(data stored in ACNUC22857 zone)

EMBL: AE016819

ID   AE016819; SV 5; linear; genomic DNA; STD; FUN; 1836693 BP.
AC   AE016819; AE016899-AE016904;
PR   Project:PRJNA13834;
DT   09-SEP-2004 (Rel. 81, Created)
DT   19-SEP-2017 (Rel. 134, Last updated, Version 17)
DE   Ashbya gossypii ATCC 10895 chromosome VI, complete sequence.
KW   .
OS   Eremothecium gossypii ATCC 10895
OC   Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes;
OC   Saccharomycetales; Saccharomycetaceae; Eremothecium.
RN   [1]
RP   1-1836693
RX   DOI; 10.1126/science.1095781.
RX   PUBMED; 15001715.
RA   Dietrich F.S., Voegeli S., Brachat S., Lerch A., Gates K., Steiner S.,
RA   Mohr C., Pohlmann R., Luedi P., Choi S., Wing R.A., Flavier A.,
RA   Gaffney T.D., Philippsen P.;
RT   "The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces
RT   cerevisiae genome";
RL   Science, e1252229 304(5668):304-307(2004).
RN   [2]
RP   1-1836693
RA   Lerch A., Brachat S., Voegeli S.E., Gaffney T., Philippsen P.,
RA   Dietrich F.S.;
RT   ;
RL   Submitted (20-DEC-2002) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [3]
RC   Sequence update by submitter
RP   1-1836693
RA   Lerch A., Brachat S., Voegeli S.E., Gaffney T., Philippsen P.,
RA   Dietrich F.S.;
RT   ;
RL   Submitted (09-AUG-2007) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [4]
RC   Sequence update by submitter
RP   1-1836693
RA   Dietrich F.S., Voegeli S., Philippsen P.;
RT   ;
RL   Submitted (03-JUN-2010) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [5]
RC   Protein update by submitter
RP   1-1836693
RA   Dietrich F.S., Voegeli S., Philippsen P.;
RT   ;
RL   Submitted (18-OCT-2010) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
DR   MD5; c5c7b9a48422cfc3edf65459bf399b00.
DR   BioSample; SAMN03081415.
DR   EnsemblGenomes-Gn; EFAGOG00000000006.
DR   EnsemblGenomes-Gn; EFAGOG00000000007.
DR   EnsemblGenomes-Gn; EFAGOG00000000017.
DR   EnsemblGenomes-Gn; EFAGOG00000000031.
DR   EnsemblGenomes-Gn; EFAGOG00000000034.
DR   EnsemblGenomes-Gn; EFAGOG00000000052.
DR   EnsemblGenomes-Gn; EFAGOG00000000053.
DR   EnsemblGenomes-Gn; EFAGOG00000000060.
DR   EnsemblGenomes-Gn; EFAGOG00000000062.
DR   EnsemblGenomes-Gn; EFAGOG00000000074.
DR   EnsemblGenomes-Gn; EFAGOG00000000076.
DR   EnsemblGenomes-Gn; EFAGOG00000000085.
DR   EnsemblGenomes-Gn; EFAGOG00000000088.
DR   EnsemblGenomes-Gn; EFAGOG00000000096.
DR   EnsemblGenomes-Gn; EFAGOG00000000120.
DR   EnsemblGenomes-Gn; EFAGOG00000000122.
DR   EnsemblGenomes-Gn; EFAGOG00000000123.
DR   EnsemblGenomes-Gn; EFAGOG00000000131.
DR   EnsemblGenomes-Gn; EFAGOG00000000145.
DR   EnsemblGenomes-Gn; EFAGOG00000000150.
DR   EnsemblGenomes-Gn; EFAGOG00000000152.
DR   EnsemblGenomes-Gn; EFAGOG00000000156.
DR   EnsemblGenomes-Gn; EFAGOG00000000157.
DR   EnsemblGenomes-Gn; EFAGOG00000000164.
DR   EnsemblGenomes-Gn; EFAGOG00000000165.
DR   EnsemblGenomes-Gn; EFAGOG00000000170.
DR   EnsemblGenomes-Gn; EFAGOG00000000174.
DR   EnsemblGenomes-Gn; EFAGOG00000000191.
DR   EnsemblGenomes-Gn; EFAGOG00000000195.
DR   EnsemblGenomes-Gn; EFAGOG00000000196.
DR   EnsemblGenomes-Gn; EFAGOG00000000213.
DR   EnsemblGenomes-Gn; EFAGOG00000000217.
DR   EnsemblGenomes-Gn; EFAGOG00000000221.
DR   EnsemblGenomes-Gn; EFAGOG00000000223.
DR   EnsemblGenomes-Gn; EFAGOG00000000226.
DR   EnsemblGenomes-Gn; EFAGOG00000000227.
DR   EnsemblGenomes-Gn; EFAGOG00000000236.
DR   EnsemblGenomes-Gn; EFAGOG00000000239.
DR   EnsemblGenomes-Gn; EFAGOG00000000241.
DR   EnsemblGenomes-Gn; EFAGOG00000000242.
DR   EnsemblGenomes-Gn; EFAGOG00000000248.
DR   EnsemblGenomes-Gn; EFAGOG00000000249.
DR   EnsemblGenomes-Gn; EFAGOG00000000276.
DR   EnsemblGenomes-Gn; EFAGOG00000000279.
DR   EnsemblGenomes-Gn; EFAGOG00000000282.
DR   EnsemblGenomes-Gn; EFAGOG00000000290.
DR   EnsemblGenomes-Gn; EFAGOG00000000298.
DR   EnsemblGenomes-Gn; EFAGOG00000000301.
DR   EnsemblGenomes-Gn; EFAGOG00000000303.
DR   EnsemblGenomes-Gn; EFAGOG00000000308.
DR   EnsemblGenomes-Gn; EFAGOG00000000312.
DR   EnsemblGenomes-Gn; EFAGOG00000000314.
DR   EnsemblGenomes-Gn; EFAGOG00000000317.
DR   EnsemblGenomes-Gn; EFAGOG00000000322.
DR   EnsemblGenomes-Gn; EFAGOG00000000324.
DR   EnsemblGenomes-Gn; EFAGOG00000000335.
DR   EnsemblGenomes-Gn; EFAGOG00000000371.
DR   EnsemblGenomes-Gn; EFAGOG00000000374.
DR   EnsemblGenomes-Gn; EFAGOG00000000376.
DR   EnsemblGenomes-Gn; EFAGOG00000000383.
DR   EnsemblGenomes-Gn; EFAGOG00000000393.
DR   EnsemblGenomes-Gn; EFAGOG00000000394.
DR   EnsemblGenomes-Gn; EFAGOG00000000397.
DR   EnsemblGenomes-Gn; EFAGOG00000000406.
DR   EnsemblGenomes-Gn; EFAGOG00000000409.
DR   EnsemblGenomes-Gn; EFAGOG00000000413.
DR   EnsemblGenomes-Gn; ENSRNA049495900.
DR   EnsemblGenomes-Gn; ENSRNA049495904.
DR   EnsemblGenomes-Gn; ENSRNA049495917.
DR   EnsemblGenomes-Gn; ENSRNA049495924.
DR   EnsemblGenomes-Gn; ENSRNA049495933.
DR   EnsemblGenomes-Gn; ENSRNA049495942.
DR   EnsemblGenomes-Gn; ENSRNA049495950.
DR   EnsemblGenomes-Gn; ENSRNA049495957.
DR   EnsemblGenomes-Gn; ENSRNA049495962.
DR   EnsemblGenomes-Gn; ENSRNA049495971.
DR   EnsemblGenomes-Gn; ENSRNA049495976.
DR   EnsemblGenomes-Gn; ENSRNA049520399.
DR   EnsemblGenomes-Gn; ENSRNA049520407.
DR   EnsemblGenomes-Gn; ENSRNA049520436.
DR   EnsemblGenomes-Gn; ENSRNA049520461.
DR   EnsemblGenomes-Gn; ENSRNA049520484.
DR   EnsemblGenomes-Gn; ENSRNA049520520.
DR   EnsemblGenomes-Gn; ENSRNA049520539.
DR   EnsemblGenomes-Gn; ENSRNA049520560.
DR   EnsemblGenomes-Gn; ENSRNA049520584.
DR   EnsemblGenomes-Gn; ENSRNA049520605.
DR   EnsemblGenomes-Gn; ENSRNA049520632.
DR   EnsemblGenomes-Gn; ENSRNA049520667.
DR   EnsemblGenomes-Gn; ENSRNA049520702.
DR   EnsemblGenomes-Gn; ENSRNA049520738.
DR   EnsemblGenomes-Gn; ENSRNA049520756.
DR   EnsemblGenomes-Gn; ENSRNA049520810.
DR   EnsemblGenomes-Gn; ENSRNA049520827.
DR   EnsemblGenomes-Gn; ENSRNA049520853.
DR   EnsemblGenomes-Gn; ENSRNA049520869.
DR   EnsemblGenomes-Gn; ENSRNA049520905.
DR   EnsemblGenomes-Gn; ENSRNA049520945.
DR   EnsemblGenomes-Gn; ENSRNA049520961.
DR   EnsemblGenomes-Gn; ENSRNA049520994.
DR   EnsemblGenomes-Gn; ENSRNA049521029.
DR   EnsemblGenomes-Gn; ENSRNA049521046.
DR   EnsemblGenomes-Gn; ENSRNA049521069.
DR   EnsemblGenomes-Gn; ENSRNA049521091.
DR   EnsemblGenomes-Gn; ENSRNA049521118.
DR   EnsemblGenomes-Gn; ENSRNA049521147.
DR   EnsemblGenomes-Gn; ENSRNA049521175.
DR   EnsemblGenomes-Gn; ENSRNA049521204.
DR   EnsemblGenomes-Gn; ENSRNA049521243.
DR   EnsemblGenomes-Gn; ENSRNA049521269.
DR   EnsemblGenomes-Gn; ENSRNA049521285.
DR   EnsemblGenomes-Gn; ENSRNA049521318.
DR   EnsemblGenomes-Gn; ENSRNA049521348.
DR   EnsemblGenomes-Gn; ENSRNA049521377.
DR   EnsemblGenomes-Gn; ENSRNA049521401.
DR   EnsemblGenomes-Gn; ENSRNA049521439.
DR   EnsemblGenomes-Gn; ENSRNA049521480.
DR   EnsemblGenomes-Gn; ENSRNA049521524.
DR   EnsemblGenomes-Gn; ENSRNA049521553.
DR   EnsemblGenomes-Gn; ENSRNA049521567.
DR   EnsemblGenomes-Gn; ENSRNA049521591.
DR   EnsemblGenomes-Gn; ENSRNA049521616.
DR   EnsemblGenomes-Tr; EFAGOT00000000006.
DR   EnsemblGenomes-Tr; EFAGOT00000000007.
DR   EnsemblGenomes-Tr; EFAGOT00000000017.
DR   EnsemblGenomes-Tr; EFAGOT00000000031.
DR   EnsemblGenomes-Tr; EFAGOT00000000034.
DR   EnsemblGenomes-Tr; EFAGOT00000000052.
DR   EnsemblGenomes-Tr; EFAGOT00000000053.
DR   EnsemblGenomes-Tr; EFAGOT00000000060.
DR   EnsemblGenomes-Tr; EFAGOT00000000062.
DR   EnsemblGenomes-Tr; EFAGOT00000000074.
DR   EnsemblGenomes-Tr; EFAGOT00000000076.
DR   EnsemblGenomes-Tr; EFAGOT00000000085.
DR   EnsemblGenomes-Tr; EFAGOT00000000088.
DR   EnsemblGenomes-Tr; EFAGOT00000000096.
DR   EnsemblGenomes-Tr; EFAGOT00000000120.
DR   EnsemblGenomes-Tr; EFAGOT00000000122.
DR   EnsemblGenomes-Tr; EFAGOT00000000123.
DR   EnsemblGenomes-Tr; EFAGOT00000000131.
DR   EnsemblGenomes-Tr; EFAGOT00000000145.
DR   EnsemblGenomes-Tr; EFAGOT00000000150.
DR   EnsemblGenomes-Tr; EFAGOT00000000152.
DR   EnsemblGenomes-Tr; EFAGOT00000000156.
DR   EnsemblGenomes-Tr; EFAGOT00000000157.
DR   EnsemblGenomes-Tr; EFAGOT00000000164.
DR   EnsemblGenomes-Tr; EFAGOT00000000165.
DR   EnsemblGenomes-Tr; EFAGOT00000000170.
DR   EnsemblGenomes-Tr; EFAGOT00000000174.
DR   EnsemblGenomes-Tr; EFAGOT00000000191.
DR   EnsemblGenomes-Tr; EFAGOT00000000195.
DR   EnsemblGenomes-Tr; EFAGOT00000000196.
DR   EnsemblGenomes-Tr; EFAGOT00000000213.
DR   EnsemblGenomes-Tr; EFAGOT00000000217.
DR   EnsemblGenomes-Tr; EFAGOT00000000221.
DR   EnsemblGenomes-Tr; EFAGOT00000000223.
DR   EnsemblGenomes-Tr; EFAGOT00000000226.
DR   EnsemblGenomes-Tr; EFAGOT00000000227.
DR   EnsemblGenomes-Tr; EFAGOT00000000236.
DR   EnsemblGenomes-Tr; EFAGOT00000000239.
DR   EnsemblGenomes-Tr; EFAGOT00000000241.
DR   EnsemblGenomes-Tr; EFAGOT00000000242.
DR   EnsemblGenomes-Tr; EFAGOT00000000248.
DR   EnsemblGenomes-Tr; EFAGOT00000000249.
DR   EnsemblGenomes-Tr; EFAGOT00000000276.
DR   EnsemblGenomes-Tr; EFAGOT00000000279.
DR   EnsemblGenomes-Tr; EFAGOT00000000282.
DR   EnsemblGenomes-Tr; EFAGOT00000000290.
DR   EnsemblGenomes-Tr; EFAGOT00000000298.
DR   EnsemblGenomes-Tr; EFAGOT00000000301.
DR   EnsemblGenomes-Tr; EFAGOT00000000303.
DR   EnsemblGenomes-Tr; EFAGOT00000000308.
DR   EnsemblGenomes-Tr; EFAGOT00000000312.
DR   EnsemblGenomes-Tr; EFAGOT00000000314.
DR   EnsemblGenomes-Tr; EFAGOT00000000317.
DR   EnsemblGenomes-Tr; EFAGOT00000000322.
DR   EnsemblGenomes-Tr; EFAGOT00000000324.
DR   EnsemblGenomes-Tr; EFAGOT00000000335.
DR   EnsemblGenomes-Tr; EFAGOT00000000371.
DR   EnsemblGenomes-Tr; EFAGOT00000000374.
DR   EnsemblGenomes-Tr; EFAGOT00000000376.
DR   EnsemblGenomes-Tr; EFAGOT00000000383.
DR   EnsemblGenomes-Tr; EFAGOT00000000393.
DR   EnsemblGenomes-Tr; EFAGOT00000000394.
DR   EnsemblGenomes-Tr; EFAGOT00000000397.
DR   EnsemblGenomes-Tr; EFAGOT00000000406.
DR   EnsemblGenomes-Tr; EFAGOT00000000409.
DR   EnsemblGenomes-Tr; EFAGOT00000000413.
DR   EuropePMC; PMC3161974; 21791067.
DR   EuropePMC; PMC519154; 15282338.
DR   RFAM; RF00004; U2.
DR   RFAM; RF00005; tRNA.
DR   RFAM; RF00069; SNORD24.
DR   RFAM; RF00093; SNORD18.
DR   RFAM; RF00134; snoZ196.
DR   RFAM; RF00309; snosnR60_Z15.
DR   RFAM; RF00471; snosnR48.
DR   RFAM; RF00479; snosnR71.
DR   RFAM; RF00509; snosnR64.
DR   RFAM; RF01195; snR52.
DR   RFAM; RF01223; snR13.
DR   RFAM; RF01244; snR4.
DR   RFAM; RF01247; snR32.
DR   RFAM; RF01258; snR10.
DR   RFAM; RF01260; snR11.
DR   RFAM; RF01261; snR82.
DR   RFAM; RF01262; snR44.
DR   RFAM; RF01266; snR45.
DR   RFAM; RF01267; snR37.
DR   RFAM; RF01502; Fungi_SRP.
DR   StrainInfo; 195190; 0.
CC   On Jun 29, 2010 this sequence version replaced AE016819.4.
CC   This genome has been completely resequenced to high accuracy (derf)
CC   and reannotated. Gene names have been maintained, though some genes
CC   have been added, and many protein sequences have been corrected.
FH   Key             Location/Qualifiers
FT   source          1..1836693
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /chromosome="VI"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /db_xref="taxon:284811"
FT                   /culture_collection="ATCC:10895"
FT   source          29053..89763
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2564"
FT                   /db_xref="taxon:284811"
FT   source          89666..147977
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1587"
FT                   /db_xref="taxon:284811"
FT   source          116449..197112
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2422"
FT                   /db_xref="taxon:284811"
FT   source          176039..227038
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1668"
FT                   /db_xref="taxon:284811"
FT   source          233999..311485
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2166"
FT                   /db_xref="taxon:284811"
FT   source          290384..354254
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1930"
FT                   /db_xref="taxon:284811"
FT   source          341173..401664
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2002"
FT                   /db_xref="taxon:284811"
FT   source          401586..425221
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2080"
FT                   /db_xref="taxon:284811"
FT   source          407411..461926
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2224"
FT                   /db_xref="taxon:284811"
FT   source          442192..502222
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1894"
FT                   /db_xref="taxon:284811"
FT   source          497430..561198
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1841"
FT                   /db_xref="taxon:284811"
FT   source          550895..601595
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1903"
FT                   /db_xref="taxon:284811"
FT   source          580104..628149
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2033"
FT                   /db_xref="taxon:284811"
FT   source          636286..715959
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2107"
FT                   /db_xref="taxon:284811"
FT   source          677067..752846
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2527"
FT                   /db_xref="taxon:284811"
FT   source          715893..794333
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2313"
FT                   /db_xref="taxon:284811"
FT   source          791672..860856
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2358"
FT                   /db_xref="taxon:284811"
FT   source          835634..903842
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2194"
FT                   /db_xref="taxon:284811"
FT   source          891641..955641
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1538"
FT                   /db_xref="taxon:284811"
FT   source          930590..1012642
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1865"
FT                   /db_xref="taxon:284811"
FT   source          1004025..1060602
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2191"
FT                   /db_xref="taxon:284811"
FT   source          1034780..1097597
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2093"
FT                   /db_xref="taxon:284811"
FT   source          1069955..1141967
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1561"
FT                   /db_xref="taxon:284811"
FT   source          1103574..1144248
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2417"
FT                   /db_xref="taxon:284811"
FT   source          1160118..1246169
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2404"
FT                   /db_xref="taxon:284811"
FT   source          1235917..1269406
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1650"
FT                   /db_xref="taxon:284811"
FT   source          1263458..1335273
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2318"
FT                   /db_xref="taxon:284811"
FT   source          1311966..1369835
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2457"
FT                   /db_xref="taxon:284811"
FT   source          1342188..1393032
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2161"
FT                   /db_xref="taxon:284811"
FT   source          1369700..1456751
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2545"
FT                   /db_xref="taxon:284811"
FT   source          1456609..1536890
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2180"
FT                   /db_xref="taxon:284811"
FT   source          1546882..1597932
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1219"
FT                   /db_xref="taxon:284811"
FT   source          1573100..1624580
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2408"
FT                   /db_xref="taxon:284811"
FT   source          1595424..1640045
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1953"
FT                   /db_xref="taxon:284811"
FT   source          1622989..1679451
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1888"
FT                   /db_xref="taxon:284811"
FT   source          1679379..1735976
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1779"
FT                   /db_xref="taxon:284811"
FT   source          1738272..1802897
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1919"
FT                   /db_xref="taxon:284811"
FT   telomere        complement(1..399)
FT                   /rpt_type=DIRECT
FT                   /rpt_unit_range=24..47
FT                   /rpt_unit_seq="ggtgtggtgtatgggtctctcagc"
FT                   /note="Chromosome VI left end terminal telomere repeat.
FT                   Composed of approximately 20 copies of a 24 base repeat
FT                   unit, and occasionally sequence varients of this repeat."
FT   telomere        complement(400..700)
FT                   /note="Chromosome VI left subtelomeric sequence. Shares
FT                   some sequence similarity with other subtelomeric regions."
FT   gene            <786..>2618
FT                   /locus_tag="AGOS_AFL235W"
FT                   /old_locus_tag="AFL235W"
FT   mRNA            <786..>2618
FT                   /locus_tag="AGOS_AFL235W"
FT                   /old_locus_tag="AFL235W"
FT                   /product="AFL235Wp"
FT   CDS_pept        786..2618
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL235W"
FT                   /old_locus_tag="AFL235W"
FT                   /product="AFL235Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIL014W (MNT3) and YER001W (MNN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL235W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53139"
FT                   /db_xref="GOA:Q755P8"
FT                   /db_xref="InterPro:IPR022751"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q755P8"
FT                   /protein_id="AAS53139.2"
FT   gene            complement(<3695..>4267)
FT                   /locus_tag="AGOS_AFL234C"
FT                   /old_locus_tag="AFL234C"
FT   mRNA            complement(<3695..>4267)
FT                   /locus_tag="AGOS_AFL234C"
FT                   /old_locus_tag="AFL234C"
FT                   /product="AFL234Cp"
FT   CDS_pept        complement(3695..4267)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL234C"
FT                   /old_locus_tag="AFL234C"
FT                   /product="AFL234Cp"
FT                   /note="NOHBY617; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL234C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53140"
FT                   /db_xref="GOA:Q755P7"
FT                   /db_xref="UniProtKB/TrEMBL:Q755P7"
FT                   /protein_id="AAS53140.1"
FT   gene            complement(<5200..>5913)
FT                   /locus_tag="AGOS_AFL233C"
FT                   /old_locus_tag="AFL233C"
FT   mRNA            complement(<5200..>5913)
FT                   /locus_tag="AGOS_AFL233C"
FT                   /old_locus_tag="AFL233C"
FT                   /product="AFL233Cp"
FT   CDS_pept        complement(5200..5913)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL233C"
FT                   /old_locus_tag="AFL233C"
FT                   /product="AFL233Cp"
FT                   /note="NOHBY616; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL233C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53141"
FT                   /db_xref="GOA:Q755P6"
FT                   /db_xref="UniProtKB/TrEMBL:Q755P6"
FT                   /protein_id="AAS53141.1"
FT                   GESSNAPAPRACAAR"
FT   gene            <6883..>7707
FT                   /locus_tag="AGOS_AFL232W"
FT                   /old_locus_tag="AFL232W"
FT   mRNA            <6883..>7707
FT                   /locus_tag="AGOS_AFL232W"
FT                   /old_locus_tag="AFL232W"
FT                   /product="AFL232Wp"
FT   CDS_pept        6883..7707
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL232W"
FT                   /old_locus_tag="AFL232W"
FT                   /product="AFL232Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR106W
FT                   (VAM3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL232W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53142"
FT                   /db_xref="GOA:Q755P5"
FT                   /db_xref="InterPro:IPR000727"
FT                   /db_xref="InterPro:IPR006012"
FT                   /db_xref="InterPro:IPR010989"
FT                   /db_xref="UniProtKB/TrEMBL:Q755P5"
FT                   /protein_id="AAS53142.2"
FT   gene            complement(<7789..>9252)
FT                   /locus_tag="AGOS_AFL231C"
FT                   /old_locus_tag="AFL231C"
FT   mRNA            complement(<7789..>9252)
FT                   /locus_tag="AGOS_AFL231C"
FT                   /old_locus_tag="AFL231C"
FT                   /product="AFL231Cp"
FT   CDS_pept        complement(7789..9252)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL231C"
FT                   /old_locus_tag="AFL231C"
FT                   /product="AFL231Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL103W
FT                   (MET4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL231C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53143"
FT                   /db_xref="GOA:Q755P4"
FT                   /db_xref="UniProtKB/TrEMBL:Q755P4"
FT                   /protein_id="AAS53143.1"
FT   gene            <10009..>10962
FT                   /locus_tag="AGOS_AFL230W"
FT                   /old_locus_tag="AFL230W"
FT   mRNA            <10009..>10962
FT                   /locus_tag="AGOS_AFL230W"
FT                   /old_locus_tag="AFL230W"
FT                   /product="AFL230Wp"
FT   CDS_pept        10009..10962
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL230W"
FT                   /old_locus_tag="AFL230W"
FT                   /product="AFL230Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR107W
FT                   (RGS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL230W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53144"
FT                   /db_xref="InterPro:IPR016137"
FT                   /db_xref="InterPro:IPR036305"
FT                   /db_xref="UniProtKB/TrEMBL:Q755P3"
FT                   /protein_id="AAS53144.1"
FT   gene            <11805..>13622
FT                   /locus_tag="AGOS_AFL229W"
FT                   /old_locus_tag="AFL229W"
FT   mRNA            <11805..>13622
FT                   /locus_tag="AGOS_AFL229W"
FT                   /old_locus_tag="AFL229W"
FT                   /product="AFL229Wp"
FT   CDS_pept        11805..13622
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL229W"
FT                   /old_locus_tag="AFL229W"
FT                   /product="AFL229Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL104C
FT                   (LEU4) and YOR108W (LEU9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL229W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53145"
FT                   /db_xref="GOA:Q755P2"
FT                   /db_xref="InterPro:IPR000891"
FT                   /db_xref="InterPro:IPR002034"
FT                   /db_xref="InterPro:IPR005668"
FT                   /db_xref="InterPro:IPR013709"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR036230"
FT                   /db_xref="InterPro:IPR039371"
FT                   /db_xref="UniProtKB/TrEMBL:Q755P2"
FT                   /protein_id="AAS53145.2"
FT   gene            <13867..>17217
FT                   /locus_tag="AGOS_AFL228W"
FT                   /old_locus_tag="AFL228W"
FT   mRNA            <13867..>17217
FT                   /locus_tag="AGOS_AFL228W"
FT                   /old_locus_tag="AFL228W"
FT                   /product="AFL228Wp"
FT   CDS_pept        13867..17217
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL228W"
FT                   /old_locus_tag="AFL228W"
FT                   /product="AFL228Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR109W
FT                   (INP53) and YNL106C (INP52)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL228W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53146"
FT                   /db_xref="GOA:Q755P1"
FT                   /db_xref="InterPro:IPR000300"
FT                   /db_xref="InterPro:IPR002013"
FT                   /db_xref="InterPro:IPR005135"
FT                   /db_xref="InterPro:IPR036691"
FT                   /db_xref="UniProtKB/TrEMBL:Q755P1"
FT                   /protein_id="AAS53146.2"
FT                   DSWKPLTPK"
FT   gene            complement(<17324..>17950)
FT                   /locus_tag="AGOS_AFL227C"
FT                   /old_locus_tag="AFL227C"
FT   mRNA            complement(<17324..>17950)
FT                   /locus_tag="AGOS_AFL227C"
FT                   /old_locus_tag="AFL227C"
FT                   /product="AFL227Cp"
FT   CDS_pept        complement(17324..17950)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL227C"
FT                   /old_locus_tag="AFL227C"
FT                   /product="AFL227Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL107W
FT                   (YAF9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL227C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53147"
FT                   /db_xref="GOA:Q755P0"
FT                   /db_xref="InterPro:IPR005033"
FT                   /db_xref="InterPro:IPR037989"
FT                   /db_xref="InterPro:IPR038704"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755P0"
FT                   /protein_id="AAS53147.1"
FT   gene            <18146..>19371
FT                   /locus_tag="AGOS_AFL226W"
FT                   /old_locus_tag="AFL226W"
FT   mRNA            join(<18146..18175,18229..>19371)
FT                   /locus_tag="AGOS_AFL226W"
FT                   /old_locus_tag="AFL226W"
FT                   /product="AFL226Wp"
FT   CDS_pept        join(18146..18175,18229..19371)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL226W"
FT                   /old_locus_tag="AFL226W"
FT                   /product="AFL226Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL108C
FT                   and YOR110W (TFC7); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL226W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53148"
FT                   /db_xref="InterPro:IPR013078"
FT                   /db_xref="InterPro:IPR014623"
FT                   /db_xref="InterPro:IPR019481"
FT                   /db_xref="InterPro:IPR029033"
FT                   /db_xref="UniProtKB/TrEMBL:Q755N9"
FT                   /protein_id="AAS53148.1"
FT   gene            <19502..>20158
FT                   /locus_tag="AGOS_AFL225W"
FT                   /old_locus_tag="AFL225W"
FT   mRNA            <19502..>20158
FT                   /locus_tag="AGOS_AFL225W"
FT                   /old_locus_tag="AFL225W"
FT                   /product="AFL225Wp"
FT   CDS_pept        19502..20158
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL225W"
FT                   /old_locus_tag="AFL225W"
FT                   /product="AFL225Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YOR111W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL225W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53149"
FT                   /db_xref="GOA:Q755N8"
FT                   /db_xref="InterPro:IPR003697"
FT                   /db_xref="InterPro:IPR029001"
FT                   /db_xref="UniProtKB/TrEMBL:Q755N8"
FT                   /protein_id="AAS53149.1"
FT   gene            <20331..>20951
FT                   /locus_tag="AGOS_AFL224W"
FT                   /old_locus_tag="AFL224W"
FT   mRNA            <20331..>20951
FT                   /locus_tag="AGOS_AFL224W"
FT                   /old_locus_tag="AFL224W"
FT                   /product="AFL224Wp"
FT   CDS_pept        20331..20951
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL224W"
FT                   /old_locus_tag="AFL224W"
FT                   /product="AFL224Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL110C
FT                   (NOP15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL224W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53150"
FT                   /db_xref="GOA:Q755N7"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR034469"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q755N7"
FT                   /protein_id="AAS53150.1"
FT   gene            <21070..>21567
FT                   /locus_tag="AGOS_AFL223W"
FT                   /old_locus_tag="AFL223W"
FT   mRNA            <21070..>21567
FT                   /locus_tag="AGOS_AFL223W"
FT                   /old_locus_tag="AFL223W"
FT                   /product="AFL223Wp"
FT   CDS_pept        21070..21567
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL223W"
FT                   /old_locus_tag="AFL223W"
FT                   /product="AFL223Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL111C
FT                   (CYB5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL223W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53151"
FT                   /db_xref="GOA:Q755N6"
FT                   /db_xref="InterPro:IPR001199"
FT                   /db_xref="InterPro:IPR036400"
FT                   /db_xref="UniProtKB/TrEMBL:Q755N6"
FT                   /protein_id="AAS53151.1"
FT                   WA"
FT   gene            <21758..>23956
FT                   /locus_tag="AGOS_AFL222W"
FT                   /old_locus_tag="AFL222W"
FT   mRNA            <21758..>23956
FT                   /locus_tag="AGOS_AFL222W"
FT                   /old_locus_tag="AFL222W"
FT                   /product="AFL222Wp"
FT   CDS_pept        21758..23956
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL222W"
FT                   /old_locus_tag="AFL222W"
FT                   /product="AFL222Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR112W
FT                   (CEX1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL222W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53152"
FT                   /db_xref="GOA:Q755N5"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q755N5"
FT                   /protein_id="AAS53152.1"
FT   gene            complement(<24180..>26519)
FT                   /locus_tag="AGOS_AFL221C"
FT                   /old_locus_tag="AFL221C"
FT   mRNA            complement(join(<24180..24577,25244..>26519))
FT                   /locus_tag="AGOS_AFL221C"
FT                   /old_locus_tag="AFL221C"
FT                   /product="AFL221Cp"
FT   CDS_pept        complement(join(24180..24577,25244..26519))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL221C"
FT                   /old_locus_tag="AFL221C"
FT                   /product="AFL221Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL112W
FT                   (DBP2); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL221C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53153"
FT                   /db_xref="GOA:Q755N4"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755N4"
FT                   /protein_id="AAS53153.2"
FT   gene            complement(<26750..>27157)
FT                   /locus_tag="AGOS_AFL220C"
FT                   /old_locus_tag="AFL220C"
FT   mRNA            complement(<26750..>27157)
FT                   /locus_tag="AGOS_AFL220C"
FT                   /old_locus_tag="AFL220C"
FT                   /product="AFL220Cp"
FT   CDS_pept        complement(26750..27157)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL220C"
FT                   /old_locus_tag="AFL220C"
FT                   /product="AFL220Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL113W
FT                   (RPC19)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL220C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53154"
FT                   /db_xref="GOA:Q755Q7"
FT                   /db_xref="InterPro:IPR008193"
FT                   /db_xref="InterPro:IPR009025"
FT                   /db_xref="InterPro:IPR033898"
FT                   /db_xref="InterPro:IPR036603"
FT                   /db_xref="UniProtKB/TrEMBL:Q755Q7"
FT                   /protein_id="AAS53154.2"
FT   gene            <27531..>28079
FT                   /locus_tag="AGOS_AFL219W"
FT                   /old_locus_tag="AFL219W"
FT   mRNA            <27531..>28079
FT                   /locus_tag="AGOS_AFL219W"
FT                   /old_locus_tag="AFL219W"
FT                   /product="AFL219Wp"
FT   CDS_pept        27531..28079
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL219W"
FT                   /old_locus_tag="AFL219W"
FT                   /product="AFL219Wp"
FT                   /note="NOHBY615; Weak homolog in Saccharomyces cerevisiae
FT                   YKL032C (IXR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL219W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53155"
FT                   /db_xref="GOA:Q755N3"
FT                   /db_xref="InterPro:IPR009071"
FT                   /db_xref="InterPro:IPR036910"
FT                   /db_xref="UniProtKB/TrEMBL:Q755N3"
FT                   /protein_id="AAS53155.1"
FT   gene            complement(<28250..>31837)
FT                   /locus_tag="AGOS_AFL218C"
FT                   /old_locus_tag="AFL218C"
FT   mRNA            complement(<28250..>31837)
FT                   /locus_tag="AGOS_AFL218C"
FT                   /old_locus_tag="AFL218C"
FT                   /product="AFL218Cp"
FT   CDS_pept        complement(28250..31837)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL218C"
FT                   /old_locus_tag="AFL218C"
FT                   /product="AFL218Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR050W
FT                   (TRK2) and YJL129C (TRK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL218C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53156"
FT                   /db_xref="GOA:Q755N2"
FT                   /db_xref="InterPro:IPR003445"
FT                   /db_xref="InterPro:IPR004773"
FT                   /db_xref="InterPro:IPR015958"
FT                   /db_xref="UniProtKB/TrEMBL:Q755N2"
FT                   /protein_id="AAS53156.2"
FT   gene            complement(<32234..>34309)
FT                   /locus_tag="AGOS_AFL217C"
FT                   /old_locus_tag="AFL217C"
FT   mRNA            complement(<32234..>34309)
FT                   /locus_tag="AGOS_AFL217C"
FT                   /old_locus_tag="AFL217C"
FT                   /product="AFL217Cp"
FT   CDS_pept        complement(32234..34309)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL217C"
FT                   /old_locus_tag="AFL217C"
FT                   /product="AFL217Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL128C
FT                   (PBS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL217C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53157"
FT                   /db_xref="GOA:Q755N1"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q755N1"
FT                   /protein_id="AAS53157.1"
FT   gene            complement(<34664..>34813)
FT                   /locus_tag="AGOS_AFL216C"
FT                   /old_locus_tag="AFL216C"
FT   mRNA            complement(<34664..>34813)
FT                   /locus_tag="AGOS_AFL216C"
FT                   /old_locus_tag="AFL216C"
FT                   /product="AFL216Cp"
FT   CDS_pept        complement(34664..34813)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL216C"
FT                   /old_locus_tag="AFL216C"
FT                   /product="AFL216Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YJL127C-B"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL216C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53158"
FT                   /db_xref="GOA:Q755N0"
FT                   /db_xref="InterPro:IPR035195"
FT                   /db_xref="UniProtKB/TrEMBL:Q755N0"
FT                   /protein_id="AAS53158.1"
FT                   AQNC"
FT   gene            complement(<34959..>36698)
FT                   /locus_tag="AGOS_AFL215C"
FT                   /old_locus_tag="AFL215C"
FT   mRNA            complement(<34959..>36698)
FT                   /locus_tag="AGOS_AFL215C"
FT                   /old_locus_tag="AFL215C"
FT                   /product="AFL215Cp"
FT   CDS_pept        complement(34959..36698)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL215C"
FT                   /old_locus_tag="AFL215C"
FT                   /product="AFL215Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL127C
FT                   (SPT10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL215C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53159"
FT                   /db_xref="GOA:Q755M9"
FT                   /db_xref="InterPro:IPR000182"
FT                   /db_xref="InterPro:IPR015416"
FT                   /db_xref="InterPro:IPR016181"
FT                   /db_xref="UniProtKB/TrEMBL:Q755M9"
FT                   /protein_id="AAS53159.1"
FT                   AYY"
FT   gene            complement(<36985..>38205)
FT                   /locus_tag="AGOS_AFL214C"
FT                   /old_locus_tag="AFL214C"
FT   mRNA            complement(<36985..>38205)
FT                   /locus_tag="AGOS_AFL214C"
FT                   /old_locus_tag="AFL214C"
FT                   /product="AFL214Cp"
FT   CDS_pept        complement(36985..38205)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL214C"
FT                   /old_locus_tag="AFL214C"
FT                   /product="AFL214Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL125C
FT                   (GCD14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL214C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53160"
FT                   /db_xref="GOA:Q755M8"
FT                   /db_xref="InterPro:IPR014816"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755M8"
FT                   /protein_id="AAS53160.1"
FT                   SQASNSV"
FT   gene            <38882..>40270
FT                   /locus_tag="AGOS_AFL213W"
FT                   /old_locus_tag="AFL213W"
FT   mRNA            <38882..>40270
FT                   /locus_tag="AGOS_AFL213W"
FT                   /old_locus_tag="AFL213W"
FT                   /product="AFL213Wp"
FT   CDS_pept        38882..40270
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL213W"
FT                   /old_locus_tag="AFL213W"
FT                   /product="AFL213Wp"
FT                   /note="NOHBY614; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E15246g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL213W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53161"
FT                   /db_xref="GOA:Q755M7"
FT                   /db_xref="InterPro:IPR006091"
FT                   /db_xref="InterPro:IPR009075"
FT                   /db_xref="InterPro:IPR009100"
FT                   /db_xref="InterPro:IPR036250"
FT                   /db_xref="InterPro:IPR037069"
FT                   /db_xref="UniProtKB/TrEMBL:Q755M7"
FT                   /protein_id="AAS53161.1"
FT                   AKSS"
FT   gene            complement(<40439..>40897)
FT                   /locus_tag="AGOS_AFL212C"
FT                   /old_locus_tag="AFL212C"
FT   mRNA            complement(<40439..>40897)
FT                   /locus_tag="AGOS_AFL212C"
FT                   /old_locus_tag="AFL212C"
FT                   /product="AFL212Cp"
FT   CDS_pept        complement(40439..40897)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL212C"
FT                   /old_locus_tag="AFL212C"
FT                   /product="AFL212Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL124C
FT                   (LSM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL212C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53162"
FT                   /db_xref="GOA:Q755M6"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR034104"
FT                   /db_xref="UniProtKB/TrEMBL:Q755M6"
FT                   /protein_id="AAS53162.1"
FT   gene            <41324..>41725
FT                   /locus_tag="AGOS_AFL211W"
FT                   /old_locus_tag="AFL211W"
FT   mRNA            <41324..>41725
FT                   /locus_tag="AGOS_AFL211W"
FT                   /old_locus_tag="AFL211W"
FT                   /product="AFL211Wp"
FT   CDS_pept        41324..41725
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL211W"
FT                   /old_locus_tag="AFL211W"
FT                   /product="AFL211Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR049C
FT                   (FMP46)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL211W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53163"
FT                   /db_xref="GOA:Q755M5"
FT                   /db_xref="InterPro:IPR012882"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755M5"
FT                   /protein_id="AAS53163.1"
FT   gene            complement(<41782..>43047)
FT                   /locus_tag="AGOS_AFL210C"
FT                   /old_locus_tag="AFL210C"
FT   mRNA            complement(<41782..>43047)
FT                   /locus_tag="AGOS_AFL210C"
FT                   /old_locus_tag="AFL210C"
FT                   /product="AFL210Cp"
FT   CDS_pept        complement(41782..43047)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL210C"
FT                   /old_locus_tag="AFL210C"
FT                   /product="AFL210Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL123C
FT                   (MTC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL210C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53164"
FT                   /db_xref="InterPro:IPR018814"
FT                   /db_xref="UniProtKB/TrEMBL:Q755M4"
FT                   /protein_id="AAS53164.2"
FT   gene            <43540..>44022
FT                   /locus_tag="AGOS_AFL209W"
FT                   /old_locus_tag="AFL209W"
FT   mRNA            <43540..>44022
FT                   /locus_tag="AGOS_AFL209W"
FT                   /old_locus_tag="AFL209W"
FT                   /product="AFL209Wp"
FT   CDS_pept        43540..44022
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL209W"
FT                   /old_locus_tag="AFL209W"
FT                   /product="AFL209Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL122W
FT                   (ALB1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL209W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53165"
FT                   /db_xref="GOA:Q755M3"
FT                   /db_xref="InterPro:IPR022784"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755M3"
FT                   /protein_id="AAS53165.1"
FT   gene            complement(<44149..>44868)
FT                   /locus_tag="AGOS_AFL208C"
FT                   /old_locus_tag="AFL208C"
FT   mRNA            complement(<44149..>44868)
FT                   /locus_tag="AGOS_AFL208C"
FT                   /old_locus_tag="AFL208C"
FT                   /product="AFL208Cp"
FT   CDS_pept        complement(44149..44868)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL208C"
FT                   /old_locus_tag="AFL208C"
FT                   /product="AFL208Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL121C
FT                   (RPE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL208C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53166"
FT                   /db_xref="GOA:Q755M2"
FT                   /db_xref="InterPro:IPR000056"
FT                   /db_xref="InterPro:IPR011060"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR026019"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755M2"
FT                   /protein_id="AAS53166.1"
FT                   DNVRDELRSRGLLDIDM"
FT   gene            complement(44965..45049)
FT                   /locus_tag="AGOS_t0130"
FT   tRNA            complement(join(44965..45001,45011..45049))
FT                   /locus_tag="AGOS_t0130"
FT                   /product="tRNA-Tyr"
FT                   /note="codon recognized: UAC"
FT   gene            complement(<45815..>47434)
FT                   /locus_tag="AGOS_AFL207C"
FT                   /old_locus_tag="AFL207C"
FT   mRNA            complement(<45815..>47434)
FT                   /locus_tag="AGOS_AFL207C"
FT                   /old_locus_tag="AFL207C"
FT                   /product="AFL207Cp"
FT   CDS_pept        complement(45815..47434)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL207C"
FT                   /old_locus_tag="AFL207C"
FT                   /product="AFL207Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR343C
FT                   (HXT6), YDR342C (HXT7) and YHR092C (HXT4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL207C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53167"
FT                   /db_xref="GOA:Q755M1"
FT                   /db_xref="InterPro:IPR003663"
FT                   /db_xref="InterPro:IPR005828"
FT                   /db_xref="InterPro:IPR005829"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q755M1"
FT                   /protein_id="AAS53167.1"
FT   gene            complement(<48062..>50008)
FT                   /locus_tag="AGOS_AFL206C"
FT                   /old_locus_tag="AFL206C"
FT   mRNA            complement(<48062..>50008)
FT                   /locus_tag="AGOS_AFL206C"
FT                   /old_locus_tag="AFL206C"
FT                   /product="AFL206Cp"
FT   CDS_pept        complement(48062..50008)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL206C"
FT                   /old_locus_tag="AFL206C"
FT                   /product="AFL206Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR341C
FT                   and YHR091C (MSR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL206C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53168"
FT                   /db_xref="GOA:Q755M0"
FT                   /db_xref="InterPro:IPR001278"
FT                   /db_xref="InterPro:IPR001412"
FT                   /db_xref="InterPro:IPR005148"
FT                   /db_xref="InterPro:IPR008909"
FT                   /db_xref="InterPro:IPR009080"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR035684"
FT                   /db_xref="InterPro:IPR036695"
FT                   /db_xref="UniProtKB/TrEMBL:Q755M0"
FT                   /protein_id="AAS53168.1"
FT                   GMRLLGLTPVDRM"
FT   gene            complement(<50502..>52142)
FT                   /locus_tag="AGOS_AFL205C"
FT                   /old_locus_tag="AFL205C"
FT   mRNA            complement(<50502..>52142)
FT                   /locus_tag="AGOS_AFL205C"
FT                   /old_locus_tag="AFL205C"
FT                   /product="AFL205Cp"
FT   CDS_pept        complement(50502..52142)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL205C"
FT                   /old_locus_tag="AFL205C"
FT                   /product="AFL205Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR094C
FT                   (HXT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL205C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53169"
FT                   /db_xref="GOA:Q755L9"
FT                   /db_xref="InterPro:IPR003663"
FT                   /db_xref="InterPro:IPR005828"
FT                   /db_xref="InterPro:IPR005829"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q755L9"
FT                   /protein_id="AAS53169.1"
FT   gene            complement(<53050..>54657)
FT                   /locus_tag="AGOS_AFL204C"
FT                   /old_locus_tag="AFL204C"
FT   mRNA            complement(<53050..>54657)
FT                   /locus_tag="AGOS_AFL204C"
FT                   /old_locus_tag="AFL204C"
FT                   /product="AFL204Cp"
FT   CDS_pept        complement(53050..54657)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL204C"
FT                   /old_locus_tag="AFL204C"
FT                   /product="AFL204Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR096C
FT                   (HXT5) and YDR342C (HXT7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL204C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53170"
FT                   /db_xref="GOA:Q755L8"
FT                   /db_xref="InterPro:IPR003663"
FT                   /db_xref="InterPro:IPR005828"
FT                   /db_xref="InterPro:IPR005829"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q755L8"
FT                   /protein_id="AAS53170.1"
FT                   WGSESWLPRSDREVAHDA"
FT   gene            complement(<55339..>56496)
FT                   /locus_tag="AGOS_AFL203C"
FT                   /old_locus_tag="AFL203C"
FT   mRNA            complement(<55339..>56496)
FT                   /locus_tag="AGOS_AFL203C"
FT                   /old_locus_tag="AFL203C"
FT                   /product="AFL203Cp"
FT   CDS_pept        complement(55339..56496)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL203C"
FT                   /old_locus_tag="AFL203C"
FT                   /product="AFL203Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR346C
FT                   (SVF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL203C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53171"
FT                   /db_xref="GOA:Q755L7"
FT                   /db_xref="InterPro:IPR013931"
FT                   /db_xref="InterPro:IPR033394"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755L7"
FT                   /protein_id="AAS53171.1"
FT   gene            complement(<57613..>59058)
FT                   /locus_tag="AGOS_AFL202C"
FT                   /old_locus_tag="AFL202C"
FT   mRNA            complement(<57613..>59058)
FT                   /locus_tag="AGOS_AFL202C"
FT                   /old_locus_tag="AFL202C"
FT                   /product="AFL202Cp"
FT   CDS_pept        complement(57613..59058)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL202C"
FT                   /old_locus_tag="AFL202C"
FT                   /product="AFL202Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL106C
FT                   (PHO2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL202C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53172"
FT                   /db_xref="GOA:Q755L6"
FT                   /db_xref="InterPro:IPR001356"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR017970"
FT                   /db_xref="UniProtKB/TrEMBL:Q755L6"
FT                   /protein_id="AAS53172.2"
FT   gene            <59887..>61380
FT                   /locus_tag="AGOS_AFL201W"
FT                   /old_locus_tag="AFL201W"
FT   mRNA            <59887..>61380
FT                   /locus_tag="AGOS_AFL201W"
FT                   /old_locus_tag="AFL201W"
FT                   /product="AFL201Wp"
FT   CDS_pept        59887..61380
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL201W"
FT                   /old_locus_tag="AFL201W"
FT                   /product="AFL201Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR170C
FT                   (ALD2) and YMR169C (ALD3); Tandem gene duplication in
FT                   Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL201W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53173"
FT                   /db_xref="GOA:Q755L5"
FT                   /db_xref="InterPro:IPR015590"
FT                   /db_xref="InterPro:IPR016160"
FT                   /db_xref="InterPro:IPR016161"
FT                   /db_xref="InterPro:IPR016162"
FT                   /db_xref="InterPro:IPR016163"
FT                   /db_xref="InterPro:IPR029510"
FT                   /db_xref="UniProtKB/TrEMBL:Q755L5"
FT                   /protein_id="AAS53173.1"
FT   gene            <61572..>63362
FT                   /locus_tag="AGOS_AFL200W"
FT                   /old_locus_tag="AFL200W"
FT   mRNA            <61572..>63362
FT                   /locus_tag="AGOS_AFL200W"
FT                   /old_locus_tag="AFL200W"
FT                   /product="AFL200Wp"
FT   CDS_pept        61572..63362
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL200W"
FT                   /old_locus_tag="AFL200W"
FT                   /product="AFL200Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR168C
FT                   (CEP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL200W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53174"
FT                   /db_xref="GOA:Q755L4"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR031760"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q755L4"
FT                   /protein_id="AAS53174.1"
FT   gene            complement(<63372..>65744)
FT                   /locus_tag="AGOS_AFL199C"
FT                   /old_locus_tag="AFL199C"
FT   mRNA            complement(join(<63372..65537,65595..>65744))
FT                   /locus_tag="AGOS_AFL199C"
FT                   /old_locus_tag="AFL199C"
FT                   /product="AFL199Cp"
FT   CDS_pept        complement(join(63372..65537,65595..65744))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL199C"
FT                   /old_locus_tag="AFL199C"
FT                   /product="AFL199Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR167W
FT                   (MLH1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL199C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53175"
FT                   /db_xref="GOA:Q755L3"
FT                   /db_xref="InterPro:IPR002099"
FT                   /db_xref="InterPro:IPR013507"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR014762"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR032189"
FT                   /db_xref="InterPro:IPR036890"
FT                   /db_xref="InterPro:IPR038973"
FT                   /db_xref="UniProtKB/TrEMBL:Q755L3"
FT                   /protein_id="AAS53175.1"
FT                   DIVEVANLPGLYKVFERC"
FT   gene            <65813..>66967
FT                   /locus_tag="AGOS_AFL198W"
FT                   /old_locus_tag="AFL198W"
FT   mRNA            <65813..>66967
FT                   /locus_tag="AGOS_AFL198W"
FT                   /old_locus_tag="AFL198W"
FT                   /product="AFL198Wp"
FT   CDS_pept        65813..66967
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL198W"
FT                   /old_locus_tag="AFL198W"
FT                   /product="AFL198Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL105W
FT                   (NSE4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL198W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53176"
FT                   /db_xref="GOA:Q755L2"
FT                   /db_xref="InterPro:IPR014854"
FT                   /db_xref="InterPro:IPR027786"
FT                   /db_xref="InterPro:IPR029225"
FT                   /db_xref="UniProtKB/TrEMBL:Q755L2"
FT                   /protein_id="AAS53176.1"
FT   gene            complement(<66989..>68143)
FT                   /locus_tag="AGOS_AFL197C"
FT                   /old_locus_tag="AFL197C"
FT   mRNA            complement(<66989..>68143)
FT                   /locus_tag="AGOS_AFL197C"
FT                   /old_locus_tag="AFL197C"
FT                   /product="AFL197Cp"
FT   CDS_pept        complement(66989..68143)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL197C"
FT                   /old_locus_tag="AFL197C"
FT                   /product="AFL197Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL104C
FT                   (QRI7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL197C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53177"
FT                   /db_xref="GOA:Q755L1"
FT                   /db_xref="InterPro:IPR000905"
FT                   /db_xref="InterPro:IPR017860"
FT                   /db_xref="InterPro:IPR017861"
FT                   /db_xref="InterPro:IPR022450"
FT                   /db_xref="UniProtKB/TrEMBL:Q755L1"
FT                   /protein_id="AAS53177.1"
FT   gene            <68418..>69503
FT                   /locus_tag="AGOS_AFL196W"
FT                   /old_locus_tag="AFL196W"
FT   mRNA            <68418..>69503
FT                   /locus_tag="AGOS_AFL196W"
FT                   /old_locus_tag="AFL196W"
FT                   /product="AFL196Wp"
FT   CDS_pept        68418..69503
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL196W"
FT                   /old_locus_tag="AFL196W"
FT                   /product="AFL196Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR166C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL196W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53178"
FT                   /db_xref="GOA:Q755L0"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q755L0"
FT                   /protein_id="AAS53178.1"
FT   gene            <70036..>72114
FT                   /locus_tag="AGOS_AFL195W"
FT                   /old_locus_tag="AFL195W"
FT   mRNA            <70036..>72114
FT                   /locus_tag="AGOS_AFL195W"
FT                   /old_locus_tag="AFL195W"
FT                   /product="AFL195Wp"
FT   CDS_pept        70036..72114
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL195W"
FT                   /old_locus_tag="AFL195W"
FT                   /product="AFL195Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR165C
FT                   (PAH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL195W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53179"
FT                   /db_xref="GOA:Q755K9"
FT                   /db_xref="InterPro:IPR007651"
FT                   /db_xref="InterPro:IPR013209"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR026058"
FT                   /db_xref="InterPro:IPR031315"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q755K9"
FT                   /protein_id="AAS53179.1"
FT   gene            <72669..>76175
FT                   /locus_tag="AGOS_AFL194W"
FT                   /old_locus_tag="AFL194W"
FT   mRNA            <72669..>76175
FT                   /locus_tag="AGOS_AFL194W"
FT                   /old_locus_tag="AFL194W"
FT                   /product="AFL194Wp"
FT   CDS_pept        72669..76175
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL194W"
FT                   /old_locus_tag="AFL194W"
FT                   /product="AFL194Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR164C
FT                   (MSS11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL194W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53180"
FT                   /db_xref="InterPro:IPR006594"
FT                   /db_xref="UniProtKB/TrEMBL:Q755Q6"
FT                   /protein_id="AAS53180.2"
FT                   WK"
FT   gene            <76779..>78737
FT                   /locus_tag="AGOS_AFL193W"
FT                   /old_locus_tag="AFL193W"
FT   mRNA            <76779..>78737
FT                   /locus_tag="AGOS_AFL193W"
FT                   /old_locus_tag="AFL193W"
FT                   /product="AFL193Wp"
FT   CDS_pept        76779..78737
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL193W"
FT                   /old_locus_tag="AFL193W"
FT                   /product="AFL193Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR163C
FT                   (INP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL193W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53181"
FT                   /db_xref="GOA:Q755Q0"
FT                   /db_xref="InterPro:IPR026235"
FT                   /db_xref="InterPro:IPR026859"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755Q0"
FT                   /protein_id="AAS53181.1"
FT                   ESIPVLYELNQLLSNRR"
FT   gene            complement(<78862..>80268)
FT                   /locus_tag="AGOS_AFL192C"
FT                   /old_locus_tag="AFL192C"
FT   mRNA            complement(<78862..>80268)
FT                   /locus_tag="AGOS_AFL192C"
FT                   /old_locus_tag="AFL192C"
FT                   /product="AFL192Cp"
FT   CDS_pept        complement(78862..80268)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL192C"
FT                   /old_locus_tag="AFL192C"
FT                   /product="AFL192Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL103C
FT                   (QRI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL192C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53182"
FT                   /db_xref="GOA:Q755P9"
FT                   /db_xref="InterPro:IPR002618"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="InterPro:IPR039741"
FT                   /db_xref="UniProtKB/TrEMBL:Q755P9"
FT                   /protein_id="AAS53182.1"
FT                   RFSQDGAYLT"
FT   gene            <80619..>85346
FT                   /locus_tag="AGOS_AFL191W"
FT                   /old_locus_tag="AFL191W"
FT   mRNA            <80619..>85346
FT                   /locus_tag="AGOS_AFL191W"
FT                   /old_locus_tag="AFL191W"
FT                   /product="AFL191Wp"
FT   CDS_pept        80619..85346
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL191W"
FT                   /old_locus_tag="AFL191W"
FT                   /product="AFL191Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR162C
FT                   (DNF3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL191W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53183"
FT                   /db_xref="GOA:Q755K8"
FT                   /db_xref="InterPro:IPR001757"
FT                   /db_xref="InterPro:IPR006539"
FT                   /db_xref="InterPro:IPR008250"
FT                   /db_xref="InterPro:IPR018303"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR023298"
FT                   /db_xref="InterPro:IPR023299"
FT                   /db_xref="InterPro:IPR032630"
FT                   /db_xref="InterPro:IPR032631"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q755K8"
FT                   /protein_id="AAS53183.1"
FT   gene            complement(<85608..>86315)
FT                   /locus_tag="AGOS_AFL190C"
FT                   /old_locus_tag="AFL190C"
FT   mRNA            complement(<85608..>86315)
FT                   /locus_tag="AGOS_AFL190C"
FT                   /old_locus_tag="AFL190C"
FT                   /product="AFL190Cp"
FT   CDS_pept        complement(85608..86315)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL190C"
FT                   /old_locus_tag="AFL190C"
FT                   /product="AFL190Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR161W
FT                   (HLJ1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL190C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53184"
FT                   /db_xref="GOA:Q755K7"
FT                   /db_xref="InterPro:IPR001623"
FT                   /db_xref="InterPro:IPR018253"
FT                   /db_xref="InterPro:IPR036869"
FT                   /db_xref="UniProtKB/TrEMBL:Q755K7"
FT                   /protein_id="AAS53184.1"
FT                   IVLLFLLLPSLGF"
FT   gene            <86926..>90204
FT                   /locus_tag="AGOS_AFL189W"
FT                   /old_locus_tag="AFL189W"
FT   mRNA            <86926..>90204
FT                   /locus_tag="AGOS_AFL189W"
FT                   /old_locus_tag="AFL189W"
FT                   /product="AFL189Wp"
FT   CDS_pept        86926..90204
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL189W"
FT                   /old_locus_tag="AFL189W"
FT                   /product="AFL189Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL102W
FT                   (POL3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL189W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53185"
FT                   /db_xref="GOA:Q755K6"
FT                   /db_xref="InterPro:IPR006133"
FT                   /db_xref="InterPro:IPR006134"
FT                   /db_xref="InterPro:IPR006172"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR017964"
FT                   /db_xref="InterPro:IPR023211"
FT                   /db_xref="InterPro:IPR025687"
FT                   /db_xref="InterPro:IPR036397"
FT                   /db_xref="InterPro:IPR042087"
FT                   /db_xref="UniProtKB/TrEMBL:Q755K6"
FT                   /protein_id="AAS53185.2"
FT   gene            complement(<90256..>91674)
FT                   /locus_tag="AGOS_AFL188C"
FT                   /old_locus_tag="AFL188C"
FT   mRNA            complement(<90256..>91674)
FT                   /locus_tag="AGOS_AFL188C"
FT                   /old_locus_tag="AFL188C"
FT                   /product="AFL188Cp"
FT   CDS_pept        complement(90256..91674)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL188C"
FT                   /old_locus_tag="AFL188C"
FT                   /product="AFL188Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL101C
FT                   (DUN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL188C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53186"
FT                   /db_xref="GOA:Q755K5"
FT                   /db_xref="InterPro:IPR000253"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR008984"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q755K5"
FT                   /protein_id="AAS53186.2"
FT                   TYSELSSIQQTASK"
FT   gene            complement(<91909..>94284)
FT                   /locus_tag="AGOS_AFL187C"
FT                   /old_locus_tag="AFL187C"
FT   mRNA            complement(<91909..>94284)
FT                   /locus_tag="AGOS_AFL187C"
FT                   /old_locus_tag="AFL187C"
FT                   /product="AFL187Cp"
FT   CDS_pept        complement(91909..94284)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL187C"
FT                   /old_locus_tag="AFL187C"
FT                   /product="AFL187Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR160W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL187C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53187"
FT                   /db_xref="UniProtKB/TrEMBL:Q755K4"
FT                   /protein_id="AAS53187.1"
FT   gene            <94329..>94703
FT                   /locus_tag="AGOS_AFL186W"
FT                   /old_locus_tag="AFL186W"
FT   mRNA            <94329..>94703
FT                   /locus_tag="AGOS_AFL186W"
FT                   /old_locus_tag="AFL186W"
FT                   /product="AFL186Wp"
FT   CDS_pept        94329..94703
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL186W"
FT                   /old_locus_tag="AFL186W"
FT                   /product="AFL186Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR159C
