag="AER102W"
FT                   /product="AER102Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR422W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER102W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52786"
FT                   /db_xref="GOA:Q757B1"
FT                   /db_xref="InterPro:IPR010703"
FT                   /db_xref="InterPro:IPR026791"
FT                   /db_xref="InterPro:IPR027357"
FT                   /db_xref="InterPro:IPR031057"
FT                   /db_xref="InterPro:IPR032376"
FT                   /db_xref="UniProtKB/TrEMBL:Q757B1"
FT                   /protein_id="AAS52786.1"
FT   gene            <833254..>833625
FT                   /locus_tag="AGOS_AER103W"
FT                   /old_locus_tag="AER103W"
FT   mRNA            <833254..>833625
FT                   /locus_tag="AGOS_AER103W"
FT                   /old_locus_tag="AER103W"
FT                   /product="AER103Wp"
FT   CDS_pept        833254..833625
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER103W"
FT                   /old_locus_tag="AER103W"
FT                   /product="AER103Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL192C
FT                   (ACP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER103W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52787"
FT                   /db_xref="GOA:Q757B0"
FT                   /db_xref="InterPro:IPR003231"
FT                   /db_xref="InterPro:IPR006162"
FT                   /db_xref="InterPro:IPR009081"
FT                   /db_xref="InterPro:IPR036736"
FT                   /db_xref="UniProtKB/TrEMBL:Q757B0"
FT                   /protein_id="AAS52787.1"
FT   gene            <833997..>835046
FT                   /locus_tag="AGOS_AER104W"
FT                   /old_locus_tag="AER104W"
FT   mRNA            <833997..>835046
FT                   /locus_tag="AGOS_AER104W"
FT                   /old_locus_tag="AER104W"
FT                   /product="AER104Wp"
FT   CDS_pept        833997..835046
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER104W"
FT                   /old_locus_tag="AER104W"
FT                   /product="AER104Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL193C
FT                   (SDS22)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER104W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52788"
FT                   /db_xref="GOA:Q757A9"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR003591"
FT                   /db_xref="InterPro:IPR025875"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:Q757A9"
FT                   /protein_id="AAS52788.1"
FT                   KIDATYIRG"
FT   gene            <835224..>836597
FT                   /locus_tag="AGOS_AER105W"
FT                   /old_locus_tag="AER105W"
FT   mRNA            <835224..>836597
FT                   /locus_tag="AGOS_AER105W"
FT                   /old_locus_tag="AER105W"
FT                   /product="AER105Wp"
FT   CDS_pept        835224..836597
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER105W"
FT                   /old_locus_tag="AER105W"
FT                   /product="AER105Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL194C
FT                   (MST1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER105W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52789"
FT                   /db_xref="GOA:Q757A8"
FT                   /db_xref="InterPro:IPR002314"
FT                   /db_xref="InterPro:IPR002320"
FT                   /db_xref="InterPro:IPR004154"
FT                   /db_xref="InterPro:IPR006195"
FT                   /db_xref="InterPro:IPR033728"
FT                   /db_xref="InterPro:IPR036621"
FT                   /db_xref="UniProtKB/TrEMBL:Q757A8"
FT                   /protein_id="AAS52789.1"
FT   gene            complement(<836668..>837909)
FT                   /locus_tag="AGOS_AER106C"
FT                   /old_locus_tag="AER106C"
FT   mRNA            complement(<836668..>837909)
FT                   /locus_tag="AGOS_AER106C"
FT                   /old_locus_tag="AER106C"
FT                   /product="AER106Cp"
FT   CDS_pept        complement(836668..837909)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER106C"
FT                   /old_locus_tag="AER106C"
FT                   /product="AER106Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR423C
FT                   (ATG17)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER106C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52790"
FT                   /db_xref="GOA:Q757A7"
FT                   /db_xref="InterPro:IPR007240"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757A7"
FT                   /protein_id="AAS52790.1"
FT                   LSPLYDLEYRIKKV"
FT   gene            <838014..>839924
FT                   /locus_tag="AGOS_AER107W"
FT                   /old_locus_tag="AER107W"
FT   mRNA            <838014..>839924
FT                   /locus_tag="AGOS_AER107W"
FT                   /old_locus_tag="AER107W"
FT                   /product="AER107Wp"
FT   CDS_pept        838014..839924
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER107W"
FT                   /old_locus_tag="AER107W"