FT                   (ATG16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL186W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53188"
FT                   /db_xref="GOA:Q755K3"
FT                   /db_xref="InterPro:IPR013923"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755K3"
FT                   /protein_id="AAS53188.1"
FT   gene            <94988..>97864
FT                   /locus_tag="AGOS_AFL185W"
FT                   /old_locus_tag="AFL185W"
FT   mRNA            <94988..>97864
FT                   /locus_tag="AGOS_AFL185W"
FT                   /old_locus_tag="AFL185W"
FT                   /product="AFL185Wp"
FT   CDS_pept        94988..97864
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL185W"
FT                   /old_locus_tag="AFL185W"
FT                   /product="AFL185Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR205C
FT                   (PFK2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL185W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53189"
FT                   /db_xref="GOA:Q755Q5"
FT                   /db_xref="InterPro:IPR000023"
FT                   /db_xref="InterPro:IPR009161"
FT                   /db_xref="InterPro:IPR015912"
FT                   /db_xref="InterPro:IPR022953"
FT                   /db_xref="InterPro:IPR029068"
FT                   /db_xref="InterPro:IPR035966"
FT                   /db_xref="UniProtKB/TrEMBL:Q755Q5"
FT                   /protein_id="AAS53189.2"
FT   gene            <98211..>99377
FT                   /locus_tag="AGOS_AFL184W"
FT                   /old_locus_tag="AFL184W"
FT   mRNA            <98211..>99377
FT                   /locus_tag="AGOS_AFL184W"
FT                   /old_locus_tag="AFL184W"
FT                   /product="AFL184Wp"
FT   CDS_pept        98211..99377
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL184W"
FT                   /old_locus_tag="AFL184W"
FT                   /product="AFL184Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR204C
FT                   (INP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL184W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53190"
FT                   /db_xref="GOA:Q755Q4"
FT                   /db_xref="InterPro:IPR024758"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755Q4"
FT                   /protein_id="AAS53190.2"
FT   gene            complement(<99588..>100748)
FT                   /locus_tag="AGOS_AFL183C"
FT                   /old_locus_tag="AFL183C"
FT   mRNA            complement(<99588..>100748)
FT                   /locus_tag="AGOS_AFL183C"
FT                   /old_locus_tag="AFL183C"
FT                   /product="AFL183Cp"
FT   CDS_pept        complement(99588..100748)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL183C"
FT                   /old_locus_tag="AFL183C"
FT                   /product="AFL183Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR203W
FT                   (TOM40)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL183C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53191"
FT                   /db_xref="GOA:Q755Q3"
FT                   /db_xref="InterPro:IPR023614"
FT                   /db_xref="InterPro:IPR027246"
FT                   /db_xref="InterPro:IPR037930"
FT                   /db_xref="UniProtKB/TrEMBL:Q755Q3"
FT                   /protein_id="AAS53191.1"
FT   gene            complement(<100956..>101339)
FT                   /locus_tag="AGOS_AFL182C"
FT                   /old_locus_tag="AFL182C"
FT   mRNA            complement(<100956..>101339)
FT                   /locus_tag="AGOS_AFL182C"
FT                   /old_locus_tag="AFL182C"
FT                   /product="AFL182Cp"
FT   CDS_pept        complement(100956..101339)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL182C"
FT                   /old_locus_tag="AFL182C"
FT                   /product="AFL182Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR010W
FT                   (CSE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL182C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53192"
FT                   /db_xref="GOA:Q755Q2"
FT                   /db_xref="InterPro:IPR011425"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755Q2"
FT                   /protein_id="AAS53192.1"
FT   gene            complement(<101362..>102030)
FT                   /locus_tag="AGOS_AFL181C"
FT                   /old_locus_tag="AFL181C"
FT   mRNA            complement(<101362..>102030)
FT                   /locus_tag="AGOS_AFL181C"
FT                   /old_locus_tag="AFL181C"
FT                   /product="AFL181Cp"
FT   CDS_pept        complement(101362..102030)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL181C"
FT                   /old_locus_tag="AFL181C"
FT                   /product="AFL181Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR202W
FT                   (ERG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL181C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53193"
FT                   /db_xref="GOA:Q755Q1"
FT                   /db_xref="InterPro:IPR006716"
FT                   /db_xref="UniProtKB/TrEMBL:Q755Q1"
FT                   /protein_id="AAS53193.1"
FT                   "
FT   gene            complement(<102238..>102765)
FT                   /locus_tag="AGOS_AFL180C"
FT                   /old_locus_tag="AFL180C"
FT   mRNA            complement(<102238..>102765)
FT                   /locus_tag="AGOS_AFL180C"
FT                   /old_locus_tag="AFL180C"
FT                   /product="AFL180Cp"
FT   CDS_pept        complement(102238..102765)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL180C"
FT                   /old_locus_tag="AFL180C"
FT                   /product="AFL180Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR009W
FT                   (NRM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL180C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53194"
FT                   /db_xref="InterPro:IPR013734"
FT                   /db_xref="UniProtKB/TrEMBL:Q755Q8"
FT                   /protein_id="AAS53194.2"
FT                   SASAAAPTEHIH"
FT   gene            complement(<103261..>105198)
FT                   /locus_tag="AGOS_AFL179C"
FT                   /old_locus_tag="AFL179C"
FT   mRNA            complement(<103261..>105198)
FT                   /locus_tag="AGOS_AFL179C"
FT                   /old_locus_tag="AFL179C"
FT                   /product="AFL179Cp"
FT   CDS_pept        complement(103261..105198)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL179C"
FT                   /old_locus_tag="AFL179C"
FT                   /product="AFL179Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR008W
FT                   (LRO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL179C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53195"
FT                   /db_xref="GOA:Q755K2"
FT                   /db_xref="InterPro:IPR003386"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/TrEMBL:Q755K2"
FT                   /protein_id="AAS53195.1"
FT                   DWVARLNFPL"
FT   gene            <105476..>106324
FT                   /locus_tag="AGOS_AFL178W"
FT                   /old_locus_tag="AFL178W"
FT   mRNA            <105476..>106324
FT                   /locus_tag="AGOS_AFL178W"
FT                   /old_locus_tag="AFL178W"
FT                   /product="AFL178Wp"
FT   CDS_pept        105476..106324
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL178W"
FT                   /old_locus_tag="AFL178W"
FT                   /product="AFL178Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR007C
FT                   (ATG3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL178W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53196"
FT                   /db_xref="GOA:Q755K1"
FT                   /db_xref="InterPro:IPR007134"
FT                   /db_xref="InterPro:IPR007135"
FT                   /db_xref="InterPro:IPR019461"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755K1"
FT                   /protein_id="AAS53196.2"
FT                   W"
FT   gene            <106502..>107689
FT                   /locus_tag="AGOS_AFL177W"
FT                   /old_locus_tag="AFL177W"
FT   mRNA            join(<106502..106577,106644..>107689)
FT                   /locus_tag="AGOS_AFL177W"
FT                   /old_locus_tag="AFL177W"
FT                   /product="AFL177Wp"
FT   CDS_pept        join(106502..106577,106644..107689)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL177W"
FT                   /old_locus_tag="AFL177W"
FT                   /product="AFL177Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR201C
FT                   (RAD14); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL177W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53197"
FT                   /db_xref="GOA:Q755K0"
FT                   /db_xref="InterPro:IPR000465"
FT                   /db_xref="InterPro:IPR009061"
FT                   /db_xref="InterPro:IPR022656"
FT                   /db_xref="InterPro:IPR022658"
FT                   /db_xref="InterPro:IPR037129"
FT                   /db_xref="UniProtKB/TrEMBL:Q755K0"
FT                   /protein_id="AAS53197.2"
FT   gene            complement(<107864..>109678)
FT                   /locus_tag="AGOS_AFL176C"
FT                   /old_locus_tag="AFL176C"
FT   mRNA            complement(<107864..>109678)
FT                   /locus_tag="AGOS_AFL176C"
FT                   /old_locus_tag="AFL176C"
FT                   /product="AFL176Cp"
FT   CDS_pept        complement(107864..109678)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL176C"
FT                   /old_locus_tag="AFL176C"
FT                   /product="AFL176Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR006W
FT                   (VPS27)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL176C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53198"
FT                   /db_xref="GOA:Q755J9"
FT                   /db_xref="InterPro:IPR000306"
FT                   /db_xref="InterPro:IPR002014"
FT                   /db_xref="InterPro:IPR003903"
FT                   /db_xref="InterPro:IPR008942"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR017073"
FT                   /db_xref="InterPro:IPR017455"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755J9"
FT                   /protein_id="AAS53198.1"
FT   gene            complement(<110009..>110770)
FT                   /locus_tag="AGOS_AFL175C"
FT                   /old_locus_tag="AFL175C"
FT   mRNA            complement(<110009..>110770)
FT                   /locus_tag="AGOS_AFL175C"
FT                   /old_locus_tag="AFL175C"
FT                   /product="AFL175Cp"
FT   CDS_pept        complement(110009..110770)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL175C"
FT                   /old_locus_tag="AFL175C"
FT                   /product="AFL175Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR200W
FT                   (ROT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL175C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53199"
FT                   /db_xref="GOA:Q755J8"
FT                   /db_xref="InterPro:IPR019623"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755J8"
FT                   /protein_id="AAS53199.2"
FT   gene            complement(<111464..>113002)
FT                   /locus_tag="AGOS_AFL174C"
FT                   /old_locus_tag="AFL174C"
FT   mRNA            complement(<111464..>113002)
FT                   /locus_tag="AGOS_AFL174C"
FT                   /old_locus_tag="AFL174C"
FT                   /product="AFL174Cp"
FT   CDS_pept        complement(111464..113002)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL174C"
FT                   /old_locus_tag="AFL174C"
FT                   /product="AFL174Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL256C
FT                   (CLN2) and YMR199W (CLN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL174C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53200"
FT                   /db_xref="GOA:Q755J7"
FT                   /db_xref="InterPro:IPR006671"
FT                   /db_xref="InterPro:IPR013763"
FT                   /db_xref="InterPro:IPR014399"
FT                   /db_xref="InterPro:IPR036915"
FT                   /db_xref="InterPro:IPR039361"
FT                   /db_xref="UniProtKB/TrEMBL:Q755J7"
FT                   /protein_id="AAS53200.1"
FT   gene            complement(<113592..>114683)
FT                   /locus_tag="AGOS_AFL173C"
FT                   /old_locus_tag="AFL173C"
FT   mRNA            complement(<113592..>114683)
FT                   /locus_tag="AGOS_AFL173C"
FT                   /old_locus_tag="AFL173C"
FT                   /product="AFL173Cp"
FT   CDS_pept        complement(113592..114683)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL173C"
FT                   /old_locus_tag="AFL173C"
FT                   /product="AFL173Cp"
FT                   /note="NOHBY613; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F06512g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL173C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53201"
FT                   /db_xref="UniProtKB/TrEMBL:Q755J6"
FT                   /protein_id="AAS53201.2"
FT   gene            <114853..>115914
FT                   /locus_tag="AGOS_AFL172W"
FT                   /old_locus_tag="AFL172W"
FT   mRNA            <114853..>115914
FT                   /locus_tag="AGOS_AFL172W"
FT                   /old_locus_tag="AFL172W"
FT                   /product="AFL172Wp"
FT   CDS_pept        114853..115914
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL172W"
FT                   /old_locus_tag="AFL172W"
FT                   /product="AFL172Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL255W
FT                   (BBP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL172W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53202"
FT                   /db_xref="GOA:Q755J5"
FT                   /db_xref="InterPro:IPR029328"
FT                   /db_xref="InterPro:IPR029330"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755J5"
FT                   /protein_id="AAS53202.2"
FT                   DTIDTQFLNHIVK"
FT   gene            <116263..>117561
FT                   /locus_tag="AGOS_AFL171W"
FT                   /old_locus_tag="AFL171W"
FT   mRNA            <116263..>117561
FT                   /locus_tag="AGOS_AFL171W"
FT                   /old_locus_tag="AFL171W"
FT                   /product="AFL171Wp"
FT   CDS_pept        116263..117561
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL171W"
FT                   /old_locus_tag="AFL171W"
FT                   /product="AFL171Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL254W
FT                   (HFI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL171W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53203"
FT                   /db_xref="GOA:Q755J4"
FT                   /db_xref="InterPro:IPR024738"
FT                   /db_xref="UniProtKB/TrEMBL:Q755J4"
FT                   /protein_id="AAS53203.2"
FT   gene            complement(<117692..>119593)
FT                   /locus_tag="AGOS_AFL170C"
FT                   /old_locus_tag="AFL170C"
FT   mRNA            complement(<117692..>119593)
FT                   /locus_tag="AGOS_AFL170C"
FT                   /old_locus_tag="AFL170C"
FT                   /product="AFL170Cp"
FT   CDS_pept        complement(117692..119593)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL170C"
FT                   /old_locus_tag="AFL170C"
FT                   /product="AFL170Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL253C
FT                   (VIK1) and YMR198W (CIK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL170C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53204"
FT                   /db_xref="GOA:Q755J3"
FT                   /db_xref="InterPro:IPR031852"
FT                   /db_xref="UniProtKB/TrEMBL:Q755J3"
FT                   /protein_id="AAS53204.1"
FT   gene            complement(<119998..>120453)
FT                   /locus_tag="AGOS_AFL169C"
FT                   /old_locus_tag="AFL169C"
FT   mRNA            complement(<119998..>120453)
FT                   /locus_tag="AGOS_AFL169C"
FT                   /old_locus_tag="AFL169C"
FT                   /product="AFL169Cp"
FT   CDS_pept        complement(119998..120453)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL169C"
FT                   /old_locus_tag="AFL169C"
FT                   /product="AFL169Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL252C
FT                   (YAH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL169C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53205"
FT                   /db_xref="GOA:Q755J2"
FT                   /db_xref="InterPro:IPR001041"
FT                   /db_xref="InterPro:IPR001055"
FT                   /db_xref="InterPro:IPR012675"
FT                   /db_xref="InterPro:IPR018298"
FT                   /db_xref="InterPro:IPR036010"
FT                   /db_xref="UniProtKB/TrEMBL:Q755J2"
FT                   /protein_id="AAS53205.1"
FT   gene            <120751..>121398
FT                   /locus_tag="AGOS_AFL168W"
FT                   /old_locus_tag="AFL168W"
FT   mRNA            <120751..>121398
FT                   /locus_tag="AGOS_AFL168W"
FT                   /old_locus_tag="AFL168W"
FT                   /product="AFL168Wp"
FT   CDS_pept        120751..121398
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL168W"
FT                   /old_locus_tag="AFL168W"
FT                   /product="AFL168Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR197C
FT                   (VTI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL168W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53206"
FT                   /db_xref="GOA:Q755J1"
FT                   /db_xref="InterPro:IPR000727"
FT                   /db_xref="InterPro:IPR007705"
FT                   /db_xref="InterPro:IPR010989"
FT                   /db_xref="InterPro:IPR038407"
FT                   /db_xref="UniProtKB/TrEMBL:Q755J1"
FT                   /protein_id="AAS53206.1"
FT   gene            complement(<121503..>124760)
FT                   /locus_tag="AGOS_AFL167C"
FT                   /old_locus_tag="AFL167C"
FT   mRNA            complement(<121503..>124760)
FT                   /locus_tag="AGOS_AFL167C"
FT                   /old_locus_tag="AFL167C"
FT                   /product="AFL167Cp"
FT   CDS_pept        complement(121503..124760)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL167C"
FT                   /old_locus_tag="AFL167C"
FT                   /product="AFL167Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR196W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL167C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53207"
FT                   /db_xref="GOA:Q755J0"
FT                   /db_xref="InterPro:IPR004888"
FT                   /db_xref="InterPro:IPR008928"
FT                   /db_xref="InterPro:IPR031335"
FT                   /db_xref="UniProtKB/TrEMBL:Q755J0"
FT                   /protein_id="AAS53207.2"
FT   gene            complement(<124955..>125338)
FT                   /locus_tag="AGOS_AFL166C"
FT                   /old_locus_tag="AFL166C"
FT   mRNA            complement(<124955..>125338)
FT                   /locus_tag="AGOS_AFL166C"
FT                   /old_locus_tag="AFL166C"
FT                   /product="AFL166Cp"
FT   CDS_pept        complement(124955..125338)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL166C"
FT                   /old_locus_tag="AFL166C"
FT                   /product="AFL166Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR195W
FT                   (ICY1) and YPL250C (ICY2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL166C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53208"
FT                   /db_xref="UniProtKB/TrEMBL:Q755I9"
FT                   /protein_id="AAS53208.1"
FT   gene            <125643..>125927
FT                   /locus_tag="AGOS_AFL165W"
FT                   /old_locus_tag="AFL165W"
FT   mRNA            <125643..>125927
FT                   /locus_tag="AGOS_AFL165W"
FT                   /old_locus_tag="AFL165W"
FT                   /product="AFL165Wp"
FT   CDS_pept        125643..125927
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL165W"
FT                   /old_locus_tag="AFL165W"
FT                   /product="AFL165Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR194C-B (CMC4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL165W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53209"
FT                   /db_xref="GOA:Q755I8"
FT                   /db_xref="InterPro:IPR009069"
FT                   /db_xref="InterPro:IPR027179"
FT                   /db_xref="UniProtKB/TrEMBL:Q755I8"
FT                   /protein_id="AAS53209.1"
FT   gene            complement(126091..126119)
FT                   /locus_tag="AGOS_AgSNR11"
FT                   /old_locus_tag="AgSNR11"
FT   ncRNA           complement(126091..126119)
FT                   /locus_tag="AGOS_AgSNR11"
FT                   /old_locus_tag="AgSNR11"
FT                   /product="AgSNR11"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR11; start and end coordinates are approximates. Not in
FT                   synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<126214..>126798)
FT                   /locus_tag="AGOS_AFL164C"
FT                   /old_locus_tag="AFL164C"
FT   mRNA            complement(<126214..>126798)
FT                   /locus_tag="AGOS_AFL164C"
FT                   /old_locus_tag="AFL164C"
FT                   /product="AFL164Cp"
FT   CDS_pept        complement(126214..126798)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL164C"
FT                   /old_locus_tag="AFL164C"
FT                   /product="AFL164Cp"
FT                   /note="NOHBY612; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0D12518g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL164C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53210"
FT                   /db_xref="UniProtKB/TrEMBL:Q755I7"
FT                   /protein_id="AAS53210.2"
FT   gene            complement(<127515..>128042)
FT                   /locus_tag="AGOS_AFL163C"
FT                   /old_locus_tag="AFL163C"
FT   mRNA            complement(join(<127515..127801,128027..>128042))
FT                   /locus_tag="AGOS_AFL163C"
FT                   /old_locus_tag="AFL163C"
FT                   /product="AFL163Cp"
FT   CDS_pept        complement(join(127515..127801,128027..128042))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL163C"
FT                   /old_locus_tag="AFL163C"
FT                   /product="AFL163Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL249C-A (RPL36B) and YMR194W (RPL36A); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL163C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53211"
FT                   /db_xref="GOA:Q755I6"
FT                   /db_xref="InterPro:IPR000509"
FT                   /db_xref="InterPro:IPR038097"
FT                   /db_xref="UniProtKB/TrEMBL:Q755I6"
FT                   /protein_id="AAS53211.1"
FT   gene            complement(<128499..>129284)
FT                   /locus_tag="AGOS_AFL162C"
FT                   /old_locus_tag="AFL162C"
FT   mRNA            complement(<128499..>129284)
FT                   /locus_tag="AGOS_AFL162C"
FT                   /old_locus_tag="AFL162C"
FT                   /product="AFL162Cp"
FT   CDS_pept        complement(128499..129284)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL162C"
FT                   /old_locus_tag="AFL162C"
FT                   /product="AFL162Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR193W
FT                   (MRPL24)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL162C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53212"
FT                   /db_xref="GOA:Q755I5"
FT                   /db_xref="InterPro:IPR001383"
FT                   /db_xref="InterPro:IPR026569"
FT                   /db_xref="InterPro:IPR034704"
FT                   /db_xref="InterPro:IPR037147"
FT                   /db_xref="UniProtKB/TrEMBL:Q755I5"
FT                   /protein_id="AAS53212.1"
FT   gene            complement(<129492..>131981)
FT                   /locus_tag="AGOS_AFL161C"
FT                   /old_locus_tag="AFL161C"
FT   mRNA            complement(<129492..>131981)
FT                   /locus_tag="AGOS_AFL161C"
FT                   /old_locus_tag="AFL161C"
FT                   /product="AFL161Cp"
FT   CDS_pept        complement(129492..131981)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL161C"
FT                   /old_locus_tag="AFL161C"
FT                   /product="AFL161Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL249C
FT                   (GYP5) and YMR192W (GYL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL161C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53213"
FT                   /db_xref="GOA:Q755I4"
FT                   /db_xref="InterPro:IPR000195"
FT                   /db_xref="InterPro:IPR035969"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755I4"
FT                   /protein_id="AAS53213.2"
FT                   SHIVTPSISSWTFKKPW"
FT   gene            complement(<132308..>134254)
FT                   /locus_tag="AGOS_AFL160C"
FT                   /old_locus_tag="AFL160C"
FT   mRNA            complement(<132308..>134254)
FT                   /locus_tag="AGOS_AFL160C"
FT                   /old_locus_tag="AFL160C"
FT                   /product="AFL160Cp"
FT   CDS_pept        complement(132308..134254)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL160C"
FT                   /old_locus_tag="AFL160C"
FT                   /product="AFL160Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL248C
FT                   (GAL4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL160C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53214"
FT                   /db_xref="GOA:Q755I3"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR005600"
FT                   /db_xref="InterPro:IPR007219"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q755I3"
FT                   /protein_id="AAS53214.1"
FT                   KDPGTDSPLTDTA"
FT   unsure          134811..134818
FT                   /note="sequence of low quality; region difficult to
FT                   PCR/sequence; plasmids, PCR products, and sequence from
FT                   other strains confirms the basic structure; number of C's
FT                   may be slightly different"
FT   gene            <135171..>139142
FT                   /locus_tag="AGOS_AFL159W"
FT                   /old_locus_tag="AFL159W"
FT   mRNA            <135171..>139142
FT                   /locus_tag="AGOS_AFL159W"
FT                   /old_locus_tag="AFL159W"
FT                   /product="AFL159Wp"
FT   CDS_pept        135171..139142
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL159W"
FT                   /old_locus_tag="AFL159W"
FT                   /product="AFL159Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR190C
FT                   (SGS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL159W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53215"
FT                   /db_xref="GOA:Q755I2"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR002464"
FT                   /db_xref="InterPro:IPR004589"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR018982"
FT                   /db_xref="InterPro:IPR022758"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR032284"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="UniProtKB/TrEMBL:Q755I2"
FT                   /protein_id="AAS53215.2"
FT   gene            complement(<139224..>140918)
FT                   /locus_tag="AGOS_AFL158C"
FT                   /old_locus_tag="AFL158C"
FT   mRNA            complement(<139224..>140918)
FT                   /locus_tag="AGOS_AFL158C"
FT                   /old_locus_tag="AFL158C"
FT                   /product="AFL158Cp"
FT   CDS_pept        complement(139224..140918)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL158C"
FT                   /old_locus_tag="AFL158C"
FT                   /product="AFL158Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YAL067C (SEO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL158C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53216"
FT                   /db_xref="GOA:Q755I1"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q755I1"
FT                   /protein_id="AAS53216.1"
FT   gene            complement(<141840..>143156)
FT                   /locus_tag="AGOS_AFL157C"
FT                   /old_locus_tag="AFL157C"
FT   mRNA            complement(<141840..>143156)
FT                   /locus_tag="AGOS_AFL157C"
FT                   /old_locus_tag="AFL157C"
FT                   /product="AFL157Cp"
FT   CDS_pept        complement(141840..143156)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL157C"
FT                   /old_locus_tag="AFL157C"
FT                   /product="AFL157Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL247C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL157C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53217"
FT                   /db_xref="GOA:Q755I0"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q755I0"
FT                   /protein_id="AAS53217.2"
FT   gene            <143544..>144242
FT                   /locus_tag="AGOS_AFL156W"
FT                   /old_locus_tag="AFL156W"
FT   mRNA            <143544..>144242
FT                   /locus_tag="AGOS_AFL156W"
FT                   /old_locus_tag="AFL156W"
FT                   /product="AFL156Wp"
FT   CDS_pept        143544..144242
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL156W"
FT                   /old_locus_tag="AFL156W"
FT                   /product="AFL156Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR188C
FT                   (MRPS17)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL156W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53218"
FT                   /db_xref="GOA:Q755H9"
FT                   /db_xref="InterPro:IPR000266"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="UniProtKB/TrEMBL:Q755H9"
FT                   /protein_id="AAS53218.2"
FT                   RKHITADLLN"
FT   gene            complement(<144302..>145087)
FT                   /locus_tag="AGOS_AFL155C"
FT                   /old_locus_tag="AFL155C"
FT   mRNA            complement(<144302..>145087)
FT                   /locus_tag="AGOS_AFL155C"
FT                   /old_locus_tag="AFL155C"
FT                   /product="AFL155Cp"
FT   CDS_pept        complement(144302..145087)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL155C"
FT                   /old_locus_tag="AFL155C"
FT                   /product="AFL155Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL246C
FT                   (RBD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL155C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53219"
FT                   /db_xref="GOA:Q755H8"
FT                   /db_xref="InterPro:IPR022764"
FT                   /db_xref="InterPro:IPR035952"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755H8"
FT                   /protein_id="AAS53219.1"
FT   gene            complement(<145415..>146389)
FT                   /locus_tag="AGOS_AFL154C"
FT                   /old_locus_tag="AFL154C"
FT   mRNA            complement(<145415..>146389)
FT                   /locus_tag="AGOS_AFL154C"
FT                   /old_locus_tag="AFL154C"
FT                   /product="AFL154Cp"
FT   CDS_pept        complement(145415..146389)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL154C"
FT                   /old_locus_tag="AFL154C"
FT                   /product="AFL154Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL244C
FT                   (HUT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL154C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53220"
FT                   /db_xref="GOA:Q755H7"
FT                   /db_xref="InterPro:IPR013657"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755H7"
FT                   /protein_id="AAS53220.2"
FT   gene            <146710..>148437
FT                   /locus_tag="AGOS_AFL153W"
FT                   /old_locus_tag="AFL153W"
FT   mRNA            <146710..>148437
FT                   /locus_tag="AGOS_AFL153W"
FT                   /old_locus_tag="AFL153W"
FT                   /product="AFL153Wp"
FT   CDS_pept        146710..148437
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL153W"
FT                   /old_locus_tag="AFL153W"
FT                   /product="AFL153Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL243W
FT                   (SRP68)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL153W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53221"
FT                   /db_xref="GOA:Q755H6"
FT                   /db_xref="InterPro:IPR026258"
FT                   /db_xref="InterPro:IPR034652"
FT                   /db_xref="InterPro:IPR038253"
FT                   /db_xref="UniProtKB/TrEMBL:Q755H6"
FT                   /protein_id="AAS53221.1"
FT   gene            <148658..>149935
FT                   /locus_tag="AGOS_AFL152W"
FT                   /old_locus_tag="AFL152W"
FT   mRNA            <148658..>149935
FT                   /locus_tag="AGOS_AFL152W"
FT                   /old_locus_tag="AFL152W"
FT                   /product="AFL152Wp"
FT   CDS_pept        148658..149935
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL152W"
FT                   /old_locus_tag="AFL152W"
FT                   /product="AFL152Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR187C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL152W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53222"
FT                   /db_xref="GOA:Q755H5"
FT                   /db_xref="UniProtKB/TrEMBL:Q755H5"
FT                   /protein_id="AAS53222.1"
FT   gene            <150323..>151129
FT                   /locus_tag="AGOS_AFL151W"
FT                   /old_locus_tag="AFL151W"
FT   mRNA            <150323..>151129
FT                   /locus_tag="AGOS_AFL151W"
FT                   /old_locus_tag="AFL151W"
FT                   /product="AFL151Wp"
FT   CDS_pept        150323..151129
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL151W"
FT                   /old_locus_tag="AFL151W"
FT                   /product="AFL151Wp"
FT                   /note="NOHBY611; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0A03146g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL151W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53223"
FT                   /db_xref="UniProtKB/TrEMBL:Q755H4"
FT                   /protein_id="AAS53223.2"
FT   gene            complement(<151290..>156230)
FT                   /locus_tag="AGOS_AFL150C"
FT                   /old_locus_tag="AFL150C"
FT   mRNA            complement(<151290..>156230)
FT                   /locus_tag="AGOS_AFL150C"
FT                   /old_locus_tag="AFL150C"
FT                   /product="AFL150Cp"
FT   CDS_pept        complement(151290..156230)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL150C"
FT                   /old_locus_tag="AFL150C"
FT                   /product="AFL150Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL242C
FT                   (IQG1)"
FT                   /db_xref="GOA:Q755H3"
FT                   /db_xref="InterPro:IPR000048"
FT                   /db_xref="InterPro:IPR000593"
FT                   /db_xref="InterPro:IPR001715"
FT                   /db_xref="InterPro:IPR001936"
FT                   /db_xref="InterPro:IPR008936"
FT                   /db_xref="InterPro:IPR036872"
FT                   /db_xref="UniProtKB/TrEMBL:Q755H3"
FT                   /protein_id="AAS53224.2"
FT                   LLCEVFFR"
FT   gene            complement(<156568..>157433)
FT                   /locus_tag="AGOS_AFL149C"
FT                   /old_locus_tag="AFL149C"
FT   mRNA            complement(join(<156568..157298,157352..>157433))
FT                   /locus_tag="AGOS_AFL149C"
FT                   /old_locus_tag="AFL149C"
FT                   /product="AFL149Cp"
FT   CDS_pept        complement(join(156568..157298,157352..157433))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL149C"
FT                   /old_locus_tag="AFL149C"
FT                   /product="AFL149Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL241C
FT                   (CIN2); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL149C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53225"
FT                   /db_xref="GOA:Q755H2"
FT                   /db_xref="InterPro:IPR027684"
FT                   /db_xref="UniProtKB/TrEMBL:Q755H2"
FT                   /protein_id="AAS53225.1"
FT   gene            complement(<157654..>159768)
FT                   /locus_tag="AGOS_AFL148C"
FT                   /old_locus_tag="AFL148C"
FT   mRNA            complement(<157654..>159768)
FT                   /locus_tag="AGOS_AFL148C"
FT                   /old_locus_tag="AFL148C"
FT                   /product="AFL148Cp"
FT   CDS_pept        complement(157654..159768)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL148C"
FT                   /old_locus_tag="AFL148C"
FT                   /product="AFL148Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR186W
FT                   (HSC82) and YPL240C (HSP82)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL148C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53226"
FT                   /db_xref="GOA:Q8J2M3"
FT                   /db_xref="InterPro:IPR001404"
FT                   /db_xref="InterPro:IPR003594"
FT                   /db_xref="InterPro:IPR019805"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR020575"
FT                   /db_xref="InterPro:IPR036890"
FT                   /db_xref="InterPro:IPR037196"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8J2M3"
FT                   /protein_id="AAS53226.1"
FT                   APETAMEEVD"
FT   gene            complement(<160054..>162870)
FT                   /locus_tag="AGOS_AFL147C"
FT                   /old_locus_tag="AFL147C"
FT   mRNA            complement(<160054..>162870)
FT                   /locus_tag="AGOS_AFL147C"
FT                   /old_locus_tag="AFL147C"
FT                   /product="AFL147Cp"
FT   CDS_pept        complement(160054..162870)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL147C"
FT                   /old_locus_tag="AFL147C"
FT                   /product="AFL147Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR185W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL147C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53227"
FT                   /db_xref="GOA:Q755H0"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR019451"
FT                   /db_xref="InterPro:IPR039600"
FT                   /db_xref="UniProtKB/TrEMBL:Q755H0"
FT                   /protein_id="AAS53227.1"
FT                   ALQLLEGR"
FT   gene            <163008..>163604
FT                   /locus_tag="AGOS_AFL146W"
FT                   /old_locus_tag="AFL146W"
FT   mRNA            <163008..>163604
FT                   /locus_tag="AGOS_AFL146W"
FT                   /old_locus_tag="AFL146W"
FT                   /product="AFL146Wp"
FT   CDS_pept        163008..163604
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL146W"
FT                   /old_locus_tag="AFL146W"
FT                   /product="AFL146Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL239W
FT                   (YAR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL146W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53228"
FT                   /db_xref="InterPro:IPR002110"
FT                   /db_xref="InterPro:IPR020683"
FT                   /db_xref="InterPro:IPR036770"
FT                   /db_xref="UniProtKB/TrEMBL:Q755G9"
FT                   /protein_id="AAS53228.1"
FT   gene            <163861..>164709
FT                   /locus_tag="AGOS_AFL145W"
FT                   /old_locus_tag="AFL145W"
FT   mRNA            <163861..>164709
FT                   /locus_tag="AGOS_AFL145W"
FT                   /old_locus_tag="AFL145W"
FT                   /product="AFL145Wp"
FT   CDS_pept        163861..164709
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL145W"
FT                   /old_locus_tag="AFL145W"
FT                   /product="AFL145Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL237W
FT                   (SUI3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL145W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53229"
FT                   /db_xref="GOA:Q755G8"
FT                   /db_xref="InterPro:IPR002735"
FT                   /db_xref="InterPro:IPR016189"
FT                   /db_xref="InterPro:IPR016190"
FT                   /db_xref="UniProtKB/TrEMBL:Q755G8"
FT                   /protein_id="AAS53229.2"
FT                   F"
FT   gene            complement(<164940..>165416)
FT                   /locus_tag="AGOS_AFL144C"
FT                   /old_locus_tag="AFL144C"
FT   mRNA            complement(<164940..>165416)
FT                   /locus_tag="AGOS_AFL144C"
FT                   /old_locus_tag="AFL144C"
FT                   /product="AFL144Cp"
FT   CDS_pept        complement(164940..165416)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL144C"
FT                   /old_locus_tag="AFL144C"
FT                   /product="AFL144Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR184W
FT                   (ADD37)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL144C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53230"
FT                   /db_xref="UniProtKB/TrEMBL:Q755G7"
FT                   /protein_id="AAS53230.1"
FT   gene            complement(<165676..>166761)
FT                   /locus_tag="AGOS_AFL143C"
FT                   /old_locus_tag="AFL143C"
FT   mRNA            complement(<165676..>166761)
FT                   /locus_tag="AGOS_AFL143C"
FT                   /old_locus_tag="AFL143C"
FT                   /product="AFL143Cp"
FT   CDS_pept        complement(165676..166761)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL143C"
FT                   /old_locus_tag="AFL143C"
FT                   /product="AFL143Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL236C
FT                   (ENV7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL143C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53231"
FT                   /db_xref="GOA:Q755G6"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q755G6"
FT                   /protein_id="AAS53231.1"
FT   gene            <166967..>168376
FT                   /locus_tag="AGOS_AFL142W"
FT                   /old_locus_tag="AFL142W"
FT   mRNA            <166967..>168376
FT                   /locus_tag="AGOS_AFL142W"
FT                   /old_locus_tag="AFL142W"
FT                   /product="AFL142Wp"
FT   CDS_pept        166967..168376
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL142W"
FT                   /old_locus_tag="AFL142W"
FT                   /product="AFL142Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL235W
FT                   (RVB2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL142W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53232"
FT                   /db_xref="GOA:Q755G5"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR010339"
FT                   /db_xref="InterPro:IPR027238"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR037942"
FT                   /db_xref="InterPro:IPR041048"
FT                   /db_xref="InterPro:IPR042487"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755G5"
FT                   /protein_id="AAS53232.2"
FT                   GRNADAMDTNE"
FT   gene            complement(<168568..>169062)
FT                   /locus_tag="AGOS_AFL141C"
FT                   /old_locus_tag="AFL141C"
FT   mRNA            complement(<168568..>169062)
FT                   /locus_tag="AGOS_AFL141C"
FT                   /old_locus_tag="AFL141C"
FT                   /product="AFL141Cp"
FT   CDS_pept        complement(168568..169062)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL141C"
FT                   /old_locus_tag="AFL141C"
FT                   /product="AFL141Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL234C
FT                   (VMA11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL141C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53233"
FT                   /db_xref="GOA:Q755G4"
FT                   /db_xref="InterPro:IPR000245"
FT                   /db_xref="InterPro:IPR002379"
FT                   /db_xref="InterPro:IPR011555"
FT                   /db_xref="InterPro:IPR035921"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755G4"
FT                   /protein_id="AAS53233.1"
FT                   N"
FT   gene            <169942..>170595
FT                   /locus_tag="AGOS_AFL140W"
FT                   /old_locus_tag="AFL140W"
FT   mRNA            <169942..>170595
FT                   /locus_tag="AGOS_AFL140W"
FT                   /old_locus_tag="AFL140W"
FT                   /product="AFL140Wp"
FT   CDS_pept        169942..170595
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL140W"
FT                   /old_locus_tag="AFL140W"
FT                   /product="AFL140Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL233W
FT                   (NSL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL140W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53234"
FT                   /db_xref="GOA:Q755G3"
FT                   /db_xref="InterPro:IPR013950"
FT                   /db_xref="UniProtKB/TrEMBL:Q755G3"
FT                   /protein_id="AAS53234.1"
FT   gene            <170943..>171836
FT                   /locus_tag="AGOS_AFL139W"
FT                   /old_locus_tag="AFL139W"
FT   mRNA            <170943..>171836
FT                   /locus_tag="AGOS_AFL139W"
FT                   /old_locus_tag="AFL139W"
FT                   /product="AFL139Wp"
FT   CDS_pept        170943..171836
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL139W"
FT                   /old_locus_tag="AFL139W"
FT                   /product="AFL139Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR183C
FT                   (SSO2) and YPL232W (SSO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL139W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53235"
FT                   /db_xref="GOA:Q755G2"
FT                   /db_xref="InterPro:IPR000727"
FT                   /db_xref="InterPro:IPR006011"
FT                   /db_xref="InterPro:IPR006012"
FT                   /db_xref="InterPro:IPR010989"
FT                   /db_xref="UniProtKB/TrEMBL:Q755G2"
FT                   /protein_id="AAS53235.1"
FT                   LIIVAIAVAVPLATRK"
FT   gene            <172713..>178388
FT                   /locus_tag="AGOS_AFL138W"
FT                   /old_locus_tag="AFL138W"
FT   mRNA            <172713..>178388
FT                   /locus_tag="AGOS_AFL138W"
FT                   /old_locus_tag="AFL138W"
FT                   /product="AFL138Wp"
FT   CDS_pept        172713..178388
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL138W"
FT                   /old_locus_tag="AFL138W"
FT                   /product="AFL138Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL231W
FT                   (FAS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL138W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53236"
FT                   /db_xref="GOA:Q755G1"
FT                   /db_xref="InterPro:IPR004568"
FT                   /db_xref="InterPro:IPR008278"
FT                   /db_xref="InterPro:IPR009081"
FT                   /db_xref="InterPro:IPR014030"
FT                   /db_xref="InterPro:IPR014031"
FT                   /db_xref="InterPro:IPR016035"
FT                   /db_xref="InterPro:IPR016039"
FT                   /db_xref="InterPro:IPR018201"
FT                   /db_xref="InterPro:IPR026025"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="InterPro:IPR037143"
FT                   /db_xref="InterPro:IPR040899"
FT                   /db_xref="InterPro:IPR041550"
FT                   /db_xref="UniProtKB/TrEMBL:Q755G1"
FT                   /protein_id="AAS53236.2"
FT                   SISHDDFQAVAVAIAEK"
FT   gene            complement(178466..178889)
FT                   /locus_tag="AGOS_AgSNR83"
FT                   /old_locus_tag="AgSNR83"
FT   ncRNA           complement(178466..178889)
FT                   /locus_tag="AGOS_AgSNR83"
FT                   /old_locus_tag="AgSNR83"
FT                   /product="AgSNR83"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR83 (RUF3); start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <179512..>180045
FT                   /locus_tag="AGOS_AFL137W"
FT                   /old_locus_tag="AFL137W"
FT   mRNA            <179512..>180045
FT                   /locus_tag="AGOS_AFL137W"
FT                   /old_locus_tag="AFL137W"
FT                   /product="AFL137Wp"
FT   CDS_pept        179512..180045
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL137W"
FT                   /old_locus_tag="AFL137W"
FT                   /product="AFL137Wp"
FT                   /note="NOHBY610; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Zygosacchromyces rouxi ZYRO0E07744g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL137W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53237"
FT                   /db_xref="UniProtKB/TrEMBL:Q755G0"
FT                   /protein_id="AAS53237.1"
FT                   FDAYAGLLAVLPPI"
FT   gene            <180213..>181388
FT                   /locus_tag="AGOS_AFL136W"
FT                   /old_locus_tag="AFL136W"
FT   mRNA            <180213..>181388
FT                   /locus_tag="AGOS_AFL136W"
FT                   /old_locus_tag="AFL136W"
FT                   /product="AFL136Wp"
FT   CDS_pept        180213..181388
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL136W"
FT                   /old_locus_tag="AFL136W"
FT                   /product="AFL136Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL230W
FT                   (USV1) and YMR182C (RGM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL136W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53238"
FT                   /db_xref="GOA:Q755F9"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q755F9"
FT                   /protein_id="AAS53238.2"
FT   gene            <181674..>182285
FT                   /locus_tag="AGOS_AFL135W"
FT                   /old_locus_tag="AFL135W"
FT   mRNA            <181674..>182285
FT                   /locus_tag="AGOS_AFL135W"
FT                   /old_locus_tag="AFL135W"
FT                   /product="AFL135Wp"
FT   CDS_pept        181674..182285
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL135W"
FT                   /old_locus_tag="AFL135W"
FT                   /product="AFL135Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR181C
FT                   and YPL229W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL135W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53239"
FT                   /db_xref="UniProtKB/TrEMBL:Q755F8"
FT                   /protein_id="AAS53239.1"
FT   gene            <182634..>184070
FT                   /locus_tag="AGOS_AFL134W"
FT                   /old_locus_tag="AFL134W"
FT   mRNA            <182634..>184070
FT                   /locus_tag="AGOS_AFL134W"
FT                   /old_locus_tag="AFL134W"
FT                   /product="AFL134Wp"
FT   CDS_pept        182634..184070
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL134W"
FT                   /old_locus_tag="AFL134W"
FT                   /product="AFL134Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL228W
FT                   (CET1) and YMR180C (CTL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL134W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53240"
FT                   /db_xref="GOA:Q755F7"
FT                   /db_xref="InterPro:IPR004206"
FT                   /db_xref="InterPro:IPR033469"
FT                   /db_xref="InterPro:IPR037009"
FT                   /db_xref="InterPro:IPR040343"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755F7"
FT                   /protein_id="AAS53240.2"
FT   gene            complement(<184172..>185128)
FT                   /locus_tag="AGOS_AFL133C"
FT                   /old_locus_tag="AFL133C"
FT   mRNA            complement(<184172..>185128)
FT                   /locus_tag="AGOS_AFL133C"
FT                   /old_locus_tag="AFL133C"
FT                   /product="AFL133Cp"
FT   CDS_pept        complement(184172..185128)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL133C"
FT                   /old_locus_tag="AFL133C"
FT                   /product="AFL133Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL227C
FT                   (ALG5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL133C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53241"
FT                   /db_xref="GOA:Q755F6"
FT                   /db_xref="InterPro:IPR001173"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="InterPro:IPR035518"
FT                   /db_xref="UniProtKB/TrEMBL:Q755F6"
FT                   /protein_id="AAS53241.2"
FT   gene            complement(<185438..>187414)
FT                   /locus_tag="AGOS_AFL132C"
FT                   /old_locus_tag="AFL132C"
FT   mRNA            complement(<185438..>187414)
FT                   /locus_tag="AGOS_AFL132C"
FT                   /old_locus_tag="AFL132C"
FT                   /product="AFL132Cp"
FT   CDS_pept        complement(185438..187414)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL132C"
FT                   /old_locus_tag="AFL132C"
FT                   /product="AFL132Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR179W
FT                   (SPT21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL132C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53242"
FT                   /db_xref="GOA:Q755F5"
FT                   /db_xref="InterPro:IPR042403"
FT                   /db_xref="UniProtKB/TrEMBL:Q755F5"
FT                   /protein_id="AAS53242.2"
FT   gene            <188088..>191660
FT                   /locus_tag="AGOS_AFL131W"
FT                   /old_locus_tag="AFL131W"
FT   mRNA            <188088..>191660
FT                   /locus_tag="AGOS_AFL131W"
FT                   /old_locus_tag="AFL131W"
FT                   /product="AFL131Wp"
FT   CDS_pept        188088..191660
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL131W"
FT                   /old_locus_tag="AFL131W"
FT                   /product="AFL131Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL226W
FT                   (NEW1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL131W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53243"
FT                   /db_xref="GOA:Q755F4"
FT                   /db_xref="InterPro:IPR000953"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR016197"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR023780"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q755F4"
FT                   /protein_id="AAS53243.2"
FT   gene            complement(<191721..>192611)
FT                   /locus_tag="AGOS_AFL130C"
FT                   /old_locus_tag="AFL130C"
FT   mRNA            complement(<191721..>192611)
FT                   /locus_tag="AGOS_AFL130C"
FT                   /old_locus_tag="AFL130C"
FT                   /product="AFL130Cp"
FT   CDS_pept        complement(191721..192611)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL130C"
FT                   /old_locus_tag="AFL130C"
FT                   /product="AFL130Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR178W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL130C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53244"
FT                   /db_xref="GOA:Q755F3"
FT                   /db_xref="InterPro:IPR001453"
FT                   /db_xref="InterPro:IPR036425"
FT                   /db_xref="UniProtKB/TrEMBL:Q755F3"
FT                   /protein_id="AAS53244.1"
FT                   KEVSEEDERKFSDAR"
FT   gene            <192828..>193265
FT                   /locus_tag="AGOS_AFL129W"
FT                   /old_locus_tag="AFL129W"
FT   mRNA            <192828..>193265
FT                   /locus_tag="AGOS_AFL129W"
FT                   /old_locus_tag="AFL129W"
FT                   /product="AFL129Wp"
FT   CDS_pept        192828..193265
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL129W"
FT                   /old_locus_tag="AFL129W"
FT                   /product="AFL129Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL225W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL129W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53245"
FT                   /db_xref="InterPro:IPR008476"
FT                   /db_xref="InterPro:IPR021148"
FT                   /db_xref="InterPro:IPR023139"
FT                   /db_xref="UniProtKB/TrEMBL:Q755F2"
FT                   /protein_id="AAS53245.1"
FT   gene            complement(<193301..>194668)
FT                   /locus_tag="AGOS_AFL128C"
FT                   /old_locus_tag="AFL128C"
FT   mRNA            complement(<193301..>194668)
FT                   /locus_tag="AGOS_AFL128C"
FT                   /old_locus_tag="AFL128C"
FT                   /product="AFL128Cp"
FT   CDS_pept        complement(193301..194668)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL128C"
FT                   /old_locus_tag="AFL128C"
FT                   /product="AFL128Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR177W
FT                   (MMT1) and YPL224C (MMT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL128C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53246"
FT                   /db_xref="GOA:Q755F1"
FT                   /db_xref="InterPro:IPR002524"
FT                   /db_xref="InterPro:IPR027469"
FT                   /db_xref="UniProtKB/TrEMBL:Q755F1"
FT                   /protein_id="AAS53246.2"
FT   gene            complement(<194909..>199474)
FT                   /locus_tag="AGOS_AFL127C"
FT                   /old_locus_tag="AFL127C"
FT   mRNA            complement(<194909..>199474)
FT                   /locus_tag="AGOS_AFL127C"
FT                   /old_locus_tag="AFL127C"
FT                   /product="AFL127Cp"
FT   CDS_pept        complement(194909..199474)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL127C"
FT                   /old_locus_tag="AFL127C"
FT                   /product="AFL127Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR176W
FT                   (ECM5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL127C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53247"
FT                   /db_xref="GOA:Q755F0"
FT                   /db_xref="InterPro:IPR001606"
FT                   /db_xref="InterPro:IPR003347"
FT                   /db_xref="InterPro:IPR003349"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR013637"
FT                   /db_xref="InterPro:IPR019786"
FT                   /db_xref="InterPro:IPR036431"
FT                   /db_xref="UniProtKB/TrEMBL:Q755F0"
FT                   /protein_id="AAS53247.1"
FT                   C"
FT   gene            <200198..>200527
FT                   /locus_tag="AGOS_AFL126W"
FT                   /old_locus_tag="AFL126W"
FT   mRNA            <200198..>200527
FT                   /locus_tag="AGOS_AFL126W"
FT                   /old_locus_tag="AFL126W"
FT                   /product="AFL126Wp"
FT   CDS_pept        200198..200527
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL126W"
FT                   /old_locus_tag="AFL126W"
FT                   /product="AFL126Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR174C
FT                   (PAI3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL126W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53248"
FT                   /db_xref="GOA:Q755E9"
FT                   /db_xref="UniProtKB/TrEMBL:Q755E9"
FT                   /protein_id="AAS53248.2"
FT                   SREGN"
FT   gene            <201338..>202975
FT                   /locus_tag="AGOS_AFL125W"
FT                   /old_locus_tag="AFL125W"
FT   mRNA            <201338..>202975
FT                   /locus_tag="AGOS_AFL125W"
FT                   /old_locus_tag="AFL125W"
FT                   /product="AFL125Wp"
FT   CDS_pept        201338..202975
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL125W"
FT                   /old_locus_tag="AFL125W"
FT                   /product="AFL125Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR173W
FT                   (DDR48)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL125W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53249"
FT                   /db_xref="UniProtKB/TrEMBL:Q755E8"
FT                   /protein_id="AAS53249.2"
FT   gene            complement(<203079..>204968)
FT                   /locus_tag="AGOS_AFL124C"
FT                   /old_locus_tag="AFL124C"
FT   mRNA            complement(<203079..>204968)
FT                   /locus_tag="AGOS_AFL124C"
FT                   /old_locus_tag="AFL124C"
FT                   /product="AFL124Cp"
FT   CDS_pept        complement(203079..204968)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL124C"
FT                   /old_locus_tag="AFL124C"
FT                   /product="AFL124Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR172W
FT                   (HOT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL124C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53250"
FT                   /db_xref="GOA:Q755E7"
FT                   /db_xref="InterPro:IPR022210"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755E7"
FT                   /protein_id="AAS53250.1"
FT   gene            <205462..>207459
FT                   /locus_tag="AGOS_AFL123W"
FT                   /old_locus_tag="AFL123W"
FT   mRNA            <205462..>207459
FT                   /locus_tag="AGOS_AFL123W"
FT                   /old_locus_tag="AFL123W"
FT                   /product="AFL123Wp"
FT   CDS_pept        205462..207459
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL123W"
FT                   /old_locus_tag="AFL123W"
FT                   /product="AFL123Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL222W
FT                   (FMP40)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL123W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53251"
FT                   /db_xref="GOA:Q755E6"
FT                   /db_xref="InterPro:IPR003846"
FT                   /db_xref="UniProtKB/TrEMBL:Q755E6"
FT                   /protein_id="AAS53251.2"
FT   gene            <207898..>210066
FT                   /locus_tag="AGOS_AFL122W"
FT                   /old_locus_tag="AFL122W"
FT   mRNA            <207898..>210066
FT                   /locus_tag="AGOS_AFL122W"
FT                   /old_locus_tag="AFL122W"
FT                   /product="AFL122Wp"
FT   CDS_pept        207898..210066
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL122W"
FT                   /old_locus_tag="AFL122W"
FT                   /product="AFL122Wp"
FT                   /note="NOHBY608; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0A03784g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL122W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53252"
FT                   /db_xref="UniProtKB/TrEMBL:Q755E5"
FT                   /protein_id="AAS53252.2"
FT   gene            <210369..>213383
FT                   /locus_tag="AGOS_AFL121W"
FT                   /old_locus_tag="AFL121W"
FT   mRNA            <210369..>213383
FT                   /locus_tag="AGOS_AFL121W"
FT                   /old_locus_tag="AFL121W"
FT                   /product="AFL121Wp"
FT   CDS_pept        210369..213383
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL121W"
FT                   /old_locus_tag="AFL121W"
FT                   /product="AFL121Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YBL022C (PIM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL121W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53253"
FT                   /db_xref="GOA:Q755E4"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR008268"
FT                   /db_xref="InterPro:IPR008269"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR027065"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR027501"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755E4"
FT                   /protein_id="AAS53253.2"
FT                   NLWHACEDSSVRPQL"
FT   gene            <213848..>215911
FT                   /locus_tag="AGOS_AFL120W"
FT                   /old_locus_tag="AFL120W"
FT   mRNA            <213848..>215911
FT                   /locus_tag="AGOS_AFL120W"
FT                   /old_locus_tag="AFL120W"
FT                   /product="AFL120Wp"
FT   CDS_pept        213848..215911
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL120W"
FT                   /old_locus_tag="AFL120W"
FT                   /product="AFL120Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL139W
FT                   (FLC3) and YPL221W (FLC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL120W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53254"
FT                   /db_xref="GOA:Q755E3"
FT                   /db_xref="InterPro:IPR010308"
FT                   /db_xref="InterPro:IPR032800"
FT                   /db_xref="InterPro:IPR040241"
FT                   /db_xref="UniProtKB/TrEMBL:Q755E3"
FT                   /protein_id="AAS53254.1"
FT   gene            complement(<216140..>217402)
FT                   /locus_tag="AGOS_AFL119C"
FT                   /old_locus_tag="AFL119C"
FT   mRNA            complement(<216140..>217402)
FT                   /locus_tag="AGOS_AFL119C"
FT                   /old_locus_tag="AFL119C"
FT                   /product="AFL119Cp"
FT   CDS_pept        complement(216140..217402)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL119C"
FT                   /old_locus_tag="AFL119C"
FT                   /product="AFL119Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGL138C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL119C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53255"
FT                   /db_xref="UniProtKB/TrEMBL:Q755E2"
FT                   /protein_id="AAS53255.1"
FT   gene            <217686..>220337
FT                   /locus_tag="AGOS_AFL118W"
FT                   /old_locus_tag="AFL118W"
FT   mRNA            join(<217686..217703,217857..>220337)
FT                   /locus_tag="AGOS_AFL118W"
FT                   /old_locus_tag="AFL118W"
FT                   /product="AFL118Wp"
FT   CDS_pept        join(217686..217703,217857..220337)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL118W"
FT                   /old_locus_tag="AFL118W"
FT                   /product="AFL118Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL137W
FT                   (SEC27); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL118W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53256"
FT                   /db_xref="GOA:Q755E1"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR006692"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR016453"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q755E1"
FT                   /protein_id="AAS53256.1"
FT   gene            complement(<220427..>221338)
FT                   /locus_tag="AGOS_AFL117C"
FT                   /old_locus_tag="AFL117C"
FT   mRNA            complement(<220427..>221338)
FT                   /locus_tag="AGOS_AFL117C"
FT                   /old_locus_tag="AFL117C"
FT                   /product="AFL117Cp"
FT   CDS_pept        complement(220427..221338)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL117C"
FT                   /old_locus_tag="AFL117C"
FT                   /product="AFL117Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL136C
FT                   (MRM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL117C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53257"
FT                   /db_xref="GOA:Q755E0"
FT                   /db_xref="InterPro:IPR002877"
FT                   /db_xref="InterPro:IPR015507"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q755E0"
FT                   /protein_id="AAS53257.2"
FT   gene            <221651..>222304
FT                   /locus_tag="AGOS_AFL116W"
FT                   /old_locus_tag="AFL116W"
FT   mRNA            <221651..>222304
FT                   /locus_tag="AGOS_AFL116W"
FT                   /old_locus_tag="AFL116W"
FT                   /product="AFL116Wp"
FT   CDS_pept        221651..222304
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL116W"
FT                   /old_locus_tag="AFL116W"
FT                   /product="AFL116Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL135W
FT                   (RPL1B) and YPL220W (RPL1A)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL116W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53258"
FT                   /db_xref="GOA:Q755D9"
FT                   /db_xref="InterPro:IPR002143"
FT                   /db_xref="InterPro:IPR016095"
FT                   /db_xref="InterPro:IPR023673"
FT                   /db_xref="InterPro:IPR023674"
FT                   /db_xref="InterPro:IPR028364"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755D9"
FT                   /protein_id="AAS53258.1"
FT   gene            <222669..>223829
FT                   /locus_tag="AGOS_AFL115W"
FT                   /old_locus_tag="AFL115W"
FT   mRNA            <222669..>223829
FT                   /locus_tag="AGOS_AFL115W"
FT                   /old_locus_tag="AFL115W"
FT                   /product="AFL115Wp"
FT   CDS_pept        222669..223829
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL115W"
FT                   /old_locus_tag="AFL115W"
FT                   /product="AFL115Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL219W
FT                   (PCL8) and YGL134W (PCL10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL115W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53259"
FT                   /db_xref="GOA:Q755D8"
FT                   /db_xref="InterPro:IPR013922"
FT                   /db_xref="UniProtKB/TrEMBL:Q755D8"
FT                   /protein_id="AAS53259.1"
FT   gene            <224188..>224760
FT                   /locus_tag="AGOS_AFL114W"
FT                   /old_locus_tag="AFL114W"
FT   mRNA            <224188..>224760
FT                   /locus_tag="AGOS_AFL114W"
FT                   /old_locus_tag="AFL114W"
FT                   /product="AFL114Wp"
FT   CDS_pept        224188..224760
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL114W"
FT                   /old_locus_tag="AFL114W"
FT                   /product="AFL114Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL218W
FT                   (SAR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL114W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53260"
FT                   /db_xref="GOA:Q755D7"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR006687"
FT                   /db_xref="InterPro:IPR006689"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755D7"
FT                   /protein_id="AAS53260.1"
FT   gene            complement(<224956..>228444)
FT                   /locus_tag="AGOS_AFL113C"
FT                   /old_locus_tag="AFL113C"
FT   mRNA            complement(<224956..>228444)
FT                   /locus_tag="AGOS_AFL113C"
FT                   /old_locus_tag="AFL113C"
FT                   /product="AFL113Cp"
FT   CDS_pept        complement(224956..228444)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL113C"
FT                   /old_locus_tag="AFL113C"
FT                   /product="AFL113Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL217C
FT                   (BMS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL113C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53261"
FT                   /db_xref="GOA:Q755D6"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR007034"
FT                   /db_xref="InterPro:IPR012948"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR030387"
FT                   /db_xref="InterPro:IPR037875"
FT                   /db_xref="InterPro:IPR039761"
FT                   /db_xref="UniProtKB/TrEMBL:Q755D6"
FT                   /protein_id="AAS53261.2"
FT   gene            <228840..>232424
FT                   /locus_tag="AGOS_AFL112W"
FT                   /old_locus_tag="AFL112W"
FT   mRNA            <228840..>232424
FT                   /locus_tag="AGOS_AFL112W"
FT                   /old_locus_tag="AFL112W"
FT                   /product="AFL112Wp"
FT   CDS_pept        228840..232424
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL112W"
FT                   /old_locus_tag="AFL112W"
FT                   /product="AFL112Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL133W
FT                   (ITC1) and YPL216W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL112W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53262"
FT                   /db_xref="GOA:Q755D5"
FT                   /db_xref="InterPro:IPR013136"
FT                   /db_xref="InterPro:IPR018501"
FT                   /db_xref="InterPro:IPR028941"
FT                   /db_xref="InterPro:IPR028942"
FT                   /db_xref="UniProtKB/TrEMBL:Q755D5"
FT                   /protein_id="AAS53262.2"
FT   gene            <232814..>233800
FT                   /locus_tag="AGOS_AFL111W"
FT                   /old_locus_tag="AFL111W"
FT   mRNA            <232814..>233800
FT                   /locus_tag="AGOS_AFL111W"
FT                   /old_locus_tag="AFL111W"
FT                   /product="AFL111Wp"
FT   CDS_pept        232814..233800
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL111W"
FT                   /old_locus_tag="AFL111W"
FT                   /product="AFL111Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL215W
FT                   (CBP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL111W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53263"
FT                   /db_xref="GOA:Q755D4"
FT                   /db_xref="InterPro:IPR007129"
FT                   /db_xref="InterPro:IPR021150"
FT                   /db_xref="UniProtKB/TrEMBL:Q755D4"
FT                   /protein_id="AAS53263.2"
FT   gene            complement(<233889..>235532)
FT                   /locus_tag="AGOS_AFL110C"
FT                   /old_locus_tag="AFL110C"
FT   mRNA            complement(<233889..>235532)
FT                   /locus_tag="AGOS_AFL110C"
FT                   /old_locus_tag="AFL110C"
FT                   /product="AFL110Cp"
FT   CDS_pept        complement(233889..235532)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL110C"
FT                   /old_locus_tag="AFL110C"
FT                   /product="AFL110Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL214C
FT                   (THI6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL110C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53264"
FT                   /db_xref="GOA:Q755D3"
FT                   /db_xref="InterPro:IPR000417"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR022998"
FT                   /db_xref="InterPro:IPR029056"
FT                   /db_xref="InterPro:IPR034291"
FT                   /db_xref="InterPro:IPR036206"
FT                   /db_xref="UniProtKB/TrEMBL:Q755D3"
FT                   /protein_id="AAS53264.1"
FT   gene            <235723..>236436
FT                   /locus_tag="AGOS_AFL109W"
FT                   /old_locus_tag="AFL109W"
FT   mRNA            <235723..>236436
FT                   /locus_tag="AGOS_AFL109W"
FT                   /old_locus_tag="AFL109W"
FT                   /product="AFL109Wp"
FT   CDS_pept        235723..236436
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL109W"
FT                   /old_locus_tag="AFL109W"
FT                   /product="AFL109Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL213W
FT                   (LEA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL109W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53265"
FT                   /db_xref="GOA:Q755D2"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755D2"
FT                   /protein_id="AAS53265.1"
FT                   EIERLEKLLSGGVIQ"
FT   gene            complement(<236472..>240833)
FT                   /locus_tag="AGOS_AFL108C"
FT                   /old_locus_tag="AFL108C"
FT   mRNA            complement(<236472..>240833)
FT                   /locus_tag="AGOS_AFL108C"
FT                   /old_locus_tag="AFL108C"
FT                   /product="AFL108Cp"
FT   CDS_pept        complement(236472..240833)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL108C"
FT                   /old_locus_tag="AFL108C"
FT                   /product="AFL108Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL131C
FT                   (SNT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL108C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53266"
FT                   /db_xref="GOA:Q755D1"
FT                   /db_xref="InterPro:IPR001005"
FT                   /db_xref="InterPro:IPR001025"
FT                   /db_xref="InterPro:IPR001965"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR019787"
FT                   /db_xref="InterPro:IPR029617"
FT                   /db_xref="InterPro:IPR034732"
FT                   /db_xref="UniProtKB/TrEMBL:Q755D1"
FT                   /protein_id="AAS53266.2"
FT   gene            <241066..>242457
FT                   /locus_tag="AGOS_AFL107W"
FT                   /old_locus_tag="AFL107W"
FT   mRNA            <241066..>242457
FT                   /locus_tag="AGOS_AFL107W"
FT                   /old_locus_tag="AFL107W"
FT                   /product="AFL107Wp"
FT   CDS_pept        241066..242457
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL107W"
FT                   /old_locus_tag="AFL107W"
FT                   /product="AFL107Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL130W
FT                   (CEG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL107W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53267"
FT                   /db_xref="GOA:Q755D0"
FT                   /db_xref="InterPro:IPR001339"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR013846"
FT                   /db_xref="InterPro:IPR017075"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755D0"
FT                   /protein_id="AAS53267.1"
FT                   RARIE"
FT   gene            complement(<242546..>243868)
FT                   /locus_tag="AGOS_AFL106C"
FT                   /old_locus_tag="AFL106C"
FT   mRNA            complement(<242546..>243868)
FT                   /locus_tag="AGOS_AFL106C"
FT                   /old_locus_tag="AFL106C"
FT                   /product="AFL106Cp"
FT   CDS_pept        complement(242546..243868)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL106C"
FT                   /old_locus_tag="AFL106C"
FT                   /product="AFL106Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL129C
FT                   (RSM23)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL106C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53268"
FT                   /db_xref="GOA:Q755C9"
FT                   /db_xref="InterPro:IPR017082"
FT                   /db_xref="InterPro:IPR019368"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q755C9"
FT                   /protein_id="AAS53268.2"
FT   gene            complement(<244069..>245655)
FT                   /locus_tag="AGOS_AFL105C"
FT                   /old_locus_tag="AFL105C"
FT   mRNA            complement(<244069..>245655)
FT                   /locus_tag="AGOS_AFL105C"
FT                   /old_locus_tag="AFL105C"
FT                   /product="AFL105Cp"
FT   CDS_pept        complement(244069..245655)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL105C"
FT                   /old_locus_tag="AFL105C"
FT                   /product="AFL105Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL212C
FT                   (PUS1) and YGL063W (PUS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL105C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53269"
FT                   /db_xref="GOA:Q755C8"
FT                   /db_xref="InterPro:IPR001406"
FT                   /db_xref="InterPro:IPR020095"
FT                   /db_xref="InterPro:IPR020097"
FT                   /db_xref="InterPro:IPR020103"
FT                   /db_xref="InterPro:IPR041708"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755C8"
FT                   /protein_id="AAS53269.2"
FT                   ATEVPTTQSDA"
FT   gene            <246109..>246654
FT                   /locus_tag="AGOS_AFL104W"
FT                   /old_locus_tag="AFL104W"
FT   mRNA            <246109..>246654
FT                   /locus_tag="AGOS_AFL104W"
FT                   /old_locus_tag="AFL104W"
FT                   /product="AFL104Wp"
FT   CDS_pept        246109..246654
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL104W"
FT                   /old_locus_tag="AFL104W"
FT                   /product="AFL104Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL211W
FT                   (NIP7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL104W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53270"
FT                   /db_xref="GOA:Q755C7"
FT                   /db_xref="InterPro:IPR002478"
FT                   /db_xref="InterPro:IPR005155"
FT                   /db_xref="InterPro:IPR015947"
FT                   /db_xref="InterPro:IPR016686"
FT                   /db_xref="InterPro:IPR036974"
FT                   /db_xref="InterPro:IPR040598"
FT                   /db_xref="UniProtKB/TrEMBL:Q755C7"
FT                   /protein_id="AAS53270.1"
FT                   FRQADIGEYLRDEDTLFT"
FT   gene            complement(<246762..>248606)
FT                   /locus_tag="AGOS_AFL103C"
FT                   /old_locus_tag="AFL103C"
FT   mRNA            complement(<246762..>248606)
FT                   /locus_tag="AGOS_AFL103C"
FT                   /old_locus_tag="AFL103C"
FT                   /product="AFL103Cp"
FT   CDS_pept        complement(246762..248606)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL103C"
FT                   /old_locus_tag="AFL103C"
FT                   /product="AFL103Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL210C
FT                   (SRP72)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL103C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53271"
FT                   /db_xref="GOA:Q755C6"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013699"
FT                   /db_xref="InterPro:IPR026270"
FT                   /db_xref="UniProtKB/TrEMBL:Q755C6"
FT                   /protein_id="AAS53271.1"
FT   gene            <248850..>250514
FT                   /locus_tag="AGOS_AFL102W"
FT                   /old_locus_tag="AFL102W"
FT   mRNA            <248850..>250514
FT                   /locus_tag="AGOS_AFL102W"
FT                   /old_locus_tag="AFL102W"
FT                   /product="AFL102Wp"
FT   CDS_pept        248850..250514
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL102W"
FT                   /old_locus_tag="AFL102W"
FT                   /product="AFL102Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL064C
FT                   (MRH4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL102W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53272"
FT                   /db_xref="GOA:Q755C5"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755C5"
FT                   /protein_id="AAS53272.1"
FT   gene            complement(<250575..>251678)
FT                   /locus_tag="AGOS_AFL101C"
FT                   /old_locus_tag="AFL101C"
FT   mRNA            complement(<250575..>251678)
FT                   /locus_tag="AGOS_AFL101C"
FT                   /old_locus_tag="AFL101C"
FT                   /product="AFL101Cp"
FT   CDS_pept        complement(250575..251678)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL101C"
FT                   /old_locus_tag="AFL101C"
FT                   /product="AFL101Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL209C
FT                   (IPL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL101C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53273"
FT                   /db_xref="GOA:Q755C4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR030616"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755C4"
FT                   /protein_id="AAS53273.1"
FT   gene            <252056..>253786
FT                   /locus_tag="AGOS_AFL100W"
FT                   /old_locus_tag="AFL100W"
FT   mRNA            <252056..>253786
FT                   /locus_tag="AGOS_AFL100W"
FT                   /old_locus_tag="AFL100W"
FT                   /product="AFL100Wp"
FT   CDS_pept        252056..253786
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL100W"
FT                   /old_locus_tag="AFL100W"
FT                   /product="AFL100Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL208W
FT                   (RKM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL100W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53274"
FT                   /db_xref="GOA:Q755C3"
FT                   /db_xref="InterPro:IPR001214"
FT                   /db_xref="InterPro:IPR017119"
FT                   /db_xref="UniProtKB/TrEMBL:Q755C3"
FT                   /protein_id="AAS53274.2"
FT                   "
FT   gene            <254140..>256458
FT                   /locus_tag="AGOS_AFL099W"
FT                   /old_locus_tag="AFL099W"
FT   mRNA            <254140..>256458
FT                   /locus_tag="AGOS_AFL099W"
FT                   /old_locus_tag="AFL099W"
FT                   /product="AFL099Wp"
FT   CDS_pept        254140..256458
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL099W"
FT                   /old_locus_tag="AFL099W"
FT                   /product="AFL099Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL207W
FT                   (TYW1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL099W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53275"
FT                   /db_xref="GOA:Q755C2"
FT                   /db_xref="InterPro:IPR007197"
FT                   /db_xref="InterPro:IPR008254"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR013917"
FT                   /db_xref="InterPro:IPR029039"
FT                   /db_xref="InterPro:IPR034556"
FT                   /db_xref="UniProtKB/TrEMBL:Q755C2"
FT                   /protein_id="AAS53275.1"
FT   gene            <256774..>258318
FT                   /locus_tag="AGOS_AFL098W"
FT                   /old_locus_tag="AFL098W"
FT   mRNA            <256774..>258318
FT                   /locus_tag="AGOS_AFL098W"
FT                   /old_locus_tag="AFL098W"
FT                   /product="AFL098Wp"
FT   CDS_pept        256774..258318
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL098W"
FT                   /old_locus_tag="AFL098W"
FT                   /product="AFL098Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL065C
FT                   (ALG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL098W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53276"
FT                   /db_xref="GOA:Q755C1"
FT                   /db_xref="InterPro:IPR001296"
FT                   /db_xref="InterPro:IPR027054"
FT                   /db_xref="InterPro:IPR028098"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755C1"
FT                   /protein_id="AAS53276.1"
FT   gene            complement(<258354..>259934)
FT                   /locus_tag="AGOS_AFL097C"
FT                   /old_locus_tag="AFL097C"
FT   mRNA            complement(<258354..>259934)
FT                   /locus_tag="AGOS_AFL097C"
FT                   /old_locus_tag="AFL097C"
FT                   /product="AFL097Cp"
FT   CDS_pept        complement(258354..259934)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL097C"
FT                   /old_locus_tag="AFL097C"
FT                   /product="AFL097Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL066W
FT                   (SGF73)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL097C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53277"
FT                   /db_xref="GOA:Q755C0"
FT                   /db_xref="InterPro:IPR013243"
FT                   /db_xref="InterPro:IPR037804"
FT                   /db_xref="InterPro:IPR041251"
FT                   /db_xref="UniProtKB/TrEMBL:Q755C0"
FT                   /protein_id="AAS53277.1"
FT                   NNGYDSRGN"
FT   gene            complement(<260408..>261358)
FT                   /locus_tag="AGOS_AFL096C"
FT                   /old_locus_tag="AFL096C"
FT   mRNA            complement(<260408..>261358)
FT                   /locus_tag="AGOS_AFL096C"
FT                   /old_locus_tag="AFL096C"
FT                   /product="AFL096Cp"
FT   CDS_pept        complement(260408..261358)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL096C"
FT                   /old_locus_tag="AFL096C"
FT                   /product="AFL096Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL206C
FT                   (PGC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL096C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53278"
FT                   /db_xref="GOA:Q755B9"
FT                   /db_xref="InterPro:IPR017946"
FT                   /db_xref="InterPro:IPR030395"
FT                   /db_xref="UniProtKB/TrEMBL:Q755B9"
FT                   /protein_id="AAS53278.1"
FT   gene            <262306..>269913
FT                   /locus_tag="AGOS_AFL095W"
FT                   /old_locus_tag="AFL095W"
FT   mRNA            <262306..>269913
FT                   /locus_tag="AGOS_AFL095W"
FT                   /old_locus_tag="AFL095W"
FT                   /product="AFL095Wp"
FT   CDS_pept        262306..269913
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL095W"
FT                   /old_locus_tag="AFL095W"
FT                   /product="AFL095Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YHR211W (FLO5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL095W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53279"
FT                   /db_xref="GOA:Q755B8"
FT                   /db_xref="InterPro:IPR001389"
FT                   /db_xref="InterPro:IPR011658"
FT                   /db_xref="InterPro:IPR018871"
FT                   /db_xref="InterPro:IPR037524"
FT                   /db_xref="UniProtKB/TrEMBL:Q755B8"
FT                   /protein_id="AAS53279.2"
FT                   IVALFLSMLFLC"
FT   gene            complement(<270537..>273344)
FT                   /locus_tag="AGOS_AFL092C"
FT                   /old_locus_tag="AFL092C"
FT   mRNA            complement(<270537..>273344)
FT                   /locus_tag="AGOS_AFL092C"
FT                   /old_locus_tag="AFL092C"
FT                   /product="AFL092Cp"
FT   CDS_pept        complement(270537..273344)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL092C"
FT                   /old_locus_tag="AFL092C"
FT                   /product="AFL092Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YHR211W (FLO5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL092C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53280"
FT                   /db_xref="GOA:Q755B7"
FT                   /db_xref="InterPro:IPR001389"
FT                   /db_xref="InterPro:IPR018871"
FT                   /db_xref="InterPro:IPR037524"
FT                   /db_xref="UniProtKB/TrEMBL:Q755B7"
FT                   /protein_id="AAS53280.2"
FT                   TTLLL"
FT   gene            <273862..>275298
FT                   /locus_tag="AGOS_AFL091W"
FT                   /old_locus_tag="AFL091W"
FT   mRNA            <273862..>275298
FT                   /locus_tag="AGOS_AFL091W"
FT                   /old_locus_tag="AFL091W"
FT                   /product="AFL091Wp"
FT   CDS_pept        273862..275298
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL091W"
FT                   /old_locus_tag="AFL091W"
FT                   /product="AFL091Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL204W
FT                   (HRR25)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL091W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53281"
FT                   /db_xref="GOA:Q755B6"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q755B6"
FT                   /protein_id="AAS53281.1"
FT   gene            <275767..>276807
FT                   /locus_tag="AGOS_AFL090W"
FT                   /old_locus_tag="AFL090W"
FT   mRNA            <275767..>276807
FT                   /locus_tag="AGOS_AFL090W"
FT                   /old_locus_tag="AFL090W"
FT                   /product="AFL090Wp"
FT   CDS_pept        275767..276807
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL090W"
FT                   /old_locus_tag="AFL090W"
FT                   /product="AFL090Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL203W
FT                   (TPK2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL090W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53282"
FT                   /db_xref="GOA:Q755B5"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR000961"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q755B5"
FT                   /protein_id="AAS53282.1"
FT                   SYFVDF"
FT   gene            complement(<276890..>277390)
FT                   /locus_tag="AGOS_AFL089C"
FT                   /old_locus_tag="AFL089C"
FT   mRNA            complement(<276890..>277390)
FT                   /locus_tag="AGOS_AFL089C"
FT                   /old_locus_tag="AFL089C"
FT                   /product="AFL089Cp"
FT   CDS_pept        complement(276890..277390)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL089C"
FT                   /old_locus_tag="AFL089C"
FT                   /product="AFL089Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL068W
FT                   (MNP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL089C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53283"
FT                   /db_xref="GOA:Q755B4"
FT                   /db_xref="InterPro:IPR000206"
FT                   /db_xref="InterPro:IPR008932"
FT                   /db_xref="InterPro:IPR013823"
FT                   /db_xref="InterPro:IPR014719"
FT                   /db_xref="InterPro:IPR036235"
FT                   /db_xref="UniProtKB/TrEMBL:Q755B4"
FT                   /protein_id="AAS53283.1"
FT                   VLE"
FT   gene            <277606..>277974
FT                   /locus_tag="AGOS_AFL088W"
FT                   /old_locus_tag="AFL088W"
FT   mRNA            <277606..>277974
FT                   /locus_tag="AGOS_AFL088W"
FT                   /old_locus_tag="AFL088W"
FT                   /product="AFL088Wp"
FT   CDS_pept        277606..277974
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL088W"
FT                   /old_locus_tag="AFL088W"
FT                   /product="AFL088Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL070C
FT                   (RPB9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL088W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53284"
FT                   /db_xref="GOA:Q755B3"
FT                   /db_xref="InterPro:IPR001222"
FT                   /db_xref="InterPro:IPR001529"
FT                   /db_xref="InterPro:IPR012164"
FT                   /db_xref="InterPro:IPR019761"
FT                   /db_xref="InterPro:IPR034012"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755B3"
FT                   /protein_id="AAS53284.1"
FT                   GCSHIFTSDQKNKRTTFS"
FT   gene            complement(<277997..>279355)
FT                   /locus_tag="AGOS_AFL087C"
FT                   /old_locus_tag="AFL087C"
FT   mRNA            complement(<277997..>279355)
FT                   /locus_tag="AGOS_AFL087C"
FT                   /old_locus_tag="AFL087C"
FT                   /product="AFL087Cp"
FT   CDS_pept        complement(277997..279355)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL087C"
FT                   /old_locus_tag="AFL087C"
FT                   /product="AFL087Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL071W
FT                   (AFT1) and YPL202C (AFT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL087C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53285"
FT                   /db_xref="GOA:Q755B2"
FT                   /db_xref="InterPro:IPR014842"
FT                   /db_xref="UniProtKB/TrEMBL:Q755B2"
FT                   /protein_id="AAS53285.1"
FT   gene            <279672..>281033
FT                   /locus_tag="AGOS_AFL086W"
FT                   /old_locus_tag="AFL086W"
FT   mRNA            <279672..>281033
FT                   /locus_tag="AGOS_AFL086W"
FT                   /old_locus_tag="AFL086W"
FT                   /product="AFL086Wp"
FT   CDS_pept        279672..281033
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL086W"
FT                   /old_locus_tag="AFL086W"
FT                   /product="AFL086Wp"
FT                   /note="NOHBY605; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL086W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53286"
FT                   /db_xref="UniProtKB/TrEMBL:Q755B1"
FT                   /protein_id="AAS53286.2"
FT   gene            complement(<281143..>282963)
FT                   /locus_tag="AGOS_AFL085C"
FT                   /old_locus_tag="AFL085C"
FT   mRNA            complement(<281143..>282963)
FT                   /locus_tag="AGOS_AFL085C"
FT                   /old_locus_tag="AFL085C"
FT                   /product="AFL085Cp"
FT   CDS_pept        complement(281143..282963)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL085C"
FT                   /old_locus_tag="AFL085C"
FT                   /product="AFL085Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL073W
FT                   (HSF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL085C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53287"
FT                   /db_xref="GOA:Q755B0"
FT                   /db_xref="InterPro:IPR000232"
FT                   /db_xref="InterPro:IPR027725"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="UniProtKB/TrEMBL:Q755B0"
FT                   /protein_id="AAS53287.2"
FT   gene            <283597..>284613
FT                   /locus_tag="AGOS_AFL084W"
FT                   /old_locus_tag="AFL084W"
FT   mRNA            <283597..>284613
FT                   /locus_tag="AGOS_AFL084W"
FT                   /old_locus_tag="AFL084W"
FT                   /product="AFL084Wp"
FT   CDS_pept        283597..284613
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL084W"
FT                   /old_locus_tag="AFL084W"
FT                   /product="AFL084Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL075C
FT                   (MPS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL084W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53288"
FT                   /db_xref="GOA:Q755A9"
FT                   /db_xref="InterPro:IPR031433"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755A9"
FT                   /protein_id="AAS53288.2"
FT   gene            complement(<284734..>285495)
FT                   /locus_tag="AGOS_AFL083C"
FT                   /old_locus_tag="AFL083C"
FT   mRNA            complement(<284734..>285495)
FT                   /locus_tag="AGOS_AFL083C"
FT                   /old_locus_tag="AFL083C"
FT                   /product="AFL083Cp"
FT   CDS_pept        complement(284734..285495)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL083C"
FT                   /old_locus_tag="AFL083C"
FT                   /product="AFL083Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL199C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL083C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53289"
FT                   /db_xref="InterPro:IPR002625"
FT                   /db_xref="InterPro:IPR013899"
FT                   /db_xref="InterPro:IPR036063"
FT                   /db_xref="UniProtKB/TrEMBL:Q755A8"
FT                   /protein_id="AAS53289.1"
FT   gene            285797..285852
FT                   /locus_tag="AGOS_AgSNR39b"
FT                   /old_locus_tag="AgSNR39b"
FT   ncRNA           285797..285852
FT                   /locus_tag="AGOS_AgSNR39b"
FT                   /old_locus_tag="AgSNR39b"
FT                   /product="AgSNR39b"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR39b; start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <286109..>287321
FT                   /locus_tag="AGOS_AFL082W"
FT                   /old_locus_tag="AFL082W"
FT   mRNA            join(<286109..286116,286384..286477,286692..>287321)
FT                   /locus_tag="AGOS_AFL082W"
FT                   /old_locus_tag="AFL082W"
FT                   /product="AFL082Wp"
FT   CDS_pept        join(286109..286116,286384..286477,286692..287321)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL082W"
FT                   /old_locus_tag="AFL082W"
FT                   /product="AFL082Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL076C
FT                   (RPL7A) and YPL198W (RPL7B); 2-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL082W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53290"
FT                   /db_xref="GOA:Q755A7"
FT                   /db_xref="InterPro:IPR005998"
FT                   /db_xref="InterPro:IPR012988"
FT                   /db_xref="InterPro:IPR016082"
FT                   /db_xref="InterPro:IPR018038"
FT                   /db_xref="InterPro:IPR023106"
FT                   /db_xref="InterPro:IPR035808"
FT                   /db_xref="InterPro:IPR036919"
FT                   /db_xref="InterPro:IPR039699"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755A7"
FT                   /protein_id="AAS53290.1"
FT   gene            286556..286630
FT                   /locus_tag="AGOS_AgSNR3959"
FT                   /old_locus_tag="AgSNR39_59"
FT   ncRNA           286556..286630
FT                   /locus_tag="AGOS_AgSNR3959"
FT                   /old_locus_tag="AgSNR39_59"
FT                   /product="AgSNR39_59"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR39 and SNR59; start and end coordinates are approximate;
FT                   in synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <287773..>289401
FT                   /locus_tag="AGOS_AFL081W"
FT                   /old_locus_tag="AFL081W"
FT   mRNA            <287773..>289401
FT                   /locus_tag="AGOS_AFL081W"
FT                   /old_locus_tag="AFL081W"
FT                   /product="AFL081Wp"
FT   CDS_pept        287773..289401
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL081W"
FT                   /old_locus_tag="AFL081W"
FT                   /product="AFL081Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL077C
FT                   (HNM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL081W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53291"
FT                   /db_xref="GOA:Q755A6"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="InterPro:IPR004756"
FT                   /db_xref="InterPro:IPR004840"
FT                   /db_xref="UniProtKB/TrEMBL:Q755A6"
FT                   /protein_id="AAS53291.1"
FT   gene            <289639..>291246
FT                   /locus_tag="AGOS_AFL080W"
FT                   /old_locus_tag="AFL080W"
FT   mRNA            <289639..>291246
FT                   /locus_tag="AGOS_AFL080W"
FT                   /old_locus_tag="AFL080W"
FT                   /product="AFL080Wp"
FT   CDS_pept        289639..291246
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL080W"
FT                   /old_locus_tag="AFL080W"
FT                   /product="AFL080Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL078C
FT                   (DBP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL080W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53292"
FT                   /db_xref="GOA:Q755A5"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755A5"
FT                   /protein_id="AAS53292.1"
FT                   AFYKNVDLTKKAKKITFD"
FT   gene            <291568..>293184
FT                   /locus_tag="AGOS_AFL079W"
FT                   /old_locus_tag="AFL079W"
FT   mRNA            <291568..>293184
FT                   /locus_tag="AGOS_AFL079W"
FT                   /old_locus_tag="AFL079W"
FT                   /product="AFL079Wp"
FT   CDS_pept        291568..293184
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL079W"
FT                   /old_locus_tag="AFL079W"
FT                   /product="AFL079Wp"
FT                   /note="NOHBY604; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E19569g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL079W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53293"
FT                   /db_xref="GOA:Q755A4"
FT                   /db_xref="InterPro:IPR001199"
FT                   /db_xref="InterPro:IPR005804"
FT                   /db_xref="InterPro:IPR012171"
FT                   /db_xref="InterPro:IPR036400"
FT                   /db_xref="UniProtKB/TrEMBL:Q755A4"
FT                   /protein_id="AAS53293.1"
FT   gene            <293366..>294079
FT                   /locus_tag="AGOS_AFL078W"
FT                   /old_locus_tag="AFL078W"
FT   mRNA            <293366..>294079
FT                   /locus_tag="AGOS_AFL078W"
FT                   /old_locus_tag="AFL078W"
FT                   /product="AFL078Wp"
FT   CDS_pept        293366..294079
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL078W"
FT                   /old_locus_tag="AFL078W"
FT                   /product="AFL078Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL196W
FT                   (OXR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL078W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53294"
FT                   /db_xref="GOA:Q755A3"
FT                   /db_xref="InterPro:IPR006571"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755A3"
FT                   /protein_id="AAS53294.2"
FT                   GPRFHIVALEVWRVG"
FT   gene            complement(<294119..>294691)
FT                   /locus_tag="AGOS_AFL077C"
FT                   /old_locus_tag="AFL077C"
FT   mRNA            complement(<294119..>294691)
FT                   /locus_tag="AGOS_AFL077C"
FT                   /old_locus_tag="AFL077C"
FT                   /product="AFL077Cp"
FT   CDS_pept        complement(294119..294691)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL077C"
FT                   /old_locus_tag="AFL077C"
FT                   /product="AFL077Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL079W
FT                   (KXD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL077C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53295"
FT                   /db_xref="GOA:Q755A2"
FT                   /db_xref="InterPro:IPR019371"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755A2"
FT                   /protein_id="AAS53295.1"
FT   gene            <294832..>297531
FT                   /locus_tag="AGOS_AFL076W"
FT                   /old_locus_tag="AFL076W"
FT   mRNA            <294832..>297531
FT                   /locus_tag="AGOS_AFL076W"
FT                   /old_locus_tag="AFL076W"
FT                   /product="AFL076Wp"
FT   CDS_pept        294832..297531
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL076W"
FT                   /old_locus_tag="AFL076W"
FT                   /product="AFL076Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL195W
FT                   (APL5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL076W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53296"
FT                   /db_xref="GOA:Q755A1"
FT                   /db_xref="InterPro:IPR002553"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR017105"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755A1"
FT                   /protein_id="AAS53296.1"
FT   gene            <297725..>299356
FT                   /locus_tag="AGOS_AFL075W"
FT                   /old_locus_tag="AFL075W"
FT   mRNA            <297725..>299356
FT                   /locus_tag="AGOS_AFL075W"
FT                   /old_locus_tag="AFL075W"
FT                   /product="AFL075Wp"
FT   CDS_pept        297725..299356
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL075W"
FT                   /old_locus_tag="AFL075W"
FT                   /product="AFL075Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL194W
FT                   (DDC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL075W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53297"
FT                   /db_xref="GOA:Q755A0"
FT                   /db_xref="InterPro:IPR007268"
FT                   /db_xref="InterPro:IPR026217"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q755A0"
FT                   /protein_id="AAS53297.1"
FT   gene            complement(<299448..>299813)
FT                   /locus_tag="AGOS_AFL074C"
FT                   /old_locus_tag="AFL074C"
FT   mRNA            complement(<299448..>299813)
FT                   /locus_tag="AGOS_AFL074C"
FT                   /old_locus_tag="AFL074C"
FT                   /product="AFL074Cp"
FT   CDS_pept        complement(299448..299813)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL074C"
FT                   /old_locus_tag="AFL074C"
FT                   /product="AFL074Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL080W
FT                   (FMP37)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL074C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53298"
FT                   /db_xref="GOA:Q754Z9"
FT                   /db_xref="InterPro:IPR005336"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Z9"
FT                   /protein_id="AAS53298.1"
FT                   FNYFGEKPAVKGTEKTA"
FT   gene            <300152..>301159
FT                   /locus_tag="AGOS_AFL073W"
FT                   /old_locus_tag="AFL073W"
FT   mRNA            <300152..>301159
FT                   /locus_tag="AGOS_AFL073W"
FT                   /old_locus_tag="AFL073W"
FT                   /product="AFL073Wp"
FT   CDS_pept        300152..301159
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL073W"
FT                   /old_locus_tag="AFL073W"
FT                   /product="AFL073Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL193W
FT                   (RSA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL073W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53299"
FT                   /db_xref="InterPro:IPR019496"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Z8"
FT                   /protein_id="AAS53299.1"
FT   gene            complement(<301212..>301571)
FT                   /locus_tag="AGOS_AFL072CA"
FT   mRNA            complement(<301212..>301571)
FT                   /locus_tag="AGOS_AFL072CA"
FT                   /product="AFL072C-Ap"
FT   CDS_pept        complement(301212..301571)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL072CA"
FT                   /product="AFL072C-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL192C
FT                   (PRM3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL072CA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41786"
FT                   /db_xref="GOA:D8FGF6"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGF6"
FT                   /protein_id="ADJ41786.1"
FT                   FIGAALAEFVLAKFK"
FT   gene            complement(<301898..>302842)
FT                   /locus_tag="AGOS_AFL072C"
FT                   /old_locus_tag="AFL072C"
FT   mRNA            complement(<301898..>302842)
FT                   /locus_tag="AGOS_AFL072C"
FT                   /old_locus_tag="AFL072C"
FT                   /product="AFL072Cp"
FT   CDS_pept        complement(301898..302842)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL072C"
FT                   /old_locus_tag="AFL072C"
FT                   /product="AFL072Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGL081W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL072C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53300"
FT                   /db_xref="GOA:Q754Y3"
FT                   /db_xref="InterPro:IPR000253"
FT                   /db_xref="InterPro:IPR008984"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y3"
FT                   /protein_id="AAS53300.1"
FT   gene            complement(<303114..>304208)
FT                   /locus_tag="AGOS_AFL071C"
FT                   /old_locus_tag="AFL071C"
FT   mRNA            complement(<303114..>304208)
FT                   /locus_tag="AGOS_AFL071C"
FT                   /old_locus_tag="AFL071C"
FT                   /product="AFL071Cp"
FT   CDS_pept        complement(303114..304208)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL071C"
FT                   /old_locus_tag="AFL071C"
FT                   /product="AFL071Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL082W
FT                   and YPL191C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL071C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53301"
FT                   /db_xref="GOA:Q754Y2"
FT                   /db_xref="InterPro:IPR007518"
FT                   /db_xref="InterPro:IPR033979"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y2"
FT                   /protein_id="AAS53301.2"
FT   gene            complement(<304701..>306974)
FT                   /locus_tag="AGOS_AFL070C"
FT                   /old_locus_tag="AFL070C"
FT   mRNA            complement(<304701..>306974)
FT                   /locus_tag="AGOS_AFL070C"
FT                   /old_locus_tag="AFL070C"
FT                   /product="AFL070Cp"
FT   CDS_pept        complement(304701..306974)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL070C"
FT                   /old_locus_tag="AFL070C"
FT                   /product="AFL070Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL190C
FT                   (NAB3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL070C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53302"
FT                   /db_xref="GOA:Q754Y1"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR034167"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="InterPro:IPR036621"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y1"
FT                   /protein_id="AAS53302.1"
FT                   QLQK"
FT   gene            complement(<307397..>307573)
FT                   /locus_tag="AGOS_AFL069C"
FT                   /old_locus_tag="AFL069C"
FT   mRNA            complement(<307397..>307573)
FT                   /locus_tag="AGOS_AFL069C"
FT                   /old_locus_tag="AFL069C"
FT                   /product="AFL069Cp"
FT   CDS_pept        complement(307397..307573)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL069C"
FT                   /old_locus_tag="AFL069C"
FT                   /product="AFL069Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL189C-A (COA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL069C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53303"
FT                   /db_xref="GOA:Q754Y0"
FT                   /db_xref="InterPro:IPR031459"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y0"
FT                   /protein_id="AAS53303.1"
FT                   VRERNEGARAAQE"
FT   gene            complement(<307843..>310185)
FT                   /locus_tag="AGOS_AFL068C"
FT                   /old_locus_tag="AFL068C"
FT   mRNA            complement(<307843..>310185)
FT                   /locus_tag="AGOS_AFL068C"
FT                   /old_locus_tag="AFL068C"
FT                   /product="AFL068Cp"
FT   CDS_pept        complement(307843..310185)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL068C"
FT                   /old_locus_tag="AFL068C"
FT                   /product="AFL068Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL083W
FT                   (SCY1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL068C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53304"
FT                   /db_xref="GOA:Q754Z4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Z4"
FT                   /protein_id="AAS53304.1"
FT   gene            complement(310402..310472)
FT                   /locus_tag="AGOS_t0131"
FT   tRNA            complement(310402..310472)
FT                   /locus_tag="AGOS_t0131"
FT                   /product="tRNA-Gly"
FT                   /note="codon recognized: GGC"
FT   gene            <310646..>312382
FT                   /locus_tag="AGOS_AFL067W"
FT                   /old_locus_tag="AFL067W"
FT   mRNA            <310646..>312382
FT                   /locus_tag="AGOS_AFL067W"
FT                   /old_locus_tag="AFL067W"
FT                   /product="AFL067Wp"
FT   CDS_pept        310646..312382
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL067W"
FT                   /old_locus_tag="AFL067W"
FT                   /product="AFL067Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL084C
FT                   (GUP1) and YPL189W (GUP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL067W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53305"
FT                   /db_xref="GOA:Q754Z3"
FT                   /db_xref="InterPro:IPR004299"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Z3"
FT                   /protein_id="AAS53305.2"
FT                   KC"
FT   gene            complement(<312428..>313258)
FT                   /locus_tag="AGOS_AFL066C"
FT                   /old_locus_tag="AFL066C"
FT   mRNA            complement(<312428..>313258)
FT                   /locus_tag="AGOS_AFL066C"
FT                   /old_locus_tag="AFL066C"
FT                   /product="AFL066Cp"
FT   CDS_pept        complement(312428..313258)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL066C"
FT                   /old_locus_tag="AFL066C"
FT                   /product="AFL066Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL085W
FT                   (LCL3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL066C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53306"
FT                   /db_xref="GOA:Q754Z2"
FT                   /db_xref="InterPro:IPR016071"
FT                   /db_xref="InterPro:IPR035437"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754Z2"
FT                   /protein_id="AAS53306.1"
FT   gene            complement(<313433..>315412)
FT                   /locus_tag="AGOS_AFL065C"
FT                   /old_locus_tag="AFL065C"
FT   mRNA            complement(<313433..>315412)
FT                   /locus_tag="AGOS_AFL065C"
FT                   /old_locus_tag="AFL065C"
FT                   /product="AFL065Cp"
FT   CDS_pept        complement(313433..315412)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL065C"
FT                   /old_locus_tag="AFL065C"
FT                   /product="AFL065Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL086W
FT                   (MAD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL065C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53307"
FT                   /db_xref="GOA:Q754Z1"
FT                   /db_xref="InterPro:IPR008672"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754Z1"
FT                   /protein_id="AAS53307.2"
FT   gene            <315643..>316111
FT                   /locus_tag="AGOS_AFL064W"
FT                   /old_locus_tag="AFL064W"
FT   mRNA            join(<315643..315653,315706..>316111)
FT                   /locus_tag="AGOS_AFL064W"
FT                   /old_locus_tag="AFL064W"
FT                   /product="AFL064Wp"
FT   CDS_pept        join(315643..315653,315706..316111)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL064W"
FT                   /old_locus_tag="AFL064W"
FT                   /product="AFL064Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL087C
FT                   (MMS2); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL064W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53308"
FT                   /db_xref="GOA:Q754Z0"
FT                   /db_xref="InterPro:IPR000608"
FT                   /db_xref="InterPro:IPR016135"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Z0"
FT                   /protein_id="AAS53308.1"
FT   gene            <316245..>317396
FT                   /locus_tag="AGOS_AFL063W"
FT                   /old_locus_tag="AFL063W"
FT   mRNA            <316245..>317396
FT                   /locus_tag="AGOS_AFL063W"
FT                   /old_locus_tag="AFL063W"
FT                   /product="AFL063Wp"
FT   CDS_pept        316245..317396
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL063W"
FT                   /old_locus_tag="AFL063W"
FT                   /product="AFL063Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL188W
FT                   (POS5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL063W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53309"
FT                   /db_xref="GOA:Q754X9"
FT                   /db_xref="InterPro:IPR002504"
FT                   /db_xref="InterPro:IPR016064"
FT                   /db_xref="InterPro:IPR017437"
FT                   /db_xref="UniProtKB/TrEMBL:Q754X9"
FT                   /protein_id="AAS53309.1"
FT   gene            complement(317424..317647)
FT                   /locus_tag="AGOS_AgSNR10"
FT                   /old_locus_tag="AgSNR10"
FT   ncRNA           complement(317424..317647)
FT                   /locus_tag="AGOS_AgSNR10"
FT                   /old_locus_tag="AgSNR10"
FT                   /product="AgSNR10"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR10; start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <318116..>318463
FT                   /locus_tag="AGOS_AFL062W"
FT                   /old_locus_tag="AFL062W"
FT   mRNA            <318116..>318463
FT                   /locus_tag="AGOS_AFL062W"
FT                   /old_locus_tag="AFL062W"
FT                   /product="AFL062Wp"
FT   CDS_pept        318116..318463
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL062W"
FT                   /old_locus_tag="AFL062W"
FT                   /product="AFL062Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL187W
FT                   (MF(ALPHA)1) and YGL089C (MF(ALPHA)2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL062W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53310"
FT                   /db_xref="GOA:Q754X8"
FT                   /db_xref="InterPro:IPR008675"
FT                   /db_xref="UniProtKB/TrEMBL:Q754X8"
FT                   /protein_id="AAS53310.1"
FT                   GHRRIFPAIDL"
FT   gene            complement(<318880..>320529)
FT                   /locus_tag="AGOS_AFL061C"
FT                   /old_locus_tag="AFL061C"
FT   mRNA            complement(<318880..>320529)
FT                   /locus_tag="AGOS_AFL061C"
FT                   /old_locus_tag="AFL061C"
FT                   /product="AFL061Cp"
FT   CDS_pept        complement(318880..320529)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL061C"
FT                   /old_locus_tag="AFL061C"
FT                   /product="AFL061Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL184C
FT                   (MRN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL061C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53311"
FT                   /db_xref="GOA:Q754X7"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="InterPro:IPR039171"
FT                   /db_xref="UniProtKB/TrEMBL:Q754X7"
FT                   /protein_id="AAS53311.2"
FT   gene            <321263..>322852
FT                   /locus_tag="AGOS_AFL060W"
FT                   /old_locus_tag="AFL060W"
FT   mRNA            <321263..>322852
FT                   /locus_tag="AGOS_AFL060W"
FT                   /old_locus_tag="AFL060W"
FT                   /product="AFL060Wp"
FT   CDS_pept        321263..322852
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL060W"
FT                   /old_locus_tag="AFL060W"
FT                   /product="AFL060Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL091C
FT                   (NBP35)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL060W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53312"
FT                   /db_xref="GOA:Q754X6"
FT                   /db_xref="InterPro:IPR000808"
FT                   /db_xref="InterPro:IPR019591"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR028601"
FT                   /db_xref="InterPro:IPR033756"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754X6"
FT                   /protein_id="AAS53312.2"
FT                   VVEALRDAVGDV"
FT   gene            complement(<322932..>326888)
FT                   /locus_tag="AGOS_AFL059C"
FT                   /old_locus_tag="AFL059C"
FT   mRNA            complement(<322932..>326888)
FT                   /locus_tag="AGOS_AFL059C"
FT                   /old_locus_tag="AFL059C"
FT                   /product="AFL059Cp"
FT   CDS_pept        complement(322932..326888)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL059C"
FT                   /old_locus_tag="AFL059C"
FT                   /product="AFL059Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL092W
FT                   (NUP145)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL059C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53313"
FT                   /db_xref="GOA:Q754X5"
FT                   /db_xref="InterPro:IPR007230"
FT                   /db_xref="InterPro:IPR021967"
FT                   /db_xref="InterPro:IPR025574"
FT                   /db_xref="InterPro:IPR036903"
FT                   /db_xref="InterPro:IPR037665"
FT                   /db_xref="InterPro:IPR037672"
FT                   /db_xref="UniProtKB/TrEMBL:Q754X5"
FT                   /protein_id="AAS53313.1"
FT   gene            complement(<327354..>330044)
FT                   /locus_tag="AGOS_AFL058C"
FT                   /old_locus_tag="AFL058C"
FT   mRNA            complement(<327354..>330044)
FT                   /locus_tag="AGOS_AFL058C"
FT                   /old_locus_tag="AFL058C"
FT                   /product="AFL058Cp"
FT   CDS_pept        complement(327354..330044)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL058C"
FT                   /old_locus_tag="AFL058C"
FT                   /product="AFL058Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL093W
FT                   (SPC105)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL058C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53314"
FT                   /db_xref="GOA:Q754X4"
FT                   /db_xref="InterPro:IPR013253"
FT                   /db_xref="InterPro:IPR033338"
FT                   /db_xref="UniProtKB/TrEMBL:Q754X4"
FT                   /protein_id="AAS53314.1"
FT   gene            <330294..>330536
FT                   /locus_tag="AGOS_AFL057W"
FT                   /old_locus_tag="AFL057W"
FT   mRNA            <330294..>330536
FT                   /locus_tag="AGOS_AFL057W"
FT                   /old_locus_tag="AFL057W"
FT                   /product="AFL057Wp"
FT   CDS_pept        330294..330536
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL057W"
FT                   /old_locus_tag="AFL057W"
FT                   /product="AFL057Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL183W-A (RTC6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL057W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53315"
FT                   /db_xref="GOA:Q754X3"
FT                   /db_xref="InterPro:IPR000473"
FT                   /db_xref="InterPro:IPR035977"
FT                   /db_xref="UniProtKB/TrEMBL:Q754X3"
FT                   /protein_id="AAS53315.1"
FT   gene            complement(<330647..>333577)
FT                   /locus_tag="AGOS_AFL056C"
FT                   /old_locus_tag="AFL056C"
FT   mRNA            complement(<330647..>333577)
FT                   /locus_tag="AGOS_AFL056C"
FT                   /old_locus_tag="AFL056C"
FT                   /product="AFL056Cp"
FT   CDS_pept        complement(330647..333577)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL056C"
FT                   /old_locus_tag="AFL056C"
FT                   /product="AFL056Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL183C
FT                   (RTT10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL056C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53316"
FT                   /db_xref="GOA:Q754X2"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR011044"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q754X2"
FT                   /protein_id="AAS53316.1"
FT   gene            <333836..>337324
FT                   /locus_tag="AGOS_AFL055W"
FT                   /old_locus_tag="AFL055W"
FT   mRNA            <333836..>337324
FT                   /locus_tag="AGOS_AFL055W"
FT                   /old_locus_tag="AFL055W"
FT                   /product="AFL055Wp"
FT   CDS_pept        333836..337324
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL055W"
FT                   /old_locus_tag="AFL055W"
FT                   /product="AFL055Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL094C
FT                   (PAN2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL055W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53317"
FT                   /db_xref="GOA:Q754X1"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR013520"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR028881"
FT                   /db_xref="InterPro:IPR028889"
FT                   /db_xref="InterPro:IPR030843"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR036397"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754X1"
FT                   /protein_id="AAS53317.2"
FT   gene            complement(<337610..>339664)
FT                   /locus_tag="AGOS_AFL054C"
FT                   /old_locus_tag="AFL054C"
FT   mRNA            complement(<337610..>339664)
FT                   /locus_tag="AGOS_AFL054C"
FT                   /old_locus_tag="AFL054C"
FT                   /product="AFL054Cp"
FT   CDS_pept        complement(337610..339664)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL054C"
FT                   /old_locus_tag="AFL054C"
FT                   /product="AFL054Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL180W
FT                   (TCO89)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL054C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53318"
FT                   /db_xref="GOA:Q754X0"
FT                   /db_xref="InterPro:IPR018857"
FT                   /db_xref="UniProtKB/TrEMBL:Q754X0"
FT                   /protein_id="AAS53318.2"
FT   gene            <340067..>341812
FT                   /locus_tag="AGOS_AFL053W"
FT                   /old_locus_tag="AFL053W"
FT   mRNA            <340067..>341812
FT                   /locus_tag="AGOS_AFL053W"
FT                   /old_locus_tag="AFL053W"
FT                   /product="AFL053Wp"
FT   CDS_pept        340067..341812
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL053W"
FT                   /old_locus_tag="AFL053W"