FT                   /product="AER107Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR424W
FT                   (SPP382)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER107W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52791"
FT                   /db_xref="GOA:Q757A6"
FT                   /db_xref="InterPro:IPR000467"
FT                   /db_xref="UniProtKB/TrEMBL:Q757A6"
FT                   /protein_id="AAS52791.1"
FT                   A"
FT   gene            complement(<839963..>840763)
FT                   /locus_tag="AGOS_AER108C"
FT                   /old_locus_tag="AER108C"
FT   mRNA            complement(<839963..>840763)
FT                   /locus_tag="AGOS_AER108C"
FT                   /old_locus_tag="AER108C"
FT                   /product="AER108Cp"
FT   CDS_pept        complement(839963..840763)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER108C"
FT                   /old_locus_tag="AER108C"
FT                   /product="AER108Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL195W
FT                   (MIA40)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER108C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52792"
FT                   /db_xref="GOA:Q757A5"
FT                   /db_xref="InterPro:IPR010625"
FT                   /db_xref="InterPro:IPR039289"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757A5"
FT                   /protein_id="AAS52792.1"
FT   gene            <840977..>841579
FT                   /locus_tag="AGOS_AER109W"
FT                   /old_locus_tag="AER109W"
FT   mRNA            <840977..>841579
FT                   /locus_tag="AGOS_AER109W"
FT                   /old_locus_tag="AER109W"
FT                   /product="AER109Wp"
FT   CDS_pept        840977..841579
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER109W"
FT                   /old_locus_tag="AER109W"
FT                   /product="AER109Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL196C
FT                   (YKT6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER109W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52793"
FT                   /db_xref="GOA:Q757A4"
FT                   /db_xref="InterPro:IPR001388"
FT                   /db_xref="InterPro:IPR010908"
FT                   /db_xref="InterPro:IPR011012"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q757A4"
FT                   /protein_id="AAS52793.1"
FT   gene            <841780..>845697
FT                   /locus_tag="AGOS_AER110W"
FT                   /old_locus_tag="AER110W"
FT   mRNA            <841780..>845697
FT                   /locus_tag="AGOS_AER110W"
FT                   /old_locus_tag="AER110W"
FT                   /product="AER110Wp"
FT   CDS_pept        841780..845697
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER110W"
FT                   /old_locus_tag="AER110W"
FT                   /product="AER110Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR425W
FT                   (TUS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER110W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52794"
FT                   /db_xref="GOA:Q757A3"
FT                   /db_xref="InterPro:IPR000219"
FT                   /db_xref="InterPro:IPR001180"
FT                   /db_xref="InterPro:IPR001849"
FT                   /db_xref="InterPro:IPR035899"
FT                   /db_xref="UniProtKB/TrEMBL:Q757A3"
FT                   /protein_id="AAS52794.2"
FT   gene            <845989..>847024
FT                   /locus_tag="AGOS_AER111W"
FT                   /old_locus_tag="AER111W"
FT   mRNA            join(<845989..846068,846121..>847024)
FT                   /locus_tag="AGOS_AER111W"
FT                   /old_locus_tag="AER111W"
FT                   /product="AER111Wp"
FT   CDS_pept        join(845989..846068,846121..847024)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER111W"
FT                   /old_locus_tag="AER111W"
FT                   /product="AER111Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR426W
FT                   (TDA5); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER111W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52795"
FT                   /db_xref="InterPro:IPR002347"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q757A2"
FT                   /protein_id="AAS52795.1"
FT   gene            complement(<847042..>847551)
FT                   /locus_tag="AGOS_AER112C"
FT                   /old_locus_tag="AER112C"
FT   mRNA            complement(<847042..>847551)
FT                   /locus_tag="AGOS_AER112C"
FT                   /old_locus_tag="AER112C"
FT                   /product="AER112Cp"
FT   CDS_pept        complement(847042..847551)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER112C"
FT                   /old_locus_tag="AER112C"
FT                   /product="AER112Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML055W
FT                   (SPC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER112C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52796"
FT                   /db_xref="GOA:Q757A1"
FT                   /db_xref="InterPro:IPR009582"
FT                   /db_xref="UniProtKB/TrEMBL:Q757A1"
FT                   /protein_id="AAS52796.1"
FT                   VQKKRQ"
FT   gene            <847768..>849765
FT                   /locus_tag="AGOS_AER113W"
FT                   /old_locus_tag="AER113W"
FT   mRNA            <847768..>849765
FT                   /locus_tag="AGOS_AER113W"
FT                   /old_locus_tag="AER113W"
FT                   /product="AER113Wp"
FT   CDS_pept        847768..849765
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER113W"
FT                   /old_locus_tag="AER113W"
FT                   /product="AER113Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR427W
FT                   (MAG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER113W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52797"
FT                   /db_xref="GOA:Q757A0"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="InterPro:IPR018957"
FT                   /db_xref="InterPro:IPR039739"
FT                   /db_xref="UniProtKB/TrEMBL:Q757A0"
FT                   /protein_id="AAS52797.2"
FT   gene            <849910..>851869
FT                   /locus_tag="AGOS_AER114W"
FT                   /old_locus_tag="AER114W"
FT   mRNA            join(<849910..849914,849973..>851869)
FT                   /locus_tag="AGOS_AER114W"
FT                   /old_locus_tag="AER114W"
FT                   /product="AER114Wp"
FT   CDS_pept        join(849910..849914,849973..851869)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER114W"
FT                   /old_locus_tag="AER114W"
FT                   /product="AER114Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR429W
FT                   (CRN1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER114W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52798"
FT                   /db_xref="GOA:Q756Z9"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015048"
FT                   /db_xref="InterPro:IPR015505"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Z9"
FT                   /protein_id="AAS52798.1"
FT   gene            <852205..>858288
FT                   /locus_tag="AGOS_AER115W"
FT                   /old_locus_tag="AER115W"
FT   mRNA            <852205..>858288
FT                   /locus_tag="AGOS_AER115W"
FT                   /old_locus_tag="AER115W"
FT                   /product="AER115Wp"
FT   CDS_pept        852205..858288
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER115W"
FT                   /old_locus_tag="AER115W"
FT                   /product="AER115Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR430W
FT                   (SEN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER115W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52799"
FT                   /db_xref="GOA:Q756Z8"
FT                   /db_xref="InterPro:IPR014016"
FT                   /db_xref="InterPro:IPR024481"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR041677"
FT                   /db_xref="InterPro:IPR041679"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Z8"
FT                   /protein_id="AAS52799.2"
FT   gene            complement(<858363..>859586)
FT                   /locus_tag="AGOS_AER116C"
FT                   /old_locus_tag="AER116C"
FT   mRNA            complement(<858363..>859586)
FT                   /locus_tag="AGOS_AER116C"
FT                   /old_locus_tag="AER116C"
FT                   /product="AER116Cp"
FT   CDS_pept        complement(858363..859586)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER116C"
FT                   /old_locus_tag="AER116C"
FT                   /product="AER116Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR431C
FT                   (ATG23)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER116C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52800"
FT                   /db_xref="GOA:Q756Z7"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q756Z7"
FT                   /protein_id="AAS52800.1"
FT                   MATNKKSV"
FT   gene            <860733..>862462
FT                   /locus_tag="AGOS_AER117W"
FT                   /old_locus_tag="AER117W"
FT   mRNA            join(<860733..861186,861348..>862462)
FT                   /locus_tag="AGOS_AER117W"
FT                   /old_locus_tag="AER117W"
FT                   /product="AER117Wp"
FT   CDS_pept        join(860733..861186,861348..862462)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER117W"
FT                   /old_locus_tag="AER117W"
FT                   /product="AER117Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML056C
FT                   (IMD4) and YLR432W (IMD3); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER117W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52801"
FT                   /db_xref="GOA:Q756Z6"
FT                   /db_xref="InterPro:IPR000644"
FT                   /db_xref="InterPro:IPR001093"
FT                   /db_xref="InterPro:IPR005990"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR015875"
FT                   /db_xref="PDB:4XTD"
FT                   /db_xref="PDB:4XTI"
FT                   /db_xref="PDB:4XWU"
FT                   /db_xref="PDB:4Z0G"
FT                   /db_xref="PDB:4Z87"
FT                   /db_xref="PDB:5MCP"
FT                   /db_xref="PDB:5TC3"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Z6"