FT                   /product="AFL053Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL095C
FT                   (VPS45)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL053W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53319"
FT                   /db_xref="GOA:Q754W9"
FT                   /db_xref="InterPro:IPR001619"
FT                   /db_xref="InterPro:IPR027482"
FT                   /db_xref="InterPro:IPR036045"
FT                   /db_xref="UniProtKB/TrEMBL:Q754W9"
FT                   /protein_id="AAS53319.2"
FT                   LGDLL"
FT   gene            complement(<341883..>343238)
FT                   /locus_tag="AGOS_AFL052C"
FT                   /old_locus_tag="AFL052C"
FT   mRNA            complement(<341883..>343238)
FT                   /locus_tag="AGOS_AFL052C"
FT                   /old_locus_tag="AFL052C"
FT                   /product="AFL052Cp"
FT   CDS_pept        complement(341883..343238)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL052C"
FT                   /old_locus_tag="AFL052C"
FT                   /product="AFL052Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL181W
FT                   (CTI6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL052C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53320"
FT                   /db_xref="GOA:Q754Z7"
FT                   /db_xref="InterPro:IPR001965"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR019786"
FT                   /db_xref="InterPro:IPR019787"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Z7"
FT                   /protein_id="AAS53320.1"
FT   gene            <344000..>345607
FT                   /locus_tag="AGOS_AFL051W"
FT                   /old_locus_tag="AFL051W"
FT   mRNA            <344000..>345607
FT                   /locus_tag="AGOS_AFL051W"
FT                   /old_locus_tag="AFL051W"
FT                   /product="AFL051Wp"
FT   CDS_pept        344000..345607
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL051W"
FT                   /old_locus_tag="AFL051W"
FT                   /product="AFL051Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL179W
FT                   (PPQ1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL051W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53321"
FT                   /db_xref="GOA:Q754W8"
FT                   /db_xref="InterPro:IPR004843"
FT                   /db_xref="InterPro:IPR006186"
FT                   /db_xref="InterPro:IPR011159"
FT                   /db_xref="InterPro:IPR029052"
FT                   /db_xref="InterPro:IPR031675"
FT                   /db_xref="UniProtKB/TrEMBL:Q754W8"
FT                   /protein_id="AAS53321.1"
FT                   MCSFELLKPHGLKDTRRK"
FT   gene            complement(345945..346016)
FT                   /locus_tag="AGOS_t0132"
FT   tRNA            complement(345945..346016)
FT                   /locus_tag="AGOS_t0132"
FT                   /product="tRNA-Glu"
FT                   /note="codon recognized: GAG"
FT   gene            <347055..>347711
FT                   /locus_tag="AGOS_AFL050W"
FT                   /old_locus_tag="AFL050W"
FT   mRNA            <347055..>347711
FT                   /locus_tag="AGOS_AFL050W"
FT                   /old_locus_tag="AFL050W"
FT                   /product="AFL050Wp"
FT   CDS_pept        347055..347711
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL050W"
FT                   /old_locus_tag="AFL050W"
FT                   /product="AFL050Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL178W
FT                   (CBC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL050W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53322"
FT                   /db_xref="GOA:Q754W7"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR027157"
FT                   /db_xref="InterPro:IPR034148"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754W7"
FT                   /protein_id="AAS53322.1"
FT   gene            complement(<347977..>348750)
FT                   /locus_tag="AGOS_AFL049C"
FT                   /old_locus_tag="AFL049C"
FT   mRNA            complement(<347977..>348750)
FT                   /locus_tag="AGOS_AFL049C"
FT                   /old_locus_tag="AFL049C"
FT                   /product="AFL049Cp"
FT   CDS_pept        complement(347977..348750)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL049C"
FT                   /old_locus_tag="AFL049C"
FT                   /product="AFL049Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL177C
FT                   (CUP9) and YGL096W (TOS8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL049C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53323"
FT                   /db_xref="GOA:Q754W6"
FT                   /db_xref="InterPro:IPR001356"
FT                   /db_xref="InterPro:IPR008422"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="UniProtKB/TrEMBL:Q754W6"
FT                   /protein_id="AAS53323.1"
FT   gene            <350866..>352353
FT                   /locus_tag="AGOS_AFL048W"
FT                   /old_locus_tag="AFL048W"
FT   mRNA            <350866..>352353
FT                   /locus_tag="AGOS_AFL048W"
FT                   /old_locus_tag="AFL048W"
FT                   /product="AFL048Wp"
FT   CDS_pept        350866..352353
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL048W"
FT                   /old_locus_tag="AFL048W"
FT                   /product="AFL048Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR250W
FT                   (SPO23)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL048W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53324"
FT                   /db_xref="InterPro:IPR014752"
FT                   /db_xref="UniProtKB/TrEMBL:Q754W5"
FT                   /protein_id="AAS53324.2"
FT   gene            <353030..>354124
FT                   /locus_tag="AGOS_AFL047W"
FT                   /old_locus_tag="AFL047W"
FT   mRNA            <353030..>354124
FT                   /locus_tag="AGOS_AFL047W"
FT                   /old_locus_tag="AFL047W"
FT                   /product="AFL047Wp"
FT   CDS_pept        353030..354124
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL047W"
FT                   /old_locus_tag="AFL047W"
FT                   /product="AFL047Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR249C
FT                   (ARO4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL047W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53325"
FT                   /db_xref="GOA:Q754W4"
FT                   /db_xref="InterPro:IPR006218"
FT                   /db_xref="InterPro:IPR006219"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="UniProtKB/TrEMBL:Q754W4"
FT                   /protein_id="AAS53325.1"
FT   gene            <354394..>356043
FT                   /locus_tag="AGOS_AFL046W"
FT                   /old_locus_tag="AFL046W"
FT   mRNA            <354394..>356043
FT                   /locus_tag="AGOS_AFL046W"
FT                   /old_locus_tag="AFL046W"
FT                   /product="AFL046Wp"
FT   CDS_pept        354394..356043
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL046W"
FT                   /old_locus_tag="AFL046W"
FT                   /product="AFL046Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR248C
FT                   (HIS7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL046W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53326"
FT                   /db_xref="GOA:Q754W3"
FT                   /db_xref="InterPro:IPR004651"
FT                   /db_xref="InterPro:IPR006062"
FT                   /db_xref="InterPro:IPR010139"
FT                   /db_xref="InterPro:IPR011060"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR014640"
FT                   /db_xref="InterPro:IPR017926"
FT                   /db_xref="InterPro:IPR029062"
FT                   /db_xref="UniProtKB/TrEMBL:Q754W3"
FT                   /protein_id="AAS53326.1"
FT   gene            complement(<356222..>357682)
FT                   /locus_tag="AGOS_AFL045C"
FT                   /old_locus_tag="AFL045C"
FT   mRNA            complement(<356222..>357682)
FT                   /locus_tag="AGOS_AFL045C"
FT                   /old_locus_tag="AFL045C"
FT                   /product="AFL045Cp"
FT   CDS_pept        complement(356222..357682)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL045C"
FT                   /old_locus_tag="AFL045C"
FT                   /product="AFL045Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL097W
FT                   (SRM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL045C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53327"
FT                   /db_xref="GOA:Q754W2"
FT                   /db_xref="InterPro:IPR000408"
FT                   /db_xref="InterPro:IPR009091"
FT                   /db_xref="UniProtKB/TrEMBL:Q754W2"
FT                   /protein_id="AAS53327.1"
FT   gene            <358144..>359520
FT                   /locus_tag="AGOS_AFL044W"
FT                   /old_locus_tag="AFL044W"
FT   mRNA            <358144..>359520
FT                   /locus_tag="AGOS_AFL044W"
FT                   /old_locus_tag="AFL044W"
FT                   /product="AFL044Wp"
FT   CDS_pept        358144..359520
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL044W"
FT                   /old_locus_tag="AFL044W"
FT                   /product="AFL044Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR247C
FT                   (ENP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL044W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53328"
FT                   /db_xref="GOA:Q754W1"
FT                   /db_xref="InterPro:IPR007955"
FT                   /db_xref="UniProtKB/TrEMBL:Q754W1"
FT                   /protein_id="AAS53328.2"
FT                   "
FT   gene            complement(<359619..>360383)
FT                   /locus_tag="AGOS_AFL043C"
FT                   /old_locus_tag="AFL043C"
FT   mRNA            complement(<359619..>360383)
FT                   /locus_tag="AGOS_AFL043C"
FT                   /old_locus_tag="AFL043C"
FT                   /product="AFL043Cp"
FT   CDS_pept        complement(359619..360383)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL043C"
FT                   /old_locus_tag="AFL043C"
FT                   /product="AFL043Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL098W
FT                   (USE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL043C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53329"
FT                   /db_xref="GOA:Q754W0"
FT                   /db_xref="InterPro:IPR019150"
FT                   /db_xref="UniProtKB/TrEMBL:Q754W0"
FT                   /protein_id="AAS53329.2"
FT   gene            complement(360613..361005)
FT                   /locus_tag="AGOS_AgSNR82"
FT                   /old_locus_tag="AgSNR82"
FT   ncRNA           complement(360613..361005)
FT                   /locus_tag="AGOS_AgSNR82"
FT                   /old_locus_tag="AgSNR82"
FT                   /product="AgSNR82"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR82 (RUF2); start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<361030..>362955)
FT                   /locus_tag="AGOS_AFL042C"
FT                   /old_locus_tag="AFL042C"
FT   mRNA            complement(<361030..>362955)
FT                   /locus_tag="AGOS_AFL042C"
FT                   /old_locus_tag="AFL042C"
FT                   /product="AFL042Cp"
FT   CDS_pept        complement(361030..362955)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL042C"
FT                   /old_locus_tag="AFL042C"
FT                   /product="AFL042Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL099W
FT                   (LSG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL042C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53330"
FT                   /db_xref="GOA:Q754V9"
FT                   /db_xref="InterPro:IPR006073"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR030378"
FT                   /db_xref="UniProtKB/TrEMBL:Q754V9"
FT                   /protein_id="AAS53330.2"
FT                   AAMFSD"
FT   gene            complement(<363155..>364264)
FT                   /locus_tag="AGOS_AFL041C"
FT                   /old_locus_tag="AFL041C"
FT   mRNA            complement(<363155..>364264)
FT                   /locus_tag="AGOS_AFL041C"
FT                   /old_locus_tag="AFL041C"
FT                   /product="AFL041Cp"
FT   CDS_pept        complement(363155..364264)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL041C"
FT                   /old_locus_tag="AFL041C"
FT                   /product="AFL041Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR246W
FT                   (RRT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL041C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53331"
FT                   /db_xref="GOA:Q754V8"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q754V8"
FT                   /protein_id="AAS53331.1"
FT   gene            <364593..>367853
FT                   /locus_tag="AGOS_AFL040W"
FT                   /old_locus_tag="AFL040W"
FT   mRNA            <364593..>367853
FT                   /locus_tag="AGOS_AFL040W"
FT                   /old_locus_tag="AFL040W"
FT                   /product="AFL040Wp"
FT   CDS_pept        364593..367853
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL040W"
FT                   /old_locus_tag="AFL040W"
FT                   /product="AFL040Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR245C
FT                   (ISW1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL040W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53332"
FT                   /db_xref="GOA:Q754V7"
FT                   /db_xref="InterPro:IPR000330"
FT                   /db_xref="InterPro:IPR001005"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR015194"
FT                   /db_xref="InterPro:IPR015195"
FT                   /db_xref="InterPro:IPR017884"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036306"
FT                   /db_xref="InterPro:IPR038718"
FT                   /db_xref="UniProtKB/TrEMBL:Q754V7"
FT                   /protein_id="AAS53332.1"
FT   gene            complement(<368010..>368657)
FT                   /locus_tag="AGOS_AFL039C"
FT                   /old_locus_tag="AFL039C"
FT   mRNA            complement(<368010..>368657)
FT                   /locus_tag="AGOS_AFL039C"
FT                   /old_locus_tag="AFL039C"
FT                   /product="AFL039Cp"
FT   CDS_pept        complement(368010..368657)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL039C"
FT                   /old_locus_tag="AFL039C"
FT                   /product="AFL039Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIR037W (HYR1) and Syntenic homolog of Saccharomyces
FT                   cerevisiae YBR244W (GPX2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL039C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53333"
FT                   /db_xref="GOA:Q754Y9"
FT                   /db_xref="InterPro:IPR000889"
FT                   /db_xref="InterPro:IPR029759"
FT                   /db_xref="InterPro:IPR029760"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y9"
FT                   /protein_id="AAS53333.1"
FT   gene            complement(<369012..>370004)
FT                   /locus_tag="AGOS_AFL038C"
FT                   /old_locus_tag="AFL038C"
FT   mRNA            complement(<369012..>370004)
FT                   /locus_tag="AGOS_AFL038C"
FT                   /old_locus_tag="AFL038C"
FT                   /product="AFL038Cp"
FT   CDS_pept        complement(369012..370004)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL038C"
FT                   /old_locus_tag="AFL038C"
FT                   /product="AFL038Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL100W
FT                   (SEH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL038C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53334"
FT                   /db_xref="GOA:Q754Y8"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR037363"
FT                   /db_xref="InterPro:IPR037597"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y8"
FT                   /protein_id="AAS53334.1"
FT   gene            <370180..>371544
FT                   /locus_tag="AGOS_AFL037W"
FT                   /old_locus_tag="AFL037W"
FT   mRNA            <370180..>371544
FT                   /locus_tag="AGOS_AFL037W"
FT                   /old_locus_tag="AFL037W"
FT                   /product="AFL037Wp"
FT   CDS_pept        370180..371544
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL037W"
FT                   /old_locus_tag="AFL037W"
FT                   /product="AFL037Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR243C
FT                   (ALG7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL037W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53335"
FT                   /db_xref="GOA:Q754Z6"
FT                   /db_xref="InterPro:IPR000715"
FT                   /db_xref="InterPro:IPR033895"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Z6"
FT                   /protein_id="AAS53335.1"
FT   gene            complement(<371575..>372216)
FT                   /locus_tag="AGOS_AFL036C"
FT                   /old_locus_tag="AFL036C"
FT   mRNA            complement(<371575..>372216)
FT                   /locus_tag="AGOS_AFL036C"
FT                   /old_locus_tag="AFL036C"
FT                   /product="AFL036Cp"
FT   CDS_pept        complement(371575..372216)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL036C"
FT                   /old_locus_tag="AFL036C"
FT                   /product="AFL036Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL101W
FT                   and YBR242W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL036C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53336"
FT                   /db_xref="GOA:Q754Z5"
FT                   /db_xref="InterPro:IPR003607"
FT                   /db_xref="InterPro:IPR006674"
FT                   /db_xref="InterPro:IPR039356"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Z5"
FT                   /protein_id="AAS53336.2"
FT   gene            complement(<372377..>373031)
FT                   /locus_tag="AGOS_AFL035C"
FT                   /old_locus_tag="AFL035C"
FT   mRNA            complement(join(<372377..372777,372983..>373031))
FT                   /locus_tag="AGOS_AFL035C"
FT                   /old_locus_tag="AFL035C"
FT                   /product="AFL035Cp"
FT   CDS_pept        complement(join(372377..372777,372983..373031))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL035C"
FT                   /old_locus_tag="AFL035C"
FT                   /product="AFL035Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL103W
FT                   (RPL28); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL035C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53337"
FT                   /db_xref="GOA:Q754V6"
FT                   /db_xref="InterPro:IPR001196"
FT                   /db_xref="InterPro:IPR021131"
FT                   /db_xref="InterPro:IPR030878"
FT                   /db_xref="InterPro:IPR036227"
FT                   /db_xref="UniProtKB/TrEMBL:Q754V6"
FT                   /protein_id="AAS53337.1"
FT   gene            <373258..>374682
FT                   /locus_tag="AGOS_AFL034W"
FT                   /old_locus_tag="AFL034W"
FT   mRNA            <373258..>374682
FT                   /locus_tag="AGOS_AFL034W"
FT                   /old_locus_tag="AFL034W"
FT                   /product="AFL034Wp"
FT   CDS_pept        373258..374682
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL034W"
FT                   /old_locus_tag="AFL034W"
FT                   /product="AFL034Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR241C
FT                   and YGL104C (VPS73)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL034W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53338"
FT                   /db_xref="GOA:Q754V5"
FT                   /db_xref="InterPro:IPR003663"
FT                   /db_xref="InterPro:IPR005828"
FT                   /db_xref="InterPro:IPR005829"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q754V5"
FT                   /protein_id="AAS53338.2"
FT                   PETRGKHDYREVWQGF"
FT   gene            <374916..>376064
FT                   /locus_tag="AGOS_AFL033W"
FT                   /old_locus_tag="AFL033W"
FT   mRNA            <374916..>376064
FT                   /locus_tag="AGOS_AFL033W"
FT                   /old_locus_tag="AFL033W"
FT                   /product="AFL033Wp"
FT   CDS_pept        374916..376064
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL033W"
FT                   /old_locus_tag="AFL033W"
FT                   /product="AFL033Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR240C
FT                   (THI2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL033W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53339"
FT                   /db_xref="GOA:Q754V4"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q754V4"
FT                   /protein_id="AAS53339.1"
FT   gene            complement(<376057..>377172)
FT                   /locus_tag="AGOS_AFL032C"
FT                   /old_locus_tag="AFL032C"
FT   mRNA            complement(<376057..>377172)
FT                   /locus_tag="AGOS_AFL032C"
FT                   /old_locus_tag="AFL032C"
FT                   /product="AFL032Cp"
FT   CDS_pept        complement(376057..377172)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL032C"
FT                   /old_locus_tag="AFL032C"
FT                   /product="AFL032Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL105W
FT                   (ARC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL032C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53340"
FT                   /db_xref="GOA:Q754V3"
FT                   /db_xref="InterPro:IPR002547"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR036282"
FT                   /db_xref="UniProtKB/TrEMBL:Q754V3"
FT                   /protein_id="AAS53340.1"
FT   gene            <377592..>379145
FT                   /locus_tag="AGOS_AFL031W"
FT                   /old_locus_tag="AFL031W"
FT   mRNA            <377592..>379145
FT                   /locus_tag="AGOS_AFL031W"
FT                   /old_locus_tag="AFL031W"
FT                   /product="AFL031Wp"
FT   CDS_pept        377592..379145
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL031W"
FT                   /old_locus_tag="AFL031W"
FT                   /product="AFL031Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR239C
FT                   (ERT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL031W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53341"
FT                   /db_xref="GOA:Q754V2"
FT                   /db_xref="InterPro:IPR000014"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR013767"
FT                   /db_xref="InterPro:IPR035965"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754V2"
FT                   /protein_id="AAS53341.2"
FT                   "
FT   gene            complement(<379246..>379674)
FT                   /locus_tag="AGOS_AFL030C"
FT                   /old_locus_tag="AFL030C"
FT   mRNA            complement(<379246..>379674)
FT                   /locus_tag="AGOS_AFL030C"
FT                   /old_locus_tag="AFL030C"
FT                   /product="AFL030Cp"
FT   CDS_pept        complement(379246..379674)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL030C"
FT                   /old_locus_tag="AFL030C"
FT                   /product="AFL030Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL106W
FT                   (MLC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL030C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53342"
FT                   /db_xref="GOA:Q754V1"
FT                   /db_xref="InterPro:IPR002048"
FT                   /db_xref="InterPro:IPR011992"
FT                   /db_xref="UniProtKB/TrEMBL:Q754V1"
FT                   /protein_id="AAS53342.1"
FT   gene            <384489..>386492
FT                   /locus_tag="AGOS_AFL029W"
FT                   /old_locus_tag="AFL029W"
FT   mRNA            <384489..>386492
FT                   /locus_tag="AGOS_AFL029W"
FT                   /old_locus_tag="AFL029W"
FT                   /product="AFL029Wp"
FT   CDS_pept        384489..386492
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL029W"
FT                   /old_locus_tag="AFL029W"
FT                   /product="AFL029Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR238C
FT                   and YGL107C (RMD9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL029W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53343"
FT                   /db_xref="GOA:Q754V0"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754V0"
FT                   /protein_id="AAS53343.1"
FT   gene            <386889..>387323
FT                   /locus_tag="AGOS_AFL028W"
FT                   /old_locus_tag="AFL028W"
FT   mRNA            <386889..>387323
FT                   /locus_tag="AGOS_AFL028W"
FT                   /old_locus_tag="AFL028W"
FT                   /product="AFL028Wp"
FT   CDS_pept        386889..387323
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL028W"
FT                   /old_locus_tag="AFL028W"
FT                   /product="AFL028Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGL108C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL028W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53344"
FT                   /db_xref="UniProtKB/TrEMBL:Q754U9"
FT                   /protein_id="AAS53344.2"
FT   gene            complement(<387429..>389996)
FT                   /locus_tag="AGOS_AFL027C"
FT                   /old_locus_tag="AFL027C"
FT   mRNA            complement(<387429..>389996)
FT                   /locus_tag="AGOS_AFL027C"
FT                   /old_locus_tag="AFL027C"
FT                   /product="AFL027Cp"
FT   CDS_pept        complement(387429..389996)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL027C"
FT                   /old_locus_tag="AFL027C"
FT                   /product="AFL027Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR237W
FT                   (PRP5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL027C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53345"
FT                   /db_xref="GOA:Q754U8"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754U8"
FT                   /protein_id="AAS53345.2"
FT   gene            <390191..>391483
FT                   /locus_tag="AGOS_AFL026W"
FT                   /old_locus_tag="AFL026W"
FT   mRNA            <390191..>391483
FT                   /locus_tag="AGOS_AFL026W"
FT                   /old_locus_tag="AFL026W"
FT                   /product="AFL026Wp"
FT   CDS_pept        390191..391483
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL026W"
FT                   /old_locus_tag="AFL026W"
FT                   /product="AFL026Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR236C
FT                   (ABD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL026W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53346"
FT                   /db_xref="GOA:Q754U7"
FT                   /db_xref="InterPro:IPR004971"
FT                   /db_xref="InterPro:IPR016899"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="InterPro:IPR039753"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754U7"
FT                   /protein_id="AAS53346.1"
FT   gene            complement(<391581..>394901)
FT                   /locus_tag="AGOS_AFL025C"
FT                   /old_locus_tag="AFL025C"
FT   mRNA            complement(<391581..>394901)
FT                   /locus_tag="AGOS_AFL025C"
FT                   /old_locus_tag="AFL025C"
FT                   /product="AFL025Cp"
FT   CDS_pept        complement(391581..394901)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL025C"
FT                   /old_locus_tag="AFL025C"
FT                   /product="AFL025Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBR235W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL025C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53347"
FT                   /db_xref="GOA:Q754U6"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="InterPro:IPR018491"
FT                   /db_xref="UniProtKB/TrEMBL:Q754U6"
FT                   /protein_id="AAS53347.1"
FT   gene            <395358..>397154
FT                   /locus_tag="AGOS_AFL024W"
FT                   /old_locus_tag="AFL024W"
FT   mRNA            <395358..>397154
FT                   /locus_tag="AGOS_AFL024W"
FT                   /old_locus_tag="AFL024W"
FT                   /product="AFL024Wp"
FT   CDS_pept        395358..397154
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL024W"
FT                   /old_locus_tag="AFL024W"
FT                   /product="AFL024Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL110C
FT                   (CUE3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL024W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53348"
FT                   /db_xref="GOA:Q754U5"
FT                   /db_xref="InterPro:IPR003892"
FT                   /db_xref="InterPro:IPR041808"
FT                   /db_xref="UniProtKB/TrEMBL:Q754U5"
FT                   /protein_id="AAS53348.1"
FT   gene            complement(<397232..>398539)
FT                   /locus_tag="AGOS_AFL023C"
FT                   /old_locus_tag="AFL023C"
FT   mRNA            complement(<397232..>398539)
FT                   /locus_tag="AGOS_AFL023C"
FT                   /old_locus_tag="AFL023C"
FT                   /product="AFL023Cp"
FT   CDS_pept        complement(397232..398539)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL023C"
FT                   /old_locus_tag="AFL023C"
FT                   /product="AFL023Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL111W
FT                   (NSA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL023C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53349"
FT                   /db_xref="GOA:Q754U4"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR037379"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754U4"
FT                   /protein_id="AAS53349.1"
FT   gene            <398785..>399900
FT                   /locus_tag="AGOS_AFL022W"
FT                   /old_locus_tag="AFL022W"
FT   mRNA            <398785..>399900
FT                   /locus_tag="AGOS_AFL022W"
FT                   /old_locus_tag="AFL022W"
FT                   /product="AFL022Wp"
FT   CDS_pept        398785..399900
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL022W"
FT                   /old_locus_tag="AFL022W"
FT                   /product="AFL022Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR234C
FT                   (ARC40)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL022W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53350"
FT                   /db_xref="GOA:Q754U3"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017383"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q754U3"
FT                   /protein_id="AAS53350.1"
FT   gene            complement(<399936..>400193)
FT                   /locus_tag="AGOS_AFL021C"
FT                   /old_locus_tag="AFL021C"
FT   mRNA            complement(<399936..>400193)
FT                   /locus_tag="AGOS_AFL021C"
FT                   /old_locus_tag="AFL021C"
FT                   /product="AFL021Cp"
FT   CDS_pept        complement(399936..400193)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL021C"
FT                   /old_locus_tag="AFL021C"
FT                   /product="AFL021Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBR233W-A (DAD3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL021C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53351"
FT                   /db_xref="GOA:Q754U2"
FT                   /db_xref="InterPro:IPR013965"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754U2"
FT                   /protein_id="AAS53351.1"
FT   gene            <400368..>401882
FT                   /locus_tag="AGOS_AFL020W"
FT                   /old_locus_tag="AFL020W"
FT   mRNA            <400368..>401882
FT                   /locus_tag="AGOS_AFL020W"
FT                   /old_locus_tag="AFL020W"
FT                   /product="AFL020Wp"
FT   CDS_pept        400368..401882
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL020W"
FT                   /old_locus_tag="AFL020W"
FT                   /product="AFL020Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL112C
FT                   (TAF6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL020W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53352"
FT                   /db_xref="GOA:Q754U1"
FT                   /db_xref="InterPro:IPR004823"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="InterPro:IPR011442"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR037796"
FT                   /db_xref="UniProtKB/TrEMBL:Q754U1"
FT                   /protein_id="AAS53352.1"
FT   gene            complement(<401981..>403996)
FT                   /locus_tag="AGOS_AFL019C"
FT                   /old_locus_tag="AFL019C"
FT   mRNA            complement(<401981..>403996)
FT                   /locus_tag="AGOS_AFL019C"
FT                   /old_locus_tag="AFL019C"
FT                   /product="AFL019Cp"
FT   CDS_pept        complement(401981..403996)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL019C"
FT                   /old_locus_tag="AFL019C"
FT                   /product="AFL019Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL113W
FT                   (SLD3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL019C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53353"
FT                   /db_xref="GOA:Q754U0"
FT                   /db_xref="InterPro:IPR013948"
FT                   /db_xref="InterPro:IPR041393"
FT                   /db_xref="InterPro:IPR042511"
FT                   /db_xref="UniProtKB/TrEMBL:Q754U0"
FT                   /protein_id="AAS53353.1"
FT   gene            complement(<404279..>405457)
FT                   /locus_tag="AGOS_AFL018C"
FT                   /old_locus_tag="AFL018C"
FT   mRNA            complement(<404279..>405457)
FT                   /locus_tag="AGOS_AFL018C"
FT                   /old_locus_tag="AFL018C"
FT                   /product="AFL018Cp"
FT   CDS_pept        complement(404279..405457)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL018C"
FT                   /old_locus_tag="AFL018C"
FT                   /product="AFL018Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR233W
FT                   (PBP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL018C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53354"
FT                   /db_xref="GOA:Q754T9"
FT                   /db_xref="InterPro:IPR004087"
FT                   /db_xref="InterPro:IPR004088"
FT                   /db_xref="InterPro:IPR036612"
FT                   /db_xref="UniProtKB/TrEMBL:Q754T9"
FT                   /protein_id="AAS53354.1"
FT   gene            <405643..>406503
FT                   /locus_tag="AGOS_AFL017W"
FT                   /old_locus_tag="AFL017W"
FT   mRNA            <405643..>406503
FT                   /locus_tag="AGOS_AFL017W"
FT                   /old_locus_tag="AFL017W"
FT                   /product="AFL017Wp"
FT   CDS_pept        405643..406503
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL017W"
FT                   /old_locus_tag="AFL017W"
FT                   /product="AFL017Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR231C
FT                   (SWC5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL017W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53355"
FT                   /db_xref="GOA:Q754T8"
FT                   /db_xref="InterPro:IPR011421"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754T8"
FT                   /protein_id="AAS53355.1"
FT                   GAQGM"
FT   gene            complement(<406542..>408656)
FT                   /locus_tag="AGOS_AFL016C"
FT                   /old_locus_tag="AFL016C"
FT   mRNA            complement(<406542..>408656)
FT                   /locus_tag="AGOS_AFL016C"
FT                   /old_locus_tag="AFL016C"
FT                   /product="AFL016Cp"
FT   CDS_pept        complement(406542..408656)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL016C"
FT                   /old_locus_tag="AFL016C"
FT                   /product="AFL016Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGL114W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL016C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53356"
FT                   /db_xref="GOA:Q754T7"
FT                   /db_xref="InterPro:IPR004813"
FT                   /db_xref="UniProtKB/TrEMBL:Q754T7"
FT                   /protein_id="AAS53356.1"
FT                   TLASIGTPHM"
FT   gene            complement(<408908..>409915)
FT                   /locus_tag="AGOS_AFL015C"
FT                   /old_locus_tag="AFL015C"
FT   mRNA            complement(<408908..>409915)
FT                   /locus_tag="AGOS_AFL015C"
FT                   /old_locus_tag="AFL015C"
FT                   /product="AFL015Cp"
FT   CDS_pept        complement(408908..409915)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL015C"
FT                   /old_locus_tag="AFL015C"
FT                   /product="AFL015Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL115W
FT                   (SNF4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL015C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53357"
FT                   /db_xref="GOA:Q754T6"
FT                   /db_xref="InterPro:IPR000644"
FT                   /db_xref="UniProtKB/TrEMBL:Q754T6"
FT                   /protein_id="AAS53357.1"
FT   gene            410319..410913
FT                   /locus_tag="AGOS_AgSNR20"
FT                   /old_locus_tag="AgSNR20"
FT   ncRNA           410319..410913
FT                   /locus_tag="AGOS_AgSNR20"
FT                   /old_locus_tag="AgSNR20"
FT                   /product="AgSNR20"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR20 (LSR1). U2 SnRNA, LSR1; start and end coordinates are
FT                   approximate; in synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<410922..>412595)
FT                   /locus_tag="AGOS_AFL014C"
FT                   /old_locus_tag="AFL014C"
FT   mRNA            complement(<410922..>412595)
FT                   /locus_tag="AGOS_AFL014C"
FT                   /old_locus_tag="AFL014C"
FT                   /product="AFL014Cp"
FT   CDS_pept        complement(410922..412595)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL014C"
FT                   /old_locus_tag="AFL014C"
FT                   /product="AFL014Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL116W
FT                   (CDC20)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL014C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53358"
FT                   /db_xref="GOA:Q754T5"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR033010"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q754T5"
FT                   /protein_id="AAS53358.1"
FT   gene            complement(<413068..>413718)
FT                   /locus_tag="AGOS_AFL013C"
FT   mRNA            complement(<413068..>413718)
FT                   /locus_tag="AGOS_AFL013C"
FT                   /product="AFL013Cp"
FT   CDS_pept        complement(413068..413718)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL013C"
FT                   /product="AFL013Cp"
FT                   /note="NOHBY671; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0B00495g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL013C"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41787"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGF7"
FT                   /protein_id="ADJ41787.1"
FT   gene            414649..414748
FT                   /locus_tag="AGOS_t0133"
FT   tRNA            join(414649..414684,414713..414748)
FT                   /locus_tag="AGOS_t0133"
FT                   /product="tRNA-Trp"
FT                   /note="codon recognized: UGG"
FT   gene            complement(414835..414906)
FT                   /locus_tag="AGOS_t0134"
FT   tRNA            complement(414835..414906)
FT                   /locus_tag="AGOS_t0134"
FT                   /product="tRNA-Asp"
FT                   /note="codon recognized: GAC"
FT   gene            complement(414911..414992)
FT                   /locus_tag="AGOS_t0135"
FT   tRNA            complement(414911..414992)
FT                   /locus_tag="AGOS_t0135"
FT                   /product="tRNA-Ser"
FT                   /note="codon recognized: UCU"
FT   gene            complement(<415195..>416073)
FT                   /locus_tag="AGOS_AFL012C"
FT                   /old_locus_tag="AFL012C"
FT   mRNA            complement(<415195..>416073)
FT                   /locus_tag="AGOS_AFL012C"
FT                   /old_locus_tag="AFL012C"
FT                   /product="AFL012Cp"
FT   CDS_pept        complement(415195..416073)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL012C"
FT                   /old_locus_tag="AFL012C"
FT                   /product="AFL012Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAR008W
FT                   (SEN34)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL012C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53360"
FT                   /db_xref="GOA:Q754T3"
FT                   /db_xref="InterPro:IPR006676"
FT                   /db_xref="InterPro:IPR006677"
FT                   /db_xref="InterPro:IPR011856"
FT                   /db_xref="InterPro:IPR016690"
FT                   /db_xref="InterPro:IPR036167"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754T3"
FT                   /protein_id="AAS53360.2"
FT                   SVFSIEWSGFG"
FT   gene            <416691..>420419
FT                   /locus_tag="AGOS_AFL011W"
FT                   /old_locus_tag="AFL011W"
FT   mRNA            <416691..>420419
FT                   /locus_tag="AGOS_AFL011W"
FT                   /old_locus_tag="AFL011W"
FT                   /product="AFL011Wp"
FT   CDS_pept        416691..420419
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL011W"
FT                   /old_locus_tag="AFL011W"
FT                   /product="AFL011Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL006W
FT                   (PMC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL011W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53361"
FT                   /db_xref="GOA:Q754T2"
FT                   /db_xref="InterPro:IPR001757"
FT                   /db_xref="InterPro:IPR004014"
FT                   /db_xref="InterPro:IPR006068"
FT                   /db_xref="InterPro:IPR006408"
FT                   /db_xref="InterPro:IPR008250"
FT                   /db_xref="InterPro:IPR018303"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR023298"
FT                   /db_xref="InterPro:IPR023299"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q754T2"
FT                   /protein_id="AAS53361.1"
FT                   SPTSAKSSAKTYINKDV"
FT   gene            complement(<420559..>421317)
FT                   /locus_tag="AGOS_AFL010C"
FT                   /old_locus_tag="AFL010C"
FT   mRNA            complement(<420559..>421317)
FT                   /locus_tag="AGOS_AFL010C"
FT                   /old_locus_tag="AFL010C"
FT                   /product="AFL010Cp"
FT   CDS_pept        complement(420559..421317)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL010C"
FT                   /old_locus_tag="AFL010C"
FT                   /product="AFL010Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL005C
FT                   (COG7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL010C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53362"
FT                   /db_xref="GOA:Q754T1"
FT                   /db_xref="UniProtKB/TrEMBL:Q754T1"
FT                   /protein_id="AAS53362.1"
FT   gene            complement(<421433..>422674)
FT                   /locus_tag="AGOS_AFL009C"
FT                   /old_locus_tag="AFL009C"
FT   mRNA            complement(<421433..>422674)
FT                   /locus_tag="AGOS_AFL009C"
FT                   /old_locus_tag="AFL009C"
FT                   /product="AFL009Cp"
FT   CDS_pept        complement(421433..422674)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL009C"
FT                   /old_locus_tag="AFL009C"
FT                   /product="AFL009Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL004C
FT                   (RPN14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL009C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53363"
FT                   /db_xref="GOA:Q754T0"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q754T0"
FT                   /protein_id="AAS53363.1"
FT                   VWAVGSRSFCAKYS"
FT   gene            <422841..>424925
FT                   /locus_tag="AGOS_AFL008W"
FT                   /old_locus_tag="AFL008W"
FT   mRNA            <422841..>424925
FT                   /locus_tag="AGOS_AFL008W"
FT                   /old_locus_tag="AFL008W"
FT                   /product="AFL008Wp"
FT   CDS_pept        422841..424925
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL008W"
FT                   /old_locus_tag="AFL008W"
FT                   /product="AFL008Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAR007C
FT                   (RFA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL008W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53364"
FT                   /db_xref="GOA:Q754S9"
FT                   /db_xref="InterPro:IPR004365"
FT                   /db_xref="InterPro:IPR004591"
FT                   /db_xref="InterPro:IPR007199"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR013955"
FT                   /db_xref="InterPro:IPR031657"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S9"
FT                   /protein_id="AAS53364.1"
FT                   "
FT   gene            complement(<425430..>427085)
FT                   /locus_tag="AGOS_AFL007C"
FT                   /old_locus_tag="AFL007C"
FT   mRNA            complement(<425430..>427085)
FT                   /locus_tag="AGOS_AFL007C"
FT                   /old_locus_tag="AFL007C"
FT                   /product="AFL007Cp"
FT   CDS_pept        complement(425430..427085)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL007C"
FT                   /old_locus_tag="AFL007C"
FT                   /product="AFL007Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL003C
FT                   (CDH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL007C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53365"
FT                   /db_xref="GOA:Q754S8"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR024977"
FT                   /db_xref="InterPro:IPR033010"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S8"
FT                   /protein_id="AAS53365.2"
FT   gene            complement(<427351..>428652)
FT                   /locus_tag="AGOS_AFL006C"
FT                   /old_locus_tag="AFL006C"
FT   mRNA            complement(<427351..>428652)
FT                   /locus_tag="AGOS_AFL006C"
FT                   /old_locus_tag="AFL006C"
FT                   /product="AFL006Cp"
FT   CDS_pept        complement(427351..428652)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL006C"
FT                   /old_locus_tag="AFL006C"
FT                   /product="AFL006Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAR003W
FT                   (SWD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL006C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53366"
FT                   /db_xref="GOA:Q754S7"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR037850"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S7"
FT                   /protein_id="AAS53366.1"
FT   gene            <428819..>429475
FT                   /locus_tag="AGOS_AFL005W"
FT                   /old_locus_tag="AFL005W"
FT   mRNA            <428819..>429475
FT                   /locus_tag="AGOS_AFL005W"
FT                   /old_locus_tag="AFL005W"
FT                   /product="AFL005Wp"
FT   CDS_pept        428819..429475
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL005W"
FT                   /old_locus_tag="AFL005W"
FT                   /product="AFL005Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YAR002C-A (ERP1) and YGL002W (ERP6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL005W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53367"
FT                   /db_xref="GOA:Q754S6"
FT                   /db_xref="InterPro:IPR009038"
FT                   /db_xref="InterPro:IPR015720"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S6"
FT                   /protein_id="AAS53367.1"
FT   gene            complement(<430215..>431904)
FT                   /locus_tag="AGOS_AFL004C"
FT                   /old_locus_tag="AFL004C"
FT   mRNA            complement(join(<430215..431729,431791..>431904))
FT                   /locus_tag="AGOS_AFL004C"
FT                   /old_locus_tag="AFL004C"
FT                   /product="AFL004Cp"
FT   CDS_pept        complement(join(430215..431729,431791..431904))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL004C"
FT                   /old_locus_tag="AFL004C"
FT                   /product="AFL004Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAR002W
FT                   (NUP60); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL004C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53368"
FT                   /db_xref="GOA:Q754S5"
FT                   /db_xref="InterPro:IPR034432"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S5"
FT                   /protein_id="AAS53368.1"
FT   gene            complement(432047..432158)
FT                   /locus_tag="AGOS_t0136"
FT   tRNA            complement(join(432047..432082,432123..432158))
FT                   /locus_tag="AGOS_t0136"
FT                   /product="tRNA-Pro"
FT                   /note="codon recognized: CCA"
FT   gene            complement(<432400..>433347)
FT                   /locus_tag="AGOS_AFL003C"
FT                   /old_locus_tag="AFL003C"
FT   mRNA            complement(<432400..>433347)
FT                   /locus_tag="AGOS_AFL003C"
FT                   /old_locus_tag="AFL003C"
FT                   /product="AFL003Cp"
FT   CDS_pept        complement(432400..433347)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL003C"
FT                   /old_locus_tag="AFL003C"
FT                   /product="AFL003Cp"
FT                   /note="NOHBY601; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0H22528g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL003C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53369"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S4"
FT                   /protein_id="AAS53369.1"
FT   gene            complement(<433755..>437273)
FT                   /locus_tag="AGOS_AFL002C"
FT                   /old_locus_tag="AFL002C"
FT   mRNA            complement(join(<433755..437146,437210..>437273))
FT                   /locus_tag="AGOS_AFL002C"
FT                   /old_locus_tag="AFL002C"
FT                   /product="AFL002Cp"
FT   CDS_pept        complement(join(433755..437146,437210..437273))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL002C"
FT                   /old_locus_tag="AFL002C"
FT                   /product="AFL002Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL001C
FT                   (TFC3); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL002C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53370"
FT                   /db_xref="GOA:Q754S3"
FT                   /db_xref="InterPro:IPR007309"
FT                   /db_xref="InterPro:IPR035625"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S3"
FT                   /protein_id="AAS53370.2"
FT   gene            <437499..>438245
FT                   /locus_tag="AGOS_AFL001W"
FT                   /old_locus_tag="AFL001W"
FT   mRNA            <437499..>438245
FT                   /locus_tag="AGOS_AFL001W"
FT                   /old_locus_tag="AFL001W"
FT                   /product="AFL001Wp"
FT   CDS_pept        437499..438245
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFL001W"
FT                   /old_locus_tag="AFL001W"
FT                   /product="AFL001Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR001C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFL001W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53371"
FT                   /db_xref="GOA:Q754S2"
FT                   /db_xref="InterPro:IPR019369"
FT                   /db_xref="InterPro:IPR041370"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S2"
FT                   /protein_id="AAS53371.1"
FT   centromere      438382..438573
FT                   /note="Chromosome VI centromere"
FT   centromere      438382..438389
FT                   /note="Chromosome VI centromere CDE I element"
FT   centromere      438390..438555
FT                   /note="Chromosome VI centromere CDE II element"
FT   centromere      438556..438573
FT                   /note="Chromosome VI centromere CDE III element"
FT   gene            <438759..>439811
FT                   /locus_tag="AGOS_AFR001W"
FT                   /old_locus_tag="AFR001W"
FT   mRNA            <438759..>439811
FT                   /locus_tag="AGOS_AFR001W"
FT                   /old_locus_tag="AFR001W"
FT                   /product="AFR001Wp"
FT   CDS_pept        438759..439811
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR001W"
FT                   /old_locus_tag="AFR001W"
FT                   /product="AFR001Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL001C
FT                   (ERG26)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR001W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53372"
FT                   /db_xref="GOA:Q754S1"
FT                   /db_xref="InterPro:IPR002225"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S1"
FT                   /protein_id="AAS53372.1"
FT                   TLLWMDEDAS"
FT   gene            complement(<439929..>443621)
FT                   /locus_tag="AGOS_AFR002C"
FT                   /old_locus_tag="AFR002C"
FT   mRNA            complement(<439929..>443621)
FT                   /locus_tag="AGOS_AFR002C"
FT                   /old_locus_tag="AFR002C"
FT                   /product="AFR002Cp"
FT   CDS_pept        complement(439929..443621)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR002C"
FT                   /old_locus_tag="AFR002C"
FT                   /product="AFR002Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL002W
FT                   (VPS8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR002C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53373"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR025941"
FT                   /db_xref="UniProtKB/TrEMBL:Q754S0"
FT                   /protein_id="AAS53373.1"
FT                   CYEDK"
FT   gene            complement(<443802..>444679)
FT                   /locus_tag="AGOS_AFR003C"
FT                   /old_locus_tag="AFR003C"
FT   mRNA            complement(join(<443802..444342,444600..>444679))
FT                   /locus_tag="AGOS_AFR003C"
FT                   /old_locus_tag="AFR003C"
FT                   /product="AFR003Cp"
FT   CDS_pept        complement(join(443802..444342,444600..444679))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR003C"
FT                   /old_locus_tag="AFR003C"
FT                   /product="AFR003Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YAL003W
FT                   (EFB1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR003C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53374"
FT                   /db_xref="GOA:Q754R9"
FT                   /db_xref="InterPro:IPR001326"
FT                   /db_xref="InterPro:IPR014038"
FT                   /db_xref="InterPro:IPR014717"
FT                   /db_xref="InterPro:IPR018940"
FT                   /db_xref="InterPro:IPR036219"
FT                   /db_xref="InterPro:IPR036282"
FT                   /db_xref="UniProtKB/TrEMBL:Q754R9"
FT                   /protein_id="AAS53374.1"
FT   gene            complement(444397..444489)
FT                   /locus_tag="AGOS_AgSNR18"
FT                   /old_locus_tag="AgSNR18"
FT   ncRNA           complement(444397..444489)
FT                   /locus_tag="AGOS_AgSNR18"
FT                   /old_locus_tag="AgSNR18"
FT                   /product="AgSNR18"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR18; start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <445060..>446211
FT                   /locus_tag="AGOS_AFR004W"
FT                   /old_locus_tag="AFR004W"
FT   mRNA            <445060..>446211
FT                   /locus_tag="AGOS_AFR004W"
FT                   /old_locus_tag="AFR004W"
FT                   /product="AFR004Wp"
FT   CDS_pept        445060..446211
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR004W"
FT                   /old_locus_tag="AFR004W"
FT                   /product="AFR004Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR321C
FT                   (SFH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR004W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53375"
FT                   /db_xref="GOA:Q754R8"
FT                   /db_xref="InterPro:IPR006939"
FT                   /db_xref="InterPro:IPR017393"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754R8"
FT                   /protein_id="AAS53375.1"
FT   gene            complement(<446479..>448620)
FT                   /locus_tag="AGOS_AFR005C"
FT                   /old_locus_tag="AFR005C"
FT   mRNA            complement(<446479..>448620)
FT                   /locus_tag="AGOS_AFR005C"
FT                   /old_locus_tag="AFR005C"
FT                   /product="AFR005Cp"
FT   CDS_pept        complement(446479..448620)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR005C"
FT                   /old_locus_tag="AFR005C"
FT                   /product="AFR005Cp"
FT                   /note="NOHBY618; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR005C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53376"
FT                   /db_xref="UniProtKB/TrEMBL:Q754R7"
FT                   /protein_id="AAS53376.1"
FT   gene            complement(<449035..>449763)
FT                   /locus_tag="AGOS_AFR006C"
FT                   /old_locus_tag="AFR006C"
FT   mRNA            complement(<449035..>449763)
FT                   /locus_tag="AGOS_AFR006C"
FT                   /old_locus_tag="AFR006C"
FT                   /product="AFR006Cp"
FT   CDS_pept        complement(449035..449763)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR006C"
FT                   /old_locus_tag="AFR006C"
FT                   /product="AFR006Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL020C
FT                   (GET1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR006C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53377"
FT                   /db_xref="GOA:Q754R6"
FT                   /db_xref="InterPro:IPR027538"
FT                   /db_xref="InterPro:IPR028945"
FT                   /db_xref="InterPro:IPR029012"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754R6"
FT                   /protein_id="AAS53377.1"
FT   gene            <450058..>452616
FT                   /locus_tag="AGOS_AFR007W"
FT                   /old_locus_tag="AFR007W"
FT   mRNA            <450058..>452616
FT                   /locus_tag="AGOS_AFR007W"
FT                   /old_locus_tag="AFR007W"
FT                   /product="AFR007Wp"
FT   CDS_pept        450058..452616
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR007W"
FT                   /old_locus_tag="AFR007W"
FT                   /product="AFR007Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR069C
FT                   (DOA4) and YER144C (UBP5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR007W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53378"
FT                   /db_xref="GOA:Q754R5"
FT                   /db_xref="InterPro:IPR001394"
FT                   /db_xref="InterPro:IPR001763"
FT                   /db_xref="InterPro:IPR018200"
FT                   /db_xref="InterPro:IPR028889"
FT                   /db_xref="InterPro:IPR036873"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754R5"
FT                   /protein_id="AAS53378.2"
FT   gene            complement(<452689..>453561)
FT                   /locus_tag="AGOS_AFR008C"
FT                   /old_locus_tag="AFR008C"
FT   mRNA            complement(<452689..>453561)
FT                   /locus_tag="AGOS_AFR008C"
FT                   /old_locus_tag="AFR008C"
FT                   /product="AFR008Cp"
FT   CDS_pept        complement(452689..453561)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR008C"
FT                   /old_locus_tag="AFR008C"
FT                   /product="AFR008Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR068W
FT                   (DOS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR008C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53379"
FT                   /db_xref="InterPro:IPR005607"
FT                   /db_xref="InterPro:IPR035925"
FT                   /db_xref="UniProtKB/TrEMBL:Q754R4"
FT                   /protein_id="AAS53379.1"
FT                   AESDDDEWE"
FT   gene            <453738..>454364
FT                   /locus_tag="AGOS_AFR009W"
FT                   /old_locus_tag="AFR009W"
FT   mRNA            <453738..>454364
FT                   /locus_tag="AGOS_AFR009W"
FT                   /old_locus_tag="AFR009W"
FT                   /product="AFR009Wp"
FT   CDS_pept        453738..454364
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR009W"
FT                   /old_locus_tag="AFR009W"
FT                   /product="AFR009Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR067C
FT                   (OCA6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR009W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53380"
FT                   /db_xref="GOA:Q754R3"
FT                   /db_xref="InterPro:IPR004861"
FT                   /db_xref="InterPro:IPR029021"
FT                   /db_xref="UniProtKB/TrEMBL:Q754R3"
FT                   /protein_id="AAS53380.1"
FT   gene            complement(<454393..>455811)
FT                   /locus_tag="AGOS_AFR010C"
FT                   /old_locus_tag="AFR010C"
FT   mRNA            complement(<454393..>455811)
FT                   /locus_tag="AGOS_AFR010C"
FT                   /old_locus_tag="AFR010C"
FT                   /product="AFR010Cp"
FT   CDS_pept        complement(454393..455811)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR010C"
FT                   /old_locus_tag="AFR010C"
FT                   /product="AFR010Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER143W
FT                   (DDI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR010C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53381"
FT                   /db_xref="GOA:Q754R2"
FT                   /db_xref="InterPro:IPR001995"
FT                   /db_xref="InterPro:IPR009060"
FT                   /db_xref="InterPro:IPR015940"
FT                   /db_xref="InterPro:IPR019103"
FT                   /db_xref="InterPro:IPR021109"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754R2"
FT                   /protein_id="AAS53381.1"
FT                   SQGNAEYAAAFLFQ"
FT   gene            <455988..>456845
FT                   /locus_tag="AGOS_AFR011W"
FT                   /old_locus_tag="AFR011W"
FT   mRNA            <455988..>456845
FT                   /locus_tag="AGOS_AFR011W"
FT                   /old_locus_tag="AFR011W"
FT                   /product="AFR011Wp"
FT   CDS_pept        455988..456845
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR011W"
FT                   /old_locus_tag="AFR011W"
FT                   /product="AFR011Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER142C
FT                   (MAG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR011W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53382"
FT                   /db_xref="GOA:Q754R1"
FT                   /db_xref="InterPro:IPR000035"
FT                   /db_xref="InterPro:IPR003265"
FT                   /db_xref="InterPro:IPR011257"
FT                   /db_xref="UniProtKB/TrEMBL:Q754R1"
FT                   /protein_id="AAS53382.1"
FT                   HSIH"
FT   gene            complement(<457711..>459162)
FT                   /locus_tag="AGOS_AFR012C"
FT                   /old_locus_tag="AFR012C"
FT   mRNA            complement(<457711..>459162)
FT                   /locus_tag="AGOS_AFR012C"
FT                   /old_locus_tag="AFR012C"
FT                   /product="AFR012Cp"
FT   CDS_pept        complement(457711..459162)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR012C"
FT                   /old_locus_tag="AFR012C"
FT                   /product="AFR012Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER141W
FT                   (COX15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR012C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53383"
FT                   /db_xref="GOA:Q754R0"
FT                   /db_xref="InterPro:IPR003780"
FT                   /db_xref="InterPro:IPR023754"
FT                   /db_xref="UniProtKB/TrEMBL:Q754R0"