FT                   /protein_id="AAS52801.2"
FT                   KRLFD"
FT   gene            861218..861297
FT                   /locus_tag="AGOS_AgSNR54"
FT                   /old_locus_tag="AgSNR54"
FT   ncRNA           861218..861297
FT                   /locus_tag="AGOS_AgSNR54"
FT                   /old_locus_tag="AgSNR54"
FT                   /product="AgSNR54"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR54; start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<862755..>864500)
FT                   /locus_tag="AGOS_AER118C"
FT                   /old_locus_tag="AER118C"
FT   mRNA            complement(<862755..>864500)
FT                   /locus_tag="AGOS_AER118C"
FT                   /old_locus_tag="AER118C"
FT                   /product="AER118Cp"
FT   CDS_pept        complement(862755..864500)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER118C"
FT                   /old_locus_tag="AER118C"
FT                   /product="AER118Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR433C
FT                   (CNA1) and YML057W (CMP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER118C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52802"
FT                   /db_xref="GOA:Q756Z5"
FT                   /db_xref="InterPro:IPR004843"
FT                   /db_xref="InterPro:IPR006186"
FT                   /db_xref="InterPro:IPR041751"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Z5"
FT                   /protein_id="AAS52802.1"
FT                   EKEEK"
FT   gene            <864833..>865450
FT                   /locus_tag="AGOS_AER119W"
FT                   /old_locus_tag="AER119W"
FT   mRNA            <864833..>865450
FT                   /locus_tag="AGOS_AER119W"
FT                   /old_locus_tag="AER119W"
FT                   /product="AER119Wp"
FT   CDS_pept        864833..865450
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER119W"
FT                   /old_locus_tag="AER119W"
FT                   /product="AER119Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR435W
FT                   (TSR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER119W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52803"
FT                   /db_xref="GOA:Q756Z4"
FT                   /db_xref="InterPro:IPR019398"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Z4"
FT                   /protein_id="AAS52803.1"
FT   gene            complement(<865505..>869614)
FT                   /locus_tag="AGOS_AER120C"
FT                   /old_locus_tag="AER120C"
FT   mRNA            complement(<865505..>869614)
FT                   /locus_tag="AGOS_AER120C"
FT                   /old_locus_tag="AER120C"
FT                   /product="AER120Cp"
FT   CDS_pept        complement(865505..869614)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER120C"
FT                   /old_locus_tag="AER120C"
FT                   /product="AER120Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR436C
FT                   (ECM30)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER120C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52804"
FT                   /db_xref="GOA:Q756Z3"
FT                   /db_xref="InterPro:IPR026705"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Z3"
FT                   /protein_id="AAS52804.2"
FT   gene            complement(<869973..>870557)
FT                   /locus_tag="AGOS_AER122C"
FT                   /old_locus_tag="AER122C"
FT   mRNA            complement(<869973..>870557)
FT                   /locus_tag="AGOS_AER122C"
FT                   /old_locus_tag="AER122C"
FT                   /product="AER122Cp"
FT   CDS_pept        complement(869973..870557)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER122C"
FT                   /old_locus_tag="AER122C"
FT                   /product="AER122Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR437C
FT                   (DIF1) and YML058W (SML1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER122C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52805"
FT                   /db_xref="GOA:Q756Z2"
FT                   /db_xref="InterPro:IPR013900"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q756Z2"
FT                   /protein_id="AAS52805.1"
FT   gene            <870925..>872229
FT                   /locus_tag="AGOS_AER123W"
FT                   /old_locus_tag="AER123W"
FT   mRNA            <870925..>872229
FT                   /locus_tag="AGOS_AER123W"
FT                   /old_locus_tag="AER123W"
FT                   /product="AER123Wp"
FT   CDS_pept        870925..872229
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER123W"
FT                   /old_locus_tag="AER123W"
FT                   /product="AER123Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR438W
FT                   (CAR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER123W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52806"
FT                   /db_xref="GOA:Q756Z1"
FT                   /db_xref="InterPro:IPR005814"
FT                   /db_xref="InterPro:IPR010164"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="InterPro:IPR034758"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Z1"