FT                   /protein_id="AAS53383.1"
FT   gene            complement(<459486..>462662)
FT                   /locus_tag="AGOS_AFR013C"
FT                   /old_locus_tag="AFR013C"
FT   mRNA            complement(<459486..>462662)
FT                   /locus_tag="AGOS_AFR013C"
FT                   /old_locus_tag="AFR013C"
FT                   /product="AFR013Cp"
FT   CDS_pept        complement(459486..462662)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR013C"
FT                   /old_locus_tag="AFR013C"
FT                   /product="AFR013Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL022C
FT                   (PIM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR013C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53384"
FT                   /db_xref="GOA:Q754Q9"
FT                   /db_xref="InterPro:IPR003111"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR004815"
FT                   /db_xref="InterPro:IPR008268"
FT                   /db_xref="InterPro:IPR008269"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR015947"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR027065"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR027503"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754Q9"
FT                   /protein_id="AAS53384.2"
FT                   RSKATASSSN"
FT   gene            complement(<462878..>463408)
FT                   /locus_tag="AGOS_AFR014C"
FT                   /old_locus_tag="AFR014C"
FT   mRNA            complement(<462878..>463408)
FT                   /locus_tag="AGOS_AFR014C"
FT                   /old_locus_tag="AFR014C"
FT                   /product="AFR014Cp"
FT   CDS_pept        complement(462878..463408)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR014C"
FT                   /old_locus_tag="AFR014C"
FT                   /product="AFR014Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL021C
FT                   (HAP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR014C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53385"
FT                   /db_xref="GOA:Q754Q8"
FT                   /db_xref="InterPro:IPR003956"
FT                   /db_xref="InterPro:IPR003958"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Q8"
FT                   /protein_id="AAS53385.1"
FT                   QDQFINQDGSLYI"
FT   gene            <463560..>465218
FT                   /locus_tag="AGOS_AFR015W"
FT                   /old_locus_tag="AFR015W"
FT   mRNA            <463560..>465218
FT                   /locus_tag="AGOS_AFR015W"
FT                   /old_locus_tag="AFR015W"
FT                   /product="AFR015Wp"
FT   CDS_pept        463560..465218
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR015W"
FT                   /old_locus_tag="AFR015W"
FT                   /product="AFR015Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL020W
FT                   (RFT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR015W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53386"
FT                   /db_xref="GOA:Q754Q7"
FT                   /db_xref="InterPro:IPR007594"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754Q7"
FT                   /protein_id="AAS53386.1"
FT   gene            <465277..>466953
FT                   /locus_tag="AGOS_AFR016W"
FT                   /old_locus_tag="AFR016W"
FT   mRNA            <465277..>466953
FT                   /locus_tag="AGOS_AFR016W"
FT                   /old_locus_tag="AFR016W"
FT                   /product="AFR016Wp"
FT   CDS_pept        465277..466953
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR016W"
FT                   /old_locus_tag="AFR016W"
FT                   /product="AFR016Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL019W
FT                   (APN2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR016W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53387"
FT                   /db_xref="GOA:Q754Q6"
FT                   /db_xref="InterPro:IPR004808"
FT                   /db_xref="InterPro:IPR005135"
FT                   /db_xref="InterPro:IPR010666"
FT                   /db_xref="InterPro:IPR020848"
FT                   /db_xref="InterPro:IPR036691"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Q6"
FT                   /protein_id="AAS53387.1"
FT   gene            complement(<466992..>467459)
FT                   /locus_tag="AGOS_AFR017C"
FT                   /old_locus_tag="AFR017C"
FT   mRNA            complement(join(<466992..467346,467407..>467459))
FT                   /locus_tag="AGOS_AFR017C"
FT                   /old_locus_tag="AFR017C"
FT                   /product="AFR017Cp"
FT   CDS_pept        complement(join(466992..467346,467407..467459))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR017C"
FT                   /old_locus_tag="AFR017C"
FT                   /product="AFR017Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL018C
FT                   (POP8); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR017C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53388"
FT                   /db_xref="GOA:Q754Q5"
FT                   /db_xref="InterPro:IPR020347"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Q5"
FT                   /protein_id="AAS53388.1"
FT   gene            complement(<467650..>472176)
FT                   /locus_tag="AGOS_AFR018C"
FT                   /old_locus_tag="AFR018C"
FT   mRNA            complement(<467650..>472176)
FT                   /locus_tag="AGOS_AFR018C"
FT                   /old_locus_tag="AFR018C"
FT                   /product="AFR018Cp"
FT   CDS_pept        complement(467650..472176)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR018C"
FT                   /old_locus_tag="AFR018C"
FT                   /product="AFR018Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL017C
FT                   (PEP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR018C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53389"
FT                   /db_xref="GOA:Q754Q4"
FT                   /db_xref="InterPro:IPR006581"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR031777"
FT                   /db_xref="InterPro:IPR031778"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754Q4"
FT                   /protein_id="AAS53389.2"
FT   gene            <472913..>473992
FT                   /locus_tag="AGOS_AFR019W"
FT                   /old_locus_tag="AFR019W"
FT   mRNA            <472913..>473992
FT                   /locus_tag="AGOS_AFR019W"
FT                   /old_locus_tag="AFR019W"
FT                   /product="AFR019Wp"
FT   CDS_pept        472913..473992
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR019W"
FT                   /old_locus_tag="AFR019W"
FT                   /product="AFR019Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL016W
FT                   (FUS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR019W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53390"
FT                   /db_xref="GOA:Q754Q3"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR003527"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Q3"
FT                   /protein_id="AAS53390.1"
FT   gene            <474366..>475937
FT                   /locus_tag="AGOS_AFR020W"
FT                   /old_locus_tag="AFR020W"
FT   mRNA            <474366..>475937
FT                   /locus_tag="AGOS_AFR020W"
FT                   /old_locus_tag="AFR020W"
FT                   /product="AFR020Wp"
FT   CDS_pept        474366..475937
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR020W"
FT                   /old_locus_tag="AFR020W"
FT                   /product="AFR020Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL015W
FT                   (ACH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR020W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53391"
FT                   /db_xref="GOA:Q754Q2"
FT                   /db_xref="InterPro:IPR003702"
FT                   /db_xref="InterPro:IPR026888"
FT                   /db_xref="InterPro:IPR037171"
FT                   /db_xref="InterPro:IPR038460"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754Q2"
FT                   /protein_id="AAS53391.2"
FT                   KVPSWD"
FT   gene            477330..477441
FT                   /locus_tag="AGOS_t0137"
FT   tRNA            join(477330..477365,477406..477441)
FT                   /locus_tag="AGOS_t0137"
FT                   /product="tRNA-Pro"
FT                   /note="codon recognized: CCA"
FT   gene            <477646..>482655
FT                   /locus_tag="AGOS_AFR021W"
FT                   /old_locus_tag="AFR021W"
FT   mRNA            <477646..>482655
FT                   /locus_tag="AGOS_AFR021W"
FT                   /old_locus_tag="AFR021W"
FT                   /product="AFR021Wp"
FT   CDS_pept        477646..482655
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR021W"
FT                   /old_locus_tag="AFR021W"
FT                   /product="AFR021Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL172W
FT                   (APC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR021W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53392"
FT                   /db_xref="GOA:Q754Q1"
FT                   /db_xref="InterPro:IPR024990"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Q1"
FT                   /protein_id="AAS53392.1"
FT   gene            complement(<482819..>484363)
FT                   /locus_tag="AGOS_AFR022C"
FT                   /old_locus_tag="AFR022C"
FT   mRNA            complement(<482819..>484363)
FT                   /locus_tag="AGOS_AFR022C"
FT                   /old_locus_tag="AFR022C"
FT                   /product="AFR022Cp"
FT   CDS_pept        complement(482819..484363)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR022C"
FT                   /old_locus_tag="AFR022C"
FT                   /product="AFR022Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL169C
FT                   (PSD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR022C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53393"
FT                   /db_xref="GOA:Q754Q0"
FT                   /db_xref="InterPro:IPR003817"
FT                   /db_xref="InterPro:IPR033177"
FT                   /db_xref="InterPro:IPR033661"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Q0"
FT                   /protein_id="AAS53393.1"
FT   gene            <484617..>485519
FT                   /locus_tag="AGOS_AFR023W"
FT                   /old_locus_tag="AFR023W"
FT   mRNA            <484617..>485519
FT                   /locus_tag="AGOS_AFR023W"
FT                   /old_locus_tag="AFR023W"
FT                   /product="AFR023Wp"
FT   CDS_pept        484617..485519
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR023W"
FT                   /old_locus_tag="AFR023W"
FT                   /product="AFR023Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR144C
FT                   (DCD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR023W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53394"
FT                   /db_xref="GOA:Q754P9"
FT                   /db_xref="InterPro:IPR002125"
FT                   /db_xref="InterPro:IPR015517"
FT                   /db_xref="InterPro:IPR016192"
FT                   /db_xref="InterPro:IPR016193"
FT                   /db_xref="InterPro:IPR035105"
FT                   /db_xref="UniProtKB/TrEMBL:Q754P9"
FT                   /protein_id="AAS53394.1"
FT   gene            complement(<485544..>486317)
FT                   /locus_tag="AGOS_AFR024C"
FT                   /old_locus_tag="AFR024C"
FT   mRNA            complement(<485544..>486317)
FT                   /locus_tag="AGOS_AFR024C"
FT                   /old_locus_tag="AFR024C"
FT                   /product="AFR024Cp"
FT   CDS_pept        complement(485544..486317)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR024C"
FT                   /old_locus_tag="AFR024C"
FT                   /product="AFR024Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL168C
FT                   (FMP41)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR024C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53395"
FT                   /db_xref="GOA:Q754P8"
FT                   /db_xref="InterPro:IPR011234"
FT                   /db_xref="InterPro:IPR036663"
FT                   /db_xref="UniProtKB/TrEMBL:Q754P8"
FT                   /protein_id="AAS53395.1"
FT   gene            complement(<486595..>488061)
FT                   /locus_tag="AGOS_AFR025C"
FT                   /old_locus_tag="AFR025C"
FT   mRNA            complement(<486595..>488061)
FT                   /locus_tag="AGOS_AFR025C"
FT                   /old_locus_tag="AFR025C"
FT                   /product="AFR025Cp"
FT   CDS_pept        complement(486595..488061)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR025C"
FT                   /old_locus_tag="AFR025C"
FT                   /product="AFR025Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL167C
FT                   (SKO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR025C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53396"
FT                   /db_xref="GOA:Q754P7"
FT                   /db_xref="InterPro:IPR004827"
FT                   /db_xref="InterPro:IPR020956"
FT                   /db_xref="UniProtKB/TrEMBL:Q754P7"
FT                   /protein_id="AAS53396.2"
FT   gene            complement(<488510..>488722)
FT                   /locus_tag="AGOS_AFR026C"
FT                   /old_locus_tag="AFR026C"
FT   mRNA            complement(<488510..>488722)
FT                   /locus_tag="AGOS_AFR026C"
FT                   /old_locus_tag="AFR026C"
FT                   /product="AFR026Cp"
FT   CDS_pept        complement(488510..488722)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR026C"
FT                   /old_locus_tag="AFR026C"
FT                   /product="AFR026Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHR143W-A (RPC10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR026C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53397"
FT                   /db_xref="GOA:Q754P6"
FT                   /db_xref="InterPro:IPR006591"
FT                   /db_xref="InterPro:IPR029040"
FT                   /db_xref="InterPro:IPR039747"
FT                   /db_xref="UniProtKB/TrEMBL:Q754P6"
FT                   /protein_id="AAS53397.1"
FT   gene            complement(<488860..>489780)
FT                   /locus_tag="AGOS_AFR027C"
FT                   /old_locus_tag="AFR027C"
FT   mRNA            complement(<488860..>489780)
FT                   /locus_tag="AGOS_AFR027C"
FT                   /old_locus_tag="AFR027C"
FT                   /product="AFR027Cp"
FT   CDS_pept        complement(488860..489780)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR027C"
FT                   /old_locus_tag="AFR027C"
FT                   /product="AFR027Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL166C
FT                   (BNI5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR027C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53398"
FT                   /db_xref="UniProtKB/TrEMBL:Q754P5"
FT                   /protein_id="AAS53398.2"
FT   gene            <489947..>490936
FT                   /locus_tag="AGOS_AFR028W"
FT                   /old_locus_tag="AFR028W"
FT   mRNA            <489947..>490936
FT                   /locus_tag="AGOS_AFR028W"
FT                   /old_locus_tag="AFR028W"
FT                   /product="AFR028Wp"
FT   CDS_pept        489947..490936
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR028W"
FT                   /old_locus_tag="AFR028W"
FT                   /product="AFR028Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YNL165W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR028W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53399"
FT                   /db_xref="UniProtKB/TrEMBL:Q754P4"
FT                   /protein_id="AAS53399.1"
FT   gene            complement(<491025..>491501)
FT                   /locus_tag="AGOS_AFR029C"
FT                   /old_locus_tag="AFR029C"
FT   mRNA            complement(<491025..>491501)
FT                   /locus_tag="AGOS_AFR029C"
FT                   /old_locus_tag="AFR029C"
FT                   /product="AFR029Cp"
FT   CDS_pept        complement(491025..491501)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR029C"
FT                   /old_locus_tag="AFR029C"
FT                   /product="AFR029Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR143W
FT                   (DSE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR029C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53400"
FT                   /db_xref="UniProtKB/TrEMBL:Q754P3"
FT                   /protein_id="AAS53400.2"
FT   gene            complement(<492216..>493250)
FT                   /locus_tag="AGOS_AFR030C"
FT                   /old_locus_tag="AFR030C"
FT   mRNA            complement(<492216..>493250)
FT                   /locus_tag="AGOS_AFR030C"
FT                   /old_locus_tag="AFR030C"
FT                   /product="AFR030Cp"
FT   CDS_pept        complement(492216..493250)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR030C"
FT                   /old_locus_tag="AFR030C"
FT                   /product="AFR030Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL164C
FT                   (IBD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR030C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53401"
FT                   /db_xref="GOA:Q754P2"
FT                   /db_xref="InterPro:IPR026231"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754P2"
FT                   /protein_id="AAS53401.1"
FT                   KGKR"
FT   gene            complement(<493539..>496832)
FT                   /locus_tag="AGOS_AFR031C"
FT                   /old_locus_tag="AFR031C"
FT   mRNA            complement(<493539..>496832)
FT                   /locus_tag="AGOS_AFR031C"
FT                   /old_locus_tag="AFR031C"
FT                   /product="AFR031Cp"
FT   CDS_pept        complement(493539..496832)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR031C"
FT                   /old_locus_tag="AFR031C"
FT                   /product="AFR031Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL163C
FT                   (RIA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR031C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53402"
FT                   /db_xref="GOA:Q754P1"
FT                   /db_xref="InterPro:IPR000640"
FT                   /db_xref="InterPro:IPR000795"
FT                   /db_xref="InterPro:IPR004161"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR035647"
FT                   /db_xref="InterPro:IPR041095"
FT                   /db_xref="UniProtKB/TrEMBL:Q754P1"
FT                   /protein_id="AAS53402.2"
FT   gene            <497157..>497390
FT                   /locus_tag="AGOS_AFR032W"
FT                   /old_locus_tag="AFR032W"
FT   mRNA            <497157..>497390
FT                   /locus_tag="AGOS_AFR032W"
FT                   /old_locus_tag="AFR032W"
FT                   /product="AFR032Wp"
FT   CDS_pept        497157..497390
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR032W"
FT                   /old_locus_tag="AFR032W"
FT                   /product="AFR032Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YNL162W-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR032W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53403"
FT                   /db_xref="UniProtKB/TrEMBL:Q754P0"
FT                   /protein_id="AAS53403.1"
FT   gene            complement(<497463..>498482)
FT                   /locus_tag="AGOS_AFR033C"
FT                   /old_locus_tag="AFR033C"
FT   mRNA            complement(<497463..>498482)
FT                   /locus_tag="AGOS_AFR033C"
FT                   /old_locus_tag="AFR033C"
FT                   /product="AFR033Cp"
FT   CDS_pept        complement(497463..498482)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR033C"
FT                   /old_locus_tag="AFR033C"
FT                   /product="AFR033Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR142W
FT                   (CHS7)"
FT                   /db_xref="GOA:Q754N9"
FT                   /db_xref="InterPro:IPR022057"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754N9"
FT                   /protein_id="AAS53404.1"
FT   gene            <499125..>499578
FT                   /locus_tag="AGOS_AFR034W"
FT                   /old_locus_tag="AFR034W"
FT   mRNA            join(<499125..499128,499262..>499578)
FT                   /locus_tag="AGOS_AFR034W"
FT                   /old_locus_tag="AFR034W"
FT                   /product="AFR034Wp"
FT   CDS_pept        join(499125..499128,499262..499578)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR034W"
FT                   /old_locus_tag="AFR034W"
FT                   /product="AFR034Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR141C
FT                   (RPL42B) and YNL162W (RPL42A); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR034W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53405"
FT                   /db_xref="GOA:Q754N8"
FT                   /db_xref="InterPro:IPR000552"
FT                   /db_xref="InterPro:IPR011332"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754N8"
FT                   /protein_id="AAS53405.1"
FT                   QF"
FT   gene            <499953..>502112
FT                   /locus_tag="AGOS_AFR035W"
FT                   /old_locus_tag="AFR035W"
FT   mRNA            <499953..>502112
FT                   /locus_tag="AGOS_AFR035W"
FT                   /old_locus_tag="AFR035W"
FT                   /product="AFR035Wp"
FT   CDS_pept        499953..502112
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR035W"
FT                   /old_locus_tag="AFR035W"
FT                   /product="AFR035Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL161W
FT                   (CBK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR035W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53406"
FT                   /db_xref="GOA:Q754N7"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR000961"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754N7"
FT                   /protein_id="AAS53406.1"
FT   gene            complement(502175..502283)
FT                   /locus_tag="AGOS_AgSNR32"
FT                   /old_locus_tag="AgSNR32"
FT   ncRNA           complement(502175..502283)
FT                   /locus_tag="AGOS_AgSNR32"
FT                   /old_locus_tag="AgSNR32"
FT                   /product="AgSNR32"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR32; start and end coordinates are approximate.
FT                   Similarity is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<502516..>503190)
FT                   /locus_tag="AGOS_AFR036C"
FT                   /old_locus_tag="AFR036C"
FT   mRNA            complement(<502516..>503190)
FT                   /locus_tag="AGOS_AFR036C"
FT                   /old_locus_tag="AFR036C"
FT                   /product="AFR036Cp"
FT   CDS_pept        complement(502516..503190)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR036C"
FT                   /old_locus_tag="AFR036C"
FT                   /product="AFR036Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHR140W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR036C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53407"
FT                   /db_xref="GOA:Q754N6"
FT                   /db_xref="InterPro:IPR006838"
FT                   /db_xref="UniProtKB/TrEMBL:Q754N6"
FT                   /protein_id="AAS53407.1"
FT                   LS"
FT   gene            <503607..>505019
FT                   /locus_tag="AGOS_AFR037W"
FT                   /old_locus_tag="AFR037W"
FT   mRNA            <503607..>505019
FT                   /locus_tag="AGOS_AFR037W"
FT                   /old_locus_tag="AFR037W"
FT                   /product="AFR037Wp"
FT   CDS_pept        503607..505019
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR037W"
FT                   /old_locus_tag="AFR037W"
FT                   /product="AFR037Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL142W
FT                   (MEP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR037W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53408"
FT                   /db_xref="GOA:Q754N5"
FT                   /db_xref="InterPro:IPR001905"
FT                   /db_xref="InterPro:IPR024041"
FT                   /db_xref="InterPro:IPR029020"
FT                   /db_xref="UniProtKB/TrEMBL:Q754N5"
FT                   /protein_id="AAS53408.2"
FT                   PRETPELDAVVS"
FT   gene            <505224..>505564
FT                   /locus_tag="AGOS_AFR038W"
FT                   /old_locus_tag="AFR038W"
FT   mRNA            join(<505224..505272,505323..>505564)
FT                   /locus_tag="AGOS_AFR038W"
FT                   /old_locus_tag="AFR038W"
FT                   /product="AFR038Wp"
FT   CDS_pept        join(505224..505272,505323..505564)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR038W"
FT                   /old_locus_tag="AFR038W"
FT                   /product="AFR038Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHR138C; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR038W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53409"
FT                   /db_xref="InterPro:IPR037045"
FT                   /db_xref="UniProtKB/TrEMBL:Q754N4"
FT                   /protein_id="AAS53409.1"
FT   gene            complement(<505605..>506042)
FT                   /locus_tag="AGOS_AFR039C"
FT                   /old_locus_tag="AFR039C"
FT   mRNA            complement(join(<505605..505985,506034..>506042))
FT                   /locus_tag="AGOS_AFR039C"
FT                   /old_locus_tag="AFR039C"
FT                   /product="AFR039Cp"
FT   CDS_pept        complement(join(505605..505985,506034..506042))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR039C"
FT                   /old_locus_tag="AFR039C"
FT                   /product="AFR039Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL153C
FT                   (GIM3); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR039C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53410"
FT                   /db_xref="GOA:Q754N3"
FT                   /db_xref="InterPro:IPR002777"
FT                   /db_xref="InterPro:IPR009053"
FT                   /db_xref="InterPro:IPR016661"
FT                   /db_xref="UniProtKB/TrEMBL:Q754N3"
FT                   /protein_id="AAS53410.2"
FT   gene            <507026..>508669
FT                   /locus_tag="AGOS_AFR040W"
FT                   /old_locus_tag="AFR040W"
FT   mRNA            <507026..>508669
FT                   /locus_tag="AGOS_AFR040W"
FT                   /old_locus_tag="AFR040W"
FT                   /product="AFR040Wp"
FT   CDS_pept        507026..508669
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR040W"
FT                   /old_locus_tag="AFR040W"
FT                   /product="AFR040Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR135C
FT                   (YCK1) and YNL154C (YCK2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR040W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53411"
FT                   /db_xref="GOA:Q754N2"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q754N2"
FT                   /protein_id="AAS53411.1"
FT   gene            complement(<509669..>510442)
FT                   /locus_tag="AGOS_AFR041C"
FT                   /old_locus_tag="AFR041C"
FT   mRNA            complement(<509669..>510442)
FT                   /locus_tag="AGOS_AFR041C"
FT                   /old_locus_tag="AFR041C"
FT                   /product="AFR041Cp"
FT   CDS_pept        complement(509669..510442)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR041C"
FT                   /old_locus_tag="AFR041C"
FT                   /product="AFR041Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YNL155W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR041C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53412"
FT                   /db_xref="GOA:Q754N1"
FT                   /db_xref="InterPro:IPR000058"
FT                   /db_xref="InterPro:IPR035896"
FT                   /db_xref="UniProtKB/TrEMBL:Q754N1"
FT                   /protein_id="AAS53412.1"
FT   gene            <511017..>511244
FT                   /locus_tag="AGOS_AFR041WA"
FT   mRNA            <511017..>511244
FT                   /locus_tag="AGOS_AFR041WA"
FT                   /product="AFR041W-Ap"
FT   CDS_pept        511017..511244
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR041WA"
FT                   /product="AFR041W-Ap"
FT                   /note="NOHBY672; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F27841g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR041WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41788"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGF8"
FT                   /protein_id="ADJ41788.1"
FT   gene            complement(<511575..>512249)
FT                   /locus_tag="AGOS_AFR042C"
FT                   /old_locus_tag="AFR042C"
FT   mRNA            complement(<511575..>512249)
FT                   /locus_tag="AGOS_AFR042C"
FT                   /old_locus_tag="AFR042C"
FT                   /product="AFR042Cp"
FT   CDS_pept        complement(511575..512249)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR042C"
FT                   /old_locus_tag="AFR042C"
FT                   /product="AFR042Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR134W
FT                   (WSS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR042C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53413"
FT                   /db_xref="InterPro:IPR013536"
FT                   /db_xref="UniProtKB/TrEMBL:Q754N0"
FT                   /protein_id="AAS53413.2"
FT                   ED"
FT   gene            <512442..>513257
FT                   /locus_tag="AGOS_AFR043W"
FT                   /old_locus_tag="AFR043W"
FT   mRNA            <512442..>513257
FT                   /locus_tag="AGOS_AFR043W"
FT                   /old_locus_tag="AFR043W"
FT                   /product="AFR043Wp"
FT   CDS_pept        512442..513257
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR043W"
FT                   /old_locus_tag="AFR043W"
FT                   /product="AFR043Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL156C
FT                   (NSG2) and YHR133C (NSG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR043W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53414"
FT                   /db_xref="GOA:Q754M9"
FT                   /db_xref="InterPro:IPR025929"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M9"
FT                   /protein_id="AAS53414.1"
FT   gene            complement(<513422..>513802)
FT                   /locus_tag="AGOS_AFR044C"
FT                   /old_locus_tag="AFR044C"
FT   mRNA            complement(<513422..>513802)
FT                   /locus_tag="AGOS_AFR044C"
FT                   /old_locus_tag="AFR044C"
FT                   /product="AFR044Cp"
FT   CDS_pept        complement(513422..513802)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR044C"
FT                   /old_locus_tag="AFR044C"
FT                   /product="AFR044Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHR132W-A (IGO2) and YNL157W (IGO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR044C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53415"
FT                   /db_xref="GOA:Q754M8"
FT                   /db_xref="InterPro:IPR006760"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M8"
FT                   /protein_id="AAS53415.1"
FT   gene            <514164..>515468
FT                   /locus_tag="AGOS_AFR045W"
FT                   /old_locus_tag="AFR045W"
FT   mRNA            <514164..>515468
FT                   /locus_tag="AGOS_AFR045W"
FT                   /old_locus_tag="AFR045W"
FT                   /product="AFR045Wp"
FT   CDS_pept        514164..515468
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR045W"
FT                   /old_locus_tag="AFR045W"
FT                   /product="AFR045Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR132C
FT                   (ECM14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR045W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53416"
FT                   /db_xref="GOA:Q754M7"
FT                   /db_xref="InterPro:IPR000834"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M7"
FT                   /protein_id="AAS53416.1"
FT   gene            complement(<515478..>516107)
FT                   /locus_tag="AGOS_AFR046C"
FT                   /old_locus_tag="AFR046C"
FT   mRNA            complement(<515478..>516107)
FT                   /locus_tag="AGOS_AFR046C"
FT                   /old_locus_tag="AFR046C"
FT                   /product="AFR046Cp"
FT   CDS_pept        complement(515478..516107)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR046C"
FT                   /old_locus_tag="AFR046C"
FT                   /product="AFR046Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL158W
FT                   (PGA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR046C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53417"
FT                   /db_xref="GOA:Q754M6"
FT                   /db_xref="InterPro:IPR019433"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M6"
FT                   /protein_id="AAS53417.1"
FT   gene            <516226..>517002
FT                   /locus_tag="AGOS_AFR047W"
FT                   /old_locus_tag="AFR047W"
FT   mRNA            <516226..>517002
FT                   /locus_tag="AGOS_AFR047W"
FT                   /old_locus_tag="AFR047W"
FT                   /product="AFR047Wp"
FT   CDS_pept        516226..517002
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR047W"
FT                   /old_locus_tag="AFR047W"
FT                   /product="AFR047Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL159C
FT                   (ASI2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR047W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53418"
FT                   /db_xref="GOA:Q754M5"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M5"
FT                   /protein_id="AAS53418.1"
FT   gene            <517129..>518292
FT                   /locus_tag="AGOS_AFR048W"
FT                   /old_locus_tag="AFR048W"
FT   mRNA            <517129..>518292
FT                   /locus_tag="AGOS_AFR048W"
FT                   /old_locus_tag="AFR048W"
FT                   /product="AFR048Wp"
FT   CDS_pept        517129..518292
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR048W"
FT                   /old_locus_tag="AFR048W"
FT                   /product="AFR048Wp"
FT                   /note="NOHBY619; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F27995g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR048W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53419"
FT                   /db_xref="GOA:Q754M4"
FT                   /db_xref="InterPro:IPR006035"
FT                   /db_xref="InterPro:IPR020855"
FT                   /db_xref="InterPro:IPR023696"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M4"
FT                   /protein_id="AAS53419.2"
FT   gene            <518736..>520889
FT                   /locus_tag="AGOS_AFR049W"
FT                   /old_locus_tag="AFR049W"
FT   mRNA            <518736..>520889
FT                   /locus_tag="AGOS_AFR049W"
FT                   /old_locus_tag="AFR049W"
FT                   /product="AFR049Wp"
FT   CDS_pept        518736..520889
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR049W"
FT                   /old_locus_tag="AFR049W"
FT                   /product="AFR049Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL144C
FT                   and YHR131C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR049W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53420"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M3"
FT                   /protein_id="AAS53420.1"
FT   gene            <522259..>524079
FT                   /locus_tag="AGOS_AFR050W"
FT                   /old_locus_tag="AFR050W"
FT   mRNA            <522259..>524079
FT                   /locus_tag="AGOS_AFR050W"
FT                   /old_locus_tag="AFR050W"
FT                   /product="AFR050Wp"
FT   CDS_pept        522259..524079
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR050W"
FT                   /old_locus_tag="AFR050W"
FT                   /product="AFR050Wp"
FT                   /note="NOHBY620; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E23034g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR050W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53421"
FT                   /db_xref="GOA:Q754M2"
FT                   /db_xref="InterPro:IPR000315"
FT                   /db_xref="InterPro:IPR018553"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M2"
FT                   /protein_id="AAS53421.1"
FT   gene            <524254..>525471
FT                   /locus_tag="AGOS_AFR051W"
FT                   /old_locus_tag="AFR051W"
FT   mRNA            <524254..>525471
FT                   /locus_tag="AGOS_AFR051W"
FT                   /old_locus_tag="AFR051W"
FT                   /product="AFR051Wp"
FT   CDS_pept        524254..525471
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR051W"
FT                   /old_locus_tag="AFR051W"
FT                   /product="AFR051Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR129C
FT                   (ARP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR051W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53422"
FT                   /db_xref="GOA:Q754M1"
FT                   /db_xref="InterPro:IPR004000"
FT                   /db_xref="InterPro:IPR020902"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M1"
FT                   /protein_id="AAS53422.2"
FT                   IHSRFM"
FT   gene            complement(<525568..>526266)
FT                   /locus_tag="AGOS_AFR052C"
FT                   /old_locus_tag="AFR052C"
FT   mRNA            complement(<525568..>526266)
FT                   /locus_tag="AGOS_AFR052C"
FT                   /old_locus_tag="AFR052C"
FT                   /product="AFR052Cp"
FT   CDS_pept        complement(525568..526266)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR052C"
FT                   /old_locus_tag="AFR052C"
FT                   /product="AFR052Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR128W
FT                   (FUR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR052C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53423"
FT                   /db_xref="GOA:Q754M0"
FT                   /db_xref="InterPro:IPR000836"
FT                   /db_xref="InterPro:IPR029057"
FT                   /db_xref="UniProtKB/TrEMBL:Q754M0"
FT                   /protein_id="AAS53423.1"
FT                   GDFGDRYYCI"
FT   gene            complement(<526403..>526810)
FT                   /locus_tag="AGOS_AFR053C"
FT                   /old_locus_tag="AFR053C"
FT   mRNA            complement(join(<526403..526738,526799..>526810))
FT                   /locus_tag="AGOS_AFR053C"
FT                   /old_locus_tag="AFR053C"
FT                   /product="AFR053Cp"
FT   CDS_pept        complement(join(526403..526738,526799..526810))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR053C"
FT                   /old_locus_tag="AFR053C"
FT                   /product="AFR053Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL147W
FT                   (LSM7); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR053C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53424"
FT                   /db_xref="GOA:Q754L9"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR017132"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L9"
FT                   /protein_id="AAS53424.2"
FT                   GGAVVPGPAAE"
FT   gene            <526957..>527703
FT                   /locus_tag="AGOS_AFR054W"
FT                   /old_locus_tag="AFR054W"
FT   mRNA            <526957..>527703
FT                   /locus_tag="AGOS_AFR054W"
FT                   /old_locus_tag="AFR054W"
FT                   /product="AFR054Wp"
FT   CDS_pept        526957..527703
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR054W"
FT                   /old_locus_tag="AFR054W"
FT                   /product="AFR054Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL148C
FT                   (ALF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR054W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53425"
FT                   /db_xref="GOA:Q754L8"
FT                   /db_xref="InterPro:IPR000938"
FT                   /db_xref="InterPro:IPR036859"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L8"
FT                   /protein_id="AAS53425.2"
FT   gene            <527800..>528174
FT                   /locus_tag="AGOS_AFR055W"
FT                   /old_locus_tag="AFR055W"
FT   mRNA            <527800..>528174
FT                   /locus_tag="AGOS_AFR055W"
FT                   /old_locus_tag="AFR055W"
FT                   /product="AFR055Wp"
FT   CDS_pept        527800..528174
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR055W"
FT                   /old_locus_tag="AFR055W"
FT                   /product="AFR055Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL149C
FT                   (PGA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR055W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53426"
FT                   /db_xref="GOA:Q754L7"
FT                   /db_xref="InterPro:IPR011431"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L7"
FT                   /protein_id="AAS53426.1"
FT   gene            <528349..>529053
FT                   /locus_tag="AGOS_AFR056W"
FT                   /old_locus_tag="AFR056W"
FT   mRNA            <528349..>529053
FT                   /locus_tag="AGOS_AFR056W"
FT                   /old_locus_tag="AFR056W"
FT                   /product="AFR056Wp"
FT   CDS_pept        528349..529053
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR056W"
FT                   /old_locus_tag="AFR056W"
FT                   /product="AFR056Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL151C
FT                   (RPC31)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR056W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53427"
FT                   /db_xref="GOA:Q754L6"
FT                   /db_xref="InterPro:IPR024661"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L6"
FT                   /protein_id="AAS53427.1"
FT                   GGDDDYGDEPAF"
FT   gene            complement(<529456..>530610)
FT                   /locus_tag="AGOS_AFR057C"
FT                   /old_locus_tag="AFR057C"
FT   mRNA            complement(<529456..>530610)
FT                   /locus_tag="AGOS_AFR057C"
FT                   /old_locus_tag="AFR057C"
FT                   /product="AFR057Cp"
FT   CDS_pept        complement(529456..530610)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR057C"
FT                   /old_locus_tag="AFR057C"
FT                   /product="AFR057Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL152W
FT                   (INN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR057C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53428"
FT                   /db_xref="GOA:Q754L5"
FT                   /db_xref="InterPro:IPR000008"
FT                   /db_xref="InterPro:IPR035892"
FT                   /db_xref="InterPro:IPR037791"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L5"
FT                   /protein_id="AAS53428.2"
FT   gene            complement(<530829..>535610)
FT                   /locus_tag="AGOS_AFR058C"
FT                   /old_locus_tag="AFR058C"
FT   mRNA            complement(<530829..>535610)
FT                   /locus_tag="AGOS_AFR058C"
FT                   /old_locus_tag="AFR058C"
FT                   /product="AFR058Cp"
FT   CDS_pept        complement(530829..535610)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR058C"
FT                   /old_locus_tag="AFR058C"
FT                   /product="AFR058Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL139C
FT                   (THO2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR058C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53429"
FT                   /db_xref="GOA:Q754L4"
FT                   /db_xref="InterPro:IPR021418"
FT                   /db_xref="InterPro:IPR021726"
FT                   /db_xref="InterPro:IPR032302"
FT                   /db_xref="InterPro:IPR040007"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L4"
FT                   /protein_id="AAS53429.2"
FT                   PTGPKGSGTFSRFR"
FT   gene            <535802..>536105
FT                   /locus_tag="AGOS_AFR059W"
FT                   /old_locus_tag="AFR059W"
FT   mRNA            join(<535802..535804,535854..>536105)
FT                   /locus_tag="AGOS_AFR059W"
FT                   /old_locus_tag="AFR059W"
FT                   /product="AFR059Wp"
FT   CDS_pept        join(535802..535804,535854..536105)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR059W"
FT                   /old_locus_tag="AFR059W"
FT                   /product="AFR059Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YNL138W-A ((YSF3); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR059W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53430"
FT                   /db_xref="GOA:Q754L3"
FT                   /db_xref="InterPro:IPR009846"
FT                   /db_xref="InterPro:IPR017089"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L3"
FT                   /protein_id="AAS53430.1"
FT   gene            complement(<536123..>536731)
FT                   /locus_tag="AGOS_AFR060C"
FT                   /old_locus_tag="AFR060C"
FT   mRNA            complement(<536123..>536731)
FT                   /locus_tag="AGOS_AFR060C"
FT                   /old_locus_tag="AFR060C"
FT                   /product="AFR060Cp"
FT   CDS_pept        complement(536123..536731)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR060C"
FT                   /old_locus_tag="AFR060C"
FT                   /product="AFR060Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHR127W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR060C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53431"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L2"
FT                   /protein_id="AAS53431.1"
FT   gene            <536984..>538495
FT                   /locus_tag="AGOS_AFR061W"
FT                   /old_locus_tag="AFR061W"
FT   mRNA            <536984..>538495
FT                   /locus_tag="AGOS_AFR061W"
FT                   /old_locus_tag="AFR061W"
FT                   /product="AFR061Wp"
FT   CDS_pept        536984..538495
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR061W"
FT                   /old_locus_tag="AFR061W"
FT                   /product="AFR061Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL138W
FT                   (SRV2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR061W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53432"
FT                   /db_xref="GOA:Q754L1"
FT                   /db_xref="InterPro:IPR001837"
FT                   /db_xref="InterPro:IPR006599"
FT                   /db_xref="InterPro:IPR013912"
FT                   /db_xref="InterPro:IPR013992"
FT                   /db_xref="InterPro:IPR016098"
FT                   /db_xref="InterPro:IPR017901"
FT                   /db_xref="InterPro:IPR018106"
FT                   /db_xref="InterPro:IPR028417"
FT                   /db_xref="InterPro:IPR028419"
FT                   /db_xref="InterPro:IPR036222"
FT                   /db_xref="InterPro:IPR036223"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L1"
FT                   /protein_id="AAS53432.2"
FT   gene            complement(<538633..>540054)
FT                   /locus_tag="AGOS_AFR062C"
FT                   /old_locus_tag="AFR062C"
FT   mRNA            complement(<538633..>540054)
FT                   /locus_tag="AGOS_AFR062C"
FT                   /old_locus_tag="AFR062C"
FT                   /product="AFR062Cp"
FT   CDS_pept        complement(538633..540054)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR062C"
FT                   /old_locus_tag="AFR062C"
FT                   /product="AFR062Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL137C
FT                   (NAM9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR062C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53433"
FT                   /db_xref="GOA:Q754L0"
FT                   /db_xref="InterPro:IPR002942"
FT                   /db_xref="InterPro:IPR005709"
FT                   /db_xref="InterPro:IPR018079"
FT                   /db_xref="InterPro:IPR022801"
FT                   /db_xref="InterPro:IPR036986"
FT                   /db_xref="UniProtKB/TrEMBL:Q754L0"
FT                   /protein_id="AAS53433.1"
FT                   PVHERAYMYYLRKGQ"
FT   gene            <540312..>541013
FT                   /locus_tag="AGOS_AFR063W"
FT                   /old_locus_tag="AFR063W"
FT   mRNA            <540312..>541013
FT                   /locus_tag="AGOS_AFR063W"
FT                   /old_locus_tag="AFR063W"
FT                   /product="AFR063Wp"
FT   CDS_pept        540312..541013
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR063W"
FT                   /old_locus_tag="AFR063W"
FT                   /product="AFR063Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL136W
FT                   (EAF7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR063W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53434"
FT                   /db_xref="GOA:Q754K9"
FT                   /db_xref="InterPro:IPR012423"
FT                   /db_xref="UniProtKB/TrEMBL:Q754K9"
FT                   /protein_id="AAS53434.1"
FT                   PPVQRRLRTRR"
FT   gene            complement(<541054..>541398)
FT                   /locus_tag="AGOS_AFR064C"
FT                   /old_locus_tag="AFR064C"
FT   mRNA            complement(<541054..>541398)
FT                   /locus_tag="AGOS_AFR064C"
FT                   /old_locus_tag="AFR064C"
FT                   /product="AFR064Cp"
FT   CDS_pept        complement(541054..541398)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR064C"
FT                   /old_locus_tag="AFR064C"
FT                   /product="AFR064Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL135C
FT                   (FPR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR064C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53435"
FT                   /db_xref="GOA:Q754K8"
FT                   /db_xref="InterPro:IPR001179"
FT                   /db_xref="InterPro:IPR023566"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754K8"
FT                   /protein_id="AAS53435.1"
FT                   IFEVELLKVN"
FT   gene            <542050..>542541
FT                   /locus_tag="AGOS_AFR065W"
FT                   /old_locus_tag="AFR065W"
FT   mRNA            <542050..>542541
FT                   /locus_tag="AGOS_AFR065W"
FT                   /old_locus_tag="AFR065W"
FT                   /product="AFR065Wp"
FT   CDS_pept        542050..542541
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR065W"
FT                   /old_locus_tag="AFR065W"
FT                   /product="AFR065Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR126C
FT                   (ANS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR065W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53436"
FT                   /db_xref="GOA:Q754K7"
FT                   /db_xref="InterPro:IPR000420"
FT                   /db_xref="UniProtKB/TrEMBL:Q754K7"
FT                   /protein_id="AAS53436.2"
FT                   "
FT   gene            complement(<542945..>544057)
FT                   /locus_tag="AGOS_AFR066C"
FT                   /old_locus_tag="AFR066C"
FT   mRNA            complement(<542945..>544057)
FT                   /locus_tag="AGOS_AFR066C"
FT                   /old_locus_tag="AFR066C"
FT                   /product="AFR066Cp"
FT   CDS_pept        complement(542945..544057)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR066C"
FT                   /old_locus_tag="AFR066C"
FT                   /product="AFR066Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNL134C
FT                   and Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YCR102C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR066C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53437"
FT                   /db_xref="GOA:Q754K6"
FT                   /db_xref="InterPro:IPR011032"
FT                   /db_xref="InterPro:IPR013149"
FT                   /db_xref="InterPro:IPR020843"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q754K6"
FT                   /protein_id="AAS53437.2"
FT   gene            complement(544573..544684)
FT                   /locus_tag="AGOS_t0138"
FT   tRNA            complement(join(544573..544616,544647..544684))
FT                   /locus_tag="AGOS_t0138"
FT                   /product="tRNA-Leu"
FT                   /note="codon recognized: UUG"
FT   gene            <544975..>546621
FT                   /locus_tag="AGOS_AFR067W"
FT                   /old_locus_tag="AFR067W"
FT   mRNA            <544975..>546621
FT                   /locus_tag="AGOS_AFR067W"
FT                   /old_locus_tag="AFR067W"
FT                   /product="AFR067Wp"
FT   CDS_pept        544975..546621
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR067W"
FT                   /old_locus_tag="AFR067W"
FT                   /product="AFR067Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL111W
FT                   (CCT7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR067W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53438"
FT                   /db_xref="GOA:Q754K5"
FT                   /db_xref="InterPro:IPR002194"
FT                   /db_xref="InterPro:IPR002423"
FT                   /db_xref="InterPro:IPR012720"
FT                   /db_xref="InterPro:IPR017998"
FT                   /db_xref="InterPro:IPR027409"
FT                   /db_xref="InterPro:IPR027410"
FT                   /db_xref="InterPro:IPR027413"
FT                   /db_xref="UniProtKB/TrEMBL:Q754K5"
FT                   /protein_id="AAS53438.1"
FT   gene            complement(<546698..>547312)
FT                   /locus_tag="AGOS_AFR068C"
FT                   /old_locus_tag="AFR068C"
FT   mRNA            complement(<546698..>547312)
FT                   /locus_tag="AGOS_AFR068C"
FT                   /old_locus_tag="AFR068C"
FT                   /product="AFR068Cp"
FT   CDS_pept        complement(546698..547312)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR068C"
FT                   /old_locus_tag="AFR068C"
FT                   /product="AFR068Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKR035W-A (DID2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR068C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53439"
FT                   /db_xref="GOA:Q754K4"
FT                   /db_xref="InterPro:IPR005024"
FT                   /db_xref="UniProtKB/TrEMBL:Q754K4"
FT                   /protein_id="AAS53439.1"
FT   gene            complement(<547567..>548493)
FT                   /locus_tag="AGOS_AFR069C"
FT                   /old_locus_tag="AFR069C"
FT   mRNA            complement(<547567..>548493)
FT                   /locus_tag="AGOS_AFR069C"
FT                   /old_locus_tag="AFR069C"
FT                   /product="AFR069Cp"
FT   CDS_pept        complement(547567..548493)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR069C"
FT                   /old_locus_tag="AFR069C"
FT                   /product="AFR069Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR034W
FT                   (DAL80) and YJL110C (GZF3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR069C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53440"
FT                   /db_xref="GOA:Q754K3"
FT                   /db_xref="InterPro:IPR000679"
FT                   /db_xref="InterPro:IPR013088"
FT                   /db_xref="InterPro:IPR039355"
FT                   /db_xref="UniProtKB/TrEMBL:Q754K3"
FT                   /protein_id="AAS53440.2"
FT   gene            <548779..>549189
FT                   /locus_tag="AGOS_AFR070W"
FT                   /old_locus_tag="AFR070W"
FT   mRNA            <548779..>549189
FT                   /locus_tag="AGOS_AFR070W"
FT                   /old_locus_tag="AFR070W"
FT                   /product="AFR070Wp"
FT   CDS_pept        548779..549189
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR070W"
FT                   /old_locus_tag="AFR070W"
FT                   /product="AFR070Wp"
FT                   /note="NOHBY622; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0D04950g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR070W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53441"
FT                   /db_xref="InterPro:IPR014980"
FT                   /db_xref="InterPro:IPR023389"
FT                   /db_xref="UniProtKB/TrEMBL:Q754K2"
FT                   /protein_id="AAS53441.1"
FT   gene            <549254..>553987
FT                   /locus_tag="AGOS_AFR071W"
FT                   /old_locus_tag="AFR071W"
FT   mRNA            <549254..>553987
FT                   /locus_tag="AGOS_AFR071W"
FT                   /old_locus_tag="AFR071W"
FT                   /product="AFR071Wp"
FT   CDS_pept        549254..553987
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR071W"
FT                   /old_locus_tag="AFR071W"
FT                   /product="AFR071Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR031C
FT                   (SPO14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR071W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53442"
FT                   /db_xref="GOA:Q754K1"
FT                   /db_xref="InterPro:IPR001736"
FT                   /db_xref="InterPro:IPR015679"
FT                   /db_xref="InterPro:IPR016555"
FT                   /db_xref="InterPro:IPR025202"
FT                   /db_xref="UniProtKB/TrEMBL:Q754K1"
FT                   /protein_id="AAS53442.2"
FT   gene            <554618..>556216
FT                   /locus_tag="AGOS_AFR072W"
FT                   /old_locus_tag="AFR072W"
FT   mRNA            <554618..>556216
FT                   /locus_tag="AGOS_AFR072W"
FT                   /old_locus_tag="AFR072W"
FT                   /product="AFR072Wp"
FT   CDS_pept        554618..556216
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR072W"
FT                   /old_locus_tag="AFR072W"
FT                   /product="AFR072Wp"
FT                   /note="NOHBY623; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F21252g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR072W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53443"
FT                   /db_xref="UniProtKB/TrEMBL:Q754K0"
FT                   /protein_id="AAS53443.2"
FT                   SNKVHLSRHTGCVSR"
FT   gene            complement(<556329..>557063)
FT                   /locus_tag="AGOS_AFR073C"
FT                   /old_locus_tag="AFR073C"
FT   mRNA            complement(<556329..>557063)
FT                   /locus_tag="AGOS_AFR073C"
FT                   /old_locus_tag="AFR073C"
FT                   /product="AFR073Cp"
FT   CDS_pept        complement(556329..557063)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR073C"
FT                   /old_locus_tag="AFR073C"
FT                   /product="AFR073Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR030W
FT                   (GMH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR073C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53444"
FT                   /db_xref="GOA:Q754J9"
FT                   /db_xref="InterPro:IPR007881"
FT                   /db_xref="UniProtKB/TrEMBL:Q754J9"
FT                   /protein_id="AAS53444.1"
FT   gene            complement(<557299..>562623)
FT                   /locus_tag="AGOS_AFR074C"
FT                   /old_locus_tag="AFR074C"
FT   mRNA            complement(<557299..>562623)
FT                   /locus_tag="AGOS_AFR074C"
FT                   /old_locus_tag="AFR074C"
FT                   /product="AFR074Cp"
FT   CDS_pept        complement(557299..562623)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR074C"
FT                   /old_locus_tag="AFR074C"
FT                   /product="AFR074Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL109C
FT                   (UTP10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR074C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53445"
FT                   /db_xref="GOA:Q754J8"
FT                   /db_xref="InterPro:IPR012954"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR021133"
FT                   /db_xref="InterPro:IPR022125"
FT                   /db_xref="InterPro:IPR040191"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754J8"
FT                   /protein_id="AAS53445.1"
FT                   LVKVVETVLGEPFDRYLT"
FT   gene            complement(<562944..>565166)
FT                   /locus_tag="AGOS_AFR075C"
FT                   /old_locus_tag="AFR075C"
FT   mRNA            complement(<562944..>565166)
FT                   /locus_tag="AGOS_AFR075C"
FT                   /old_locus_tag="AFR075C"
FT                   /product="AFR075Cp"
FT   CDS_pept        complement(562944..565166)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR075C"
FT                   /old_locus_tag="AFR075C"
FT                   /product="AFR075Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL108C
FT                   (PRM10) and YJL107C; YJL108C and YJL107C represent one ORF
FT                   in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR075C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53446"
FT                   /db_xref="GOA:Q754J7"
FT                   /db_xref="InterPro:IPR010619"
FT                   /db_xref="InterPro:IPR024528"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754J7"
FT                   /protein_id="AAS53446.1"
FT   gene            <565674..>568136
FT                   /locus_tag="AGOS_AFR076W"
FT                   /old_locus_tag="AFR076W"
FT   mRNA            <565674..>568136
FT                   /locus_tag="AGOS_AFR076W"
FT                   /old_locus_tag="AFR076W"
FT                   /product="AFR076Wp"
FT   CDS_pept        565674..568136
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR076W"
FT                   /old_locus_tag="AFR076W"
FT                   /product="AFR076Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL106W
FT                   (IME2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR076W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53447"
FT                   /db_xref="GOA:Q754J6"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q754J6"
FT                   /protein_id="AAS53447.1"
FT                   SFEDGLSF"
FT   gene            <568932..>571310
FT                   /locus_tag="AGOS_AFR077W"
FT                   /old_locus_tag="AFR077W"
FT   mRNA            <568932..>571310
FT                   /locus_tag="AGOS_AFR077W"
FT                   /old_locus_tag="AFR077W"
FT                   /product="AFR077Wp"
FT   CDS_pept        568932..571310
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR077W"
FT                   /old_locus_tag="AFR077W"
FT                   /product="AFR077Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR029C
FT                   (SET3) and YJL105W (SET4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR077W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53448"
FT                   /db_xref="GOA:Q754J5"
FT                   /db_xref="InterPro:IPR001214"
FT                   /db_xref="InterPro:IPR001965"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR019786"
FT                   /db_xref="InterPro:IPR019787"
FT                   /db_xref="UniProtKB/TrEMBL:Q754J5"
FT                   /protein_id="AAS53448.2"
FT   gene            <571599..>572009
FT                   /locus_tag="AGOS_AFR078W"
FT                   /old_locus_tag="AFR078W"
FT   mRNA            <571599..>572009
FT                   /locus_tag="AGOS_AFR078W"
FT                   /old_locus_tag="AFR078W"
FT                   /product="AFR078Wp"
FT   CDS_pept        571599..572009
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR078W"
FT                   /old_locus_tag="AFR078W"
FT                   /product="AFR078Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL104W
FT                   (PAM16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR078W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53449"
FT                   /db_xref="GOA:Q754J4"
FT                   /db_xref="InterPro:IPR005341"
FT                   /db_xref="InterPro:IPR036869"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754J4"
FT                   /protein_id="AAS53449.2"
FT   gene            complement(572250..572490)
FT                   /locus_tag="AGOS_AgSNR37"
FT                   /old_locus_tag="AgSNR37"
FT   ncRNA           complement(572250..572490)
FT                   /locus_tag="AGOS_AgSNR37"
FT                   /old_locus_tag="AgSNR37"
FT                   /product="AgSNR37"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR37; start and end coordinates are approximate.
FT                   Similarity is partial. In synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<572660..>574009)
FT                   /locus_tag="AGOS_AFR079C"
FT                   /old_locus_tag="AFR079C"
FT   mRNA            complement(<572660..>574009)
FT                   /locus_tag="AGOS_AFR079C"
FT                   /old_locus_tag="AFR079C"
FT                   /product="AFR079Cp"
FT   CDS_pept        complement(572660..574009)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR079C"
FT                   /old_locus_tag="AFR079C"
FT                   /product="AFR079Cp"
FT                   /note="NOHBY624; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0D05192g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR079C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53450"
FT                   /db_xref="GOA:Q754Y6"
FT                   /db_xref="InterPro:IPR000571"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y6"
FT                   /protein_id="AAS53450.1"
FT   gene            <574181..>575698
FT                   /locus_tag="AGOS_AFR080W"
FT                   /old_locus_tag="AFR080W"
FT   mRNA            <574181..>575698
FT                   /locus_tag="AGOS_AFR080W"
FT                   /old_locus_tag="AFR080W"
FT                   /product="AFR080Wp"
FT   CDS_pept        574181..575698
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR080W"
FT                   /old_locus_tag="AFR080W"
FT                   /product="AFR080Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKR023W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR080W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53451"
FT                   /db_xref="GOA:Q754Y5"
FT                   /db_xref="InterPro:IPR009349"
FT                   /db_xref="InterPro:IPR039128"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y5"
FT                   /protein_id="AAS53451.1"
FT   gene            complement(<575785..>577233)
FT                   /locus_tag="AGOS_AFR081C"
FT                   /old_locus_tag="AFR081C"
FT   mRNA            complement(<575785..>577233)
FT                   /locus_tag="AGOS_AFR081C"
FT                   /old_locus_tag="AFR081C"
FT                   /product="AFR081Cp"
FT   CDS_pept        complement(575785..577233)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR081C"
FT                   /old_locus_tag="AFR081C"
FT                   /product="AFR081Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL103C
FT                   (GSM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR081C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53452"
FT                   /db_xref="GOA:Q754J3"
FT                   /db_xref="InterPro:IPR000014"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754J3"
FT                   /protein_id="AAS53452.1"
FT   gene            complement(<577594..>579726)
FT                   /locus_tag="AGOS_AFR082C"
FT                   /old_locus_tag="AFR082C"
FT   mRNA            complement(<577594..>579726)
FT                   /locus_tag="AGOS_AFR082C"
FT                   /old_locus_tag="AFR082C"
FT                   /product="AFR082Cp"
FT   CDS_pept        complement(577594..579726)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR082C"
FT                   /old_locus_tag="AFR082C"
FT                   /product="AFR082Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR024C
FT                   (DBP7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR082C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53453"
FT                   /db_xref="GOA:Q754J2"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR025313"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754J2"
FT                   /protein_id="AAS53453.1"
FT                   RMARQAVAQSNSEFNY"
FT   gene            <579951..>580724
FT                   /locus_tag="AGOS_AFR083W"
FT                   /old_locus_tag="AFR083W"
FT   mRNA            <579951..>580724
FT                   /locus_tag="AGOS_AFR083W"
FT                   /old_locus_tag="AFR083W"
FT                   /product="AFR083Wp"
FT   CDS_pept        579951..580724
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR083W"
FT                   /old_locus_tag="AFR083W"
FT                   /product="AFR083Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR025W
FT                   (RPC37)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR083W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53454"
FT                   /db_xref="GOA:Q754J1"
FT                   /db_xref="InterPro:IPR006886"
FT                   /db_xref="UniProtKB/TrEMBL:Q754J1"
FT                   /protein_id="AAS53454.1"
FT   gene            complement(<580770..>581684)
FT                   /locus_tag="AGOS_AFR084C"
FT                   /old_locus_tag="AFR084C"
FT   mRNA            complement(<580770..>581684)
FT                   /locus_tag="AGOS_AFR084C"
FT                   /old_locus_tag="AFR084C"
FT                   /product="AFR084Cp"
FT   CDS_pept        complement(580770..581684)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR084C"
FT                   /old_locus_tag="AFR084C"
FT                   /product="AFR084Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR026C
FT                   (GCN3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR084C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53455"
FT                   /db_xref="GOA:Q754J0"
FT                   /db_xref="InterPro:IPR000649"
FT                   /db_xref="InterPro:IPR037171"
FT                   /db_xref="InterPro:IPR042528"
FT                   /db_xref="InterPro:IPR042529"
FT                   /db_xref="UniProtKB/TrEMBL:Q754J0"
FT                   /protein_id="AAS53455.2"
FT   gene            <581737..>584244
FT                   /locus_tag="AGOS_AFR085W"
FT                   /old_locus_tag="AFR085W"
FT   mRNA            <581737..>584244
FT                   /locus_tag="AGOS_AFR085W"
FT                   /old_locus_tag="AFR085W"
FT                   /product="AFR085Wp"
FT   CDS_pept        581737..584244
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR085W"
FT                   /old_locus_tag="AFR085W"
FT                   /product="AFR085Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL102W
FT                   (MEF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR085W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53456"
FT                   /db_xref="GOA:Q754I9"
FT                   /db_xref="InterPro:IPR000640"
FT                   /db_xref="InterPro:IPR000795"
FT                   /db_xref="InterPro:IPR004161"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR009022"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR030851"
FT                   /db_xref="InterPro:IPR031157"
FT                   /db_xref="InterPro:IPR035647"
FT                   /db_xref="InterPro:IPR035649"
FT                   /db_xref="InterPro:IPR041095"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754I9"
FT                   /protein_id="AAS53456.1"
FT   gene            complement(<584485..>586470)
FT                   /locus_tag="AGOS_AFR086C"
FT                   /old_locus_tag="AFR086C"
FT   mRNA            complement(<584485..>586470)
FT                   /locus_tag="AGOS_AFR086C"
FT                   /old_locus_tag="AFR086C"
FT                   /product="AFR086Cp"
FT   CDS_pept        complement(584485..586470)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR086C"
FT                   /old_locus_tag="AFR086C"
FT                   /product="AFR086Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL101C
FT                   (GSH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR086C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53457"
FT                   /db_xref="GOA:Q754I8"
FT                   /db_xref="InterPro:IPR004308"
FT                   /db_xref="InterPro:IPR014746"
FT                   /db_xref="UniProtKB/TrEMBL:Q754I8"
FT                   /protein_id="AAS53457.1"
FT   gene            <587028..>588668
FT                   /locus_tag="AGOS_AFR087W"
FT                   /old_locus_tag="AFR087W"
FT   mRNA            <587028..>588668
FT                   /locus_tag="AGOS_AFR087W"
FT                   /old_locus_tag="AFR087W"
FT                   /product="AFR087Wp"
FT   CDS_pept        587028..588668
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR087W"
FT                   /old_locus_tag="AFR087W"
FT                   /product="AFR087Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL100W
FT                   (LSB6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR087W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53458"
FT                   /db_xref="GOA:Q754I7"
FT                   /db_xref="InterPro:IPR000403"
FT                   /db_xref="InterPro:IPR039756"
FT                   /db_xref="UniProtKB/TrEMBL:Q754I7"
FT                   /protein_id="AAS53458.2"
FT   gene            <588861..>591029
FT                   /locus_tag="AGOS_AFR088W"
FT                   /old_locus_tag="AFR088W"
FT   mRNA            <588861..>591029
FT                   /locus_tag="AGOS_AFR088W"
FT                   /old_locus_tag="AFR088W"
FT                   /product="AFR088Wp"
FT   CDS_pept        588861..591029
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR088W"
FT                   /old_locus_tag="AFR088W"
FT                   /product="AFR088Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL099W
FT                   (CHS6) and YKR027W (BCH2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR088W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53459"
FT                   /db_xref="GOA:Q754I6"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR015374"
FT                   /db_xref="UniProtKB/TrEMBL:Q754I6"
FT                   /protein_id="AAS53459.1"
FT   gene            <591557..>594652
FT                   /locus_tag="AGOS_AFR089W"
FT                   /old_locus_tag="AFR089W"
FT   mRNA            <591557..>594652
FT                   /locus_tag="AGOS_AFR089W"
FT                   /old_locus_tag="AFR089W"
FT                   /product="AFR089Wp"
FT   CDS_pept        591557..594652
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR089W"
FT                   /old_locus_tag="AFR089W"
FT                   /product="AFR089Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR028W
FT                   (SAP190) and YJL098W (SAP185)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR089W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53460"
FT                   /db_xref="GOA:Q754I5"
FT                   /db_xref="InterPro:IPR007587"
FT                   /db_xref="UniProtKB/TrEMBL:Q754I5"
FT                   /protein_id="AAS53460.2"
FT   gene            <594940..>595593
FT                   /locus_tag="AGOS_AFR090W"
FT                   /old_locus_tag="AFR090W"
FT   mRNA            <594940..>595593
FT                   /locus_tag="AGOS_AFR090W"
FT                   /old_locus_tag="AFR090W"
FT                   /product="AFR090Wp"
FT   CDS_pept        594940..595593
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR090W"
FT                   /old_locus_tag="AFR090W"
FT                   /product="AFR090Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL097W
FT                   (PHS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR090W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53461"
FT                   /db_xref="GOA:Q754Y4"
FT                   /db_xref="InterPro:IPR007482"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y4"
FT                   /protein_id="AAS53461.1"
FT   gene            <595762..>596241
FT                   /locus_tag="AGOS_AFR091W"
FT                   /old_locus_tag="AFR091W"
FT   mRNA            <595762..>596241
FT                   /locus_tag="AGOS_AFR091W"
FT                   /old_locus_tag="AFR091W"
FT                   /product="AFR091Wp"
FT   CDS_pept        595762..596241
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR091W"
FT                   /old_locus_tag="AFR091W"
FT                   /product="AFR091Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL096W
FT                   (MRPL49)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR091W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53462"
FT                   /db_xref="GOA:Q754Y7"
FT                   /db_xref="InterPro:IPR028909"
FT                   /db_xref="InterPro:IPR036164"
FT                   /db_xref="UniProtKB/TrEMBL:Q754Y7"
FT                   /protein_id="AAS53462.1"
FT   gene            <596512..>600783
FT                   /locus_tag="AGOS_AFR092W"
FT                   /old_locus_tag="AFR092W"
FT   mRNA            <596512..>600783
FT                   /locus_tag="AGOS_AFR092W"
FT                   /old_locus_tag="AFR092W"
FT                   /product="AFR092Wp"
FT   CDS_pept        596512..600783
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR092W"
FT                   /old_locus_tag="AFR092W"
FT                   /product="AFR092Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL095W
FT                   (BCK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR092W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53463"
FT                   /db_xref="GOA:Q754I4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013761"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q754I4"
FT                   /protein_id="AAS53463.1"
FT   gene            <601121..>604516
FT                   /locus_tag="AGOS_AFR093W"
FT                   /old_locus_tag="AFR093W"
FT   mRNA            <601121..>604516
FT                   /locus_tag="AGOS_AFR093W"
FT                   /old_locus_tag="AFR093W"
FT                   /product="AFR093Wp"
FT   CDS_pept        601121..604516
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR093W"
FT                   /old_locus_tag="AFR093W"
FT                   /product="AFR093Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL092W
FT                   (SRS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR093W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53464"
FT                   /db_xref="GOA:Q754I3"
FT                   /db_xref="InterPro:IPR000212"
FT                   /db_xref="InterPro:IPR013986"
FT                   /db_xref="InterPro:IPR014016"
FT                   /db_xref="InterPro:IPR014017"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR034739"
FT                   /db_xref="UniProtKB/TrEMBL:Q754I3"
FT                   /protein_id="AAS53464.2"
FT   gene            complement(<604539..>605981)
FT                   /locus_tag="AGOS_AFR094C"
FT                   /old_locus_tag="AFR094C"
FT   mRNA            complement(<604539..>605981)
FT                   /locus_tag="AGOS_AFR094C"
FT                   /old_locus_tag="AFR094C"
FT                   /product="AFR094Cp"
FT   CDS_pept        complement(604539..605981)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR094C"
FT                   /old_locus_tag="AFR094C"
FT                   /product="AFR094Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL091C
FT                   (GWT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR094C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53465"
FT                   /db_xref="GOA:Q754I2"
FT                   /db_xref="InterPro:IPR009447"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754I2"
FT                   /protein_id="AAS53465.1"
FT   gene            complement(<606107..>608119)
FT                   /locus_tag="AGOS_AFR095C"
FT                   /old_locus_tag="AFR095C"
FT   mRNA            complement(<606107..>608119)
FT                   /locus_tag="AGOS_AFR095C"
FT                   /old_locus_tag="AFR095C"
FT                   /product="AFR095Cp"
FT   CDS_pept        complement(606107..608119)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR095C"
FT                   /old_locus_tag="AFR095C"
FT                   /product="AFR095Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL090C
FT                   (DPB11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR095C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53466"
FT                   /db_xref="GOA:Q754I1"
FT                   /db_xref="InterPro:IPR001357"
FT                   /db_xref="InterPro:IPR036420"
FT                   /db_xref="UniProtKB/TrEMBL:Q754I1"
FT                   /protein_id="AAS53466.2"
FT   gene            <608413..>610971
FT                   /locus_tag="AGOS_AFR096W"
FT                   /old_locus_tag="AFR096W"
FT   mRNA            <608413..>610971
FT                   /locus_tag="AGOS_AFR096W"
FT                   /old_locus_tag="AFR096W"
FT                   /product="AFR096Wp"
FT   CDS_pept        608413..610971
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR096W"
FT                   /old_locus_tag="AFR096W"
FT                   /product="AFR096Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL089W
FT                   (SIP4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR096W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53467"
FT                   /db_xref="GOA:Q754H2"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q754H2"
FT                   /protein_id="AAS53467.2"
FT   gene            <611340..>612173
FT                   /locus_tag="AGOS_AFR097W"
FT                   /old_locus_tag="AFR097W"
FT   mRNA            <611340..>612173
FT                   /locus_tag="AGOS_AFR097W"
FT                   /old_locus_tag="AFR097W"
FT                   /product="AFR097Wp"
FT   CDS_pept        611340..612173
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR097W"
FT                   /old_locus_tag="AFR097W"
FT                   /product="AFR097Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR022C
FT                   (NTR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR097W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53468"
FT                   /db_xref="GOA:Q754H1"
FT                   /db_xref="InterPro:IPR028211"
FT                   /db_xref="UniProtKB/TrEMBL:Q754H1"
FT                   /protein_id="AAS53468.1"
FT   gene            <612461..>613510
FT                   /locus_tag="AGOS_AFR098W"
FT                   /old_locus_tag="AFR098W"
FT   mRNA            <612461..>613510
FT                   /locus_tag="AGOS_AFR098W"
FT                   /old_locus_tag="AFR098W"
FT                   /product="AFR098Wp"
FT   CDS_pept        612461..613510
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR098W"
FT                   /old_locus_tag="AFR098W"
FT                   /product="AFR098Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL088W
FT                   (ARG3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR098W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53469"
FT                   /db_xref="GOA:Q754H4"
FT                   /db_xref="InterPro:IPR002292"
FT                   /db_xref="InterPro:IPR006130"
FT                   /db_xref="InterPro:IPR006131"
FT                   /db_xref="InterPro:IPR006132"
FT                   /db_xref="InterPro:IPR036901"
FT                   /db_xref="UniProtKB/TrEMBL:Q754H4"
FT                   /protein_id="AAS53469.1"
FT                   KNGDFSGLN"
FT   gene            complement(<613546..>616008)
FT                   /locus_tag="AGOS_AFR099C"
FT                   /old_locus_tag="AFR099C"
FT   mRNA            complement(<613546..>616008)
FT                   /locus_tag="AGOS_AFR099C"
FT                   /old_locus_tag="AFR099C"
FT                   /product="AFR099Cp"
FT   CDS_pept        complement(613546..616008)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR099C"
FT                   /old_locus_tag="AFR099C"
FT                   /product="AFR099Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL087C
FT                   (TRL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR099C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53470"
FT                   /db_xref="GOA:Q754H3"
FT                   /db_xref="InterPro:IPR012387"
FT                   /db_xref="InterPro:IPR015965"
FT                   /db_xref="InterPro:IPR015966"
FT                   /db_xref="InterPro:IPR019039"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q754H3"
FT                   /protein_id="AAS53470.2"
FT                   AAVRINIY"
FT   gene            <616219..>618063
FT                   /locus_tag="AGOS_AFR100W"
FT                   /old_locus_tag="AFR100W"
FT   mRNA            <616219..>618063
FT                   /locus_tag="AGOS_AFR100W"
FT                   /old_locus_tag="AFR100W"
FT                   /product="AFR100Wp"
FT   CDS_pept        616219..618063
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR100W"
FT                   /old_locus_tag="AFR100W"
FT                   /product="AFR100Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL085W
FT                   (EXO70)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR100W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53471"
FT                   /db_xref="GOA:Q754H0"
FT                   /db_xref="InterPro:IPR004140"
FT                   /db_xref="InterPro:IPR016159"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754H0"
FT                   /protein_id="AAS53471.1"
FT   gene            complement(<618283..>621201)
FT                   /locus_tag="AGOS_AFR101C"
FT                   /old_locus_tag="AFR101C"
FT   mRNA            complement(<618283..>621201)
FT                   /locus_tag="AGOS_AFR101C"
FT                   /old_locus_tag="AFR101C"
FT                   /product="AFR101Cp"
FT   CDS_pept        complement(618283..621201)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR101C"
FT                   /old_locus_tag="AFR101C"
FT                   /product="AFR101Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL084C
FT                   (ALY2) and YKR021W (ALY1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR101C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53472"
FT                   /db_xref="InterPro:IPR011022"
FT                   /db_xref="InterPro:IPR014756"
FT                   /db_xref="UniProtKB/TrEMBL:Q754G9"
FT                   /protein_id="AAS53472.2"
FT   gene            complement(<621310..>621726)
FT                   /locus_tag="AGOS_AFR102C"
FT                   /old_locus_tag="AFR102C"
FT   mRNA            complement(<621310..>621726)
FT                   /locus_tag="AGOS_AFR102C"
FT                   /old_locus_tag="AFR102C"
FT                   /product="AFR102Cp"
FT   CDS_pept        complement(621310..621726)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR102C"
FT                   /old_locus_tag="AFR102C"
FT                   /product="AFR102Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR020W
FT                   (VPS51)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR102C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53473"
FT                   /db_xref="GOA:Q754G8"
FT                   /db_xref="UniProtKB/TrEMBL:Q754G8"
FT                   /protein_id="AAS53473.1"
FT   gene            <621925..>624159
FT                   /locus_tag="AGOS_AFR103W"
FT                   /old_locus_tag="AFR103W"
FT   mRNA            <621925..>624159
FT                   /locus_tag="AGOS_AFR103W"
FT                   /old_locus_tag="AFR103W"
FT                   /product="AFR103Wp"
FT   CDS_pept        621925..624159
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR103W"
FT                   /old_locus_tag="AFR103W"
FT                   /product="AFR103Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL083W
FT                   (TAX4) and YKR019C (IRS4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR103W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53474"
FT                   /db_xref="GOA:Q754G7"
FT                   /db_xref="InterPro:IPR000261"
FT                   /db_xref="InterPro:IPR011992"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754G7"
FT                   /protein_id="AAS53474.1"
FT   gene            <624840..>626471
FT                   /locus_tag="AGOS_AFR104W"
FT                   /old_locus_tag="AFR104W"
FT   mRNA            <624840..>626471
FT                   /locus_tag="AGOS_AFR104W"
FT                   /old_locus_tag="AFR104W"
FT                   /product="AFR104Wp"
FT   CDS_pept        624840..626471
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR104W"
FT                   /old_locus_tag="AFR104W"
FT                   /product="AFR104Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKR017C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR104W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53475"
FT                   /db_xref="GOA:Q754G6"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR002867"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="InterPro:IPR031127"
FT                   /db_xref="UniProtKB/TrEMBL:Q754G6"
FT                   /protein_id="AAS53475.1"
FT   gene            complement(<626522..>627961)
FT                   /locus_tag="AGOS_AFR105C"
FT                   /old_locus_tag="AFR105C"
FT   mRNA            complement(<626522..>627961)
FT                   /locus_tag="AGOS_AFR105C"
FT                   /old_locus_tag="AFR105C"
FT                   /product="AFR105Cp"
FT   CDS_pept        complement(626522..627961)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR105C"
FT                   /old_locus_tag="AFR105C"
FT                   /product="AFR105Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJL081C
FT                   (ARP4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR105C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53476"
FT                   /db_xref="GOA:Q754G5"
FT                   /db_xref="InterPro:IPR004000"
FT                   /db_xref="InterPro:IPR020902"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754G5"
FT                   /protein_id="AAS53476.1"
FT   gene            complement(<628193..>629683)
FT                   /locus_tag="AGOS_AFR106C"
FT                   /old_locus_tag="AFR106C"
FT   mRNA            complement(<628193..>629683)
FT                   /locus_tag="AGOS_AFR106C"
FT                   /old_locus_tag="AFR106C"
FT                   /product="AFR106Cp"
FT   CDS_pept        complement(628193..629683)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR106C"
FT                   /old_locus_tag="AFR106C"
FT                   /product="AFR106Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR016W
FT                   (FCJ1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR106C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53477"
FT                   /db_xref="GOA:Q754G4"
FT                   /db_xref="InterPro:IPR019133"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754G4"
FT                   /protein_id="AAS53477.2"
FT   gene            <630322..>631512
FT                   /locus_tag="AGOS_AFR107W"
FT                   /old_locus_tag="AFR107W"
FT   mRNA            <630322..>631512
FT                   /locus_tag="AGOS_AFR107W"
FT                   /old_locus_tag="AFR107W"
FT                   /product="AFR107Wp"
FT   CDS_pept        630322..631512
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR107W"
FT                   /old_locus_tag="AFR107W"
FT                   /product="AFR107Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR159C
FT                   (NSR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR107W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53478"
FT                   /db_xref="GOA:Q754G3"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR034272"
FT                   /db_xref="InterPro:IPR034276"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q754G3"
FT                   /protein_id="AAS53478.1"
FT   gene            <632538..>634184
FT                   /locus_tag="AGOS_AFR108W"
FT                   /old_locus_tag="AFR108W"
FT   mRNA            <632538..>634184
FT                   /locus_tag="AGOS_AFR108W"
FT                   /old_locus_tag="AFR108W"
FT                   /product="AFR108Wp"
FT   CDS_pept        632538..634184
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR108W"
FT                   /old_locus_tag="AFR108W"
FT                   /product="AFR108Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL045W
FT                   (RIM8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR108W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53479"
FT                   /db_xref="GOA:Q754G2"
FT                   /db_xref="InterPro:IPR011021"
FT                   /db_xref="InterPro:IPR011022"
FT                   /db_xref="InterPro:IPR014752"
FT                   /db_xref="InterPro:IPR014756"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754G2"
FT                   /protein_id="AAS53479.1"
FT   gene            <634390..>635103
FT                   /locus_tag="AGOS_AFR109W"
FT                   /old_locus_tag="AFR109W"
FT   mRNA            <634390..>635103
FT                   /locus_tag="AGOS_AFR109W"
FT                   /old_locus_tag="AFR109W"
FT                   /product="AFR109Wp"
FT   CDS_pept        634390..635103
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR109W"
FT                   /old_locus_tag="AFR109W"
FT                   /product="AFR109Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR158C
FT                   (MTR3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR109W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53480"
FT                   /db_xref="GOA:Q754G1"
FT                   /db_xref="InterPro:IPR001247"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR027408"
FT                   /db_xref="UniProtKB/TrEMBL:Q754G1"
FT                   /protein_id="AAS53480.1"
FT                   QRDAIIEHVVSKNKS"
FT   gene            complement(<635233..>637764)
FT                   /locus_tag="AGOS_AFR110C"
FT                   /old_locus_tag="AFR110C"
FT   mRNA            complement(<635233..>637764)
FT                   /locus_tag="AGOS_AFR110C"
FT                   /old_locus_tag="AFR110C"
FT                   /product="AFR110Cp"
FT   CDS_pept        complement(635233..637764)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR110C"
FT                   /old_locus_tag="AFR110C"
FT                   /product="AFR110Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR157W
FT                   (CHO2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR110C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53481"
FT                   /db_xref="GOA:Q754G0"
FT                   /db_xref="InterPro:IPR007318"
FT                   /db_xref="InterPro:IPR016219"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754G0"
FT                   /protein_id="AAS53481.1"
FT   gene            complement(<638384..>639904)
FT                   /locus_tag="AGOS_AFR111C"
FT                   /old_locus_tag="AFR111C"
FT   mRNA            complement(<638384..>639904)
FT                   /locus_tag="AGOS_AFR111C"
FT                   /old_locus_tag="AFR111C"
FT                   /product="AFR111Cp"
FT   CDS_pept        complement(638384..639904)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR111C"
FT                   /old_locus_tag="AFR111C"
FT                   /product="AFR111Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR314C
FT                   (CDC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR111C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53482"
FT                   /db_xref="GOA:Q754F9"
FT                   /db_xref="InterPro:IPR016491"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR030379"
FT                   /db_xref="UniProtKB/TrEMBL:Q754F9"
FT                   /protein_id="AAS53482.2"
FT   gene            <640372..>641127
FT                   /locus_tag="AGOS_AFR112W"
FT                   /old_locus_tag="AFR112W"
FT   mRNA            <640372..>641127
FT                   /locus_tag="AGOS_AFR112W"
FT                   /old_locus_tag="AFR112W"
FT                   /product="AFR112Wp"
FT   CDS_pept        640372..641127
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR112W"
FT                   /old_locus_tag="AFR112W"
FT                   /product="AFR112Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL022C
FT                   (HIF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR112W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53483"
FT                   /db_xref="GOA:Q754F8"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR019544"
FT                   /db_xref="UniProtKB/TrEMBL:Q754F8"
FT                   /protein_id="AAS53483.2"
FT   gene            <641164..>642126
FT                   /locus_tag="AGOS_AFR113W"
FT                   /old_locus_tag="AFR113W"
FT   mRNA            <641164..>642126
FT                   /locus_tag="AGOS_AFR113W"
FT                   /old_locus_tag="AFR113W"
FT                   /product="AFR113Wp"
FT   CDS_pept        641164..642126
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR113W"
FT                   /old_locus_tag="AFR113W"
FT                   /product="AFR113Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL023C
FT                   (POM33)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR113W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53484"
FT                   /db_xref="GOA:Q754F7"
FT                   /db_xref="InterPro:IPR005344"
FT                   /db_xref="UniProtKB/TrEMBL:Q754F7"
FT                   /protein_id="AAS53484.1"
FT   gene            <642461..>644386
FT                   /locus_tag="AGOS_AFR114W"
FT                   /old_locus_tag="AFR114W"
FT   mRNA            <642461..>644386
FT                   /locus_tag="AGOS_AFR114W"
FT                   /old_locus_tag="AFR114W"
FT                   /product="AFR114Wp"
FT   CDS_pept        642461..644386
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR114W"
FT                   /old_locus_tag="AFR114W"
FT                   /product="AFR114Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL024C
FT                   (SSA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR114W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53485"
FT                   /db_xref="GOA:Q754F6"
FT                   /db_xref="InterPro:IPR013126"
FT                   /db_xref="InterPro:IPR018181"
FT                   /db_xref="InterPro:IPR029047"
FT                   /db_xref="InterPro:IPR029048"
FT                   /db_xref="UniProtKB/TrEMBL:Q754F6"
FT                   /protein_id="AAS53485.1"
FT                   TVEEVD"
FT   gene            complement(644792..644903)
FT                   /locus_tag="AGOS_t0139"
FT   tRNA            complement(join(644792..644827,644868..644903))
FT                   /locus_tag="AGOS_t0139"
FT                   /product="tRNA-Pro"
FT                   /note="codon recognized: CCA"
FT   gene            645373..645471
FT                   /locus_tag="AGOS_t0140"
FT   tRNA            join(645373..645408,645436..645471)
FT                   /locus_tag="AGOS_t0140"
FT                   /product="tRNA-Trp"
FT                   /note="codon recognized: UGG"
FT   gene            <645630..>646160
FT                   /locus_tag="AGOS_AFR115W"
FT                   /old_locus_tag="AFR115W"
FT   mRNA            <645630..>646160
FT                   /locus_tag="AGOS_AFR115W"
FT                   /old_locus_tag="AFR115W"
FT                   /product="AFR115Wp"
FT   CDS_pept        645630..646160
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR115W"
FT                   /old_locus_tag="AFR115W"
FT                   /product="AFR115Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YKL069W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR115W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53486"
FT                   /db_xref="GOA:Q754F5"
FT                   /db_xref="InterPro:IPR000614"
FT                   /db_xref="InterPro:IPR003018"
FT                   /db_xref="InterPro:IPR029016"
FT                   /db_xref="UniProtKB/TrEMBL:Q754F5"
FT                   /protein_id="AAS53486.1"
FT                   EKLAQEISRTCKF"
FT   gene            complement(646253..646326)
FT                   /locus_tag="AGOS_t0141"
FT   tRNA            complement(646253..646326)
FT                   /locus_tag="AGOS_t0141"
FT                   /product="tRNA-Val"
FT                   /note="codon recognized: GUU"
FT   gene            complement(646330..646401)
FT                   /locus_tag="AGOS_t0142"
FT   tRNA            complement(646330..646401)
FT                   /locus_tag="AGOS_t0142"
FT                   /product="tRNA-His"
FT                   /note="codon recognized: CAC"
FT   gene            <646558..>648108
FT                   /locus_tag="AGOS_AFR116W"
FT                   /old_locus_tag="AFR116W"
FT   mRNA            <646558..>648108
FT                   /locus_tag="AGOS_AFR116W"
FT                   /old_locus_tag="AFR116W"
FT                   /product="AFR116Wp"
FT   CDS_pept        646558..648108
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR116W"
FT                   /old_locus_tag="AFR116W"
FT                   /product="AFR116Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YGL160W (AIM14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR116W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53487"
FT                   /db_xref="GOA:Q754F4"
FT                   /db_xref="InterPro:IPR013112"
FT                   /db_xref="InterPro:IPR013121"
FT                   /db_xref="InterPro:IPR013130"
FT                   /db_xref="InterPro:IPR017927"
FT                   /db_xref="InterPro:IPR017938"
FT                   /db_xref="InterPro:IPR039261"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754F4"
FT                   /protein_id="AAS53487.1"
FT   gene            complement(<648252..>651710)
FT                   /locus_tag="AGOS_AFR117C"
FT                   /old_locus_tag="AFR117C"
FT   mRNA            complement(<648252..>651710)
FT                   /locus_tag="AGOS_AFR117C"
FT                   /old_locus_tag="AFR117C"
FT                   /product="AFR117Cp"
FT   CDS_pept        complement(648252..651710)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR117C"
FT                   /old_locus_tag="AFR117C"
FT                   /product="AFR117Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR256W
FT                   (HAP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR117C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53488"
FT                   /db_xref="GOA:Q754F3"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR007219"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q754F3"
FT                   /protein_id="AAS53488.2"
FT   gene            <654516..>655214
FT                   /locus_tag="AGOS_AFR118W"
FT                   /old_locus_tag="AFR118W"
FT   mRNA            <654516..>655214
FT                   /locus_tag="AGOS_AFR118W"
FT                   /old_locus_tag="AFR118W"
FT                   /product="AFR118Wp"
FT   CDS_pept        654516..655214
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR118W"
FT                   /old_locus_tag="AFR118W"
FT                   /product="AFR118Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR254C
FT                   (NDL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR118W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53489"
FT                   /db_xref="UniProtKB/TrEMBL:Q754F2"
FT                   /protein_id="AAS53489.1"
FT                   TTTNTQVPRR"
FT   gene            complement(<655263..>656990)
FT                   /locus_tag="AGOS_AFR119C"
FT                   /old_locus_tag="AFR119C"
FT   mRNA            complement(<655263..>656990)
FT                   /locus_tag="AGOS_AFR119C"
FT                   /old_locus_tag="AFR119C"
FT                   /product="AFR119Cp"
FT   CDS_pept        complement(655263..656990)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR119C"
FT                   /old_locus_tag="AFR119C"
FT                   /product="AFR119Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR253W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR119C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53490"
FT                   /db_xref="GOA:Q754F1"
FT                   /db_xref="InterPro:IPR004147"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q754F1"
FT                   /protein_id="AAS53490.2"
FT   gene            complement(<657302..>657850)
FT                   /locus_tag="AGOS_AFR120C"
FT                   /old_locus_tag="AFR120C"
FT   mRNA            complement(<657302..>657850)
FT                   /locus_tag="AGOS_AFR120C"
FT                   /old_locus_tag="AFR120C"
FT                   /product="AFR120Cp"
FT   CDS_pept        complement(657302..657850)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR120C"
FT                   /old_locus_tag="AFR120C"
FT                   /product="AFR120Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR251W
FT                   (SYM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR120C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53491"
FT                   /db_xref="GOA:Q754F0"
FT                   /db_xref="InterPro:IPR007248"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754F0"
FT                   /protein_id="AAS53491.1"
FT   gene            <658350..>660020
FT                   /locus_tag="AGOS_AFR121W"
FT                   /old_locus_tag="AFR121W"
FT   mRNA            <658350..>660020
FT                   /locus_tag="AGOS_AFR121W"
FT                   /old_locus_tag="AFR121W"
FT                   /product="AFR121Wp"
FT   CDS_pept        658350..660020
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR121W"
FT                   /old_locus_tag="AFR121W"
FT                   /product="AFR121Wp"
FT                   /note="NOHBY625; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F22902g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR121W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53492"
FT                   /db_xref="UniProtKB/TrEMBL:Q754E9"
FT                   /protein_id="AAS53492.2"
FT   gene            complement(<660508..>662382)
FT                   /locus_tag="AGOS_AFR122C"
FT                   /old_locus_tag="AFR122C"
FT   mRNA            complement(<660508..>662382)
FT                   /locus_tag="AGOS_AFR122C"
FT                   /old_locus_tag="AFR122C"
FT                   /product="AFR122Cp"
FT   CDS_pept        complement(660508..662382)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR122C"
FT                   /old_locus_tag="AFR122C"
FT                   /product="AFR122Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR173W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR122C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53493"
FT                   /db_xref="GOA:Q754E8"
FT                   /db_xref="UniProtKB/TrEMBL:Q754E8"
FT                   /protein_id="AAS53493.1"
FT   gene            <662731..>663627
FT                   /locus_tag="AGOS_AFR123W"
FT                   /old_locus_tag="AFR123W"
FT   mRNA            <662731..>663627
FT                   /locus_tag="AGOS_AFR123W"
FT                   /old_locus_tag="AFR123W"
FT                   /product="AFR123Wp"
FT   CDS_pept        662731..663627
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR123W"
FT                   /old_locus_tag="AFR123W"
FT                   /product="AFR123Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR172C
FT                   (DPH5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR123W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53494"
FT                   /db_xref="GOA:Q754E7"
FT                   /db_xref="InterPro:IPR000878"
FT                   /db_xref="InterPro:IPR004551"
FT                   /db_xref="InterPro:IPR014776"
FT                   /db_xref="InterPro:IPR014777"
FT                   /db_xref="InterPro:IPR035996"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754E7"
FT                   /protein_id="AAS53494.1"
FT                   QEFFKPAPWVPPPEDED"
FT   gene            <663810..>664280
FT                   /locus_tag="AGOS_AFR124W"
FT                   /old_locus_tag="AFR124W"
FT   mRNA            <663810..>664280
FT                   /locus_tag="AGOS_AFR124W"
FT                   /old_locus_tag="AFR124W"
FT                   /product="AFR124Wp"
FT   CDS_pept        663810..664280
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR124W"
FT                   /old_locus_tag="AFR124W"
FT                   /product="AFR124Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR170C
FT                   (APS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR124W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53495"
FT                   /db_xref="GOA:Q754E6"
FT                   /db_xref="InterPro:IPR011012"
FT                   /db_xref="InterPro:IPR016635"
FT                   /db_xref="InterPro:IPR022775"
FT                   /db_xref="UniProtKB/TrEMBL:Q754E6"
FT                   /protein_id="AAS53495.1"
FT   gene            complement(<664351..>664743)
FT                   /locus_tag="AGOS_AFR125C"
FT                   /old_locus_tag="AFR125C"
FT   mRNA            complement(<664351..>664743)
FT                   /locus_tag="AGOS_AFR125C"
FT                   /old_locus_tag="AFR125C"
FT                   /product="AFR125Cp"
FT   CDS_pept        complement(664351..664743)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR125C"
FT                   /old_locus_tag="AFR125C"
FT                   /product="AFR125Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YMR252C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR125C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53496"
FT                   /db_xref="UniProtKB/TrEMBL:Q754E5"
FT                   /protein_id="AAS53496.1"
FT   gene            complement(664854..664952)
FT                   /locus_tag="AGOS_t0143"
FT   tRNA            complement(join(664854..664889,664917..664952))
FT                   /locus_tag="AGOS_t0143"
FT                   /product="tRNA-Trp"
FT                   /note="codon recognized: UGG"
FT   gene            <665254..>666522
FT                   /locus_tag="AGOS_AFR126W"
FT                   /old_locus_tag="AFR126W"
FT   mRNA            <665254..>666522
FT                   /locus_tag="AGOS_AFR126W"
FT                   /old_locus_tag="AFR126W"
FT                   /product="AFR126Wp"
FT   CDS_pept        665254..666522
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR126W"
FT                   /old_locus_tag="AFR126W"
FT                   /product="AFR126Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YBR287W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR126W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53497"
FT                   /db_xref="GOA:Q754E4"
FT                   /db_xref="InterPro:IPR004776"
FT                   /db_xref="UniProtKB/TrEMBL:Q754E4"
FT                   /protein_id="AAS53497.1"
FT   gene            666734..666845
FT                   /locus_tag="AGOS_t0144"
FT   tRNA            join(666734..666771,666802..666845)
FT                   /locus_tag="AGOS_t0144"
FT                   /product="tRNA-Leu"
FT                   /note="codon recognized: UUG"
FT   gene            666916..666987
FT                   /locus_tag="AGOS_t0145"
FT   tRNA            666916..666987
FT                   /locus_tag="AGOS_t0145"
FT                   /product="tRNA-Thr"
FT                   /note="codon recognized: ACA"
FT   gene            <667099..>667761
FT                   /locus_tag="AGOS_AFR127W"
FT                   /old_locus_tag="AFR127W"
FT   mRNA            <667099..>667761
FT                   /locus_tag="AGOS_AFR127W"
FT                   /old_locus_tag="AFR127W"
FT                   /product="AFR127Wp"
FT   CDS_pept        667099..667761
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR127W"
FT                   /old_locus_tag="AFR127W"
FT                   /product="AFR127Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR181W
FT                   (SVP26)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR127W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53498"
FT                   /db_xref="GOA:Q754E3"
FT                   /db_xref="InterPro:IPR007277"
FT                   /db_xref="UniProtKB/TrEMBL:Q754E3"
FT                   /protein_id="AAS53498.2"
FT   gene            <667843..>670011
FT                   /locus_tag="AGOS_AFR128W"
FT                   /old_locus_tag="AFR128W"
FT   mRNA            <667843..>670011
FT                   /locus_tag="AGOS_AFR128W"
FT                   /old_locus_tag="AFR128W"
FT                   /product="AFR128Wp"
FT   CDS_pept        667843..670011
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR128W"
FT                   /old_locus_tag="AFR128W"
FT                   /product="AFR128Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHR182W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR128W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53499"
FT                   /db_xref="UniProtKB/TrEMBL:Q754E2"
FT                   /protein_id="AAS53499.2"
FT   gene            <670548..>672044
FT                   /locus_tag="AGOS_AFR129W"
FT                   /old_locus_tag="AFR129W"
FT   mRNA            <670548..>672044
FT                   /locus_tag="AGOS_AFR129W"
FT                   /old_locus_tag="AFR129W"
FT                   /product="AFR129Wp"
FT   CDS_pept        670548..672044
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR129W"
FT                   /old_locus_tag="AFR129W"
FT                   /product="AFR129Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR183W
FT                   (GND1) and YGR256W (GND2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR129W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53500"
FT                   /db_xref="GOA:Q754E1"
FT                   /db_xref="InterPro:IPR006113"
FT                   /db_xref="InterPro:IPR006114"
FT                   /db_xref="InterPro:IPR006115"
FT                   /db_xref="InterPro:IPR006183"
FT                   /db_xref="InterPro:IPR006184"
FT                   /db_xref="InterPro:IPR008927"
FT                   /db_xref="InterPro:IPR013328"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q754E1"
FT                   /protein_id="AAS53500.2"
FT   gene            <672363..>674222
FT                   /locus_tag="AGOS_AFR130W"
FT                   /old_locus_tag="AFR130W"
FT   mRNA            <672363..>674222
FT                   /locus_tag="AGOS_AFR130W"
FT                   /old_locus_tag="AFR130W"
FT                   /product="AFR130Wp"
FT   CDS_pept        672363..674222
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR130W"
FT                   /old_locus_tag="AFR130W"
FT                   /product="AFR130Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR184W
FT                   (SSP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR130W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53501"
FT                   /db_xref="UniProtKB/TrEMBL:Q754E0"
FT                   /protein_id="AAS53501.1"
FT   gene            complement(<674416..>675450)
FT                   /locus_tag="AGOS_AFR131C"
FT                   /old_locus_tag="AFR131C"
FT   mRNA            complement(<674416..>675450)
FT                   /locus_tag="AGOS_AFR131C"
FT                   /old_locus_tag="AFR131C"
FT                   /product="AFR131Cp"
FT   CDS_pept        complement(674416..675450)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR131C"
FT                   /old_locus_tag="AFR131C"
FT                   /product="AFR131Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR257C
FT                   (MTM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR131C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53502"
FT                   /db_xref="GOA:Q754D9"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D9"
FT                   /protein_id="AAS53502.2"
FT                   FFTS"
FT   gene            complement(<675736..>676500)
FT                   /locus_tag="AGOS_AFR132C"
FT                   /old_locus_tag="AFR132C"
FT   mRNA            complement(<675736..>676500)
FT                   /locus_tag="AGOS_AFR132C"
FT                   /old_locus_tag="AFR132C"
FT                   /product="AFR132Cp"
FT   CDS_pept        complement(675736..676500)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR132C"
FT                   /old_locus_tag="AFR132C"
FT                   /product="AFR132Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR185C
FT                   (PFS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR132C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53503"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D8"
FT                   /protein_id="AAS53503.1"
FT   gene            complement(<676677..>679589)
FT                   /locus_tag="AGOS_AFR133C"
FT                   /old_locus_tag="AFR133C"
FT   mRNA            complement(<676677..>679589)
FT                   /locus_tag="AGOS_AFR133C"
FT                   /old_locus_tag="AFR133C"
FT                   /product="AFR133Cp"
FT   CDS_pept        complement(676677..679589)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR133C"
FT                   /old_locus_tag="AFR133C"
FT                   /product="AFR133Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR258C
FT                   (RAD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR133C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53504"
FT                   /db_xref="GOA:Q754D7"
FT                   /db_xref="InterPro:IPR001044"
FT                   /db_xref="InterPro:IPR006084"
FT                   /db_xref="InterPro:IPR006085"
FT                   /db_xref="InterPro:IPR006086"
FT                   /db_xref="InterPro:IPR008918"
FT                   /db_xref="InterPro:IPR019974"
FT                   /db_xref="InterPro:IPR029060"
FT                   /db_xref="InterPro:IPR036279"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D7"
FT                   /protein_id="AAS53504.1"
FT   gene            complement(679682..679754)
FT                   /locus_tag="AGOS_t0146"
FT   tRNA            complement(679682..679754)
FT                   /locus_tag="AGOS_t0146"
FT                   /product="tRNA-Val"
FT                   /note="codon recognized: GUG"
FT   gene            complement(<680315..>681274)
FT                   /locus_tag="AGOS_AFR134C"
FT                   /old_locus_tag="AFR134C"
FT   mRNA            complement(<680315..>681274)
FT                   /locus_tag="AGOS_AFR134C"
FT                   /old_locus_tag="AFR134C"
FT                   /product="AFR134Cp"
FT   CDS_pept        complement(680315..681274)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR134C"
FT                   /old_locus_tag="AFR134C"
FT                   /product="AFR134Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR142W
FT                   (LSC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR134C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53505"
FT                   /db_xref="GOA:Q754D6"
FT                   /db_xref="InterPro:IPR003781"
FT                   /db_xref="InterPro:IPR005810"
FT                   /db_xref="InterPro:IPR005811"
FT                   /db_xref="InterPro:IPR016102"
FT                   /db_xref="InterPro:IPR017440"
FT                   /db_xref="InterPro:IPR033847"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D6"
FT                   /protein_id="AAS53505.2"
FT   gene            <681760..>684135
FT                   /locus_tag="AGOS_AFR135W"
FT                   /old_locus_tag="AFR135W"
FT   mRNA            <681760..>684135
FT                   /locus_tag="AGOS_AFR135W"
FT                   /old_locus_tag="AFR135W"
FT                   /product="AFR135Wp"
FT   CDS_pept        681760..684135
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR135W"
FT                   /old_locus_tag="AFR135W"
FT                   /product="AFR135Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR141C
FT                   (ARP8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR135W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53506"
FT                   /db_xref="GOA:Q754D5"
FT                   /db_xref="InterPro:IPR004000"
FT                   /db_xref="InterPro:IPR027668"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D5"
FT                   /protein_id="AAS53506.1"
FT   gene            complement(<684307..>686394)
FT                   /locus_tag="AGOS_AFR136C"
FT                   /old_locus_tag="AFR136C"
FT   mRNA            complement(<684307..>686394)
FT                   /locus_tag="AGOS_AFR136C"
FT                   /old_locus_tag="AFR136C"
FT                   /product="AFR136Cp"
FT   CDS_pept        complement(684307..686394)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR136C"
FT                   /old_locus_tag="AFR136C"
FT                   /product="AFR136Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR140W
FT                   (SFL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR136C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53507"
FT                   /db_xref="GOA:Q754D4"
FT                   /db_xref="InterPro:IPR000232"
FT                   /db_xref="InterPro:IPR027725"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D4"
FT                   /protein_id="AAS53507.1"
FT                   T"
FT   gene            complement(<687006..>688109)
FT                   /locus_tag="AGOS_AFR137C"
FT                   /old_locus_tag="AFR137C"
FT   mRNA            complement(<687006..>688109)
FT                   /locus_tag="AGOS_AFR137C"
FT                   /old_locus_tag="AFR137C"
FT                   /product="AFR137Cp"
FT   CDS_pept        complement(687006..688109)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR137C"
FT                   /old_locus_tag="AFR137C"
FT                   /product="AFR137Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR136W
FT                   (IDH2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR137C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53508"
FT                   /db_xref="GOA:Q754D3"
FT                   /db_xref="InterPro:IPR004434"
FT                   /db_xref="InterPro:IPR019818"
FT                   /db_xref="InterPro:IPR024084"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D3"
FT                   /protein_id="AAS53508.1"
FT   gene            <688486..>690345
FT                   /locus_tag="AGOS_AFR138W"
FT                   /old_locus_tag="AFR138W"
FT   mRNA            <688486..>690345
FT                   /locus_tag="AGOS_AFR138W"
FT                   /old_locus_tag="AFR138W"
FT                   /product="AFR138Wp"
FT   CDS_pept        688486..690345
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR138W"
FT                   /old_locus_tag="AFR138W"
FT                   /product="AFR138Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR390C
FT                   (UBA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR138W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53509"
FT                   /db_xref="GOA:Q754D2"
FT                   /db_xref="InterPro:IPR000594"
FT                   /db_xref="InterPro:IPR019572"
FT                   /db_xref="InterPro:IPR023318"
FT                   /db_xref="InterPro:IPR030661"
FT                   /db_xref="InterPro:IPR033127"
FT                   /db_xref="InterPro:IPR035985"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D2"
FT                   /protein_id="AAS53509.1"
FT   gene            complement(<690727..>693186)
FT                   /locus_tag="AGOS_AFR139C"
FT                   /old_locus_tag="AFR139C"
FT   mRNA            complement(<690727..>693186)
FT                   /locus_tag="AGOS_AFR139C"
FT                   /old_locus_tag="AFR139C"
FT                   /product="AFR139Cp"
FT   CDS_pept        complement(690727..693186)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR139C"
FT                   /old_locus_tag="AFR139C"
FT                   /product="AFR139Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR389W
FT                   (SAC7) and YOR134W (BAG7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR139C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53510"
FT                   /db_xref="GOA:Q754D1"
FT                   /db_xref="InterPro:IPR000198"
FT                   /db_xref="InterPro:IPR008936"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D1"
FT                   /protein_id="AAS53510.2"
FT                   SRSRSAT"
FT   gene            complement(<693462..>694628)
FT                   /locus_tag="AGOS_AFR140C"
FT                   /old_locus_tag="AFR140C"
FT   mRNA            complement(<693462..>694628)
FT                   /locus_tag="AGOS_AFR140C"
FT                   /old_locus_tag="AFR140C"
FT                   /product="AFR140Cp"
FT   CDS_pept        complement(693462..694628)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR140C"
FT                   /old_locus_tag="AFR140C"
FT                   /product="AFR140Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR388W
FT                   (RVS167)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR140C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53511"
FT                   /db_xref="GOA:Q754D0"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR004148"
FT                   /db_xref="InterPro:IPR027267"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="UniProtKB/TrEMBL:Q754D0"
FT                   /protein_id="AAS53511.2"
FT   gene            complement(<694802..>696616)
FT                   /locus_tag="AGOS_AFR141C"
FT                   /old_locus_tag="AFR141C"
FT   mRNA            complement(<694802..>696616)
FT                   /locus_tag="AGOS_AFR141C"
FT                   /old_locus_tag="AFR141C"
FT                   /product="AFR141Cp"
FT   CDS_pept        complement(694802..696616)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR141C"
FT                   /old_locus_tag="AFR141C"
FT                   /product="AFR141Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR386W
FT                   (MUS81)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR141C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53512"
FT                   /db_xref="GOA:Q754C9"
FT                   /db_xref="InterPro:IPR006166"
FT                   /db_xref="InterPro:IPR011335"
FT                   /db_xref="InterPro:IPR027421"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754C9"
FT                   /protein_id="AAS53512.1"
FT   gene            complement(<696874..>699402)
FT                   /locus_tag="AGOS_AFR142C"
FT                   /old_locus_tag="AFR142C"
FT   mRNA            complement(<696874..>699402)
FT                   /locus_tag="AGOS_AFR142C"
FT                   /old_locus_tag="AFR142C"
FT                   /product="AFR142Cp"
FT   CDS_pept        complement(696874..699402)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR142C"
FT                   /old_locus_tag="AFR142C"
FT                   /product="AFR142Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR385W
FT                   (EFT2) and YOR133W (EFT1)"
FT                   /db_xref="GOA:Q754C8"
FT                   /db_xref="InterPro:IPR000640"
FT                   /db_xref="InterPro:IPR000795"
FT                   /db_xref="InterPro:IPR004161"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR005517"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR031157"
FT                   /db_xref="InterPro:IPR035647"
FT                   /db_xref="InterPro:IPR041095"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754C8"
FT                   /protein_id="AAS53513.1"
FT   gene            complement(<699602..>701182)
FT                   /locus_tag="AGOS_AFR143C"
FT                   /old_locus_tag="AFR143C"
FT   mRNA            complement(<699602..>701182)
FT                   /locus_tag="AGOS_AFR143C"
FT                   /old_locus_tag="AFR143C"
FT                   /product="AFR143Cp"
FT   CDS_pept        complement(699602..701182)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR143C"
FT                   /old_locus_tag="AFR143C"
FT                   /product="AFR143Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR132W
FT                   (VPS17)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR143C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53514"
FT                   /db_xref="GOA:Q754C7"
FT                   /db_xref="InterPro:IPR001683"
FT                   /db_xref="InterPro:IPR014461"
FT                   /db_xref="InterPro:IPR027267"
FT                   /db_xref="InterPro:IPR036871"
FT                   /db_xref="InterPro:IPR037907"
FT                   /db_xref="UniProtKB/TrEMBL:Q754C7"
FT                   /protein_id="AAS53514.2"
FT                   ATILGTSTF"
FT   gene            <701953..>702735
FT                   /locus_tag="AGOS_AFR144W"
FT                   /old_locus_tag="AFR144W"
FT   mRNA            <701953..>702735
FT                   /locus_tag="AGOS_AFR144W"
FT                   /old_locus_tag="AFR144W"
FT                   /product="AFR144Wp"
FT   CDS_pept        701953..702735
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR144W"
FT                   /old_locus_tag="AFR144W"
FT                   /product="AFR144Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR384C
FT                   (ATO3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR144W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53515"
FT                   /db_xref="GOA:Q754C6"
FT                   /db_xref="InterPro:IPR000791"
FT                   /db_xref="UniProtKB/TrEMBL:Q754C6"
FT                   /protein_id="AAS53515.1"
FT   gene            complement(702906..702977)
FT                   /locus_tag="AGOS_t0147"
FT   tRNA            complement(702906..702977)
FT                   /locus_tag="AGOS_t0147"
FT                   /product="tRNA-Asp"
FT                   /note="codon recognized: GAC"
FT   gene            complement(<703202..>703528)
FT                   /locus_tag="AGOS_AFR145C"
FT                   /old_locus_tag="AFR145C"
FT   mRNA            complement(<703202..>703528)
FT                   /locus_tag="AGOS_AFR145C"
FT                   /old_locus_tag="AFR145C"
FT                   /product="AFR145Cp"
FT   CDS_pept        complement(703202..703528)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR145C"
FT                   /old_locus_tag="AFR145C"
FT                   /product="AFR145Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR382W
FT                   (RPP2B)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR145C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53516"
FT                   /db_xref="GOA:Q754C5"
FT                   /db_xref="InterPro:IPR027534"
FT                   /db_xref="InterPro:IPR038716"
FT                   /db_xref="UniProtKB/TrEMBL:Q754C5"
FT                   /protein_id="AAS53516.1"
FT                   GLFD"
FT   gene            <703820..>704665
FT                   /locus_tag="AGOS_AFR146W"
FT                   /old_locus_tag="AFR146W"
FT   mRNA            <703820..>704665
FT                   /locus_tag="AGOS_AFR146W"
FT                   /old_locus_tag="AFR146W"
FT                   /product="AFR146Wp"
FT   CDS_pept        703820..704665
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR146W"
FT                   /old_locus_tag="AFR146W"
FT                   /product="AFR146Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOR130C
FT                   (ORT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR146W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53517"
FT                   /db_xref="GOA:Q754C4"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q754C4"
FT                   /protein_id="AAS53517.1"
FT                   "
FT   gene            complement(<704686..>705633)
FT                   /locus_tag="AGOS_AFR147C"
FT                   /old_locus_tag="AFR147C"
FT   mRNA            complement(<704686..>705633)
FT                   /locus_tag="AGOS_AFR147C"
FT                   /old_locus_tag="AFR147C"
FT                   /product="AFR147Cp"
FT   CDS_pept        complement(704686..705633)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR147C"
FT                   /old_locus_tag="AFR147C"
FT                   /product="AFR147Cp"
FT                   /note="NOHBY626; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E02750g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR147C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53518"
FT                   /db_xref="GOA:Q754C3"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q754C3"
FT                   /protein_id="AAS53518.2"
FT   gene            <706096..>706438
FT                   /locus_tag="AGOS_AFR148W"
FT                   /old_locus_tag="AFR148W"
FT   mRNA            join(<706096..706102,706167..>706438)
FT                   /locus_tag="AGOS_AFR148W"
FT                   /old_locus_tag="AFR148W"
FT                   /product="AFR148Wp"
FT   CDS_pept        join(706096..706102,706167..706438)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR148W"
FT                   /old_locus_tag="AFR148W"
FT                   /product="AFR148Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR381C-A; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR148W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53519"
FT                   /db_xref="UniProtKB/TrEMBL:Q754C2"
FT                   /protein_id="AAS53519.1"
FT   gene            complement(<706527..>707720)
FT                   /locus_tag="AGOS_AFR149C"
FT                   /old_locus_tag="AFR149C"
FT   mRNA            complement(join(<706527..706940,707472..>707720))
FT                   /locus_tag="AGOS_AFR149C"
FT                   /old_locus_tag="AFR149C"
FT                   /product="AFR149Cp"
FT   CDS_pept        complement(join(706527..706940,707472..707720))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR149C"
FT                   /old_locus_tag="AFR149C"
FT                   /product="AFR149Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR381W
FT                   (YRA1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR149C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53520"
FT                   /db_xref="GOA:Q754C1"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q754C1"
FT                   /protein_id="AAS53520.1"
FT   gene            <708468..>708668
FT                   /locus_tag="AGOS_AFR149WA"
FT   mRNA            <708468..>708668
FT                   /locus_tag="AGOS_AFR149WA"
FT                   /product="AFR149W-Ap"
FT   CDS_pept        708468..708668
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR149WA"
FT                   /product="AFR149W-Ap"
FT                   /note="NOHBY673; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of unnamed Holleya sinecauda gene."
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR149WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41789"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGE0"
FT                   /protein_id="ADJ41789.1"
FT   gene            complement(<708723..>709772)
FT                   /locus_tag="AGOS_AFR150C"
FT                   /old_locus_tag="AFR150C"
FT   mRNA            complement(<708723..>709772)
FT                   /locus_tag="AGOS_AFR150C"
FT                   /old_locus_tag="AFR150C"
FT                   /product="AFR150Cp"
FT   CDS_pept        complement(708723..709772)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR150C"
FT                   /old_locus_tag="AFR150C"
FT                   /product="AFR150Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL029C
FT                   (CAK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR150C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53521"
FT                   /db_xref="GOA:Q754C0"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q754C0"
FT                   /protein_id="AAS53521.1"
FT                   TLRTFAQLQ"
FT   gene            complement(<710030..>711085)
FT                   /locus_tag="AGOS_AFR151C"
FT                   /old_locus_tag="AFR151C"
FT   mRNA            complement(<710030..>711085)
FT                   /locus_tag="AGOS_AFR151C"
FT                   /old_locus_tag="AFR151C"
FT                   /product="AFR151Cp"
FT   CDS_pept        complement(710030..711085)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR151C"
FT                   /old_locus_tag="AFR151C"
FT                   /product="AFR151Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR056W
FT                   (ERG3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR151C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53522"
FT                   /db_xref="GOA:Q754B9"
FT                   /db_xref="InterPro:IPR006694"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754B9"
FT                   /protein_id="AAS53522.2"
FT                   EGPADDRVYER"
FT   gene            complement(<711433..>712245)
FT                   /locus_tag="AGOS_AFR152C"
FT                   /old_locus_tag="AFR152C"
FT   mRNA            complement(<711433..>712245)
FT                   /locus_tag="AGOS_AFR152C"
FT                   /old_locus_tag="AFR152C"
FT                   /product="AFR152Cp"
FT   CDS_pept        complement(711433..712245)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR152C"
FT                   /old_locus_tag="AFR152C"
FT                   /product="AFR152Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL028C
FT                   (CAF16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR152C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53523"
FT                   /db_xref="GOA:Q754B8"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q754B8"
FT                   /protein_id="AAS53523.1"
FT   gene            <712587..>714317
FT                   /locus_tag="AGOS_AFR153W"
FT                   /old_locus_tag="AFR153W"
FT   mRNA            <712587..>714317
FT                   /locus_tag="AGOS_AFR153W"
FT                   /old_locus_tag="AFR153W"
FT                   /product="AFR153Wp"
FT   CDS_pept        712587..714317
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR153W"
FT                   /old_locus_tag="AFR153W"
FT                   /product="AFR153Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR055C
FT                   (SPT8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR153W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53524"
FT                   /db_xref="GOA:Q754B7"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q754B7"
FT                   /protein_id="AAS53524.2"
FT                   "
FT   gene            complement(<714686..>716338)
FT                   /locus_tag="AGOS_AFR154C"
FT                   /old_locus_tag="AFR154C"
FT   mRNA            complement(<714686..>716338)
FT                   /locus_tag="AGOS_AFR154C"
FT                   /old_locus_tag="AFR154C"
FT                   /product="AFR154Cp"
FT   CDS_pept        complement(714686..716338)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR154C"
FT                   /old_locus_tag="AFR154C"
FT                   /product="AFR154Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL027C
FT                   (GYP8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR154C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53525"
FT                   /db_xref="GOA:Q754B6"
FT                   /db_xref="InterPro:IPR000195"
FT                   /db_xref="InterPro:IPR035969"
FT                   /db_xref="UniProtKB/TrEMBL:Q754B6"
FT                   /protein_id="AAS53525.1"
FT   gene            <716650..>718341
FT                   /locus_tag="AGOS_AFR155W"
FT                   /old_locus_tag="AFR155W"
FT   mRNA            <716650..>718341
FT                   /locus_tag="AGOS_AFR155W"
FT                   /old_locus_tag="AFR155W"
FT                   /product="AFR155Wp"
FT   CDS_pept        716650..718341
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR155W"
FT                   /old_locus_tag="AFR155W"
FT                   /product="AFR155Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YLR259C (HSP60)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR155W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53526"
FT                   /db_xref="GOA:Q754B5"
FT                   /db_xref="InterPro:IPR001844"
FT                   /db_xref="InterPro:IPR002423"
FT                   /db_xref="InterPro:IPR018370"
FT                   /db_xref="InterPro:IPR027409"
FT                   /db_xref="InterPro:IPR027410"
FT                   /db_xref="InterPro:IPR027413"
FT                   /db_xref="UniProtKB/TrEMBL:Q754B5"
FT                   /protein_id="AAS53526.2"
FT   gene            <719061..>720737
FT                   /locus_tag="AGOS_AFR156W"
FT                   /old_locus_tag="AFR156W"
FT   mRNA            <719061..>720737
FT                   /locus_tag="AGOS_AFR156W"
FT                   /old_locus_tag="AFR156W"
FT                   /product="AFR156Wp"
FT   CDS_pept        719061..720737
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR156W"
FT                   /old_locus_tag="AFR156W"
FT                   /product="AFR156Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YOR348C (PUT4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR156W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53527"
FT                   /db_xref="GOA:Q754B4"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="InterPro:IPR004840"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="UniProtKB/TrEMBL:Q754B4"
FT                   /protein_id="AAS53527.2"
FT   gene            <720875..>721378
FT                   /locus_tag="AGOS_AFR157W"
FT                   /old_locus_tag="AFR157W"
FT   mRNA            join(<720875..720929,720981..>721378)
FT                   /locus_tag="AGOS_AFR157W"
FT                   /old_locus_tag="AFR157W"
FT                   /product="AFR157Wp"
FT   CDS_pept        join(720875..720929,720981..721378)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR157W"
FT                   /old_locus_tag="AFR157W"
FT                   /product="AFR157Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL125C
FT                   (HNT1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR157W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53528"
FT                   /db_xref="GOA:Q754B3"
FT                   /db_xref="InterPro:IPR001310"
FT                   /db_xref="InterPro:IPR011146"
FT                   /db_xref="InterPro:IPR019808"
FT                   /db_xref="InterPro:IPR036265"
FT                   /db_xref="InterPro:IPR039384"
FT                   /db_xref="UniProtKB/TrEMBL:Q754B3"
FT                   /protein_id="AAS53528.1"
FT   gene            <721630..>724128
FT                   /locus_tag="AGOS_AFR158W"
FT                   /old_locus_tag="AFR158W"
FT   mRNA            <721630..>724128
FT                   /locus_tag="AGOS_AFR158W"
FT                   /old_locus_tag="AFR158W"
FT                   /product="AFR158Wp"
FT   CDS_pept        721630..724128
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR158W"
FT                   /old_locus_tag="AFR158W"
FT                   /product="AFR158Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL126C
FT                   (CDC48)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR158W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53529"
FT                   /db_xref="GOA:Q754B2"
FT                   /db_xref="InterPro:IPR003338"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR004201"
FT                   /db_xref="InterPro:IPR005938"
FT                   /db_xref="InterPro:IPR009010"
FT                   /db_xref="InterPro:IPR015415"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR029067"
FT                   /db_xref="InterPro:IPR041569"
FT                   /db_xref="UniProtKB/TrEMBL:Q754B2"
FT                   /protein_id="AAS53529.2"
FT   gene            complement(<724500..>725426)
FT                   /locus_tag="AGOS_AFR159C"
FT                   /old_locus_tag="AFR159C"
FT   mRNA            complement(<724500..>725426)
FT                   /locus_tag="AGOS_AFR159C"
FT                   /old_locus_tag="AFR159C"
FT                   /product="AFR159Cp"
FT   CDS_pept        complement(724500..725426)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR159C"
FT                   /old_locus_tag="AFR159C"
FT                   /product="AFR159Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL127W
FT                   (PCL2) and YDL179W (PCL9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR159C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53530"
FT                   /db_xref="GOA:Q754H9"
FT                   /db_xref="InterPro:IPR006671"
FT                   /db_xref="InterPro:IPR012104"
FT                   /db_xref="InterPro:IPR013763"
FT                   /db_xref="InterPro:IPR036915"
FT                   /db_xref="UniProtKB/TrEMBL:Q754H9"
FT                   /protein_id="AAS53530.1"
FT   gene            complement(<726122..>727333)
FT                   /locus_tag="AGOS_AFR160C"
FT                   /old_locus_tag="AFR160C"
FT   mRNA            complement(<726122..>727333)
FT                   /locus_tag="AGOS_AFR160C"
FT                   /old_locus_tag="AFR160C"
FT                   /product="AFR160Cp"
FT   CDS_pept        complement(726122..727333)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR160C"
FT                   /old_locus_tag="AFR160C"
FT                   /product="AFR160Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL128W
FT                   (VCX1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR160C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53531"
FT                   /db_xref="GOA:Q754H5"
FT                   /db_xref="InterPro:IPR004713"
FT                   /db_xref="InterPro:IPR004798"
FT                   /db_xref="InterPro:IPR004837"
FT                   /db_xref="UniProtKB/TrEMBL:Q754H5"
FT                   /protein_id="AAS53531.2"
FT                   SVLA"
FT   gene            complement(<727767..>729050)
FT                   /locus_tag="AGOS_AFR161C"
FT                   /old_locus_tag="AFR161C"
FT   mRNA            complement(<727767..>729050)
FT                   /locus_tag="AGOS_AFR161C"
FT                   /old_locus_tag="AFR161C"
FT                   /product="AFR161Cp"
FT   CDS_pept        complement(727767..729050)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR161C"
FT                   /old_locus_tag="AFR161C"
FT                   /product="AFR161Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDL180W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR161C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53532"
FT                   /db_xref="GOA:Q754B1"
FT                   /db_xref="UniProtKB/TrEMBL:Q754B1"
FT                   /protein_id="AAS53532.1"
FT   gene            complement(<729371..>730453)
FT                   /locus_tag="AGOS_AFR162C"
FT                   /old_locus_tag="AFR162C"
FT   mRNA            complement(<729371..>730453)
FT                   /locus_tag="AGOS_AFR162C"
FT                   /old_locus_tag="AFR162C"
FT                   /product="AFR162Cp"
FT   CDS_pept        complement(729371..730453)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR162C"
FT                   /old_locus_tag="AFR162C"
FT                   /product="AFR162Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDL129W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR162C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53533"
FT                   /db_xref="UniProtKB/TrEMBL:Q754B0"
FT                   /protein_id="AAS53533.1"
FT   gene            complement(<731139..>731511)
FT                   /locus_tag="AGOS_AFR163C"
FT                   /old_locus_tag="AFR163C"
FT   mRNA            complement(join(<731139..731342,731398..>731511))
FT                   /locus_tag="AGOS_AFR163C"
FT                   /old_locus_tag="AFR163C"
FT                   /product="AFR163Cp"
FT   CDS_pept        complement(join(731139..731342,731398..731511))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR163C"
FT                   /old_locus_tag="AFR163C"
FT                   /product="AFR163Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDL130W
FT                   (RPP1B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR163C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53534"
FT                   /db_xref="GOA:Q754A9"
FT                   /db_xref="InterPro:IPR027534"
FT                   /db_xref="InterPro:IPR038716"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A9"
FT                   /protein_id="AAS53534.1"
FT                   D"
FT   gene            complement(731674..731745)
FT                   /locus_tag="AGOS_t0148"
FT   tRNA            complement(731674..731745)
FT                   /locus_tag="AGOS_t0148"
FT                   /product="tRNA-Glu"
FT                   /note="codon recognized: GAG"
FT   gene            733050..733150
FT                   /locus_tag="AGOS_t0149"
FT   tRNA            join(733050..733086,733106..733150)
FT                   /locus_tag="AGOS_t0149"
FT                   /product="tRNA-Ser"
FT                   /note="codon recognized: AGC"
FT   gene            <733270..>733884
FT                   /locus_tag="AGOS_AFR164W"
FT                   /old_locus_tag="AFR164W"
FT   mRNA            <733270..>733884
FT                   /locus_tag="AGOS_AFR164W"
FT                   /old_locus_tag="AFR164W"
FT                   /product="AFR164Wp"
FT   CDS_pept        733270..733884
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR164W"
FT                   /old_locus_tag="AFR164W"
FT                   /product="AFR164Wp"
FT                   /note="NOHBY627; No homolog in Saccharomyces cerevisiae;
FT                   Non-syntenic homolog of Kluyveromyces lactis KLLA0C12023g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR164W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53535"
FT                   /db_xref="GOA:Q754A8"
FT                   /db_xref="InterPro:IPR002547"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A8"
FT                   /protein_id="AAS53535.1"
FT   gene            complement(733975..734085)
FT                   /locus_tag="AGOS_t0150"
FT   tRNA            complement(join(733975..734018,734048..734085))
FT                   /locus_tag="AGOS_t0150"
FT                   /product="tRNA-Leu"
FT                   /note="codon recognized: UUG"
FT   gene            complement(<735621..>736232)
FT                   /locus_tag="AGOS_AFR165C"
FT                   /old_locus_tag="AFR165C"
FT   mRNA            complement(<735621..>736232)
FT                   /locus_tag="AGOS_AFR165C"
FT                   /old_locus_tag="AFR165C"
FT                   /product="AFR165Cp"
FT   CDS_pept        complement(735621..736232)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR165C"
FT                   /old_locus_tag="AFR165C"
FT                   /product="AFR165Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL200C
FT                   (EMP24)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR165C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53536"
FT                   /db_xref="GOA:Q754A7"
FT                   /db_xref="InterPro:IPR009038"
FT                   /db_xref="InterPro:IPR015720"
FT                   /db_xref="InterPro:IPR036598"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A7"
FT                   /protein_id="AAS53536.1"
FT   gene            complement(<737857..>739001)
FT                   /locus_tag="AGOS_AFR166C"
FT                   /old_locus_tag="AFR166C"
FT   mRNA            complement(join(<737857..738618,738819..>739001))
FT                   /locus_tag="AGOS_AFR166C"
FT                   /old_locus_tag="AFR166C"
FT                   /product="AFR166Cp"
FT   CDS_pept        complement(join(737857..738618,738819..739001))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR166C"
FT                   /old_locus_tag="AFR166C"
FT                   /product="AFR166Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER133W
FT                   (GLC7); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR166C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53537"
FT                   /db_xref="GOA:Q754A6"
FT                   /db_xref="InterPro:IPR004843"
FT                   /db_xref="InterPro:IPR006186"
FT                   /db_xref="InterPro:IPR029052"
FT                   /db_xref="InterPro:IPR031675"
FT                   /db_xref="InterPro:IPR037981"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A6"
FT                   /protein_id="AAS53537.2"
FT   gene            739463..739497
FT                   /locus_tag="AGOS_AgSNR52"
FT                   /old_locus_tag="AgSNR52"
FT   ncRNA           739463..739497
FT                   /locus_tag="AGOS_AgSNR52"
FT                   /old_locus_tag="AgSNR52"
FT                   /product="AgSNR52"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR52; start and end coordinates are approximate.
FT                   Similarity is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            <739516..>740136
FT                   /locus_tag="AGOS_AFR167W"
FT                   /old_locus_tag="AFR167W"
FT   mRNA            <739516..>740136
FT                   /locus_tag="AGOS_AFR167W"
FT                   /old_locus_tag="AFR167W"
FT                   /product="AFR167Wp"
FT   CDS_pept        739516..740136
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR167W"
FT                   /old_locus_tag="AFR167W"
FT                   /product="AFR167Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL198W
FT                   (YIP4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR167W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53538"
FT                   /db_xref="GOA:Q754A5"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A5"
FT                   /protein_id="AAS53538.1"
FT   gene            <740358..>745100
FT                   /locus_tag="AGOS_AFR168W"
FT                   /old_locus_tag="AFR168W"
FT   mRNA            <740358..>745100
FT                   /locus_tag="AGOS_AFR168W"
FT                   /old_locus_tag="AFR168W"
FT                   /product="AFR168Wp"
FT   CDS_pept        740358..745100
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR168W"
FT                   /old_locus_tag="AFR168W"
FT                   /product="AFR168Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL197W
FT                   (MDS3) and YER132C (PMD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR168W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53539"
FT                   /db_xref="GOA:Q754A4"
FT                   /db_xref="InterPro:IPR015915"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A4"
FT                   /protein_id="AAS53539.2"
FT                   K"
FT   gene            complement(745290..745340)
FT                   /locus_tag="AGOS_AgSNR4"
FT                   /old_locus_tag="AgSNR4"
FT   ncRNA           complement(745290..745340)
FT                   /locus_tag="AGOS_AgSNR4"
FT                   /old_locus_tag="AgSNR4"
FT                   /product="AgSNR4"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR4; start and end coordinates are approximate. Similarity
FT                   is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            <745556..>753571
FT                   /locus_tag="AGOS_AFR169W"
FT                   /old_locus_tag="AFR169W"
FT   mRNA            <745556..>753571
FT                   /locus_tag="AGOS_AFR169W"
FT                   /old_locus_tag="AFR169W"
FT                   /product="AFR169Wp"
FT   CDS_pept        745556..753571
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR169W"
FT                   /old_locus_tag="AFR169W"
FT                   /product="AFR169Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL195W
FT                   (GCN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR169W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53540"
FT                   /db_xref="GOA:Q754A3"
FT                   /db_xref="InterPro:IPR000357"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR021133"
FT                   /db_xref="InterPro:IPR022716"
FT                   /db_xref="InterPro:IPR033173"
FT                   /db_xref="InterPro:IPR034085"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A3"
FT                   /protein_id="AAS53540.2"
FT   gene            complement(<753610..>753873)
FT                   /locus_tag="AGOS_AFR170C"
FT                   /old_locus_tag="AFR170C"
FT   mRNA            complement(<753610..>753873)
FT                   /locus_tag="AGOS_AFR170C"
FT                   /old_locus_tag="AFR170C"
FT                   /product="AFR170Cp"
FT   CDS_pept        complement(753610..753873)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR170C"
FT                   /old_locus_tag="AFR170C"
FT                   /product="AFR170Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   AFR170C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR170C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53541"
FT                   /db_xref="GOA:Q754A2"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A2"
FT                   /protein_id="AAS53541.1"
FT   gene            <754009..>755847
FT                   /locus_tag="AGOS_AFR171W"
FT                   /old_locus_tag="AFR171W"
FT   mRNA            <754009..>755847
FT                   /locus_tag="AGOS_AFR171W"
FT                   /old_locus_tag="AFR171W"
FT                   /product="AFR171Wp"
FT   CDS_pept        754009..755847
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR171W"
FT                   /old_locus_tag="AFR171W"
FT                   /product="AFR171Wp"
FT                   /note="NOHBY629; No homolog in Saccharomyces cerevisiae;
FT                   Non-syntenic homolog of Kluyveromyces lactis KLLA0D05038g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR171W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53542"
FT                   /db_xref="GOA:Q754A1"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR021858"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A1"
FT                   /protein_id="AAS53542.1"
FT   gene            complement(<755890..>757239)
FT                   /locus_tag="AGOS_AFR172C"
FT                   /old_locus_tag="AFR172C"
FT   mRNA            complement(<755890..>757239)
FT                   /locus_tag="AGOS_AFR172C"
FT                   /old_locus_tag="AFR172C"
FT                   /product="AFR172Cp"
FT   CDS_pept        complement(755890..757239)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR172C"
FT                   /old_locus_tag="AFR172C"
FT                   /product="AFR172Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL194C
FT                   (HOS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR172C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53543"
FT                   /db_xref="GOA:Q754A0"
FT                   /db_xref="InterPro:IPR000286"
FT                   /db_xref="InterPro:IPR003084"
FT                   /db_xref="InterPro:IPR023696"
FT                   /db_xref="InterPro:IPR023801"
FT                   /db_xref="InterPro:IPR037138"
FT                   /db_xref="UniProtKB/TrEMBL:Q754A0"
FT                   /protein_id="AAS53543.1"
FT   gene            <757680..>759359
FT                   /locus_tag="AGOS_AFR173W"
FT                   /old_locus_tag="AFR173W"
FT   mRNA            <757680..>759359
FT                   /locus_tag="AGOS_AFR173W"
FT                   /old_locus_tag="AFR173W"
FT                   /product="AFR173Wp"
FT   CDS_pept        757680..759359
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR173W"
FT                   /old_locus_tag="AFR173W"
FT                   /product="AFR173Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL192W
FT                   (IME4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR173W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53544"
FT                   /db_xref="GOA:Q753Z9"
FT                   /db_xref="InterPro:IPR007757"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Z9"
FT                   /protein_id="AAS53544.1"
FT   gene            <759857..>760951
FT                   /locus_tag="AGOS_AFR174W"
FT                   /old_locus_tag="AFR174W"
FT   mRNA            <759857..>760951
FT                   /locus_tag="AGOS_AFR174W"
FT                   /old_locus_tag="AFR174W"
FT                   /product="AFR174Wp"
FT   CDS_pept        759857..760951
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR174W"
FT                   /old_locus_tag="AFR174W"
FT                   /product="AFR174Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR065W
FT                   (RRG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR174W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53545"
FT                   /db_xref="GOA:Q753Z8"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753Z8"
FT                   /protein_id="AAS53545.1"
FT   gene            complement(<760971..>761597)
FT                   /locus_tag="AGOS_AFR175C"
FT                   /old_locus_tag="AFR175C"
FT   mRNA            complement(<760971..>761597)
FT                   /locus_tag="AGOS_AFR175C"
FT                   /old_locus_tag="AFR175C"
FT                   /product="AFR175Cp"
FT   CDS_pept        complement(760971..761597)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR175C"
FT                   /old_locus_tag="AFR175C"
FT                   /product="AFR175Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER139C
FT                   (RTR1) and YDR066C (RTR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR175C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53546"
FT                   /db_xref="GOA:Q753Z7"
FT                   /db_xref="InterPro:IPR007308"
FT                   /db_xref="InterPro:IPR038534"
FT                   /db_xref="InterPro:IPR039693"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Z7"
FT                   /protein_id="AAS53546.1"
FT   gene            <761787..>763283
FT                   /locus_tag="AGOS_AFR176W"
FT                   /old_locus_tag="AFR176W"
FT   mRNA            <761787..>763283
FT                   /locus_tag="AGOS_AFR176W"
FT                   /old_locus_tag="AFR176W"
FT                   /product="AFR176Wp"
FT   CDS_pept        761787..763283
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR176W"
FT                   /old_locus_tag="AFR176W"
FT                   /product="AFR176Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YER140W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR176W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53547"
FT                   /db_xref="GOA:Q753Z6"
FT                   /db_xref="InterPro:IPR008010"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Z6"
FT                   /protein_id="AAS53547.2"
FT   gene            complement(<763362..>764453)
FT                   /locus_tag="AGOS_AFR177C"
FT                   /old_locus_tag="AFR177C"
FT   mRNA            complement(<763362..>764453)
FT                   /locus_tag="AGOS_AFR177C"
FT                   /old_locus_tag="AFR177C"
FT                   /product="AFR177Cp"
FT   CDS_pept        complement(763362..764453)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR177C"
FT                   /old_locus_tag="AFR177C"
FT                   /product="AFR177Cp"
FT                   /note="NOHBY630; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F12606g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR177C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53548"
FT                   /db_xref="GOA:Q753Z5"
FT                   /db_xref="InterPro:IPR003126"
FT                   /db_xref="InterPro:IPR040204"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Z5"
FT                   /protein_id="AAS53548.1"
FT   gene            <765049..>767706
FT                   /locus_tag="AGOS_AFR178W"
FT                   /old_locus_tag="AFR178W"
FT   mRNA            <765049..>767706
FT                   /locus_tag="AGOS_AFR178W"
FT                   /old_locus_tag="AFR178W"
FT                   /product="AFR178Wp"
FT   CDS_pept        765049..767706
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR178W"
FT                   /old_locus_tag="AFR178W"
FT                   /product="AFR178Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL023C
FT                   (MCM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR178W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53549"
FT                   /db_xref="GOA:Q753Z4"
FT                   /db_xref="InterPro:IPR001208"
FT                   /db_xref="InterPro:IPR008045"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR018525"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR027925"
FT                   /db_xref="InterPro:IPR031327"
FT                   /db_xref="InterPro:IPR033762"
FT                   /db_xref="InterPro:IPR041562"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Z4"
FT                   /protein_id="AAS53549.1"
FT                   LQRSFAIYTMSRGD"
FT   gene            complement(<767878..>769980)
FT                   /locus_tag="AGOS_AFR179C"
FT                   /old_locus_tag="AFR179C"
FT   mRNA            complement(<767878..>769980)
FT                   /locus_tag="AGOS_AFR179C"
FT                   /old_locus_tag="AFR179C"
FT                   /product="AFR179Cp"
FT   CDS_pept        complement(767878..769980)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR179C"
FT                   /old_locus_tag="AFR179C"
FT                   /product="AFR179Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL024W
FT                   (NCL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR179C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53550"
FT                   /db_xref="GOA:Q753Z3"
FT                   /db_xref="InterPro:IPR001678"
FT                   /db_xref="InterPro:IPR018314"
FT                   /db_xref="InterPro:IPR023267"
FT                   /db_xref="InterPro:IPR023270"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Z3"
FT                   /protein_id="AAS53550.2"
FT                   DASEQV"
FT   gene            complement(<770113..>770517)
FT                   /locus_tag="AGOS_AFR180C"
FT                   /old_locus_tag="AFR180C"
FT   mRNA            complement(<770113..>770517)
FT                   /locus_tag="AGOS_AFR180C"
FT                   /old_locus_tag="AFR180C"
FT                   /product="AFR180Cp"
FT   CDS_pept        complement(770113..770517)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR180C"
FT                   /old_locus_tag="AFR180C"
FT                   /product="AFR180Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL025W
FT                   (RRN10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR180C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53551"
FT                   /db_xref="GOA:Q753Z2"
FT                   /db_xref="InterPro:IPR007898"
FT                   /db_xref="InterPro:IPR022793"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Z2"
FT                   /protein_id="AAS53551.1"
FT   gene            complement(770665..770855)
FT                   /locus_tag="AGOS_AgSNRSCR1"
FT                   /old_locus_tag="AgSNRSCR1"
FT   ncRNA           complement(770665..770855)
FT                   /locus_tag="AGOS_AgSNRSCR1"
FT                   /old_locus_tag="AgSNRSCR1"
FT                   /product="AgSNRSCR1"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNRSCR1; start and end coordinates are approximates. Not in
FT                   synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            <771176..>771568
FT                   /locus_tag="AGOS_AFR181W"
FT                   /old_locus_tag="AFR181W"
FT   mRNA            <771176..>771568
FT                   /locus_tag="AGOS_AFR181W"
FT                   /old_locus_tag="AFR181W"
FT                   /product="AFR181Wp"
FT   CDS_pept        771176..771568
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR181W"
FT                   /old_locus_tag="AFR181W"
FT                   /product="AFR181Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YER137C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR181W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53552"
FT                   /db_xref="GOA:Q753Z1"
FT                   /db_xref="InterPro:IPR036875"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Z1"
FT                   /protein_id="AAS53552.1"
FT   gene            complement(<771642..>772002)
FT                   /locus_tag="AGOS_AFR182C"
FT                   /old_locus_tag="AFR182C"
FT   mRNA            complement(join(<771642..771875,771949..>772002))
FT                   /locus_tag="AGOS_AFR182C"
FT                   /old_locus_tag="AFR182C"
FT                   /product="AFR182Cp"
FT   CDS_pept        complement(join(771642..771875,771949..772002))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR182C"
FT                   /old_locus_tag="AFR182C"
FT                   /product="AFR182Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL026W
FT                   (LSM2); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR182C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53553"
FT                   /db_xref="GOA:Q753Z0"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR016654"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Z0"
FT                   /protein_id="AAS53553.1"
FT   gene            complement(<772272..>773612)
FT                   /locus_tag="AGOS_AFR183C"
FT                   /old_locus_tag="AFR183C"
FT   mRNA            complement(<772272..>773612)
FT                   /locus_tag="AGOS_AFR183C"
FT                   /old_locus_tag="AFR183C"
FT                   /product="AFR183Cp"
FT   CDS_pept        complement(772272..773612)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR183C"
FT                   /old_locus_tag="AFR183C"
FT                   /product="AFR183Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER136W
FT                   (GDI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR183C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53554"
FT                   /db_xref="GOA:Q753Y9"
FT                   /db_xref="InterPro:IPR000806"
FT                   /db_xref="InterPro:IPR018203"
FT                   /db_xref="InterPro:IPR036188"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Y9"
FT                   /protein_id="AAS53554.1"
FT   gene            complement(<773972..>774628)
FT                   /locus_tag="AGOS_AFR184C"
FT                   /old_locus_tag="AFR184C"
FT   mRNA            complement(<773972..>774628)
FT                   /locus_tag="AGOS_AFR184C"
FT                   /old_locus_tag="AFR184C"
FT                   /product="AFR184Cp"
FT   CDS_pept        complement(773972..774628)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR184C"
FT                   /old_locus_tag="AFR184C"
FT                   /product="AFR184Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YER163C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR184C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53555"
FT                   /db_xref="GOA:Q753Y8"
FT                   /db_xref="InterPro:IPR006840"
FT                   /db_xref="InterPro:IPR013024"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Y8"
FT                   /protein_id="AAS53555.1"
FT   gene            complement(<774725..>775579)
FT                   /locus_tag="AGOS_AFR185C"
FT                   /old_locus_tag="AFR185C"
FT   mRNA            complement(<774725..>775579)
FT                   /locus_tag="AGOS_AFR185C"
FT                   /old_locus_tag="AFR185C"
FT                   /product="AFR185Cp"
FT   CDS_pept        complement(774725..775579)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR185C"
FT                   /old_locus_tag="AFR185C"
FT                   /product="AFR185Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL025W
FT                   (SNF6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR185C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53556"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Y7"
FT                   /protein_id="AAS53556.2"
FT                   AFF"
FT   gene            <776662..>778815
FT                   /locus_tag="AGOS_AFR186W"
FT                   /old_locus_tag="AFR186W"
FT   mRNA            <776662..>778815
FT                   /locus_tag="AGOS_AFR186W"
FT                   /old_locus_tag="AFR186W"
FT                   /product="AFR186Wp"
FT   CDS_pept        776662..778815
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR186W"
FT                   /old_locus_tag="AFR186W"
FT                   /product="AFR186Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLL032C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR186W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53557"
FT                   /db_xref="GOA:Q753Y6"
FT                   /db_xref="InterPro:IPR004087"
FT                   /db_xref="InterPro:IPR004088"
FT                   /db_xref="InterPro:IPR036612"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Y6"
FT                   /protein_id="AAS53557.1"
FT   gene            complement(<778810..>779451)
FT                   /locus_tag="AGOS_AFR187C"
FT                   /old_locus_tag="AFR187C"
FT   mRNA            complement(<778810..>779451)
FT                   /locus_tag="AGOS_AFR187C"
FT                   /old_locus_tag="AFR187C"
FT                   /product="AFR187Cp"
FT   CDS_pept        complement(778810..779451)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR187C"
FT                   /old_locus_tag="AFR187C"
FT                   /product="AFR187Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL033W
FT                   (IRC19)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR187C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53558"
FT                   /db_xref="GOA:Q753Y5"
FT                   /db_xref="InterPro:IPR016613"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753Y5"
FT                   /protein_id="AAS53558.1"
FT   gene            <779748..>782231
FT                   /locus_tag="AGOS_AFR188W"
FT                   /old_locus_tag="AFR188W"
FT   mRNA            <779748..>782231
FT                   /locus_tag="AGOS_AFR188W"
FT                   /old_locus_tag="AFR188W"
FT                   /product="AFR188Wp"
FT   CDS_pept        779748..782231
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR188W"
FT                   /old_locus_tag="AFR188W"
FT                   /product="AFR188Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL034C
FT                   (RIX7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR188W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53559"
FT                   /db_xref="GOA:Q753Y4"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR015415"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR041569"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Y4"
FT                   /protein_id="AAS53559.2"
FT                   MGWNDEAGVQVEEEA"
FT   gene            complement(<782332..>784233)
FT                   /locus_tag="AGOS_AFR189C"
FT                   /old_locus_tag="AFR189C"
FT   mRNA            complement(<782332..>784233)
FT                   /locus_tag="AGOS_AFR189C"
FT                   /old_locus_tag="AFR189C"
FT                   /product="AFR189Cp"
FT   CDS_pept        complement(782332..784233)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR189C"
FT                   /old_locus_tag="AFR189C"
FT                   /product="AFR189Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL035W
FT                   (GRC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR189C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53560"
FT                   /db_xref="GOA:Q753Y3"
FT                   /db_xref="InterPro:IPR032319"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753Y3"
FT                   /protein_id="AAS53560.1"
FT   gene            complement(<784526..>785824)
FT                   /locus_tag="AGOS_AFR190C"
FT                   /old_locus_tag="AFR190C"
FT   mRNA            complement(<784526..>785824)
FT                   /locus_tag="AGOS_AFR190C"
FT                   /old_locus_tag="AFR190C"
FT                   /product="AFR190Cp"
FT   CDS_pept        complement(784526..785824)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR190C"
FT                   /old_locus_tag="AFR190C"
FT                   /product="AFR190Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL027W
FT                   (RIM101)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR190C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53561"
FT                   /db_xref="GOA:Q753Y2"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753Y2"
FT                   /protein_id="AAS53561.1"
FT   gene            complement(<786342..>787850)
FT                   /locus_tag="AGOS_AFR191C"
FT                   /old_locus_tag="AFR191C"
FT   mRNA            complement(<786342..>787850)
FT                   /locus_tag="AGOS_AFR191C"
FT                   /old_locus_tag="AFR191C"
FT                   /product="AFR191Cp"
FT   CDS_pept        complement(786342..787850)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR191C"
FT                   /old_locus_tag="AFR191C"
FT                   /product="AFR191Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL028W
FT                   (WSC4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR191C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53562"
FT                   /db_xref="GOA:Q753Y1"
FT                   /db_xref="InterPro:IPR002889"
FT                   /db_xref="UniProtKB/TrEMBL:Q753Y1"
FT                   /protein_id="AAS53562.2"
FT   gene            <788840..>790522
FT                   /locus_tag="AGOS_AFR192W"
FT                   /old_locus_tag="AFR192W"
FT   mRNA            <788840..>790522
FT                   /locus_tag="AGOS_AFR192W"
FT                   /old_locus_tag="AFR192W"
FT                   /product="AFR192Wp"
FT   CDS_pept        788840..790522
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR192W"
FT                   /old_locus_tag="AFR192W"
FT                   /product="AFR192Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL029C
FT                   (OCA5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR192W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53563"
FT                   /db_xref="GOA:Q753Y0"
FT                   /db_xref="InterPro:IPR000195"
FT                   /db_xref="InterPro:IPR035969"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753Y0"
FT                   /protein_id="AAS53563.2"
FT   gene            <791123..>791757
FT                   /locus_tag="AGOS_AFR193W"
FT                   /old_locus_tag="AFR193W"
FT   mRNA            join(<791123..791132,791295..>791757)
FT                   /locus_tag="AGOS_AFR193W"
FT                   /old_locus_tag="AFR193W"
FT                   /product="AFR193Wp"
FT                   /note="5'UTR intron"
FT   CDS_pept        791296..791757
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR193W"
FT                   /old_locus_tag="AFR193W"
FT                   /product="AFR193Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL187C
FT                   (COX4); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR193W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53564"
FT                   /db_xref="GOA:Q753X9"
FT                   /db_xref="InterPro:IPR002124"
FT                   /db_xref="InterPro:IPR036972"
FT                   /db_xref="UniProtKB/TrEMBL:Q753X9"
FT                   /protein_id="AAS53564.1"
FT   gene            <792035..>792456
FT                   /locus_tag="AGOS_AFR194W"
FT                   /old_locus_tag="AFR194W"
FT   mRNA            join(<792035..792044,792096..>792456)
FT                   /locus_tag="AGOS_AFR194W"
FT                   /old_locus_tag="AFR194W"
FT                   /product="AFR194Wp"
FT                   /note="5'UTR intron"
FT   CDS_pept        792097..792456
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR194W"
FT                   /old_locus_tag="AFR194W"
FT                   /product="AFR194Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL189C
FT                   (RPS26A) and YER131W (RPS26B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR194W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53565"
FT                   /db_xref="GOA:Q753X8"
FT                   /db_xref="InterPro:IPR000892"
FT                   /db_xref="InterPro:IPR038551"
FT                   /db_xref="UniProtKB/TrEMBL:Q753X8"
FT                   /protein_id="AAS53565.1"
FT                   RENRVNPADAAKKAL"
FT   gene            <793484..>794848
FT                   /locus_tag="AGOS_AFR195W"
FT                   /old_locus_tag="AFR195W"
FT   mRNA            <793484..>794848
FT                   /locus_tag="AGOS_AFR195W"
FT                   /old_locus_tag="AFR195W"
FT                   /product="AFR195Wp"
FT   CDS_pept        793484..794848
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR195W"
FT                   /old_locus_tag="AFR195W"
FT                   /product="AFR195Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL190C
FT                   (CDC55)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR195W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53566"
FT                   /db_xref="GOA:Q753X7"
FT                   /db_xref="InterPro:IPR000009"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR018067"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q753X7"
FT                   /protein_id="AAS53566.1"
FT   gene            complement(<795284..>795664)
FT                   /locus_tag="AGOS_AFR196C"
FT                   /old_locus_tag="AFR196C"
FT   mRNA            complement(<795284..>795664)
FT                   /locus_tag="AGOS_AFR196C"
FT                   /old_locus_tag="AFR196C"
FT                   /product="AFR196Cp"
FT   CDS_pept        complement(795284..795664)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR196C"
FT                   /old_locus_tag="AFR196C"
FT                   /product="AFR196Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL191W
FT                   (COX13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR196C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53567"
FT                   /db_xref="GOA:Q753X6"
FT                   /db_xref="InterPro:IPR001349"
FT                   /db_xref="InterPro:IPR036418"
FT                   /db_xref="UniProtKB/TrEMBL:Q753X6"
FT                   /protein_id="AAS53567.1"
FT   gene            796218..796289
FT                   /locus_tag="AGOS_t0151"
FT   tRNA            796218..796289
FT                   /locus_tag="AGOS_t0151"
FT                   /product="tRNA-His"
FT                   /note="codon recognized: CAC"
FT   gene            797083..797194
FT                   /locus_tag="AGOS_t0152"
FT   tRNA            join(797083..797118,797159..797194)
FT                   /locus_tag="AGOS_t0152"
FT                   /product="tRNA-Pro"
FT                   /note="codon recognized: CCA"
FT   gene            <797299..>798723
FT                   /locus_tag="AGOS_AFR197W"
FT                   /old_locus_tag="AFR197W"
FT   mRNA            <797299..>798723
FT                   /locus_tag="AGOS_AFR197W"
FT                   /old_locus_tag="AFR197W"
FT                   /product="AFR197Wp"
FT   CDS_pept        797299..798723
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR197W"
FT                   /old_locus_tag="AFR197W"
FT                   /product="AFR197Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR115W
FT                   (MGR3) and YKL133C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR197W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53568"
FT                   /db_xref="GOA:Q753X5"
FT                   /db_xref="InterPro:IPR040201"
FT                   /db_xref="UniProtKB/TrEMBL:Q753X5"
FT                   /protein_id="AAS53568.1"
FT                   SNPSTVFMEPKGTETP"
FT   gene            <798903..>801233
FT                   /locus_tag="AGOS_AFR198W"
FT                   /old_locus_tag="AFR198W"
FT   mRNA            <798903..>801233
FT                   /locus_tag="AGOS_AFR198W"
FT                   /old_locus_tag="AFR198W"
FT                   /product="AFR198Wp"
FT   CDS_pept        798903..801233
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR198W"
FT                   /old_locus_tag="AFR198W"
FT                   /product="AFR198Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL134C
FT                   (OCT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR198W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53569"
FT                   /db_xref="GOA:Q753X4"
FT                   /db_xref="InterPro:IPR001567"
FT                   /db_xref="InterPro:IPR024077"
FT                   /db_xref="InterPro:IPR033851"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753X4"
FT                   /protein_id="AAS53569.1"
FT   gene            complement(<801328..>802526)
FT                   /locus_tag="AGOS_AFR199C"
FT                   /old_locus_tag="AFR199C"
FT   mRNA            complement(join(<801328..801750,801945..>802526))
FT                   /locus_tag="AGOS_AFR199C"
FT                   /old_locus_tag="AFR199C"
FT                   /product="AFR199Cp"
FT   CDS_pept        complement(join(801328..801750,801945..802526))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR199C"
FT                   /old_locus_tag="AFR199C"
FT                   /product="AFR199Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR116C
FT                   (ASC1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR199C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53570"
FT                   /db_xref="GOA:Q753X3"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q753X3"
FT                   /protein_id="AAS53570.1"
FT   gene            801813..801895
FT                   /locus_tag="AGOS_AgSNR24"
FT                   /old_locus_tag="AgSNR24"
FT   ncRNA           801813..801895
FT                   /locus_tag="AGOS_AgSNR24"
FT                   /old_locus_tag="AgSNR24"
FT                   /product="AgSNR24"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR24; start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <802970..>805054
FT                   /locus_tag="AGOS_AFR200W"
FT                   /old_locus_tag="AFR200W"
FT   mRNA            <802970..>805054
FT                   /locus_tag="AGOS_AFR200W"
FT                   /old_locus_tag="AFR200W"
FT                   /product="AFR200Wp"
FT   CDS_pept        802970..805054
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR200W"
FT                   /old_locus_tag="AFR200W"
FT                   /product="AFR200Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL135C
FT                   (APL2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR200W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53571"
FT                   /db_xref="GOA:Q753X2"
FT                   /db_xref="InterPro:IPR002553"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR016342"
FT                   /db_xref="InterPro:IPR026739"
FT                   /db_xref="UniProtKB/TrEMBL:Q753X2"
FT                   /protein_id="AAS53571.2"
FT                   "
FT   gene            complement(<805091..>805420)
FT                   /locus_tag="AGOS_AFR201C"
FT                   /old_locus_tag="AFR201C"
FT   mRNA            complement(<805091..>805420)
FT                   /locus_tag="AGOS_AFR201C"
FT                   /old_locus_tag="AFR201C"
FT                   /product="AFR201Cp"
FT   CDS_pept        complement(805091..805420)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR201C"
FT                   /old_locus_tag="AFR201C"
FT                   /product="AFR201Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL137W
FT                   (CMC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR201C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53572"
FT                   /db_xref="GOA:Q753X1"
FT                   /db_xref="InterPro:IPR013892"
FT                   /db_xref="UniProtKB/TrEMBL:Q753X1"
FT                   /protein_id="AAS53572.1"
FT                   KAGEQ"
FT   gene            <805613..>806014
FT                   /locus_tag="AGOS_AFR202W"
FT                   /old_locus_tag="AFR202W"
FT   mRNA            <805613..>806014
FT                   /locus_tag="AGOS_AFR202W"
FT                   /old_locus_tag="AFR202W"
FT                   /product="AFR202Wp"
FT   CDS_pept        805613..806014
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR202W"
FT                   /old_locus_tag="AFR202W"
FT                   /product="AFR202Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL138C
FT                   (MRPL31)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR202W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53573"
FT                   /db_xref="GOA:Q753X0"
FT                   /db_xref="InterPro:IPR016340"
FT                   /db_xref="UniProtKB/TrEMBL:Q753X0"
FT                   /protein_id="AAS53573.2"
FT   gene            complement(<806031..>806645)
FT                   /locus_tag="AGOS_AFR203C"
FT                   /old_locus_tag="AFR203C"
FT   mRNA            complement(<806031..>806645)
FT                   /locus_tag="AGOS_AFR203C"
FT                   /old_locus_tag="AFR203C"
FT                   /product="AFR203Cp"
FT   CDS_pept        complement(806031..806645)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR203C"
FT                   /old_locus_tag="AFR203C"
FT                   /product="AFR203Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR117C
FT                   (SPC24)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR203C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53574"
FT                   /db_xref="GOA:Q753W9"
FT                   /db_xref="InterPro:IPR013252"
FT                   /db_xref="InterPro:IPR038066"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753W9"
FT                   /protein_id="AAS53574.1"
FT   gene            <806759..>806965
FT                   /locus_tag="AGOS_AFR204W"
FT                   /old_locus_tag="AFR204W"
FT   mRNA            <806759..>806965
FT                   /locus_tag="AGOS_AFR204W"
FT                   /old_locus_tag="AFR204W"
FT                   /product="AFR204Wp"
FT   CDS_pept        806759..806965
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR204W"
FT                   /old_locus_tag="AFR204W"
FT                   /product="AFR204Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKL138C-A (HSK3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR204W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53575"
FT                   /db_xref="GOA:Q753W8"
FT                   /db_xref="InterPro:IPR013183"
FT                   /db_xref="InterPro:IPR042332"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753W8"
FT                   /protein_id="AAS53575.1"
FT   gene            complement(<807034..>808407)
FT                   /locus_tag="AGOS_AFR205C"
FT                   /old_locus_tag="AFR205C"
FT   mRNA            complement(<807034..>808407)
FT                   /locus_tag="AGOS_AFR205C"
FT                   /old_locus_tag="AFR205C"
FT                   /product="AFR205Cp"
FT   CDS_pept        complement(807034..808407)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR205C"
FT                   /old_locus_tag="AFR205C"
FT                   /product="AFR205Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL139W
FT                   (CTK1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR205C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53576"
FT                   /db_xref="GOA:Q753W7"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q753W7"
FT                   /protein_id="AAS53576.1"
FT   gene            complement(<808632..>809960)
FT                   /locus_tag="AGOS_AFR206C"
FT                   /old_locus_tag="AFR206C"
FT   mRNA            complement(<808632..>809960)
FT                   /locus_tag="AGOS_AFR206C"
FT                   /old_locus_tag="AFR206C"
FT                   /product="AFR206Cp"
FT   CDS_pept        complement(808632..809960)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR206C"
FT                   /old_locus_tag="AFR206C"
FT                   /product="AFR206Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL140W
FT                   (TGL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR206C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53577"
FT                   /db_xref="GOA:Q753W6"
FT                   /db_xref="InterPro:IPR000073"
FT                   /db_xref="InterPro:IPR025483"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/TrEMBL:Q753W6"
FT                   /protein_id="AAS53577.1"
FT   gene            complement(<810103..>810603)
FT                   /locus_tag="AGOS_AFR207C"
FT                   /old_locus_tag="AFR207C"
FT   mRNA            complement(<810103..>810603)
FT                   /locus_tag="AGOS_AFR207C"
FT                   /old_locus_tag="AFR207C"
FT                   /product="AFR207Cp"
FT   CDS_pept        complement(810103..810603)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR207C"
FT                   /old_locus_tag="AFR207C"
FT                   /product="AFR207Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR118C
FT                   and YKL141W (SDH3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR207C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53578"
FT                   /db_xref="GOA:Q753W5"
FT                   /db_xref="InterPro:IPR000701"
FT                   /db_xref="InterPro:IPR014314"
FT                   /db_xref="InterPro:IPR018495"
FT                   /db_xref="InterPro:IPR034804"
FT                   /db_xref="UniProtKB/TrEMBL:Q753W5"
FT                   /protein_id="AAS53578.1"
FT                   LTL"
FT   gene            complement(<810769..>811329)
FT                   /locus_tag="AGOS_AFR208C"
FT                   /old_locus_tag="AFR208C"
FT   mRNA            complement(<810769..>811329)
FT                   /locus_tag="AGOS_AFR208C"
FT                   /old_locus_tag="AFR208C"
FT                   /product="AFR208Cp"
FT   CDS_pept        complement(810769..811329)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR208C"
FT                   /old_locus_tag="AFR208C"
FT                   /product="AFR208Cp"
FT                   /note="NOHBY631; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F17842g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR208C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53579"
FT                   /db_xref="UniProtKB/TrEMBL:Q753W4"
FT                   /protein_id="AAS53579.1"
FT   gene            <811835..>812548
FT                   /locus_tag="AGOS_AFR209W"
FT                   /old_locus_tag="AFR209W"
FT   mRNA            <811835..>812548
FT                   /locus_tag="AGOS_AFR209W"
FT                   /old_locus_tag="AFR209W"
FT                   /product="AFR209Wp"
FT   CDS_pept        811835..812548
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR209W"
FT                   /old_locus_tag="AFR209W"
FT                   /product="AFR209Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR025W
FT                   (SNF7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR209W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53580"
FT                   /db_xref="GOA:Q753W3"
FT                   /db_xref="InterPro:IPR005024"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753W3"
FT                   /protein_id="AAS53580.1"
FT                   EDERALRELQAEMGL"
FT   gene            complement(<812722..>813711)
FT                   /locus_tag="AGOS_AFR210C"
FT                   /old_locus_tag="AFR210C"
FT   mRNA            complement(<812722..>813711)
FT                   /locus_tag="AGOS_AFR210C"
FT                   /old_locus_tag="AFR210C"
FT                   /product="AFR210Cp"
FT   CDS_pept        complement(812722..813711)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR210C"
FT                   /old_locus_tag="AFR210C"
FT                   /product="AFR210Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR026C
FT                   (SED5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR210C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53581"
FT                   /db_xref="GOA:Q753W2"
FT                   /db_xref="InterPro:IPR000727"
FT                   /db_xref="InterPro:IPR006012"
FT                   /db_xref="InterPro:IPR010989"
FT                   /db_xref="UniProtKB/TrEMBL:Q753W2"
FT                   /protein_id="AAS53581.2"
FT   gene            complement(<814128..>815387)
FT                   /locus_tag="AGOS_AFR211C"
FT                   /old_locus_tag="AFR211C"
FT   mRNA            complement(<814128..>815387)
FT                   /locus_tag="AGOS_AFR211C"
FT                   /old_locus_tag="AFR211C"
FT                   /product="AFR211Cp"
FT   CDS_pept        complement(814128..815387)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR211C"
FT                   /old_locus_tag="AFR211C"
FT                   /product="AFR211Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR027C
FT                   (AAT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR211C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53582"
FT                   /db_xref="GOA:Q753W1"
FT                   /db_xref="InterPro:IPR000796"
FT                   /db_xref="InterPro:IPR004838"
FT                   /db_xref="InterPro:IPR004839"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="UniProtKB/TrEMBL:Q753W1"
FT                   /protein_id="AAS53582.1"
FT   gene            <815797..>817677
FT                   /locus_tag="AGOS_AFR212W"
FT                   /old_locus_tag="AFR212W"
FT   mRNA            <815797..>817677
FT                   /locus_tag="AGOS_AFR212W"
FT                   /old_locus_tag="AFR212W"
FT                   /product="AFR212Wp"
FT   CDS_pept        815797..817677
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR212W"
FT                   /old_locus_tag="AFR212W"
FT                   /product="AFR212Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR119W
FT                   (ASI1) and Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YNL008C (ASI3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR212W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53583"
FT                   /db_xref="GOA:Q753W0"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="UniProtKB/TrEMBL:Q753W0"
FT                   /protein_id="AAS53583.2"
FT   gene            818269..818365
FT                   /locus_tag="AGOS_AgSNR30"
FT                   /old_locus_tag="AgSNR30"
FT   ncRNA           818269..818365
FT                   /locus_tag="AGOS_AgSNR30"
FT                   /old_locus_tag="AgSNR30"
FT                   /product="AgSNR30"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR30; start and end coordinates are approximate.
FT                   Similarity is partial. In synteny."
FT                   /ncRNA_class="snRNA"
FT   gene            complement(<818582..>820354)
FT                   /locus_tag="AGOS_AFR213C"
FT                   /old_locus_tag="AFR213C"
FT   mRNA            complement(<818582..>820354)
FT                   /locus_tag="AGOS_AFR213C"
FT                   /old_locus_tag="AFR213C"
FT                   /product="AFR213Cp"
FT   CDS_pept        complement(818582..820354)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR213C"
FT                   /old_locus_tag="AFR213C"
FT                   /product="AFR213Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR120C
FT                   (ADE17) and YLR028C (ADE16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR213C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53584"
FT                   /db_xref="GOA:Q753V9"
FT                   /db_xref="InterPro:IPR002695"
FT                   /db_xref="InterPro:IPR011607"
FT                   /db_xref="InterPro:IPR016193"
FT                   /db_xref="InterPro:IPR024050"
FT                   /db_xref="InterPro:IPR024051"
FT                   /db_xref="InterPro:IPR036914"
FT                   /db_xref="UniProtKB/TrEMBL:Q753V9"
FT                   /protein_id="AAS53584.2"
FT                   ELVYVENPIRLFHH"
FT   gene            complement(<820874..>821488)
FT                   /locus_tag="AGOS_AFR214C"
FT                   /old_locus_tag="AFR214C"
FT   mRNA            complement(<820874..>821488)
FT                   /locus_tag="AGOS_AFR214C"
FT                   /old_locus_tag="AFR214C"
FT                   /product="AFR214Cp"
FT   CDS_pept        complement(820874..821488)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR214C"
FT                   /old_locus_tag="AFR214C"
FT                   /product="AFR214Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR121C
FT                   (RPL15B) and YLR029C (RPL15A)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR214C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53585"
FT                   /db_xref="GOA:Q753V8"
FT                   /db_xref="InterPro:IPR000439"
FT                   /db_xref="InterPro:IPR012678"
FT                   /db_xref="InterPro:IPR020925"
FT                   /db_xref="InterPro:IPR024794"
FT                   /db_xref="UniProtKB/TrEMBL:Q753V8"
FT                   /protein_id="AAS53585.1"
FT   gene            <823087..>823326
FT                   /locus_tag="AGOS_AFR215W"
FT                   /old_locus_tag="AFR215W"
FT   mRNA            <823087..>823326
FT                   /locus_tag="AGOS_AFR215W"
FT                   /old_locus_tag="AFR215W"
FT                   /product="AFR215Wp"
FT   CDS_pept        823087..823326
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR215W"
FT                   /old_locus_tag="AFR215W"
FT                   /product="AFR215Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR122W-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR215W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53586"
FT                   /db_xref="UniProtKB/TrEMBL:Q753V7"
FT                   /protein_id="AAS53586.1"
FT   gene            <823457..>823759
FT                   /locus_tag="AGOS_AFR216W"
FT                   /old_locus_tag="AFR216W"
FT   mRNA            <823457..>823759
FT                   /locus_tag="AGOS_AFR216W"
FT                   /old_locus_tag="AFR216W"
FT                   /product="AFR216Wp"
FT   CDS_pept        823457..823759
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR216W"
FT                   /old_locus_tag="AFR216W"
FT                   /product="AFR216Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR123W
FT                   (PKR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR216W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53587"
FT                   /db_xref="GOA:Q754H8"
FT                   /db_xref="InterPro:IPR013945"
FT                   /db_xref="UniProtKB/TrEMBL:Q754H8"
FT                   /protein_id="AAS53587.1"
FT   gene            <824050..>827265
FT                   /locus_tag="AGOS_AFR217W"
FT                   /old_locus_tag="AFR217W"
FT   mRNA            <824050..>827265
FT                   /locus_tag="AGOS_AFR217W"
FT                   /old_locus_tag="AFR217W"
FT                   /product="AFR217Wp"
FT   CDS_pept        824050..827265
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR217W"
FT                   /old_locus_tag="AFR217W"
FT                   /product="AFR217Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR124W
FT                   and YLR031W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR217W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53588"
FT                   /db_xref="UniProtKB/TrEMBL:Q754H7"
FT                   /protein_id="AAS53588.1"
FT   gene            <827563..>830396
FT                   /locus_tag="AGOS_AFR218W"
FT                   /old_locus_tag="AFR218W"
FT   mRNA            join(<827563..827587,827839..>830396)
FT                   /locus_tag="AGOS_AFR218W"
FT                   /old_locus_tag="AFR218W"
FT                   /product="AFR218Wp"
FT   CDS_pept        join(827563..827587,827839..830396)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR218W"
FT                   /old_locus_tag="AFR218W"
FT                   /product="AFR218Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR125W
FT                   (STO1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR218W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53589"
FT                   /db_xref="GOA:Q754H6"
FT                   /db_xref="InterPro:IPR003890"
FT                   /db_xref="InterPro:IPR015172"
FT                   /db_xref="InterPro:IPR015174"
FT                   /db_xref="InterPro:IPR016021"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR027159"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q754H6"
FT                   /protein_id="AAS53589.2"
FT   gene            complement(<830534..>831358)
FT                   /locus_tag="AGOS_AFR219C"
FT                   /old_locus_tag="AFR219C"
FT   mRNA            complement(<830534..>831358)
FT                   /locus_tag="AGOS_AFR219C"
FT                   /old_locus_tag="AFR219C"
FT                   /product="AFR219Cp"
FT   CDS_pept        complement(830534..831358)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR219C"
FT                   /old_locus_tag="AFR219C"
FT                   /product="AFR219Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR126C
FT                   (DLT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR219C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53590"
FT                   /db_xref="GOA:Q753V6"
FT                   /db_xref="InterPro:IPR038869"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753V6"
FT                   /protein_id="AAS53590.1"
FT   gene            <831695..>834952
FT                   /locus_tag="AGOS_AFR220W"
FT                   /old_locus_tag="AFR220W"
FT   mRNA            <831695..>834952
FT                   /locus_tag="AGOS_AFR220W"
FT                   /old_locus_tag="AFR220W"
FT                   /product="AFR220Wp"
FT   CDS_pept        831695..834952
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR220W"
FT                   /old_locus_tag="AFR220W"
FT                   /product="AFR220Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR032W
FT                   (RAD5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR220W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53591"
FT                   /db_xref="GOA:Q753V5"
FT                   /db_xref="InterPro:IPR000330"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014905"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR038718"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753V5"
FT                   /protein_id="AAS53591.2"
FT   gene            complement(<834993..>835937)
FT                   /locus_tag="AGOS_AFR221C"
FT                   /old_locus_tag="AFR221C"
FT   mRNA            complement(<834993..>835937)
FT                   /locus_tag="AGOS_AFR221C"
FT                   /old_locus_tag="AFR221C"
FT                   /product="AFR221Cp"
FT   CDS_pept        complement(834993..835937)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR221C"
FT                   /old_locus_tag="AFR221C"
FT                   /product="AFR221Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR127C
FT                   (SAS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR221C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53592"
FT                   /db_xref="GOA:Q753V4"
FT                   /db_xref="InterPro:IPR002717"
FT                   /db_xref="InterPro:IPR016181"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR040706"
FT                   /db_xref="UniProtKB/TrEMBL:Q753V4"
FT                   /protein_id="AAS53592.1"
FT   gene            <836196..>839906
FT                   /locus_tag="AGOS_AFR222W"
FT                   /old_locus_tag="AFR222W"
FT   mRNA            <836196..>839906
FT                   /locus_tag="AGOS_AFR222W"
FT                   /old_locus_tag="AFR222W"
FT                   /product="AFR222Wp"
FT   CDS_pept        836196..839906
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR222W"
FT                   /old_locus_tag="AFR222W"
FT                   /product="AFR222Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR128W
FT                   (ECM16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR222W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53593"
FT                   /db_xref="GOA:Q753V3"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR002464"
FT                   /db_xref="InterPro:IPR007502"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR011709"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q753V3"
FT                   /protein_id="AAS53593.2"
FT                   KAQLSAHTVSQ"
FT   gene            <840121..>841792
FT                   /locus_tag="AGOS_AFR223W"
FT                   /old_locus_tag="AFR223W"
FT   mRNA            join(<840121..840176,840244..>841792)
FT                   /locus_tag="AGOS_AFR223W"
FT                   /old_locus_tag="AFR223W"
FT                   /product="AFR223Wp"
FT   CDS_pept        join(840121..840176,840244..841792)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR223W"
FT                   /old_locus_tag="AFR223W"
FT                   /product="AFR223Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR033W
FT                   (RSC58); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR223W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53594"
FT                   /db_xref="GOA:Q753V2"
FT                   /db_xref="InterPro:IPR001487"
FT                   /db_xref="UniProtKB/TrEMBL:Q753V2"
FT                   /protein_id="AAS53594.2"
FT                   NIPVVRTYPNRKKKYKK"
FT   gene            complement(<842097..>843515)
FT                   /locus_tag="AGOS_AFR224C"
FT                   /old_locus_tag="AFR224C"
FT   mRNA            complement(<842097..>843515)
FT                   /locus_tag="AGOS_AFR224C"
FT                   /old_locus_tag="AFR224C"
FT                   /product="AFR224Cp"
FT   CDS_pept        complement(842097..843515)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR224C"
FT                   /old_locus_tag="AFR224C"
FT                   /product="AFR224Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR034C
FT                   (SMF3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR224C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53595"
FT                   /db_xref="GOA:Q753V1"
FT                   /db_xref="InterPro:IPR001046"
FT                   /db_xref="UniProtKB/TrEMBL:Q753V1"
FT                   /protein_id="AAS53595.1"
FT                   YLVVSFLLGADVQF"
FT   gene            <843964..>847863
FT                   /locus_tag="AGOS_AFR225W"
FT                   /old_locus_tag="AFR225W"
FT   mRNA            <843964..>847863
FT                   /locus_tag="AGOS_AFR225W"
FT                   /old_locus_tag="AFR225W"
FT                   /product="AFR225Wp"
FT   CDS_pept        843964..847863
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR225W"
FT                   /old_locus_tag="AFR225W"
FT                   /product="AFR225Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR129W
FT                   (POM152)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR225W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53596"
FT                   /db_xref="GOA:Q753V0"
FT                   /db_xref="InterPro:IPR037701"
FT                   /db_xref="UniProtKB/TrEMBL:Q753V0"
FT                   /protein_id="AAS53596.1"
FT                   DAFCSAKNDAFFNNY"
FT   gene            complement(<848029..>850143)
FT                   /locus_tag="AGOS_AFR226C"
FT                   /old_locus_tag="AFR226C"
FT   mRNA            complement(<848029..>850143)
FT                   /locus_tag="AGOS_AFR226C"
FT                   /old_locus_tag="AFR226C"
FT                   /product="AFR226Cp"
FT   CDS_pept        complement(848029..850143)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR226C"
FT                   /old_locus_tag="AFR226C"
FT                   /product="AFR226Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR035C
FT                   (MLH2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR226C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53597"
FT                   /db_xref="GOA:Q753U9"
FT                   /db_xref="InterPro:IPR013507"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR014762"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR036890"
FT                   /db_xref="InterPro:IPR038973"
FT                   /db_xref="UniProtKB/TrEMBL:Q753U9"
FT                   /protein_id="AAS53597.1"
FT                   TSKGWYVVGI"
FT   gene            <850302..>851170
FT                   /locus_tag="AGOS_AFR227W"
FT                   /old_locus_tag="AFR227W"
FT   mRNA            join(<850302..850482,850536..>851170)
FT                   /locus_tag="AGOS_AFR227W"
FT                   /old_locus_tag="AFR227W"
FT                   /product="AFR227Wp"
FT   CDS_pept        join(850302..850482,850536..851170)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR227W"
FT                   /old_locus_tag="AFR227W"
FT                   /product="AFR227Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR130W; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR227W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53598"
FT                   /db_xref="GOA:Q753U8"
FT                   /db_xref="InterPro:IPR006439"
FT                   /db_xref="InterPro:IPR011949"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="InterPro:IPR041492"
FT                   /db_xref="UniProtKB/TrEMBL:Q753U8"
FT                   /protein_id="AAS53598.2"
FT   gene            complement(851205..851277)
FT                   /locus_tag="AGOS_t0153"
FT   tRNA            complement(851205..851277)
FT                   /locus_tag="AGOS_t0153"
FT                   /product="tRNA-Ala"
FT                   /note="codon recognized: GCA"
FT   gene            <852357..>854087
FT                   /locus_tag="AGOS_AFR228W"
FT                   /old_locus_tag="AFR228W"
FT   mRNA            <852357..>854087
FT                   /locus_tag="AGOS_AFR228W"
FT                   /old_locus_tag="AFR228W"
FT                   /product="AFR228Wp"
FT   CDS_pept        852357..854087
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR228W"
FT                   /old_locus_tag="AFR228W"
FT                   /product="AFR228Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YKR093W (PTR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR228W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53599"
FT                   /db_xref="GOA:Q753U7"
FT                   /db_xref="InterPro:IPR000109"
FT                   /db_xref="InterPro:IPR018456"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q753U7"
FT                   /protein_id="AAS53599.1"
FT                   "
FT   gene            complement(<854462..>856069)
FT                   /locus_tag="AGOS_AFR229C"
FT                   /old_locus_tag="AFR229C"
FT   mRNA            complement(<854462..>856069)
FT                   /locus_tag="AGOS_AFR229C"
FT                   /old_locus_tag="AFR229C"
FT                   /product="AFR229Cp"
FT   CDS_pept        complement(854462..856069)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR229C"
FT                   /old_locus_tag="AFR229C"
FT                   /product="AFR229Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YIL166C, YOL163W and YOL162W; YOL162W and YOL163W represent
FT                   one ORF in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR229C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53600"
FT                   /db_xref="GOA:Q753U6"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q753U6"
FT                   /protein_id="AAS53600.1"
FT                   IVNTTDKGNKRLDFRFAH"
FT   gene            complement(<856877..>858691)
FT                   /locus_tag="AGOS_AFR230C"
FT                   /old_locus_tag="AFR230C"
FT   mRNA            complement(<856877..>858691)
FT                   /locus_tag="AGOS_AFR230C"
FT                   /old_locus_tag="AFR230C"
FT                   /product="AFR230Cp"
FT   CDS_pept        complement(856877..858691)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR230C"
FT                   /old_locus_tag="AFR230C"
FT                   /product="AFR230Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YKR039W (GAP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR230C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53601"
FT                   /db_xref="GOA:Q753U5"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="InterPro:IPR004762"
FT                   /db_xref="InterPro:IPR004840"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="UniProtKB/TrEMBL:Q753U5"
FT                   /protein_id="AAS53601.1"
FT   gene            <859344..>860411
FT                   /locus_tag="AGOS_AFR231W"
FT                   /old_locus_tag="AFR231W"
FT   mRNA            <859344..>860411
FT                   /locus_tag="AGOS_AFR231W"
FT                   /old_locus_tag="AFR231W"
FT                   /product="AFR231Wp"
FT   CDS_pept        859344..860411
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR231W"
FT                   /old_locus_tag="AFR231W"
FT                   /product="AFR231Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL222C
FT                   (EDC1) and YER035W (EDC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR231W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53602"
FT                   /db_xref="GOA:Q753U4"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753U4"
FT                   /protein_id="AAS53602.1"
FT                   TDQPALSSLPKPSFV"
FT   gene            complement(<861077..>862900)
FT                   /locus_tag="AGOS_AFR232C"
FT                   /old_locus_tag="AFR232C"
FT   mRNA            complement(<861077..>862900)
FT                   /locus_tag="AGOS_AFR232C"
FT                   /old_locus_tag="AFR232C"
FT                   /product="AFR232Cp"
FT   CDS_pept        complement(861077..862900)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR232C"
FT                   /old_locus_tag="AFR232C"
FT                   /product="AFR232Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER036C
FT                   (ARB1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR232C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53603"
FT                   /db_xref="GOA:Q753U3"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR032781"
FT                   /db_xref="UniProtKB/TrEMBL:Q753U3"
FT                   /protein_id="AAS53603.2"
FT   gene            <863137..>864264
FT                   /locus_tag="AGOS_AFR233W"
FT                   /old_locus_tag="AFR233W"
FT   mRNA            <863137..>864264
FT                   /locus_tag="AGOS_AFR233W"
FT                   /old_locus_tag="AFR233W"
FT                   /product="AFR233Wp"
FT   CDS_pept        863137..864264
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR233W"
FT                   /old_locus_tag="AFR233W"
FT                   /product="AFR233Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL223C
FT                   (COG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR233W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53604"
FT                   /db_xref="UniProtKB/TrEMBL:Q753U2"
FT                   /protein_id="AAS53604.3"
FT   gene            <864468..>865316
FT                   /locus_tag="AGOS_AFR234W"
FT                   /old_locus_tag="AFR234W"
FT   mRNA            <864468..>865316
FT                   /locus_tag="AGOS_AFR234W"
FT                   /old_locus_tag="AFR234W"
FT                   /product="AFR234Wp"
FT   CDS_pept        864468..865316
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR234W"
FT                   /old_locus_tag="AFR234W"
FT                   /product="AFR234Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL224C
FT                   (SDT1) and YER037W (PHM8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR234W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53605"
FT                   /db_xref="GOA:Q753U1"
FT                   /db_xref="InterPro:IPR006439"
FT                   /db_xref="InterPro:IPR010237"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q753U1"
FT                   /protein_id="AAS53605.2"
FT                   A"
FT   gene            complement(<865381..>866622)
FT                   /locus_tag="AGOS_AFR235C"
FT                   /old_locus_tag="AFR235C"
FT   mRNA            complement(<865381..>866622)
FT                   /locus_tag="AGOS_AFR235C"
FT                   /old_locus_tag="AFR235C"
FT                   /product="AFR235Cp"
FT   CDS_pept        complement(865381..866622)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR235C"
FT                   /old_locus_tag="AFR235C"
FT                   /product="AFR235Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER038C
FT                   (KRE29)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR235C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53606"
FT                   /db_xref="InterPro:IPR014803"
FT                   /db_xref="UniProtKB/TrEMBL:Q753U0"
FT                   /protein_id="AAS53606.1"
FT                   SLLKSYVNMCTSYK"
FT   gene            complement(<866864..>867853)
FT                   /locus_tag="AGOS_AFR236C"
FT                   /old_locus_tag="AFR236C"
FT   mRNA            complement(<866864..>867853)
FT                   /locus_tag="AGOS_AFR236C"
FT                   /old_locus_tag="AFR236C"
FT                   /product="AFR236Cp"
FT   CDS_pept        complement(866864..867853)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR236C"
FT                   /old_locus_tag="AFR236C"
FT                   /product="AFR236Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL225W
FT                   (VRG4), YER039C (HVG1) and YER039C-A; YER039C and YER039C-A
FT                   represent one ORF in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR236C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53607"
FT                   /db_xref="GOA:Q753T9"
FT                   /db_xref="InterPro:IPR013657"
FT                   /db_xref="InterPro:IPR038736"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753T9"
FT                   /protein_id="AAS53607.2"
FT   gene            <868261..>870684
FT                   /locus_tag="AGOS_AFR237W"
FT                   /old_locus_tag="AFR237W"
FT   mRNA            <868261..>870684
FT                   /locus_tag="AGOS_AFR237W"
FT                   /old_locus_tag="AFR237W"
FT                   /product="AFR237Wp"
FT   CDS_pept        868261..870684
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR237W"
FT                   /old_locus_tag="AFR237W"
FT                   /product="AFR237Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER040W
FT                   (GLN3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR237W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53608"
FT                   /db_xref="GOA:Q754I0"
FT                   /db_xref="InterPro:IPR000679"
FT                   /db_xref="InterPro:IPR013088"
FT                   /db_xref="InterPro:IPR039355"
FT                   /db_xref="UniProtKB/TrEMBL:Q754I0"
FT                   /protein_id="AAS53608.2"
FT   gene            <871119..>873215
FT                   /locus_tag="AGOS_AFR238W"
FT                   /old_locus_tag="AFR238W"
FT   mRNA            <871119..>873215
FT                   /locus_tag="AGOS_AFR238W"
FT                   /old_locus_tag="AFR238W"
FT                   /product="AFR238Wp"
FT   CDS_pept        871119..873215
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR238W"
FT                   /old_locus_tag="AFR238W"
FT                   /product="AFR238Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER041W
FT                   (YEN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR238W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53609"
FT                   /db_xref="GOA:Q753T8"
FT                   /db_xref="InterPro:IPR006084"
FT                   /db_xref="InterPro:IPR006086"
FT                   /db_xref="InterPro:IPR029060"
FT                   /db_xref="InterPro:IPR037316"
FT                   /db_xref="UniProtKB/TrEMBL:Q753T8"
FT                   /protein_id="AAS53609.1"
FT                   FAQD"
FT   gene            <873368..>873937
FT                   /locus_tag="AGOS_AFR239W"
FT                   /old_locus_tag="AFR239W"
FT   mRNA            <873368..>873937
FT                   /locus_tag="AGOS_AFR239W"
FT                   /old_locus_tag="AFR239W"
FT                   /product="AFR239Wp"
FT   CDS_pept        873368..873937
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR239W"
FT                   /old_locus_tag="AFR239W"
FT                   /product="AFR239Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER042W
FT                   (MXR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR239W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53610"
FT                   /db_xref="GOA:Q753T7"
FT                   /db_xref="InterPro:IPR002569"
FT                   /db_xref="InterPro:IPR036509"
FT                   /db_xref="UniProtKB/TrEMBL:Q753T7"
FT                   /protein_id="AAS53610.2"
FT   gene            complement(<873973..>874383)
FT                   /locus_tag="AGOS_AFR240C"
FT                   /old_locus_tag="AFR240C"
FT   mRNA            complement(<873973..>874383)
FT                   /locus_tag="AGOS_AFR240C"
FT                   /old_locus_tag="AFR240C"
FT                   /product="AFR240Cp"
FT   CDS_pept        complement(873973..874383)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR240C"
FT                   /old_locus_tag="AFR240C"
FT                   /product="AFR240Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL226W
FT                   (MTC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR240C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53611"
FT                   /db_xref="GOA:Q753T6"
FT                   /db_xref="InterPro:IPR004203"
FT                   /db_xref="InterPro:IPR036639"
FT                   /db_xref="UniProtKB/TrEMBL:Q753T6"
FT                   /protein_id="AAS53611.1"
FT   gene            <874502..>874819
FT                   /locus_tag="AGOS_AFR241W"
FT                   /old_locus_tag="AFR241W"
FT   mRNA            join(<874502..874522,874580..>874819)
FT                   /locus_tag="AGOS_AFR241W"
FT                   /old_locus_tag="AFR241W"
FT                   /product="AFR241Wp"
FT   CDS_pept        join(874502..874522,874580..874819)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR241W"
FT                   /old_locus_tag="AFR241W"
FT                   /product="AFR241Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGL226C-A (OST5); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR241W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53612"
FT                   /db_xref="GOA:Q753T5"
FT                   /db_xref="InterPro:IPR007915"
FT                   /db_xref="UniProtKB/TrEMBL:Q753T5"
FT                   /protein_id="AAS53612.2"
FT   gene            complement(<874940..>877411)
FT                   /locus_tag="AGOS_AFR242C"
FT                   /old_locus_tag="AFR242C"
FT   mRNA            complement(<874940..>877411)
FT                   /locus_tag="AGOS_AFR242C"
FT                   /old_locus_tag="AFR242C"
FT                   /product="AFR242Cp"
FT   CDS_pept        complement(874940..877411)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR242C"
FT                   /old_locus_tag="AFR242C"
FT                   /product="AFR242Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL227W
FT                   (VID30)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR242C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53613"
FT                   /db_xref="GOA:Q753T4"
FT                   /db_xref="InterPro:IPR001870"
FT                   /db_xref="InterPro:IPR003877"
FT                   /db_xref="InterPro:IPR013144"
FT                   /db_xref="InterPro:IPR013320"
FT                   /db_xref="InterPro:IPR024964"
FT                   /db_xref="UniProtKB/TrEMBL:Q753T4"
FT                   /protein_id="AAS53613.1"
FT                   LVNIDEDLLNL"
FT   gene            complement(<877768..>879117)
FT                   /locus_tag="AGOS_AFR243C"
FT                   /old_locus_tag="AFR243C"
FT   mRNA            complement(<877768..>879117)
FT                   /locus_tag="AGOS_AFR243C"
FT                   /old_locus_tag="AFR243C"
FT                   /product="AFR243Cp"
FT   CDS_pept        complement(877768..879117)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR243C"
FT                   /old_locus_tag="AFR243C"
FT                   /product="AFR243Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER043C
FT                   (SAH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR243C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53614"
FT                   /db_xref="GOA:Q753T3"
FT                   /db_xref="InterPro:IPR000043"
FT                   /db_xref="InterPro:IPR015878"
FT                   /db_xref="InterPro:IPR020082"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="InterPro:IPR042172"
FT                   /db_xref="UniProtKB/TrEMBL:Q753T3"
FT                   /protein_id="AAS53614.1"
FT   gene            complement(<879457..>881175)
FT                   /locus_tag="AGOS_AFR244C"
FT                   /old_locus_tag="AFR244C"
FT   mRNA            complement(<879457..>881175)
FT                   /locus_tag="AGOS_AFR244C"
FT                   /old_locus_tag="AFR244C"
FT                   /product="AFR244Cp"
FT   CDS_pept        complement(879457..881175)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR244C"
FT                   /old_locus_tag="AFR244C"
FT                   /product="AFR244Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL228W
FT                   (SHE10) and YFR039C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR244C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53615"
FT                   /db_xref="GOA:Q753T2"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753T2"
FT                   /protein_id="AAS53615.1"
FT   gene            <881718..>884417
FT                   /locus_tag="AGOS_AFR245W"
FT                   /old_locus_tag="AFR245W"
FT   mRNA            <881718..>884417
FT                   /locus_tag="AGOS_AFR245W"
FT                   /old_locus_tag="AFR245W"
FT                   /product="AFR245Wp"
FT   CDS_pept        881718..884417
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR245W"
FT                   /old_locus_tag="AFR245W"
FT                   /product="AFR245Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR040W
FT                   (SAP155) and YGL229C (SAP4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR245W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53616"
FT                   /db_xref="GOA:Q753T1"
FT                   /db_xref="InterPro:IPR007587"
FT                   /db_xref="UniProtKB/TrEMBL:Q753T1"
FT                   /protein_id="AAS53616.2"
FT   gene            complement(<884535..>885401)
FT                   /locus_tag="AGOS_AFR246C"
FT                   /old_locus_tag="AFR246C"
FT   mRNA            complement(<884535..>885401)
FT                   /locus_tag="AGOS_AFR246C"
FT                   /old_locus_tag="AFR246C"
FT                   /product="AFR246Cp"
FT   CDS_pept        complement(884535..885401)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR246C"
FT                   /old_locus_tag="AFR246C"
FT                   /product="AFR246Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR041C
FT                   (ERJ5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR246C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53617"
FT                   /db_xref="GOA:Q753T0"
FT                   /db_xref="InterPro:IPR001623"
FT                   /db_xref="InterPro:IPR036869"
FT                   /db_xref="UniProtKB/TrEMBL:Q753T0"
FT                   /protein_id="AAS53617.1"
FT                   YSRAKKD"
FT   gene            <885519..>886154
FT                   /locus_tag="AGOS_AFR247W"
FT                   /old_locus_tag="AFR247W"
FT   mRNA            <885519..>886154
FT                   /locus_tag="AGOS_AFR247W"
FT                   /old_locus_tag="AFR247W"
FT                   /product="AFR247Wp"
FT   CDS_pept        885519..886154
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR247W"
FT                   /old_locus_tag="AFR247W"
FT                   /product="AFR247Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR042W
FT                   (KEG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR247W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53618"
FT                   /db_xref="GOA:Q753S9"
FT                   /db_xref="UniProtKB/TrEMBL:Q753S9"
FT                   /protein_id="AAS53618.1"
FT   gene            complement(<886156..>887070)
FT                   /locus_tag="AGOS_AFR248C"
FT                   /old_locus_tag="AFR248C"
FT   mRNA            complement(<886156..>887070)
FT                   /locus_tag="AGOS_AFR248C"
FT                   /old_locus_tag="AFR248C"
FT                   /product="AFR248Cp"
FT   CDS_pept        complement(886156..887070)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR248C"
FT                   /old_locus_tag="AFR248C"
FT                   /product="AFR248Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR043C
FT                   (IRC6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR248C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53619"
FT                   /db_xref="GOA:Q753S8"
FT                   /db_xref="InterPro:IPR034627"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q753S8"
FT                   /protein_id="AAS53619.1"
FT   gene            <888012..>888557
FT                   /locus_tag="AGOS_AFR249W"
FT                   /old_locus_tag="AFR249W"
FT   mRNA            <888012..>888557
FT                   /locus_tag="AGOS_AFR249W"
FT                   /old_locus_tag="AFR249W"
FT                   /product="AFR249Wp"
FT   CDS_pept        888012..888557
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR249W"
FT                   /old_locus_tag="AFR249W"
FT                   /product="AFR249Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL231C
FT                   (EMC4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR249W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53620"
FT                   /db_xref="GOA:Q753S7"
FT                   /db_xref="InterPro:IPR009445"
FT                   /db_xref="UniProtKB/TrEMBL:Q753S7"
FT                   /protein_id="AAS53620.1"
FT                   DWLAWETPMAYSMQSYAF"
FT   gene            complement(<888645..>889478)
FT                   /locus_tag="AGOS_AFR250C"
FT                   /old_locus_tag="AFR250C"
FT   mRNA            complement(<888645..>889478)
FT                   /locus_tag="AGOS_AFR250C"
FT                   /old_locus_tag="AFR250C"
FT                   /product="AFR250Cp"
FT   CDS_pept        complement(888645..889478)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR250C"
FT                   /old_locus_tag="AFR250C"
FT                   /product="AFR250Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL232W
FT                   (TAN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR250C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53621"
FT                   /db_xref="GOA:Q753S6"
FT                   /db_xref="InterPro:IPR004114"
FT                   /db_xref="InterPro:IPR040183"
FT                   /db_xref="UniProtKB/TrEMBL:Q753S6"
FT                   /protein_id="AAS53621.1"
FT   gene            complement(<889646..>892252)
FT                   /locus_tag="AGOS_AFR251C"
FT                   /old_locus_tag="AFR251C"
FT   mRNA            complement(<889646..>892252)
FT                   /locus_tag="AGOS_AFR251C"
FT                   /old_locus_tag="AFR251C"
FT                   /product="AFR251Cp"
FT   CDS_pept        complement(889646..892252)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR251C"
FT                   /old_locus_tag="AFR251C"
FT                   /product="AFR251Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL233W
FT                   (SEC15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR251C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53622"
FT                   /db_xref="GOA:Q753S5"
FT                   /db_xref="InterPro:IPR007225"
FT                   /db_xref="InterPro:IPR042044"
FT                   /db_xref="InterPro:IPR042045"
FT                   /db_xref="UniProtKB/TrEMBL:Q753S5"
FT                   /protein_id="AAS53622.2"
FT   gene            complement(<892637..>894223)
FT                   /locus_tag="AGOS_AFR252C"
FT                   /old_locus_tag="AFR252C"
FT   mRNA            complement(<892637..>894223)
FT                   /locus_tag="AGOS_AFR252C"
FT                   /old_locus_tag="AFR252C"
FT                   /product="AFR252Cp"
FT   CDS_pept        complement(892637..894223)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR252C"
FT                   /old_locus_tag="AFR252C"
FT                   /product="AFR252Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR044C
FT                   (DUG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR252C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS53623"
FT                   /db_xref="GOA:Q753S4"
FT                   /db_xref="InterPro:IPR002933"
FT                   /db_xref="InterPro:IPR011650"
FT                   /db_xref="InterPro:IPR017153"
FT                   /db_xref="UniProtKB/TrEMBL:Q753S4"
FT                   /protein_id="AAS53623.1"
FT                   YLYYYSISDSK"
FT   gene            <894399..>895493
FT                   /locus_tag="AGOS_AFR253W"
FT                   /old_locus_tag="AFR253W"
FT   mRNA            join(<894399..894446,894507..>895493)
FT                   /locus_tag="AGOS_AFR253W"
FT                   /old_locus_tag="AFR253W"
FT                   /product="AFR253Wp"
FT   CDS_pept        join(894399..894446,894507..895493)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AFR253W"
FT                   /old_locus_tag="AFR253W"
FT                   /product="AFR253Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YFR045W; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AFR253W"
FT                   /db_xref="EnsemblGenom