FT                   /protein_id="AAS52806.1"
FT   gene            <872566..>877134
FT                   /locus_tag="AGOS_AER124W"
FT                   /old_locus_tag="AER124W"
FT   mRNA            <872566..>877134
FT                   /locus_tag="AGOS_AER124W"
FT                   /old_locus_tag="AER124W"
FT                   /product="AER124Wp"
FT   CDS_pept        872566..877134
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER124W"
FT                   /old_locus_tag="AER124W"
FT                   /product="AER124Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML059C
FT                   (NTE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER124W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52807"
FT                   /db_xref="GOA:Q756Z0"
FT                   /db_xref="InterPro:IPR000595"
FT                   /db_xref="InterPro:IPR001423"
FT                   /db_xref="InterPro:IPR002641"
FT                   /db_xref="InterPro:IPR014710"
FT                   /db_xref="InterPro:IPR016035"
FT                   /db_xref="InterPro:IPR018490"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q756Z0"
FT                   /protein_id="AAS52807.1"
FT                   SI"
FT   gene            complement(<877180..>877431)
FT                   /locus_tag="AGOS_AER125C"
FT                   /old_locus_tag="AER125C"
FT   mRNA            complement(<877180..>877431)
FT                   /locus_tag="AGOS_AER125C"
FT                   /old_locus_tag="AER125C"
FT                   /product="AER125Cp"
FT   CDS_pept        complement(877180..877431)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER125C"
FT                   /old_locus_tag="AER125C"
FT                   /product="AER125Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR438C-A (LSM3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER125C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52808"
FT                   /db_xref="GOA:Q756Y9"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR034105"
FT                   /db_xref="InterPro:IPR040002"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Y9"
FT                   /protein_id="AAS52808.1"
FT   gene            <877581..>878606
FT                   /locus_tag="AGOS_AER126W"
FT                   /old_locus_tag="AER126W"
FT   mRNA            <877581..>878606
FT                   /locus_tag="AGOS_AER126W"
FT                   /old_locus_tag="AER126W"
FT                   /product="AER126Wp"
FT   CDS_pept        877581..878606
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER126W"
FT                   /old_locus_tag="AER126W"
FT                   /product="AER126Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR439W
FT                   (MRPL4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER126W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52809"
FT                   /db_xref="GOA:Q756Y8"
FT                   /db_xref="InterPro:IPR010729"
FT                   /db_xref="InterPro:IPR038340"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q756Y8"
FT                   /protein_id="AAS52809.2"
FT                   A"
FT   gene            complement(<878694..>879869)
FT                   /locus_tag="AGOS_AER127C"
FT                   /old_locus_tag="AER127C"
FT   mRNA            complement(<878694..>879869)
FT                   /locus_tag="AGOS_AER127C"
FT                   /old_locus_tag="AER127C"
FT                   /product="AER127Cp"
FT   CDS_pept        complement(878694..879869)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER127C"
FT                   /old_locus_tag="AER127C"
FT                   /product="AER127Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML060W
FT                   (OGG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER127C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52810"
FT                   /db_xref="GOA:Q756Y7"
FT                   /db_xref="InterPro:IPR003265"
FT                   /db_xref="InterPro:IPR011257"
FT                   /db_xref="InterPro:IPR012904"
FT                   /db_xref="InterPro:IPR023170"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Y7"
FT                   /protein_id="AAS52810.1"
FT   gene            <880109..>882517
FT                   /locus_tag="AGOS_AER128W"
FT                   /old_locus_tag="AER128W"
FT   mRNA            <880109..>882517
FT                   /locus_tag="AGOS_AER128W"
FT                   /old_locus_tag="AER128W"
FT                   /product="AER128Wp"
FT   CDS_pept        880109..882517
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER128W"
FT                   /old_locus_tag="AER128W"
FT                   /product="AER128Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML061C
FT                   (PIF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER128W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52811"
FT                   /db_xref="GOA:Q756Y6"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR010285"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Y6"
FT                   /protein_id="AAS52811.1"
FT   gene            complement(<882583..>884658)
FT                   /locus_tag="AGOS_AER129C"
FT                   /old_locus_tag="AER129C"
FT   mRNA            complement(<882583..>884658)
FT                   /locus_tag="AGOS_AER129C"
FT                   /old_locus_tag="AER129C"
FT                   /product="AER129Cp"
FT   CDS_pept        complement(882583..884658)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER129C"
FT                   /old_locus_tag="AER129C"
FT                   /product="AER129Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR440C
FT                   (SEC39)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER129C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52812"
FT                   /db_xref="GOA:Q756Y5"
FT                   /db_xref="InterPro:IPR013244"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Y5"
FT                   /protein_id="AAS52812.1"
FT   gene            <884809..>885876
FT                   /locus_tag="AGOS_AER130W"
FT                   /old_locus_tag="AER130W"
FT   mRNA            <884809..>885876
FT                   /locus_tag="AGOS_AER130W"
FT                   /old_locus_tag="AER130W"
FT                   /product="AER130Wp"
FT   CDS_pept        884809..885876
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER130W"
FT                   /old_locus_tag="AER130W"
FT                   /product="AER130Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML062C
FT                   (MFT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER130W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52813"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Y4"
FT                   /protein_id="AAS52813.1"
FT                   DPGTHREDSPDQSDT"
FT   gene            complement(<886024..>886794)
FT                   /locus_tag="AGOS_AER131C"
FT                   /old_locus_tag="AER131C"
FT   mRNA            complement(<886024..>886794)
FT                   /locus_tag="AGOS_AER131C"
FT                   /old_locus_tag="AER131C"
FT                   /product="AER131Cp"
FT   CDS_pept        complement(886024..886794)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER131C"
FT                   /old_locus_tag="AER131C"
FT                   /product="AER131Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML063W
FT                   (RPS1B) and YLR441C (RPS1A)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER131C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52814"
FT                   /db_xref="GOA:Q756Y3"
FT                   /db_xref="InterPro:IPR001593"
FT                   /db_xref="InterPro:IPR018281"
FT                   /db_xref="InterPro:IPR027500"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q756Y3"
FT                   /protein_id="AAS52814.1"
FT   gene            <887237..>887935
FT                   /locus_tag="AGOS_AER132W"
FT                   /old_locus_tag="AER132W"
FT   mRNA            <887237..>887935
FT                   /locus_tag="AGOS_AER132W"
FT                   /old_locus_tag="AER132W"
FT                   /product="AER132Wp"
FT   CDS_pept        887237..887935
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER132W"
FT                   /old_locus_tag="AER132W"
FT                   /product="AER132Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML064C
FT                   (TEM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER132W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52815"
FT                   /db_xref="GOA:Q756Y2"
FT                   /db_xref="InterPro:IPR001806"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR017231"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Y2"
FT                   /protein_id="AAS52815.1"
FT                   PEHIRNMAEQ"
FT   gene            complement(<888143..>891136)
FT                   /locus_tag="AGOS_AER133C"
FT                   /old_locus_tag="AER133C"
FT   mRNA            complement(<888143..>891136)
FT                   /locus_tag="AGOS_AER133C"
FT                   /old_locus_tag="AER133C"
FT                   /product="AER133Cp"
FT   CDS_pept        complement(888143..891136)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER133C"
FT                   /old_locus_tag="AER133C"
FT                   /product="AER133Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML065W
FT                   (ORC1) and YLR442C (SIR3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER133C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52816"
FT                   /db_xref="GOA:Q756Y1"
FT                   /db_xref="InterPro:IPR001025"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR020793"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR041083"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Y1"
FT                   /protein_id="AAS52816.2"
FT                   EDEVLKTL"
FT   gene            <891889..>893154
FT                   /locus_tag="AGOS_AER134W"
FT                   /old_locus_tag="AER134W"
FT   mRNA            <891889..>893154
FT                   /locus_tag="AGOS_AER134W"
FT                   /old_locus_tag="AER134W"
FT                   /product="AER134Wp"
FT   CDS_pept        891889..893154
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER134W"
FT                   /old_locus_tag="AER134W"
FT                   /product="AER134Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR443W
FT                   (ECM7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER134W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52817"
FT                   /db_xref="GOA:Q756Y0"
FT                   /db_xref="UniProtKB/TrEMBL:Q756Y0"
FT                   /protein_id="AAS52817.2"
FT   gene            <893279..>894436
FT                   /locus_tag="AGOS_AER135W"
FT                   /old_locus_tag="AER135W"
FT   mRNA            <893279..>894436
FT                   /locus_tag="AGOS_AER135W"
FT                   /old_locus_tag="AER135W"
FT                   /product="AER135Wp"
FT   CDS_pept        893279..894436
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER135W"
FT                   /old_locus_tag="AER135W"
FT                   /product="AER135Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML066C
FT                   (SMA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER135W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52818"
FT                   /db_xref="GOA:Q756X9"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q756X9"
FT                   /protein_id="AAS52818.1"
FT   gene            <894645..>895718
FT                   /locus_tag="AGOS_AER136W"
FT                   /old_locus_tag="AER136W"
FT   mRNA            join(<894645..894675,894727..>895718)
FT                   /locus_tag="AGOS_AER136W"
FT                   /old_locus_tag="AER136W"
FT                   /product="AER136Wp"
FT   CDS_pept        join(894645..894675,894727..895718)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER136W"
FT                   /old_locus_tag="AER136W"
FT                   /product="AER136Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML067C
FT                   (ERV41); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER136W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52819"
FT                   /db_xref="GOA:Q756X8"
FT                   /db_xref="InterPro:IPR012936"
FT                   /db_xref="InterPro:IPR039542"
FT                   /db_xref="UniProtKB/TrEMBL:Q756X8"
FT                   /protein_id="AAS52819.1"
FT                   "
FT   gene            <895839..>896388
FT                   /locus_tag="AGOS_AER137W"
FT                   /old_locus_tag="AER137W"
FT   mRNA            join(<895839..896153,896209..>896388)
FT                   /locus_tag="AGOS_AER137W"
FT                   /old_locus_tag="AER137W"
FT                   /product="AER137Wp"
FT   CDS_pept        join(895839..896153,896209..896388)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER137W"
FT                   /old_locus_tag="AER137W"
FT                   /product="AER137Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR445W; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER137W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52820"
FT                   /db_xref="GOA:Q756X7"
FT                   /db_xref="UniProtKB/TrEMBL:Q756X7"
FT                   /protein_id="AAS52820.1"
FT                   G"
FT   gene            complement(<896466..>898094)
FT                   /locus_tag="AGOS_AER138C"
FT                   /old_locus_tag="AER138C"
FT   mRNA            complement(<896466..>898094)
FT                   /locus_tag="AGOS_AER138C"
FT                   /old_locus_tag="AER138C"
FT                   /product="AER138Cp"
FT   CDS_pept        complement(896466..898094)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER138C"
FT                   /old_locus_tag="AER138C"
FT                   /product="AER138Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML069W
FT                   (POB3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER138C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52821"
FT                   /db_xref="GOA:Q756X6"
FT                   /db_xref="InterPro:IPR000969"
FT                   /db_xref="InterPro:IPR011993"
FT                   /db_xref="InterPro:IPR013719"
FT                   /db_xref="InterPro:IPR024954"
FT                   /db_xref="InterPro:IPR035417"
FT                   /db_xref="InterPro:IPR038167"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q756X6"
FT                   /protein_id="AAS52821.1"
FT   gene            complement(<898327..>900093)
FT                   /locus_tag="AGOS_AER139C"
FT                   /old_locus_tag="AER139C"
FT   mRNA            complement(<898327..>900093)
FT                   /locus_tag="AGOS_AER139C"
FT                   /old_locus_tag="AER139C"
FT                   /product="AER139Cp"
FT   CDS_pept        complement(898327..900093)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AER139C"
FT                   /old_locus_tag="AER139C"
FT                   /product="AER139Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YML070W
FT                   (DAK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AER139C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS52822"
FT                   /db_xref="GOA:Q756X5"
FT                   /db_xref="InterPro:IPR004006"
FT                   /db_xref="InterPro:IPR004007"
FT                   /db_xref="InterPro:IPR012734"
FT                   /db_xref="InterPro:IPR036117"
FT                   /db_xref="UniProtKB/TrEMBL: