(data stored in SCRATCH zone)

EMBL: AE016820

ID   AE016820; SV 4; linear; genomic DNA; STD; FUN; 1800949 BP.
AC   AE016820; AE016905-AE016909;
PR   Project:PRJNA13834;
DT   08-SEP-2004 (Rel. 81, Created)
DT   13-SEP-2017 (Rel. 134, Last updated, Version 12)
DE   Ashbya gossypii ATCC 10895 chromosome VII, complete sequence.
KW   .
OS   Eremothecium gossypii ATCC 10895
OC   Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina; Saccharomycetes;
OC   Saccharomycetales; Saccharomycetaceae; Eremothecium.
RN   [1]
RP   1-1800949
RX   DOI; 10.1126/science.1095781.
RX   PUBMED; 15001715.
RA   Dietrich F.S., Voegeli S., Brachat S., Lerch A., Gates K., Steiner S.,
RA   Mohr C., Pohlmann R., Luedi P., Choi S., Wing R.A., Flavier A.,
RA   Gaffney T.D., Philippsen P.;
RT   "The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces
RT   cerevisiae genome";
RL   Science, e1252229 304(5668):304-307(2004).
RN   [2]
RP   1-1800949
RA   Lerch A., Brachat S., Voegeli S.E., Gaffney T., Philippsen P.,
RA   Dietrich F.S.;
RT   ;
RL   Submitted (20-DEC-2002) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [3]
RC   Sequence update by submitter
RP   1-1800949
RA   Lerch A., Brachat S., Voegeli S.E., Gaffney T., Philippsen P.,
RA   Dietrich F.S.;
RT   ;
RL   Submitted (09-AUG-2007) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [4]
RC   Sequence update by submitter
RP   1-1800949
RA   Dietrich F.S., Voegeli S., Philippsen P.;
RT   ;
RL   Submitted (03-JUN-2010) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
RN   [5]
RC   Protein update by submitter
RP   1-1800949
RA   Dietrich F.S., Voegeli S., Philippsen P.;
RT   ;
RL   Submitted (02-FEB-2012) to the INSDC.
RL   Biozentrum, Klingelbergstrasse 50, Basel CH-4056, Switzerland
DR   MD5; ff824aecd5f028ab5508e04fb9fe15e3.
DR   BioSample; SAMN03081415.
DR   EnsemblGenomes-Gn; AGOS_AGR303W.
DR   EnsemblGenomes-Gn; EFAGOG00000000001.
DR   EnsemblGenomes-Gn; EFAGOG00000000005.
DR   EnsemblGenomes-Gn; EFAGOG00000000015.
DR   EnsemblGenomes-Gn; EFAGOG00000000016.
DR   EnsemblGenomes-Gn; EFAGOG00000000018.
DR   EnsemblGenomes-Gn; EFAGOG00000000027.
DR   EnsemblGenomes-Gn; EFAGOG00000000028.
DR   EnsemblGenomes-Gn; EFAGOG00000000029.
DR   EnsemblGenomes-Gn; EFAGOG00000000030.
DR   EnsemblGenomes-Gn; EFAGOG00000000032.
DR   EnsemblGenomes-Gn; EFAGOG00000000033.
DR   EnsemblGenomes-Gn; EFAGOG00000000035.
DR   EnsemblGenomes-Gn; EFAGOG00000000036.
DR   EnsemblGenomes-Gn; EFAGOG00000000040.
DR   EnsemblGenomes-Gn; EFAGOG00000000043.
DR   EnsemblGenomes-Gn; EFAGOG00000000046.
DR   EnsemblGenomes-Gn; EFAGOG00000000049.
DR   EnsemblGenomes-Gn; EFAGOG00000000050.
DR   EnsemblGenomes-Gn; EFAGOG00000000058.
DR   EnsemblGenomes-Gn; EFAGOG00000000067.
DR   EnsemblGenomes-Gn; EFAGOG00000000069.
DR   EnsemblGenomes-Gn; EFAGOG00000000073.
DR   EnsemblGenomes-Gn; EFAGOG00000000078.
DR   EnsemblGenomes-Gn; EFAGOG00000000080.
DR   EnsemblGenomes-Gn; EFAGOG00000000081.
DR   EnsemblGenomes-Gn; EFAGOG00000000082.
DR   EnsemblGenomes-Gn; EFAGOG00000000086.
DR   EnsemblGenomes-Gn; EFAGOG00000000087.
DR   EnsemblGenomes-Gn; EFAGOG00000000089.
DR   EnsemblGenomes-Gn; EFAGOG00000000090.
DR   EnsemblGenomes-Gn; EFAGOG00000000091.
DR   EnsemblGenomes-Gn; EFAGOG00000000094.
DR   EnsemblGenomes-Gn; EFAGOG00000000095.
DR   EnsemblGenomes-Gn; EFAGOG00000000099.
DR   EnsemblGenomes-Gn; EFAGOG00000000102.
DR   EnsemblGenomes-Gn; EFAGOG00000000104.
DR   EnsemblGenomes-Gn; EFAGOG00000000105.
DR   EnsemblGenomes-Gn; EFAGOG00000000109.
DR   EnsemblGenomes-Gn; EFAGOG00000000111.
DR   EnsemblGenomes-Gn; EFAGOG00000000112.
DR   EnsemblGenomes-Gn; EFAGOG00000000113.
DR   EnsemblGenomes-Gn; EFAGOG00000000115.
DR   EnsemblGenomes-Gn; EFAGOG00000000116.
DR   EnsemblGenomes-Gn; EFAGOG00000000118.
DR   EnsemblGenomes-Gn; EFAGOG00000000119.
DR   EnsemblGenomes-Gn; EFAGOG00000000121.
DR   EnsemblGenomes-Gn; EFAGOG00000000125.
DR   EnsemblGenomes-Gn; EFAGOG00000000126.
DR   EnsemblGenomes-Gn; EFAGOG00000000133.
DR   EnsemblGenomes-Gn; EFAGOG00000000136.
DR   EnsemblGenomes-Gn; EFAGOG00000000137.
DR   EnsemblGenomes-Gn; EFAGOG00000000138.
DR   EnsemblGenomes-Gn; EFAGOG00000000143.
DR   EnsemblGenomes-Gn; EFAGOG00000000146.
DR   EnsemblGenomes-Gn; EFAGOG00000000147.
DR   EnsemblGenomes-Gn; EFAGOG00000000148.
DR   EnsemblGenomes-Gn; EFAGOG00000000154.
DR   EnsemblGenomes-Gn; EFAGOG00000000163.
DR   EnsemblGenomes-Gn; EFAGOG00000000166.
DR   EnsemblGenomes-Gn; EFAGOG00000000167.
DR   EnsemblGenomes-Gn; EFAGOG00000000169.
DR   EnsemblGenomes-Gn; EFAGOG00000000178.
DR   EnsemblGenomes-Gn; EFAGOG00000000179.
DR   EnsemblGenomes-Gn; EFAGOG00000000180.
DR   EnsemblGenomes-Gn; EFAGOG00000000181.
DR   EnsemblGenomes-Gn; EFAGOG00000000182.
DR   EnsemblGenomes-Gn; EFAGOG00000000183.
DR   EnsemblGenomes-Gn; EFAGOG00000000186.
DR   EnsemblGenomes-Gn; EFAGOG00000000187.
DR   EnsemblGenomes-Gn; EFAGOG00000000188.
DR   EnsemblGenomes-Gn; EFAGOG00000000194.
DR   EnsemblGenomes-Gn; EFAGOG00000000198.
DR   EnsemblGenomes-Gn; EFAGOG00000000206.
DR   EnsemblGenomes-Gn; EFAGOG00000000207.
DR   EnsemblGenomes-Gn; EFAGOG00000000209.
DR   EnsemblGenomes-Gn; EFAGOG00000000211.
DR   EnsemblGenomes-Gn; EFAGOG00000000212.
DR   EnsemblGenomes-Gn; EFAGOG00000000214.
DR   EnsemblGenomes-Gn; EFAGOG00000000215.
DR   EnsemblGenomes-Gn; EFAGOG00000000222.
DR   EnsemblGenomes-Gn; EFAGOG00000000224.
DR   EnsemblGenomes-Gn; EFAGOG00000000228.
DR   EnsemblGenomes-Gn; EFAGOG00000000229.
DR   EnsemblGenomes-Gn; EFAGOG00000000231.
DR   EnsemblGenomes-Gn; EFAGOG00000000233.
DR   EnsemblGenomes-Gn; EFAGOG00000000237.
DR   EnsemblGenomes-Gn; EFAGOG00000000243.
DR   EnsemblGenomes-Gn; EFAGOG00000000245.
DR   EnsemblGenomes-Gn; EFAGOG00000000246.
DR   EnsemblGenomes-Gn; EFAGOG00000000251.
DR   EnsemblGenomes-Gn; EFAGOG00000000252.
DR   EnsemblGenomes-Gn; EFAGOG00000000257.
DR   EnsemblGenomes-Gn; EFAGOG00000000265.
DR   EnsemblGenomes-Gn; EFAGOG00000000268.
DR   EnsemblGenomes-Gn; EFAGOG00000000271.
DR   EnsemblGenomes-Gn; EFAGOG00000000275.
DR   EnsemblGenomes-Gn; EFAGOG00000000281.
DR   EnsemblGenomes-Gn; EFAGOG00000000283.
DR   EnsemblGenomes-Gn; EFAGOG00000000284.
DR   EnsemblGenomes-Gn; EFAGOG00000000286.
DR   EnsemblGenomes-Gn; EFAGOG00000000287.
DR   EnsemblGenomes-Gn; EFAGOG00000000288.
DR   EnsemblGenomes-Gn; EFAGOG00000000293.
DR   EnsemblGenomes-Gn; EFAGOG00000000294.
DR   EnsemblGenomes-Gn; EFAGOG00000000297.
DR   EnsemblGenomes-Gn; EFAGOG00000000300.
DR   EnsemblGenomes-Gn; EFAGOG00000000304.
DR   EnsemblGenomes-Gn; EFAGOG00000000306.
DR   EnsemblGenomes-Gn; EFAGOG00000000310.
DR   EnsemblGenomes-Gn; EFAGOG00000000311.
DR   EnsemblGenomes-Gn; EFAGOG00000000313.
DR   EnsemblGenomes-Gn; EFAGOG00000000315.
DR   EnsemblGenomes-Gn; EFAGOG00000000318.
DR   EnsemblGenomes-Gn; EFAGOG00000000325.
DR   EnsemblGenomes-Gn; EFAGOG00000000329.
DR   EnsemblGenomes-Gn; EFAGOG00000000331.
DR   EnsemblGenomes-Gn; EFAGOG00000000333.
DR   EnsemblGenomes-Gn; EFAGOG00000000338.
DR   EnsemblGenomes-Gn; EFAGOG00000000339.
DR   EnsemblGenomes-Gn; EFAGOG00000000340.
DR   EnsemblGenomes-Gn; EFAGOG00000000343.
DR   EnsemblGenomes-Gn; EFAGOG00000000345.
DR   EnsemblGenomes-Gn; EFAGOG00000000347.
DR   EnsemblGenomes-Gn; EFAGOG00000000352.
DR   EnsemblGenomes-Gn; EFAGOG00000000353.
DR   EnsemblGenomes-Gn; EFAGOG00000000354.
DR   EnsemblGenomes-Gn; EFAGOG00000000355.
DR   EnsemblGenomes-Gn; EFAGOG00000000358.
DR   EnsemblGenomes-Gn; EFAGOG00000000361.
DR   EnsemblGenomes-Gn; EFAGOG00000000364.
DR   EnsemblGenomes-Gn; EFAGOG00000000372.
DR   EnsemblGenomes-Gn; EFAGOG00000000373.
DR   EnsemblGenomes-Gn; EFAGOG00000000375.
DR   EnsemblGenomes-Gn; EFAGOG00000000379.
DR   EnsemblGenomes-Gn; EFAGOG00000000380.
DR   EnsemblGenomes-Gn; EFAGOG00000000384.
DR   EnsemblGenomes-Gn; EFAGOG00000000385.
DR   EnsemblGenomes-Gn; EFAGOG00000000388.
DR   EnsemblGenomes-Gn; EFAGOG00000000390.
DR   EnsemblGenomes-Gn; EFAGOG00000000399.
DR   EnsemblGenomes-Gn; EFAGOG00000000400.
DR   EnsemblGenomes-Gn; EFAGOG00000000410.
DR   EnsemblGenomes-Gn; EFAGOG00000000411.
DR   EnsemblGenomes-Gn; EFAGOG00000000412.
DR   EnsemblGenomes-Gn; ENSRNA049496156.
DR   EnsemblGenomes-Gn; ENSRNA049496159.
DR   EnsemblGenomes-Gn; ENSRNA049496162.
DR   EnsemblGenomes-Gn; ENSRNA049496168.
DR   EnsemblGenomes-Gn; ENSRNA049496171.
DR   EnsemblGenomes-Gn; ENSRNA049496173.
DR   EnsemblGenomes-Gn; ENSRNA049496175.
DR   EnsemblGenomes-Gn; ENSRNA049496178.
DR   EnsemblGenomes-Gn; ENSRNA049496183.
DR   EnsemblGenomes-Gn; ENSRNA049496187.
DR   EnsemblGenomes-Gn; ENSRNA049496193.
DR   EnsemblGenomes-Gn; ENSRNA049496196.
DR   EnsemblGenomes-Gn; ENSRNA049496199.
DR   EnsemblGenomes-Gn; ENSRNA049496202.
DR   EnsemblGenomes-Gn; ENSRNA049496204.
DR   EnsemblGenomes-Gn; ENSRNA049496207.
DR   EnsemblGenomes-Gn; ENSRNA049496211.
DR   EnsemblGenomes-Gn; ENSRNA049496214.
DR   EnsemblGenomes-Gn; ENSRNA049496217.
DR   EnsemblGenomes-Gn; ENSRNA049496219.
DR   EnsemblGenomes-Gn; ENSRNA049496223.
DR   EnsemblGenomes-Gn; ENSRNA049496226.
DR   EnsemblGenomes-Gn; ENSRNA049496230.
DR   EnsemblGenomes-Gn; ENSRNA049496232.
DR   EnsemblGenomes-Gn; ENSRNA049496234.
DR   EnsemblGenomes-Gn; ENSRNA049496236.
DR   EnsemblGenomes-Gn; ENSRNA049496240.
DR   EnsemblGenomes-Gn; ENSRNA049496242.
DR   EnsemblGenomes-Gn; ENSRNA049496245.
DR   EnsemblGenomes-Gn; ENSRNA049496249.
DR   EnsemblGenomes-Gn; ENSRNA049496252.
DR   EnsemblGenomes-Gn; ENSRNA049496253.
DR   EnsemblGenomes-Gn; ENSRNA049496257.
DR   EnsemblGenomes-Gn; ENSRNA049496261.
DR   EnsemblGenomes-Gn; ENSRNA049496264.
DR   EnsemblGenomes-Gn; ENSRNA049496266.
DR   EnsemblGenomes-Gn; ENSRNA049496267.
DR   EnsemblGenomes-Gn; ENSRNA049496269.
DR   EnsemblGenomes-Gn; ENSRNA049496273.
DR   EnsemblGenomes-Gn; ENSRNA049496274.
DR   EnsemblGenomes-Gn; ENSRNA049496277.
DR   EnsemblGenomes-Gn; ENSRNA049496281.
DR   EnsemblGenomes-Gn; ENSRNA049496284.
DR   EnsemblGenomes-Gn; ENSRNA049496287.
DR   EnsemblGenomes-Gn; ENSRNA049496290.
DR   EnsemblGenomes-Gn; ENSRNA049496294.
DR   EnsemblGenomes-Gn; ENSRNA049496297.
DR   EnsemblGenomes-Gn; ENSRNA049496299.
DR   EnsemblGenomes-Gn; ENSRNA049496301.
DR   EnsemblGenomes-Gn; ENSRNA049496304.
DR   EnsemblGenomes-Gn; ENSRNA049496306.
DR   EnsemblGenomes-Gn; ENSRNA049496310.
DR   EnsemblGenomes-Gn; ENSRNA049496313.
DR   EnsemblGenomes-Gn; ENSRNA049496316.
DR   EnsemblGenomes-Gn; ENSRNA049496319.
DR   EnsemblGenomes-Gn; ENSRNA049496322.
DR   EnsemblGenomes-Gn; ENSRNA049496323.
DR   EnsemblGenomes-Gn; ENSRNA049496324.
DR   EnsemblGenomes-Gn; ENSRNA049496326.
DR   EnsemblGenomes-Gn; ENSRNA049496327.
DR   EnsemblGenomes-Gn; ENSRNA049496328.
DR   EnsemblGenomes-Gn; ENSRNA049496330.
DR   EnsemblGenomes-Gn; ENSRNA049496332.
DR   EnsemblGenomes-Gn; ENSRNA049496333.
DR   EnsemblGenomes-Gn; ENSRNA049496335.
DR   EnsemblGenomes-Gn; ENSRNA049496336.
DR   EnsemblGenomes-Gn; ENSRNA049496338.
DR   EnsemblGenomes-Gn; ENSRNA049496340.
DR   EnsemblGenomes-Gn; ENSRNA049496342.
DR   EnsemblGenomes-Gn; ENSRNA049496344.
DR   EnsemblGenomes-Gn; ENSRNA049496345.
DR   EnsemblGenomes-Gn; ENSRNA049496346.
DR   EnsemblGenomes-Gn; ENSRNA049496348.
DR   EnsemblGenomes-Gn; ENSRNA049496350.
DR   EnsemblGenomes-Gn; ENSRNA049496352.
DR   EnsemblGenomes-Gn; ENSRNA049496354.
DR   EnsemblGenomes-Gn; ENSRNA049496355.
DR   EnsemblGenomes-Gn; ENSRNA049496356.
DR   EnsemblGenomes-Gn; ENSRNA049496357.
DR   EnsemblGenomes-Gn; ENSRNA049496359.
DR   EnsemblGenomes-Gn; ENSRNA049496361.
DR   EnsemblGenomes-Gn; ENSRNA049496362.
DR   EnsemblGenomes-Gn; ENSRNA049496366.
DR   EnsemblGenomes-Gn; ENSRNA049523654.
DR   EnsemblGenomes-Gn; ENSRNA049523685.
DR   EnsemblGenomes-Gn; ENSRNA049523718.
DR   EnsemblGenomes-Gn; ENSRNA049523742.
DR   EnsemblGenomes-Gn; ENSRNA049523771.
DR   EnsemblGenomes-Gn; ENSRNA049523798.
DR   EnsemblGenomes-Gn; ENSRNA049523836.
DR   EnsemblGenomes-Gn; ENSRNA049523873.
DR   EnsemblGenomes-Gn; ENSRNA049523892.
DR   EnsemblGenomes-Gn; ENSRNA049523929.
DR   EnsemblGenomes-Gn; ENSRNA049523963.
DR   EnsemblGenomes-Gn; ENSRNA049524004.
DR   EnsemblGenomes-Gn; ENSRNA049524046.
DR   EnsemblGenomes-Gn; ENSRNA049524069.
DR   EnsemblGenomes-Gn; ENSRNA049524107.
DR   EnsemblGenomes-Gn; ENSRNA049524127.
DR   EnsemblGenomes-Gn; ENSRNA049524164.
DR   EnsemblGenomes-Gn; ENSRNA049524191.
DR   EnsemblGenomes-Gn; ENSRNA049524213.
DR   EnsemblGenomes-Gn; ENSRNA049524241.
DR   EnsemblGenomes-Gn; ENSRNA049524274.
DR   EnsemblGenomes-Gn; ENSRNA049524286.
DR   EnsemblGenomes-Gn; ENSRNA049524306.
DR   EnsemblGenomes-Gn; ENSRNA049524339.
DR   EnsemblGenomes-Tr; AAS54793.
DR   EnsemblGenomes-Tr; EFAGOT00000000001.
DR   EnsemblGenomes-Tr; EFAGOT00000000005.
DR   EnsemblGenomes-Tr; EFAGOT00000000015.
DR   EnsemblGenomes-Tr; EFAGOT00000000016.
DR   EnsemblGenomes-Tr; EFAGOT00000000018.
DR   EnsemblGenomes-Tr; EFAGOT00000000027.
DR   EnsemblGenomes-Tr; EFAGOT00000000028.
DR   EnsemblGenomes-Tr; EFAGOT00000000029.
DR   EnsemblGenomes-Tr; EFAGOT00000000030.
DR   EnsemblGenomes-Tr; EFAGOT00000000032.
DR   EnsemblGenomes-Tr; EFAGOT00000000033.
DR   EnsemblGenomes-Tr; EFAGOT00000000035.
DR   EnsemblGenomes-Tr; EFAGOT00000000036.
DR   EnsemblGenomes-Tr; EFAGOT00000000040.
DR   EnsemblGenomes-Tr; EFAGOT00000000043.
DR   EnsemblGenomes-Tr; EFAGOT00000000046.
DR   EnsemblGenomes-Tr; EFAGOT00000000049.
DR   EnsemblGenomes-Tr; EFAGOT00000000050.
DR   EnsemblGenomes-Tr; EFAGOT00000000058.
DR   EnsemblGenomes-Tr; EFAGOT00000000067.
DR   EnsemblGenomes-Tr; EFAGOT00000000069.
DR   EnsemblGenomes-Tr; EFAGOT00000000073.
DR   EnsemblGenomes-Tr; EFAGOT00000000078.
DR   EnsemblGenomes-Tr; EFAGOT00000000080.
DR   EnsemblGenomes-Tr; EFAGOT00000000081.
DR   EnsemblGenomes-Tr; EFAGOT00000000082.
DR   EnsemblGenomes-Tr; EFAGOT00000000086.
DR   EnsemblGenomes-Tr; EFAGOT00000000087.
DR   EnsemblGenomes-Tr; EFAGOT00000000089.
DR   EnsemblGenomes-Tr; EFAGOT00000000090.
DR   EnsemblGenomes-Tr; EFAGOT00000000091.
DR   EnsemblGenomes-Tr; EFAGOT00000000094.
DR   EnsemblGenomes-Tr; EFAGOT00000000095.
DR   EnsemblGenomes-Tr; EFAGOT00000000099.
DR   EnsemblGenomes-Tr; EFAGOT00000000102.
DR   EnsemblGenomes-Tr; EFAGOT00000000104.
DR   EnsemblGenomes-Tr; EFAGOT00000000105.
DR   EnsemblGenomes-Tr; EFAGOT00000000109.
DR   EnsemblGenomes-Tr; EFAGOT00000000111.
DR   EnsemblGenomes-Tr; EFAGOT00000000112.
DR   EnsemblGenomes-Tr; EFAGOT00000000113.
DR   EnsemblGenomes-Tr; EFAGOT00000000115.
DR   EnsemblGenomes-Tr; EFAGOT00000000116.
DR   EnsemblGenomes-Tr; EFAGOT00000000118.
DR   EnsemblGenomes-Tr; EFAGOT00000000119.
DR   EnsemblGenomes-Tr; EFAGOT00000000121.
DR   EnsemblGenomes-Tr; EFAGOT00000000125.
DR   EnsemblGenomes-Tr; EFAGOT00000000126.
DR   EnsemblGenomes-Tr; EFAGOT00000000133.
DR   EnsemblGenomes-Tr; EFAGOT00000000136.
DR   EnsemblGenomes-Tr; EFAGOT00000000137.
DR   EnsemblGenomes-Tr; EFAGOT00000000138.
DR   EnsemblGenomes-Tr; EFAGOT00000000143.
DR   EnsemblGenomes-Tr; EFAGOT00000000146.
DR   EnsemblGenomes-Tr; EFAGOT00000000147.
DR   EnsemblGenomes-Tr; EFAGOT00000000148.
DR   EnsemblGenomes-Tr; EFAGOT00000000154.
DR   EnsemblGenomes-Tr; EFAGOT00000000163.
DR   EnsemblGenomes-Tr; EFAGOT00000000166.
DR   EnsemblGenomes-Tr; EFAGOT00000000167.
DR   EnsemblGenomes-Tr; EFAGOT00000000169.
DR   EnsemblGenomes-Tr; EFAGOT00000000178.
DR   EnsemblGenomes-Tr; EFAGOT00000000179.
DR   EnsemblGenomes-Tr; EFAGOT00000000180.
DR   EnsemblGenomes-Tr; EFAGOT00000000181.
DR   EnsemblGenomes-Tr; EFAGOT00000000182.
DR   EnsemblGenomes-Tr; EFAGOT00000000183.
DR   EnsemblGenomes-Tr; EFAGOT00000000186.
DR   EnsemblGenomes-Tr; EFAGOT00000000187.
DR   EnsemblGenomes-Tr; EFAGOT00000000188.
DR   EnsemblGenomes-Tr; EFAGOT00000000194.
DR   EnsemblGenomes-Tr; EFAGOT00000000198.
DR   EnsemblGenomes-Tr; EFAGOT00000000206.
DR   EnsemblGenomes-Tr; EFAGOT00000000207.
DR   EnsemblGenomes-Tr; EFAGOT00000000209.
DR   EnsemblGenomes-Tr; EFAGOT00000000211.
DR   EnsemblGenomes-Tr; EFAGOT00000000212.
DR   EnsemblGenomes-Tr; EFAGOT00000000214.
DR   EnsemblGenomes-Tr; EFAGOT00000000215.
DR   EnsemblGenomes-Tr; EFAGOT00000000222.
DR   EnsemblGenomes-Tr; EFAGOT00000000224.
DR   EnsemblGenomes-Tr; EFAGOT00000000228.
DR   EnsemblGenomes-Tr; EFAGOT00000000229.
DR   EnsemblGenomes-Tr; EFAGOT00000000231.
DR   EnsemblGenomes-Tr; EFAGOT00000000233.
DR   EnsemblGenomes-Tr; EFAGOT00000000237.
DR   EnsemblGenomes-Tr; EFAGOT00000000243.
DR   EnsemblGenomes-Tr; EFAGOT00000000245.
DR   EnsemblGenomes-Tr; EFAGOT00000000246.
DR   EnsemblGenomes-Tr; EFAGOT00000000251.
DR   EnsemblGenomes-Tr; EFAGOT00000000252.
DR   EnsemblGenomes-Tr; EFAGOT00000000257.
DR   EnsemblGenomes-Tr; EFAGOT00000000265.
DR   EnsemblGenomes-Tr; EFAGOT00000000268.
DR   EnsemblGenomes-Tr; EFAGOT00000000271.
DR   EnsemblGenomes-Tr; EFAGOT00000000275.
DR   EnsemblGenomes-Tr; EFAGOT00000000281.
DR   EnsemblGenomes-Tr; EFAGOT00000000283.
DR   EnsemblGenomes-Tr; EFAGOT00000000284.
DR   EnsemblGenomes-Tr; EFAGOT00000000286.
DR   EnsemblGenomes-Tr; EFAGOT00000000287.
DR   EnsemblGenomes-Tr; EFAGOT00000000288.
DR   EnsemblGenomes-Tr; EFAGOT00000000293.
DR   EnsemblGenomes-Tr; EFAGOT00000000294.
DR   EnsemblGenomes-Tr; EFAGOT00000000297.
DR   EnsemblGenomes-Tr; EFAGOT00000000300.
DR   EnsemblGenomes-Tr; EFAGOT00000000304.
DR   EnsemblGenomes-Tr; EFAGOT00000000306.
DR   EnsemblGenomes-Tr; EFAGOT00000000310.
DR   EnsemblGenomes-Tr; EFAGOT00000000311.
DR   EnsemblGenomes-Tr; EFAGOT00000000313.
DR   EnsemblGenomes-Tr; EFAGOT00000000315.
DR   EnsemblGenomes-Tr; EFAGOT00000000318.
DR   EnsemblGenomes-Tr; EFAGOT00000000325.
DR   EnsemblGenomes-Tr; EFAGOT00000000329.
DR   EnsemblGenomes-Tr; EFAGOT00000000331.
DR   EnsemblGenomes-Tr; EFAGOT00000000333.
DR   EnsemblGenomes-Tr; EFAGOT00000000338.
DR   EnsemblGenomes-Tr; EFAGOT00000000339.
DR   EnsemblGenomes-Tr; EFAGOT00000000340.
DR   EnsemblGenomes-Tr; EFAGOT00000000343.
DR   EnsemblGenomes-Tr; EFAGOT00000000345.
DR   EnsemblGenomes-Tr; EFAGOT00000000347.
DR   EnsemblGenomes-Tr; EFAGOT00000000352.
DR   EnsemblGenomes-Tr; EFAGOT00000000353.
DR   EnsemblGenomes-Tr; EFAGOT00000000354.
DR   EnsemblGenomes-Tr; EFAGOT00000000355.
DR   EnsemblGenomes-Tr; EFAGOT00000000358.
DR   EnsemblGenomes-Tr; EFAGOT00000000361.
DR   EnsemblGenomes-Tr; EFAGOT00000000364.
DR   EnsemblGenomes-Tr; EFAGOT00000000372.
DR   EnsemblGenomes-Tr; EFAGOT00000000373.
DR   EnsemblGenomes-Tr; EFAGOT00000000375.
DR   EnsemblGenomes-Tr; EFAGOT00000000379.
DR   EnsemblGenomes-Tr; EFAGOT00000000380.
DR   EnsemblGenomes-Tr; EFAGOT00000000384.
DR   EnsemblGenomes-Tr; EFAGOT00000000385.
DR   EnsemblGenomes-Tr; EFAGOT00000000388.
DR   EnsemblGenomes-Tr; EFAGOT00000000390.
DR   EnsemblGenomes-Tr; EFAGOT00000000399.
DR   EnsemblGenomes-Tr; EFAGOT00000000400.
DR   EnsemblGenomes-Tr; EFAGOT00000000410.
DR   EnsemblGenomes-Tr; EFAGOT00000000411.
DR   EnsemblGenomes-Tr; EFAGOT00000000412.
DR   EuropePMC; PMC3737163; 23749448.
DR   PR2; AE016820.
DR   RFAM; RF00001; 5S_rRNA.
DR   RFAM; RF00002; 5_8S_rRNA.
DR   RFAM; RF00005; tRNA.
DR   RFAM; RF00026; U6.
DR   RFAM; RF01184; snR79.
DR   RFAM; RF01188; snR56.
DR   RFAM; RF01203; snR47.
DR   RFAM; RF01242; snR36.
DR   RFAM; RF01960; SSU_rRNA_eukarya.
DR   SILVA-LSU; AE016820.
DR   SILVA-SSU; AE016820.
DR   StrainInfo; 195190; 0.
CC   On Jun 29, 2010 this sequence version replaced AE016820.3.
CC   This genome has been completely resequenced to high accuracy (derf)
CC   and reannotated. Gene names have been maintained, though some genes
CC   have been added, and many protein sequences have been corrected.
FH   Key             Location/Qualifiers
FT   source          1..1800949
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /chromosome="VII"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /db_xref="taxon:284811"
FT                   /culture_collection="ATCC:10895"
FT   source          41146..102189
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2526"
FT                   /db_xref="taxon:284811"
FT   source          64936..135462
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1221"
FT                   /db_xref="taxon:284811"
FT   source          102795..170796
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1631"
FT                   /db_xref="taxon:284811"
FT   source          148009..214350
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2250"
FT                   /db_xref="taxon:284811"
FT   source          209294..282254
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2502"
FT                   /db_xref="taxon:284811"
FT   source          267867..330021
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1879"
FT                   /db_xref="taxon:284811"
FT   source          288962..333184
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2524"
FT                   /db_xref="taxon:284811"
FT   source          322838..390417
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2530"
FT                   /db_xref="taxon:284811"
FT   source          776051..817915
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2156"
FT                   /db_xref="taxon:284811"
FT   source          796619..856748
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2220"
FT                   /db_xref="taxon:284811"
FT   source          817013..881212
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2041"
FT                   /db_xref="taxon:284811"
FT   source          870038..940236
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1112"
FT                   /db_xref="taxon:284811"
FT   source          896623..966110
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1833"
FT                   /db_xref="taxon:284811"
FT   source          937863..997453
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2181"
FT                   /db_xref="taxon:284811"
FT   source          1002044..1056382
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2476"
FT                   /db_xref="taxon:284811"
FT   source          1037893..1112921
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1734"
FT                   /db_xref="taxon:284811"
FT   source          1092855..1184307
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1947"
FT                   /db_xref="taxon:284811"
FT   source          1172760..1246096
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1429"
FT                   /db_xref="taxon:284811"
FT   source          1245982..1299774
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1303"
FT                   /db_xref="taxon:284811"
FT   source          1270386..1344162
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2278"
FT                   /db_xref="taxon:284811"
FT   source          1322693..1397112
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2269"
FT                   /db_xref="taxon:284811"
FT   source          1368500..1426712
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1109"
FT                   /db_xref="taxon:284811"
FT   source          1429177..1498731
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1736"
FT                   /db_xref="taxon:284811"
FT   source          1467267..1530034
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1365"
FT                   /db_xref="taxon:284811"
FT   source          1520198..1563680
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1431"
FT                   /db_xref="taxon:284811"
FT   source          1541918..1623396
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2334"
FT                   /db_xref="taxon:284811"
FT   source          1610289..1689834
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1339"
FT                   /db_xref="taxon:284811"
FT   source          1660529..1722281
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2324"
FT                   /db_xref="taxon:284811"
FT   source          1689787..1737757
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2027"
FT                   /db_xref="taxon:284811"
FT   source          1718904..1762665
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG2165"
FT                   /db_xref="taxon:284811"
FT   source          1737756..1787598
FT                   /organism="Eremothecium gossypii ATCC 10895"
FT                   /strain="ATCC 10895"
FT                   /mol_type="genomic DNA"
FT                   /clone="BAC clone bAG1989"
FT                   /db_xref="taxon:284811"
FT   telomere        complement(1..461)
FT                   /rpt_type=DIRECT
FT                   /rpt_unit_range=18..41
FT                   /rpt_unit_seq="ggtgtggtgtatgggtctctcagc"
FT                   /note="Chromosome VII left end terminal telomere repeat.
FT                   Composed of an estimated 20 copies of a 24 base repeat
FT                   unit, and occasionally sequence varients of this repeat."
FT   telomere        complement(462..3200)
FT                   /note="Chromosome VII left subtelomeric sequence. Shares
FT                   some sequence similarity with other subtelomeric regions."
FT   gene            <3308..>3979
FT                   /locus_tag="AGOS_AGL369W"
FT                   /old_locus_tag="AGL369W"
FT   mRNA            <3308..>3979
FT                   /locus_tag="AGOS_AGL369W"
FT                   /old_locus_tag="AGL369W"
FT                   /product="AGL369Wp"
FT   CDS_pept        3308..3979
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL369W"
FT                   /old_locus_tag="AGL369W"
FT                   /product="AGL369Wp"
FT                   /note="NOHBY729; No homolog in Saccharomyces cerevisiae;
FT                   Similar to Ashbya gossypii AGL368W and ADL400W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL369W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54121"
FT                   /db_xref="GOA:Q751S3"
FT                   /db_xref="UniProtKB/TrEMBL:Q751S3"
FT                   /protein_id="AAS54121.1"
FT                   N"
FT   gene            <6032..>7165
FT                   /locus_tag="AGOS_AGL368W"
FT                   /old_locus_tag="AGL368W"
FT   mRNA            <6032..>7165
FT                   /locus_tag="AGOS_AGL368W"
FT                   /old_locus_tag="AGL368W"
FT                   /product="AGL368Wp"
FT   CDS_pept        6032..7165
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL368W"
FT                   /old_locus_tag="AGL368W"
FT                   /product="AGL368Wp"
FT                   /note="NOHBY728; No homolog in Saccharomyces cerevisiae;
FT                   Similar to Ashbya gossypii AGL369W and ADL400W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL368W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54122"
FT                   /db_xref="GOA:Q751S2"
FT                   /db_xref="UniProtKB/TrEMBL:Q751S2"
FT                   /protein_id="AAS54122.1"
FT   gene            complement(<10794..>11414)
FT                   /locus_tag="AGOS_AGL367C"
FT                   /old_locus_tag="AGL367C"
FT   mRNA            complement(<10794..>11414)
FT                   /locus_tag="AGOS_AGL367C"
FT                   /old_locus_tag="AGL367C"
FT                   /product="AGL367Cp"
FT   CDS_pept        complement(10794..11414)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL367C"
FT                   /old_locus_tag="AGL367C"
FT                   /product="AGL367Cp"
FT                   /note="NOHBY727; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL367C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54123"
FT                   /db_xref="GOA:Q751Q7"
FT                   /db_xref="UniProtKB/TrEMBL:Q751Q7"
FT                   /protein_id="AAS54123.1"
FT   gene            <12573..>12719
FT                   /locus_tag="AGOS_AGL367WA"
FT                   /old_locus_tag="AGL367W-A"
FT   mRNA            <12573..>12719
FT                   /locus_tag="AGOS_AGL367WA"
FT                   /old_locus_tag="AGL367W-A"
FT                   /product="AGL367W-Ap"
FT   CDS_pept        12573..12719
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL367WA"
FT                   /old_locus_tag="AGL367W-A"
FT                   /product="AGL367W-Ap"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   Q0080 (AAP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL367WA"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54124"
FT                   /db_xref="GOA:Q751Q6"
FT                   /db_xref="InterPro:IPR009230"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751Q6"
FT                   /protein_id="AAS54124.1"
FT                   LSK"
FT   gene            complement(<14796..>15518)
FT                   /locus_tag="AGOS_AGL366C"
FT                   /old_locus_tag="AGL366C"
FT   mRNA            complement(<14796..>15518)
FT                   /locus_tag="AGOS_AGL366C"
FT                   /old_locus_tag="AGL366C"
FT                   /product="AGL366Cp"
FT   CDS_pept        complement(14796..15518)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL366C"
FT                   /old_locus_tag="AGL366C"
FT                   /product="AGL366Cp"
FT                   /note="NOHBY726; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E05478g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL366C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54125"
FT                   /db_xref="UniProtKB/TrEMBL:Q751Q5"
FT                   /protein_id="AAS54125.1"
FT                   LCEFTALGDPLYQTTTSV"
FT   gene            complement(<16191..>17990)
FT                   /locus_tag="AGOS_AGL365C"
FT                   /old_locus_tag="AGL365C"
FT   mRNA            complement(<16191..>17990)
FT                   /locus_tag="AGOS_AGL365C"
FT                   /old_locus_tag="AGL365C"
FT                   /product="AGL365Cp"
FT   CDS_pept        complement(16191..17990)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL365C"
FT                   /old_locus_tag="AGL365C"
FT                   /product="AGL365Cp"
FT                   /note="NOHBY725; No homolog in Saccharomyces cerevisiae;
FT                   Non-syntenic homolog of Kluyveromyces lactis KLLA0E12947g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL365C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54126"
FT                   /db_xref="GOA:Q751Q4"
FT                   /db_xref="InterPro:IPR000109"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q751Q4"
FT                   /protein_id="AAS54126.1"
FT   gene            complement(<19123..>22905)
FT                   /locus_tag="AGOS_AGL364C"
FT                   /old_locus_tag="AGL364C"
FT   mRNA            complement(<19123..>22905)
FT                   /locus_tag="AGOS_AGL364C"
FT                   /old_locus_tag="AGL364C"
FT                   /product="AGL364Cp"
FT   CDS_pept        complement(19123..22905)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL364C"
FT                   /old_locus_tag="AGL364C"
FT                   /product="AGL364Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YIL159W
FT                   (BNR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL364C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54127"
FT                   /db_xref="GOA:Q751Q3"
FT                   /db_xref="InterPro:IPR010473"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR014768"
FT                   /db_xref="InterPro:IPR015425"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR042201"
FT                   /db_xref="UniProtKB/TrEMBL:Q751Q3"
FT                   /protein_id="AAS54127.1"
FT   gene            complement(<23487..>25097)
FT                   /locus_tag="AGOS_AGL363C"
FT                   /old_locus_tag="AGL363C"
FT   mRNA            complement(<23487..>25097)
FT                   /locus_tag="AGOS_AGL363C"
FT                   /old_locus_tag="AGL363C"
FT                   /product="AGL363Cp"
FT   CDS_pept        complement(23487..25097)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL363C"
FT                   /old_locus_tag="AGL363C"
FT                   /product="AGL363Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YOR192C (THI72) and YLR237W (THI7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL363C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54128"
FT                   /db_xref="GOA:Q751Q2"
FT                   /db_xref="InterPro:IPR001248"
FT                   /db_xref="InterPro:IPR038271"
FT                   /db_xref="UniProtKB/TrEMBL:Q751Q2"
FT                   /protein_id="AAS54128.1"
FT   gene            <25591..>26109
FT                   /locus_tag="AGOS_AGL362W"
FT                   /old_locus_tag="AGL362W"
FT   mRNA            <25591..>26109
FT                   /locus_tag="AGOS_AGL362W"
FT                   /old_locus_tag="AGL362W"
FT                   /product="AGL362Wp"
FT   CDS_pept        25591..26109
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL362W"
FT                   /old_locus_tag="AGL362W"
FT                   /product="AGL362Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YIL161W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL362W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54129"
FT                   /db_xref="UniProtKB/TrEMBL:Q751Q1"
FT                   /protein_id="AAS54129.1"
FT                   GCGGVDGER"
FT   gene            complement(<26363..>28453)
FT                   /locus_tag="AGOS_AGL361C"
FT                   /old_locus_tag="AGL361C"
FT   mRNA            complement(<26363..>28453)
FT                   /locus_tag="AGOS_AGL361C"
FT                   /old_locus_tag="AGL361C"
FT                   /product="AGL361Cp"
FT   CDS_pept        complement(26363..28453)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL361C"
FT                   /old_locus_tag="AGL361C"
FT                   /product="AGL361Cp"
FT                   /note="NOHBY724; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F10835g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL361C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54130"
FT                   /db_xref="GOA:Q751Q0"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR021858"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q751Q0"
FT                   /protein_id="AAS54130.1"
FT                   DL"
FT   gene            <29577..>30662
FT                   /locus_tag="AGOS_AGL360W"
FT                   /old_locus_tag="AGL360W"
FT   mRNA            <29577..>30662
FT                   /locus_tag="AGOS_AGL360W"
FT                   /old_locus_tag="AGL360W"
FT                   /product="AGL360Wp"
FT   CDS_pept        29577..30662
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL360W"
FT                   /old_locus_tag="AGL360W"
FT                   /product="AGL360Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YML131W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL360W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54131"
FT                   /db_xref="GOA:Q751P9"
FT                   /db_xref="InterPro:IPR011032"
FT                   /db_xref="InterPro:IPR013149"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="InterPro:IPR041694"
FT                   /db_xref="UniProtKB/TrEMBL:Q751P9"
FT                   /protein_id="AAS54131.1"
FT   gene            complement(30795..30907)
FT                   /locus_tag="AGOS_t0173"
FT   tRNA            complement(join(30795..30830,30872..30907))
FT                   /locus_tag="AGOS_t0173"
FT                   /product="tRNA-Pro"
FT                   /note="codon recognized: CCA"
FT   gene            complement(<31314..>32441)
FT                   /locus_tag="AGOS_AGL359C"
FT                   /old_locus_tag="AGL359C"
FT   mRNA            complement(<31314..>32441)
FT                   /locus_tag="AGOS_AGL359C"
FT                   /old_locus_tag="AGL359C"
FT                   /product="AGL359Cp"
FT   CDS_pept        complement(31314..32441)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL359C"
FT                   /old_locus_tag="AGL359C"
FT                   /product="AGL359Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YER187W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL359C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54132"
FT                   /db_xref="GOA:Q751P8"
FT                   /db_xref="InterPro:IPR035237"
FT                   /db_xref="UniProtKB/TrEMBL:Q751P8"
FT                   /protein_id="AAS54132.2"
FT   gene            complement(<32992..>35412)
FT                   /locus_tag="AGOS_AGL358C"
FT                   /old_locus_tag="AGL358C"
FT   mRNA            complement(<32992..>35412)
FT                   /locus_tag="AGOS_AGL358C"
FT                   /old_locus_tag="AGL358C"
FT                   /product="AGL358Cp"
FT   CDS_pept        complement(32992..35412)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL358C"
FT                   /old_locus_tag="AGL358C"
FT                   /product="AGL358Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR302C
FT                   (YME2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL358C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54133"
FT                   /db_xref="GOA:Q751P7"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR018850"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR034260"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="InterPro:IPR039627"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751P7"
FT                   /protein_id="AAS54133.1"
FT   gene            <35645..>39145
FT                   /locus_tag="AGOS_AGL357W"
FT                   /old_locus_tag="AGL357W"
FT   mRNA            <35645..>39145
FT                   /locus_tag="AGOS_AGL357W"
FT                   /old_locus_tag="AGL357W"
FT                   /product="AGL357Wp"
FT   CDS_pept        35645..39145
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL357W"
FT                   /old_locus_tag="AGL357W"
FT                   /product="AGL357Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR304W
FT                   (UBP15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL357W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54134"
FT                   /db_xref="GOA:Q751P6"
FT                   /db_xref="InterPro:IPR001394"
FT                   /db_xref="InterPro:IPR002083"
FT                   /db_xref="InterPro:IPR008974"
FT                   /db_xref="InterPro:IPR018200"
FT                   /db_xref="InterPro:IPR024729"
FT                   /db_xref="InterPro:IPR028889"
FT                   /db_xref="InterPro:IPR029346"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/TrEMBL:Q751P6"
FT                   /protein_id="AAS54134.1"
FT                   "
FT   gene            complement(<39218..>40081)
FT                   /locus_tag="AGOS_AGL356C"
FT                   /old_locus_tag="AGL356C"
FT   mRNA            complement(<39218..>40081)
FT                   /locus_tag="AGOS_AGL356C"
FT                   /old_locus_tag="AGL356C"
FT                   /product="AGL356Cp"
FT   CDS_pept        complement(39218..40081)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL356C"
FT                   /old_locus_tag="AGL356C"
FT                   /product="AGL356Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR277C
FT                   (CAB4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL356C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54135"
FT                   /db_xref="GOA:Q751P5"
FT                   /db_xref="InterPro:IPR004821"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="UniProtKB/TrEMBL:Q751P5"
FT                   /protein_id="AAS54135.1"
FT                   LMNEDS"
FT   gene            <40239..>41903
FT                   /locus_tag="AGOS_AGL355W"
FT                   /old_locus_tag="AGL355W"
FT   mRNA            <40239..>41903
FT                   /locus_tag="AGOS_AGL355W"
FT                   /old_locus_tag="AGL355W"
FT                   /product="AGL355Wp"
FT   CDS_pept        40239..41903
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL355W"
FT                   /old_locus_tag="AGL355W"
FT                   /product="AGL355Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR278W
FT                   (CWC22)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL355W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54136"
FT                   /db_xref="GOA:Q751P4"
FT                   /db_xref="InterPro:IPR003891"
FT                   /db_xref="InterPro:IPR016021"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751P4"
FT                   /protein_id="AAS54136.1"
FT   gene            complement(<42205..>43560)
FT                   /locus_tag="AGOS_AGL354C"
FT                   /old_locus_tag="AGL354C"
FT   mRNA            complement(<42205..>43560)
FT                   /locus_tag="AGOS_AGL354C"
FT                   /old_locus_tag="AGL354C"
FT                   /product="AGL354Cp"
FT   CDS_pept        complement(42205..43560)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL354C"
FT                   /old_locus_tag="AGL354C"
FT                   /product="AGL354Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR279C
FT                   (SCW4) and YMR305C (SCW10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL354C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54137"
FT                   /db_xref="GOA:Q751P3"
FT                   /db_xref="InterPro:IPR000490"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="UniProtKB/TrEMBL:Q751P3"
FT                   /protein_id="AAS54137.1"
FT   gene            <44040..>49382
FT                   /locus_tag="AGOS_AGL353W"
FT                   /old_locus_tag="AGL353W"
FT   mRNA            <44040..>49382
FT                   /locus_tag="AGOS_AGL353W"
FT                   /old_locus_tag="AGL353W"
FT                   /product="AGL353Wp"
FT   CDS_pept        44040..49382
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL353W"
FT                   /old_locus_tag="AGL353W"
FT                   /product="AGL353Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR306W
FT                   (FKS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL353W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54138"
FT                   /db_xref="GOA:Q751P2"
FT                   /db_xref="InterPro:IPR003440"
FT                   /db_xref="InterPro:IPR026899"
FT                   /db_xref="UniProtKB/TrEMBL:Q751P2"
FT                   /protein_id="AAS54138.1"
FT   gene            <49847..>51448
FT                   /locus_tag="AGOS_AGL352W"
FT                   /old_locus_tag="AGL352W"
FT   mRNA            <49847..>51448
FT                   /locus_tag="AGOS_AGL352W"
FT                   /old_locus_tag="AGL352W"
FT                   /product="AGL352Wp"
FT   CDS_pept        49847..51448
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL352W"
FT                   /old_locus_tag="AGL352W"
FT                   /product="AGL352Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR307W
FT                   (GAS1); Tandem gene duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL352W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54139"
FT                   /db_xref="GOA:Q751P1"
FT                   /db_xref="InterPro:IPR004886"
FT                   /db_xref="InterPro:IPR012946"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="UniProtKB/TrEMBL:Q751P1"
FT                   /protein_id="AAS54139.2"
FT                   SAATLSVFMGFGLIFI"
FT   gene            <52019..>53683
FT                   /locus_tag="AGOS_AGL351W"
FT                   /old_locus_tag="AGL351W"
FT   mRNA            <52019..>53683
FT                   /locus_tag="AGOS_AGL351W"
FT                   /old_locus_tag="AGL351W"
FT                   /product="AGL351Wp"
FT   CDS_pept        52019..53683
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL351W"
FT                   /old_locus_tag="AGL351W"
FT                   /product="AGL351Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR307W
FT                   (GAS1); Tandem gene duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL351W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54140"
FT                   /db_xref="GOA:Q751S4"
FT                   /db_xref="InterPro:IPR004886"
FT                   /db_xref="InterPro:IPR012946"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="UniProtKB/TrEMBL:Q751S4"
FT                   /protein_id="AAS54140.2"
FT   gene            complement(<53849..>54856)
FT                   /locus_tag="AGOS_AGL350C"
FT                   /old_locus_tag="AGL350C"
FT   mRNA            complement(<53849..>54856)
FT                   /locus_tag="AGOS_AGL350C"
FT                   /old_locus_tag="AGL350C"
FT                   /product="AGL350Cp"
FT   CDS_pept        complement(53849..54856)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL350C"
FT                   /old_locus_tag="AGL350C"
FT                   /product="AGL350Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR280C
FT                   (PXR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL350C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54141"
FT                   /db_xref="GOA:Q751P0"
FT                   /db_xref="InterPro:IPR000467"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751P0"
FT                   /protein_id="AAS54141.1"
FT   gene            complement(<55263..>58541)
FT                   /locus_tag="AGOS_AGL349C"
FT                   /old_locus_tag="AGL349C"
FT   mRNA            complement(<55263..>58541)
FT                   /locus_tag="AGOS_AGL349C"
FT                   /old_locus_tag="AGL349C"
FT                   /product="AGL349Cp"
FT   CDS_pept        complement(55263..58541)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL349C"
FT                   /old_locus_tag="AGL349C"
FT                   /product="AGL349Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR308C
FT                   (PSE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL349C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54142"
FT                   /db_xref="GOA:Q751N9"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR040122"
FT                   /db_xref="InterPro:IPR040928"
FT                   /db_xref="InterPro:IPR041389"
FT                   /db_xref="InterPro:IPR041653"
FT                   /db_xref="UniProtKB/TrEMBL:Q751N9"
FT                   /protein_id="AAS54142.2"
FT   gene            <58874..>61063
FT                   /locus_tag="AGOS_AGL348W"
FT                   /old_locus_tag="AGL348W"
FT   mRNA            <58874..>61063
FT                   /locus_tag="AGOS_AGL348W"
FT                   /old_locus_tag="AGL348W"
FT                   /product="AGL348Wp"
FT   CDS_pept        58874..61063
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL348W"
FT                   /old_locus_tag="AGL348W"
FT                   /product="AGL348Wp"
FT                   /note="NOHBY723; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0H00616g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL348W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54143"
FT                   /db_xref="GOA:Q751N8"
FT                   /db_xref="InterPro:IPR007219"
FT                   /db_xref="UniProtKB/TrEMBL:Q751N8"
FT                   /protein_id="AAS54143.1"
FT   gene            complement(<61187..>63076)
FT                   /locus_tag="AGOS_AGL347C"
FT                   /old_locus_tag="AGL347C"
FT   mRNA            complement(<61187..>63076)
FT                   /locus_tag="AGOS_AGL347C"
FT                   /old_locus_tag="AGL347C"
FT                   /product="AGL347Cp"
FT   CDS_pept        complement(61187..63076)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL347C"
FT                   /old_locus_tag="AGL347C"
FT                   /product="AGL347Cp"
FT                   /note="NOHBY722; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0C14190g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL347C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54144"
FT                   /db_xref="InterPro:IPR000644"
FT                   /db_xref="UniProtKB/TrEMBL:Q751N7"
FT                   /protein_id="AAS54144.1"
FT   gene            <63491..>67693
FT                   /locus_tag="AGOS_AGL346W"
FT                   /old_locus_tag="AGL346W"
FT   mRNA            <63491..>67693
FT                   /locus_tag="AGOS_AGL346W"
FT                   /old_locus_tag="AGL346W"
FT                   /product="AGL346Wp"
FT   CDS_pept        63491..67693
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL346W"
FT                   /old_locus_tag="AGL346W"
FT                   /product="AGL346Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR281W
FT                   (YOR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL346W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54145"
FT                   /db_xref="GOA:Q751N6"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR011527"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR030244"
FT                   /db_xref="InterPro:IPR036640"
FT                   /db_xref="UniProtKB/TrEMBL:Q751N6"
FT                   /protein_id="AAS54145.2"
FT   gene            <68224..>70116
FT                   /locus_tag="AGOS_AGL345W"
FT                   /old_locus_tag="AGL345W"
FT   mRNA            <68224..>70116
FT                   /locus_tag="AGOS_AGL345W"
FT                   /old_locus_tag="AGL345W"
FT                   /product="AGL345Wp"
FT   CDS_pept        68224..70116
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL345W"
FT                   /old_locus_tag="AGL345W"
FT                   /product="AGL345Wp"
FT                   /note="NOHBY721; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0H00726g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL345W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54146"
FT                   /db_xref="UniProtKB/TrEMBL:Q751S6"
FT                   /protein_id="AAS54146.2"
FT   gene            complement(<70446..>72884)
FT                   /locus_tag="AGOS_AGL344C"
FT                   /old_locus_tag="AGL344C"
FT   mRNA            complement(<70446..>72884)
FT                   /locus_tag="AGOS_AGL344C"
FT                   /old_locus_tag="AGL344C"
FT                   /product="AGL344Cp"
FT   CDS_pept        complement(70446..72884)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL344C"
FT                   /old_locus_tag="AGL344C"
FT                   /product="AGL344Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR309C
FT                   (NIP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL344C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54147"
FT                   /db_xref="GOA:Q751S5"
FT                   /db_xref="InterPro:IPR000717"
FT                   /db_xref="InterPro:IPR008905"
FT                   /db_xref="InterPro:IPR027516"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751S5"
FT                   /protein_id="AAS54147.1"
FT                   "
FT   gene            complement(<74634..>75557)
FT                   /locus_tag="AGOS_AGL343C"
FT                   /old_locus_tag="AGL343C"
FT   mRNA            complement(<74634..>75557)
FT                   /locus_tag="AGOS_AGL343C"
FT                   /old_locus_tag="AGL343C"
FT                   /product="AGL343Cp"
FT   CDS_pept        complement(74634..75557)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL343C"
FT                   /old_locus_tag="AGL343C"
FT                   /product="AGL343Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR282C
FT                   (BGL2) Newly annotated start codon according to
FT                   experimentaly determined 5 end of mRNA using 5 RACE."
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL343C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54148"
FT                   /db_xref="GOA:Q751R4"
FT                   /db_xref="InterPro:IPR000490"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R4"
FT                   /protein_id="AAS54148.2"
FT   gene            complement(<75751..>77025)
FT                   /locus_tag="AGOS_AGL342C"
FT                   /old_locus_tag="AGL342C"
FT   mRNA            complement(<75751..>77025)
FT                   /locus_tag="AGOS_AGL342C"
FT                   /old_locus_tag="AGL342C"
FT                   /product="AGL342Cp"
FT   CDS_pept        complement(75751..77025)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL342C"
FT                   /old_locus_tag="AGL342C"
FT                   /product="AGL342Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR310C
FT                   and YGR283C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL342C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54149"
FT                   /db_xref="InterPro:IPR003750"
FT                   /db_xref="InterPro:IPR029026"
FT                   /db_xref="InterPro:IPR029028"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R3"
FT                   /protein_id="AAS54149.1"
FT   gene            complement(<77251..>77820)
FT                   /locus_tag="AGOS_AGL341C"
FT                   /old_locus_tag="AGL341C"
FT   mRNA            complement(<77251..>77820)
FT                   /locus_tag="AGOS_AGL341C"
FT                   /old_locus_tag="AGL341C"
FT                   /product="AGL341Cp"
FT   CDS_pept        complement(77251..77820)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL341C"
FT                   /old_locus_tag="AGL341C"
FT                   /product="AGL341Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR311C
FT                   (GLC8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL341C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54150"
FT                   /db_xref="GOA:Q751R7"
FT                   /db_xref="InterPro:IPR007062"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R7"
FT                   /protein_id="AAS54150.1"
FT   gene            complement(<78229..>79149)
FT                   /locus_tag="AGOS_AGL340C"
FT                   /old_locus_tag="AGL340C"
FT   mRNA            complement(<78229..>79149)
FT                   /locus_tag="AGOS_AGL340C"
FT                   /old_locus_tag="AGL340C"
FT                   /product="AGL340Cp"
FT   CDS_pept        complement(78229..79149)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL340C"
FT                   /old_locus_tag="AGL340C"
FT                   /product="AGL340Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR284C
FT                   (ERV29)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL340C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54151"
FT                   /db_xref="GOA:Q751R6"
FT                   /db_xref="InterPro:IPR002995"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R6"
FT                   /protein_id="AAS54151.1"
FT   gene            complement(<79589..>80881)
FT                   /locus_tag="AGOS_AGL339C"
FT                   /old_locus_tag="AGL339C"
FT   mRNA            complement(<79589..>80881)
FT                   /locus_tag="AGOS_AGL339C"
FT                   /old_locus_tag="AGL339C"
FT                   /product="AGL339Cp"
FT   CDS_pept        complement(79589..80881)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL339C"
FT                   /old_locus_tag="AGL339C"
FT                   /product="AGL339Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR285C
FT                   (ZUO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL339C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54152"
FT                   /db_xref="InterPro:IPR001623"
FT                   /db_xref="InterPro:IPR018253"
FT                   /db_xref="InterPro:IPR032003"
FT                   /db_xref="InterPro:IPR036869"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R5"
FT                   /protein_id="AAS54152.1"
FT   gene            <81071..>81883
FT                   /locus_tag="AGOS_AGL338W"
FT                   /old_locus_tag="AGL338W"
FT   mRNA            <81071..>81883
FT                   /locus_tag="AGOS_AGL338W"
FT                   /old_locus_tag="AGL338W"
FT                   /product="AGL338Wp"
FT   CDS_pept        81071..81883
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL338W"
FT                   /old_locus_tag="AGL338W"
FT                   /product="AGL338Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR312W
FT                   (ELP6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL338W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54153"
FT                   /db_xref="GOA:Q751N5"
FT                   /db_xref="InterPro:IPR018627"
FT                   /db_xref="UniProtKB/TrEMBL:Q751N5"
FT                   /protein_id="AAS54153.1"
FT   gene            complement(<81952..>83697)
FT                   /locus_tag="AGOS_AGL337C"
FT                   /old_locus_tag="AGL337C"
FT   mRNA            complement(<81952..>83697)
FT                   /locus_tag="AGOS_AGL337C"
FT                   /old_locus_tag="AGL337C"
FT                   /product="AGL337Cp"
FT   CDS_pept        complement(81952..83697)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL337C"
FT                   /old_locus_tag="AGL337C"
FT                   /product="AGL337Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR313C
FT                   (TGL3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL337C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54154"
FT                   /db_xref="GOA:Q751N4"
FT                   /db_xref="InterPro:IPR002641"
FT                   /db_xref="InterPro:IPR016035"
FT                   /db_xref="InterPro:IPR021771"
FT                   /db_xref="UniProtKB/TrEMBL:Q751N4"
FT                   /protein_id="AAS54154.1"
FT                   SSIMA"
FT   gene            <83770..>84690
FT                   /locus_tag="AGOS_AGL336W"
FT                   /old_locus_tag="AGL336W"
FT   mRNA            <83770..>84690
FT                   /locus_tag="AGOS_AGL336W"
FT                   /old_locus_tag="AGL336W"
FT                   /product="AGL336Wp"
FT   CDS_pept        83770..84690
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL336W"
FT                   /old_locus_tag="AGL336W"
FT                   /product="AGL336Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR314W
FT                   (PRE5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL336W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54155"
FT                   /db_xref="GOA:Q751N3"
FT                   /db_xref="InterPro:IPR000426"
FT                   /db_xref="InterPro:IPR001353"
FT                   /db_xref="InterPro:IPR023332"
FT                   /db_xref="InterPro:IPR029055"
FT                   /db_xref="InterPro:IPR035144"
FT                   /db_xref="UniProtKB/TrEMBL:Q751N3"
FT                   /protein_id="AAS54155.1"
FT   gene            <84899..>86974
FT                   /locus_tag="AGOS_AGL335W"
FT                   /old_locus_tag="AGL335W"
FT   mRNA            <84899..>86974
FT                   /locus_tag="AGOS_AGL335W"
FT                   /old_locus_tag="AGL335W"
FT                   /product="AGL335Wp"
FT   CDS_pept        84899..86974
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL335W"
FT                   /old_locus_tag="AGL335W"
FT                   /product="AGL335Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR301C
FT                   (ATM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL335W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54156"
FT                   /db_xref="GOA:Q751N2"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR011527"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036640"
FT                   /db_xref="InterPro:IPR039421"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751N2"
FT                   /protein_id="AAS54156.1"
FT   gene            <87259..>88791
FT                   /locus_tag="AGOS_AGL334W"
FT                   /old_locus_tag="AGL334W"
FT   mRNA            <87259..>88791
FT                   /locus_tag="AGOS_AGL334W"
FT                   /old_locus_tag="AGL334W"
FT                   /product="AGL334Wp"
FT   CDS_pept        87259..88791
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL334W"
FT                   /old_locus_tag="AGL334W"
FT                   /product="AGL334Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR300C
FT                   (ADE4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL334W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54157"
FT                   /db_xref="GOA:Q751N1"
FT                   /db_xref="InterPro:IPR000836"
FT                   /db_xref="InterPro:IPR005854"
FT                   /db_xref="InterPro:IPR017932"
FT                   /db_xref="InterPro:IPR029055"
FT                   /db_xref="InterPro:IPR029057"
FT                   /db_xref="InterPro:IPR035584"
FT                   /db_xref="UniProtKB/TrEMBL:Q751N1"
FT                   /protein_id="AAS54157.1"
FT   gene            <89080..>90195
FT                   /locus_tag="AGOS_AGL333W"
FT                   /old_locus_tag="AGL333W"
FT   mRNA            <89080..>90195
FT                   /locus_tag="AGOS_AGL333W"
FT                   /old_locus_tag="AGL333W"
FT                   /product="AGL333Wp"
FT   CDS_pept        89080..90195
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL333W"
FT                   /old_locus_tag="AGL333W"
FT                   /product="AGL333Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR299C
FT                   (DYN3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL333W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54158"
FT                   /db_xref="GOA:Q751N0"
FT                   /db_xref="InterPro:IPR022780"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751N0"
FT                   /protein_id="AAS54158.1"
FT   gene            <90637..>92646
FT                   /locus_tag="AGOS_AGL332W"
FT                   /old_locus_tag="AGL332W"
FT   mRNA            <90637..>92646
FT                   /locus_tag="AGOS_AGL332W"
FT                   /old_locus_tag="AGL332W"
FT                   /product="AGL332Wp"
FT   CDS_pept        90637..92646
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL332W"
FT                   /old_locus_tag="AGL332W"
FT                   /product="AGL332Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR276C
FT                   (RNH70)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL332W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54159"
FT                   /db_xref="GOA:Q751M9"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR013520"
FT                   /db_xref="InterPro:IPR034922"
FT                   /db_xref="InterPro:IPR036397"
FT                   /db_xref="UniProtKB/TrEMBL:Q751M9"
FT                   /protein_id="AAS54159.2"
FT   gene            complement(<92752..>93162)
FT                   /locus_tag="AGOS_AGL331C"
FT                   /old_locus_tag="AGL331C"
FT   mRNA            complement(<92752..>93162)
FT                   /locus_tag="AGOS_AGL331C"
FT                   /old_locus_tag="AGL331C"
FT                   /product="AGL331Cp"
FT   CDS_pept        complement(92752..93162)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL331C"
FT                   /old_locus_tag="AGL331C"
FT                   /product="AGL331Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR275W
FT                   (RTT102)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL331C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54160"
FT                   /db_xref="GOA:Q751M8"
FT                   /db_xref="InterPro:IPR018304"
FT                   /db_xref="UniProtKB/TrEMBL:Q751M8"
FT                   /protein_id="AAS54160.1"
FT   gene            <93334..>96369
FT                   /locus_tag="AGOS_AGL330W"
FT                   /old_locus_tag="AGL330W"
FT   mRNA            <93334..>96369
FT                   /locus_tag="AGOS_AGL330W"
FT                   /old_locus_tag="AGL330W"
FT                   /product="AGL330Wp"
FT   CDS_pept        93334..96369
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL330W"
FT                   /old_locus_tag="AGL330W"
FT                   /product="AGL330Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR274C
FT                   (TAF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL330W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54161"
FT                   /db_xref="GOA:Q751M7"
FT                   /db_xref="InterPro:IPR022591"
FT                   /db_xref="InterPro:IPR040240"
FT                   /db_xref="InterPro:IPR041670"
FT                   /db_xref="UniProtKB/TrEMBL:Q751M7"
FT                   /protein_id="AAS54161.1"
FT   gene            complement(<96447..>96872)
FT                   /locus_tag="AGOS_AGL329C"
FT                   /old_locus_tag="AGL329C"
FT   mRNA            complement(<96447..>96872)
FT                   /locus_tag="AGOS_AGL329C"
FT                   /old_locus_tag="AGL329C"
FT                   /product="AGL329Cp"
FT   CDS_pept        complement(96447..96872)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL329C"
FT                   /old_locus_tag="AGL329C"
FT                   /product="AGL329Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR298W
FT                   (LIP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL329C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54162"
FT                   /db_xref="GOA:Q751M6"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751M6"
FT                   /protein_id="AAS54162.1"
FT   gene            complement(<97285..>98976)
FT                   /locus_tag="AGOS_AGL328C"
FT                   /old_locus_tag="AGL328C"
FT   mRNA            complement(<97285..>98976)
FT                   /locus_tag="AGOS_AGL328C"
FT                   /old_locus_tag="AGL328C"
FT                   /product="AGL328Cp"
FT   CDS_pept        complement(97285..98976)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL328C"
FT                   /old_locus_tag="AGL328C"
FT                   /product="AGL328Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR297W
FT                   (PRC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL328C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54163"
FT                   /db_xref="GOA:Q751M5"
FT                   /db_xref="InterPro:IPR001563"
FT                   /db_xref="InterPro:IPR018202"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="InterPro:IPR033124"
FT                   /db_xref="UniProtKB/TrEMBL:Q751M5"
FT                   /protein_id="AAS54163.1"
FT   gene            <99454..>100020
FT                   /locus_tag="AGOS_AGL327W"
FT                   /old_locus_tag="AGL327W"
FT   mRNA            <99454..>100020
FT                   /locus_tag="AGOS_AGL327W"
FT                   /old_locus_tag="AGL327W"
FT                   /product="AGL327Wp"
FT   CDS_pept        99454..100020
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL327W"
FT                   /old_locus_tag="AGL327W"
FT                   /product="AGL327Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL043W
FT                   (ECM13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL327W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54164"
FT                   /db_xref="InterPro:IPR037738"
FT                   /db_xref="UniProtKB/TrEMBL:Q751M4"
FT                   /protein_id="AAS54164.2"
FT   gene            <100362..>102053
FT                   /locus_tag="AGOS_AGL326W"
FT                   /old_locus_tag="AGL326W"
FT   mRNA            <100362..>102053
FT                   /locus_tag="AGOS_AGL326W"
FT                   /old_locus_tag="AGL326W"
FT                   /product="AGL326Wp"
FT   CDS_pept        100362..102053
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL326W"
FT                   /old_locus_tag="AGL326W"
FT                   /product="AGL326Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YJL172W (CPS1); Tandem gene duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL326W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54165"
FT                   /db_xref="GOA:Q751M3"
FT                   /db_xref="InterPro:IPR002933"
FT                   /db_xref="InterPro:IPR017141"
FT                   /db_xref="UniProtKB/TrEMBL:Q751M3"
FT                   /protein_id="AAS54165.1"
FT   gene            <102465..>104183
FT                   /locus_tag="AGOS_AGL325W"
FT                   /old_locus_tag="AGL325W"
FT   mRNA            <102465..>104183
FT                   /locus_tag="AGOS_AGL325W"
FT                   /old_locus_tag="AGL325W"
FT                   /product="AGL325Wp"
FT   CDS_pept        102465..104183
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL325W"
FT                   /old_locus_tag="AGL325W"
FT                   /product="AGL325Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YJL172W (CPS1); Tandem gene duplication in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL325W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54166"
FT                   /db_xref="GOA:Q751M2"
FT                   /db_xref="InterPro:IPR001261"
FT                   /db_xref="InterPro:IPR002933"
FT                   /db_xref="InterPro:IPR011650"
FT                   /db_xref="InterPro:IPR017141"
FT                   /db_xref="InterPro:IPR036264"
FT                   /db_xref="UniProtKB/TrEMBL:Q751M2"
FT                   /protein_id="AAS54166.2"
FT   gene            <104372..>105103
FT                   /locus_tag="AGOS_AGL324W"
FT                   /old_locus_tag="AGL324W"
FT   mRNA            <104372..>105103
FT                   /locus_tag="AGOS_AGL324W"
FT                   /old_locus_tag="AGL324W"
FT                   /product="AGL324Wp"
FT   CDS_pept        104372..105103
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL324W"
FT                   /old_locus_tag="AGL324W"
FT                   /product="AGL324Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL041W
FT                   (PRE7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL324W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54167"
FT                   /db_xref="GOA:Q751M1"
FT                   /db_xref="InterPro:IPR001353"
FT                   /db_xref="InterPro:IPR016050"
FT                   /db_xref="InterPro:IPR023333"
FT                   /db_xref="InterPro:IPR029055"
FT                   /db_xref="InterPro:IPR035202"
FT                   /db_xref="UniProtKB/TrEMBL:Q751M1"
FT                   /protein_id="AAS54167.2"
FT   gene            complement(<105260..>105916)
FT                   /locus_tag="AGOS_AGL323C"
FT                   /old_locus_tag="AGL323C"
FT   mRNA            complement(<105260..>105916)
FT                   /locus_tag="AGOS_AGL323C"
FT                   /old_locus_tag="AGL323C"
FT                   /product="AGL323Cp"
FT   CDS_pept        complement(105260..105916)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL323C"
FT                   /old_locus_tag="AGL323C"
FT                   /product="AGL323Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL040C
FT                   (ERD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL323C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54168"
FT                   /db_xref="GOA:Q751M0"
FT                   /db_xref="InterPro:IPR000133"
FT                   /db_xref="UniProtKB/TrEMBL:Q751M0"
FT                   /protein_id="AAS54168.1"
FT   gene            <106949..>107122
FT                   /locus_tag="AGOS_AGL322W"
FT                   /old_locus_tag="AGL322W"
FT   mRNA            <106949..>107122
FT                   /locus_tag="AGOS_AGL322W"
FT                   /old_locus_tag="AGL322W"
FT                   /product="AGL322Wp"
FT   CDS_pept        106949..107122
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL322W"
FT                   /old_locus_tag="AGL322W"
FT                   /product="AGL322Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBL039W-B"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL322W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54169"
FT                   /db_xref="GOA:Q751L9"
FT                   /db_xref="UniProtKB/TrEMBL:Q751L9"
FT                   /protein_id="AAS54169.1"
FT                   PRRPKRPDGAGP"
FT   gene            <107318..>107839
FT                   /locus_tag="AGOS_AGL321W"
FT                   /old_locus_tag="AGL321W"
FT   mRNA            join(<107318..107330,107388..>107839)
FT                   /locus_tag="AGOS_AGL321W"
FT                   /old_locus_tag="AGL321W"
FT                   /product="AGL321Wp"
FT   CDS_pept        join(107318..107330,107388..107839)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL321W"
FT                   /old_locus_tag="AGL321W"
FT                   /product="AGL321Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR104C
FT                   (SOD1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL321W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54170"
FT                   /db_xref="GOA:Q751L8"
FT                   /db_xref="InterPro:IPR001424"
FT                   /db_xref="InterPro:IPR018152"
FT                   /db_xref="InterPro:IPR024134"
FT                   /db_xref="InterPro:IPR036423"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751L8"
FT                   /protein_id="AAS54170.2"
FT   gene            complement(<107960..>109690)
FT                   /locus_tag="AGOS_AGL320C"
FT                   /old_locus_tag="AGL320C"
FT   mRNA            complement(<107960..>109690)
FT                   /locus_tag="AGOS_AGL320C"
FT                   /old_locus_tag="AGL320C"
FT                   /product="AGL320Cp"
FT   CDS_pept        complement(107960..109690)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL320C"
FT                   /old_locus_tag="AGL320C"
FT                   /product="AGL320Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL039C
FT                   (URA7) and YJR103W (URA8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL320C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54171"
FT                   /db_xref="GOA:Q751L7"
FT                   /db_xref="InterPro:IPR004468"
FT                   /db_xref="InterPro:IPR017456"
FT                   /db_xref="InterPro:IPR017926"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR029062"
FT                   /db_xref="InterPro:IPR033828"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751L7"
FT                   /protein_id="AAS54171.1"
FT                   "
FT   gene            complement(<110568..>111104)
FT                   /locus_tag="AGOS_AGL319C"
FT                   /old_locus_tag="AGL319C"
FT   mRNA            complement(<110568..>111104)
FT                   /locus_tag="AGOS_AGL319C"
FT                   /old_locus_tag="AGL319C"
FT                   /product="AGL319Cp"
FT   CDS_pept        complement(110568..111104)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL319C"
FT                   /old_locus_tag="AGL319C"
FT                   /product="AGL319Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR046W
FT                   (MCM16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL319C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54172"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R2"
FT                   /protein_id="AAS54172.1"
FT                   THPRVDAWVQSLTIT"
FT   gene            <111146..>111688
FT                   /locus_tag="AGOS_AGL318W"
FT                   /old_locus_tag="AGL318W"
FT   mRNA            <111146..>111688
FT                   /locus_tag="AGOS_AGL318W"
FT                   /old_locus_tag="AGL318W"
FT                   /product="AGL318Wp"
FT   CDS_pept        111146..111688
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL318W"
FT                   /old_locus_tag="AGL318W"
FT                   /product="AGL318Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR102C
FT                   (VPS25)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL318W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54173"
FT                   /db_xref="GOA:Q751R1"
FT                   /db_xref="InterPro:IPR008570"
FT                   /db_xref="InterPro:IPR014041"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R1"
FT                   /protein_id="AAS54173.1"
FT                   RATLISNDGSVVAVKVI"
FT   gene            complement(<111714..>112469)
FT                   /locus_tag="AGOS_AGL317C"
FT                   /old_locus_tag="AGL317C"
FT   mRNA            complement(<111714..>112469)
FT                   /locus_tag="AGOS_AGL317C"
FT                   /old_locus_tag="AGL317C"
FT                   /product="AGL317Cp"
FT   CDS_pept        complement(111714..112469)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL317C"
FT                   /old_locus_tag="AGL317C"
FT                   /product="AGL317Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR101W
FT                   (RSM26)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL317C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54174"
FT                   /db_xref="GOA:Q751S1"
FT                   /db_xref="InterPro:IPR019832"
FT                   /db_xref="InterPro:IPR036314"
FT                   /db_xref="InterPro:IPR036324"
FT                   /db_xref="UniProtKB/TrEMBL:Q751S1"
FT                   /protein_id="AAS54174.1"
FT   gene            <112950..>113915
FT                   /locus_tag="AGOS_AGL316W"
FT                   /old_locus_tag="AGL316W"
FT   mRNA            <112950..>113915
FT                   /locus_tag="AGOS_AGL316W"
FT                   /old_locus_tag="AGL316W"
FT                   /product="AGL316Wp"
FT   CDS_pept        112950..113915
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL316W"
FT                   /old_locus_tag="AGL316W"
FT                   /product="AGL316Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR099W
FT                   (YUH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL316W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54175"
FT                   /db_xref="GOA:Q751S0"
FT                   /db_xref="InterPro:IPR001578"
FT                   /db_xref="InterPro:IPR017390"
FT                   /db_xref="InterPro:IPR036959"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/TrEMBL:Q751S0"
FT                   /protein_id="AAS54175.2"
FT   gene            <114304..>116013
FT                   /locus_tag="AGOS_AGL315W"
FT                   /old_locus_tag="AGL315W"
FT   mRNA            <114304..>116013
FT                   /locus_tag="AGOS_AGL315W"
FT                   /old_locus_tag="AGL315W"
FT                   /product="AGL315Wp"
FT   CDS_pept        114304..116013
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL315W"
FT                   /old_locus_tag="AGL315W"
FT                   /product="AGL315Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR045C
FT                   (THP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL315W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54176"
FT                   /db_xref="GOA:Q751L6"
FT                   /db_xref="InterPro:IPR000717"
FT                   /db_xref="InterPro:IPR005062"
FT                   /db_xref="UniProtKB/TrEMBL:Q751L6"
FT                   /protein_id="AAS54176.2"
FT   gene            complement(<116107..>116802)
FT                   /locus_tag="AGOS_AGL314C"
FT                   /old_locus_tag="AGL314C"
FT   mRNA            complement(<116107..>116802)
FT                   /locus_tag="AGOS_AGL314C"
FT                   /old_locus_tag="AGL314C"
FT                   /product="AGL314Cp"
FT   CDS_pept        complement(116107..116802)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL314C"
FT                   /old_locus_tag="AGL314C"
FT                   /product="AGL314Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR099W
FT                   (YUH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL314C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54177"
FT                   /db_xref="GOA:Q751L5"
FT                   /db_xref="InterPro:IPR001578"
FT                   /db_xref="InterPro:IPR036959"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/TrEMBL:Q751L5"
FT                   /protein_id="AAS54177.1"
FT                   LLGLGPSWK"
FT   gene            complement(<117260..>118876)
FT                   /locus_tag="AGOS_AGL313C"
FT                   /old_locus_tag="AGL313C"
FT   mRNA            complement(<117260..>118876)
FT                   /locus_tag="AGOS_AGL313C"
FT                   /old_locus_tag="AGL313C"
FT                   /product="AGL313Cp"
FT   CDS_pept        complement(117260..118876)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL313C"
FT                   /old_locus_tag="AGL313C"
FT                   /product="AGL313Cp"
FT                   /note="NOHBY719; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E09900g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL313C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54178"
FT                   /db_xref="GOA:Q751L4"
FT                   /db_xref="InterPro:IPR001683"
FT                   /db_xref="InterPro:IPR035550"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="InterPro:IPR036871"
FT                   /db_xref="UniProtKB/TrEMBL:Q751L4"
FT                   /protein_id="AAS54178.2"
FT   gene            <119823..>121574
FT                   /locus_tag="AGOS_AGL312W"
FT                   /old_locus_tag="AGL312W"
FT   mRNA            <119823..>121574
FT                   /locus_tag="AGOS_AGL312W"
FT                   /old_locus_tag="AGL312W"
FT                   /product="AGL312Wp"
FT   CDS_pept        119823..121574
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL312W"
FT                   /old_locus_tag="AGL312W"
FT                   /product="AGL312Wp"
FT                   /note="NOHBY718; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL312W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54179"
FT                   /db_xref="UniProtKB/TrEMBL:Q751L3"
FT                   /protein_id="AAS54179.1"
FT                   SPKQMQI"
FT   gene            complement(<121903..>122991)
FT                   /locus_tag="AGOS_AGL311C"
FT                   /old_locus_tag="AGL311C"
FT   mRNA            complement(<121903..>122991)
FT                   /locus_tag="AGOS_AGL311C"
FT                   /old_locus_tag="AGL311C"
FT                   /product="AGL311Cp"
FT   CDS_pept        complement(121903..122991)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL311C"
FT                   /old_locus_tag="AGL311C"
FT                   /product="AGL311Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR095W
FT                   (SFC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL311C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54180"
FT                   /db_xref="GOA:Q751L2"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q751L2"
FT                   /protein_id="AAS54180.2"
FT   gene            complement(<123092..>123370)
FT                   /locus_tag="AGOS_AGL310C"
FT                   /old_locus_tag="AGL310C"
FT   mRNA            complement(<123092..>123370)
FT                   /locus_tag="AGOS_AGL310C"
FT                   /old_locus_tag="AGL310C"
FT                   /product="AGL310Cp"
FT   CDS_pept        complement(123092..123370)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL310C"
FT                   /old_locus_tag="AGL310C"
FT                   /product="AGL310Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR043W
FT                   (RPL43A) and YJR094W-A (RPL43B)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL310C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54181"
FT                   /db_xref="GOA:Q751L1"
FT                   /db_xref="InterPro:IPR002674"
FT                   /db_xref="InterPro:IPR011331"
FT                   /db_xref="InterPro:IPR011332"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751L1"
FT                   /protein_id="AAS54181.1"
FT   gene            <123397..>123978
FT                   /locus_tag="AGOS_AGL309W"
FT                   /old_locus_tag="AGL309W"
FT   mRNA            <123397..>123978
FT                   /locus_tag="AGOS_AGL309W"
FT                   /old_locus_tag="AGL309W"
FT                   /product="AGL309Wp"
FT   CDS_pept        123397..123978
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL309W"
FT                   /old_locus_tag="AGL309W"
FT                   /product="AGL309Wp"
FT                   /note="NOHBY717; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0F14190g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL309W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54182"
FT                   /db_xref="UniProtKB/TrEMBL:Q751L0"
FT                   /protein_id="AAS54182.1"
FT   gene            <124123..>124773
FT                   /locus_tag="AGOS_AGL308W"
FT                   /old_locus_tag="AGL308W"
FT   mRNA            <124123..>124773
FT                   /locus_tag="AGOS_AGL308W"
FT                   /old_locus_tag="AGL308W"
FT                   /product="AGL308Wp"
FT   CDS_pept        124123..124773
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL308W"
FT                   /old_locus_tag="AGL308W"
FT                   /product="AGL308Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR094C
FT                   (IME1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL308W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54183"
FT                   /db_xref="UniProtKB/TrEMBL:Q751K9"
FT                   /protein_id="AAS54183.1"
FT   gene            <125195..>126166
FT                   /locus_tag="AGOS_AGL307W"
FT                   /old_locus_tag="AGL307W"
FT   mRNA            <125195..>126166
FT                   /locus_tag="AGOS_AGL307W"
FT                   /old_locus_tag="AGL307W"
FT                   /product="AGL307Wp"
FT   CDS_pept        125195..126166
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL307W"
FT                   /old_locus_tag="AGL307W"
FT                   /product="AGL307Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR093C
FT                   (FIP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL307W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54184"
FT                   /db_xref="GOA:Q751K8"
FT                   /db_xref="InterPro:IPR007854"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751K8"
FT                   /protein_id="AAS54184.1"
FT   gene            complement(<126331..>130110)
FT                   /locus_tag="AGOS_AGL306C"
FT                   /old_locus_tag="AGL306C"
FT   mRNA            complement(<126331..>130110)
FT                   /locus_tag="AGOS_AGL306C"
FT                   /old_locus_tag="AGL306C"
FT                   /product="AGL306Cp"
FT   CDS_pept        complement(126331..130110)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL306C"
FT                   /old_locus_tag="AGL306C"
FT                   /product="AGL306Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR092W
FT                   (BUD4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL306C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54185"
FT                   /db_xref="GOA:Q751K7"
FT                   /db_xref="InterPro:IPR001849"
FT                   /db_xref="InterPro:IPR011993"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751K7"
FT                   /protein_id="AAS54185.1"
FT   gene            <130958..>134131
FT                   /locus_tag="AGOS_AGL305W"
FT                   /old_locus_tag="AGL305W"
FT   mRNA            <130958..>134131
FT                   /locus_tag="AGOS_AGL305W"
FT                   /old_locus_tag="AGL305W"
FT                   /product="AGL305Wp"
FT   CDS_pept        130958..134131
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL305W"
FT                   /old_locus_tag="AGL305W"
FT                   /product="AGL305Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YJR091C
FT                   (JSN1) and YPR042C (PUF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL305W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54186"
FT                   /db_xref="GOA:Q751K6"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR001313"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR033133"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q751K6"
FT                   /protein_id="AAS54186.2"
FT                   TTHNGTFGY"
FT   gene            <134484..>135362
FT                   /locus_tag="AGOS_AGL304W"
FT                   /old_locus_tag="AGL304W"
FT   mRNA            <134484..>135362
FT                   /locus_tag="AGOS_AGL304W"
FT                   /old_locus_tag="AGL304W"
FT                   /product="AGL304Wp"
FT   CDS_pept        134484..135362
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL304W"
FT                   /old_locus_tag="AGL304W"
FT                   /product="AGL304Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER106W
FT                   (MAM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL304W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54187"
FT                   /db_xref="InterPro:IPR018847"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R0"
FT                   /protein_id="AAS54187.1"
FT                   ILRPSDIVFPK"
FT   gene            <135708..>137318
FT                   /locus_tag="AGOS_AGL303W"
FT                   /old_locus_tag="AGL303W"
FT   mRNA            <135708..>137318
FT                   /locus_tag="AGOS_AGL303W"
FT                   /old_locus_tag="AGL303W"
FT                   /product="AGL303Wp"
FT   CDS_pept        135708..137318
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL303W"
FT                   /old_locus_tag="AGL303W"
FT                   /product="AGL303Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL080C
FT                   (PET112)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL303W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54188"
FT                   /db_xref="GOA:Q751Q9"
FT                   /db_xref="InterPro:IPR003789"
FT                   /db_xref="InterPro:IPR004413"
FT                   /db_xref="InterPro:IPR006075"
FT                   /db_xref="InterPro:IPR014746"
FT                   /db_xref="InterPro:IPR017958"
FT                   /db_xref="InterPro:IPR017959"
FT                   /db_xref="InterPro:IPR018027"
FT                   /db_xref="InterPro:IPR023168"
FT                   /db_xref="InterPro:IPR042114"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751Q9"
FT                   /protein_id="AAS54188.1"
FT   gene            complement(<138217..>139110)
FT                   /locus_tag="AGOS_AGL302C"
FT                   /old_locus_tag="AGL302C"
FT   mRNA            complement(<138217..>139110)
FT                   /locus_tag="AGOS_AGL302C"
FT                   /old_locus_tag="AGL302C"
FT                   /product="AGL302Cp"
FT   CDS_pept        complement(138217..139110)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL302C"
FT                   /old_locus_tag="AGL302C"
FT                   /product="AGL302Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBL081W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL302C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54189"
FT                   /db_xref="InterPro:IPR035257"
FT                   /db_xref="UniProtKB/TrEMBL:Q751Q8"
FT                   /protein_id="AAS54189.1"
FT                   TSGSLRIWNNDMSVWG"
FT   gene            complement(<139480..>140565)
FT                   /locus_tag="AGOS_AGL301C"
FT                   /old_locus_tag="AGL301C"
FT   mRNA            complement(<139480..>140565)
FT                   /locus_tag="AGOS_AGL301C"
FT                   /old_locus_tag="AGL301C"
FT                   /product="AGL301Cp"
FT   CDS_pept        complement(139480..140565)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL301C"
FT                   /old_locus_tag="AGL301C"
FT                   /product="AGL301Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER107C
FT                   (GLE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL301C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54190"
FT                   /db_xref="GOA:Q751R9"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="InterPro:IPR037631"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R9"
FT                   /protein_id="AAS54190.1"
FT   gene            complement(<140942..>143761)
FT                   /locus_tag="AGOS_AGL300C"
FT                   /old_locus_tag="AGL300C"
FT   mRNA            complement(<140942..>143761)
FT                   /locus_tag="AGOS_AGL300C"
FT                   /old_locus_tag="AGL300C"
FT                   /product="AGL300Cp"
FT   CDS_pept        complement(140942..143761)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL300C"
FT                   /old_locus_tag="AGL300C"
FT                   /product="AGL300Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER109C
FT                   (FLO8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL300C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54191"
FT                   /db_xref="GOA:Q751R8"
FT                   /db_xref="InterPro:IPR006594"
FT                   /db_xref="UniProtKB/TrEMBL:Q751R8"
FT                   /protein_id="AAS54191.2"
FT                   FNFFQFSWR"
FT   gene            complement(<144583..>145881)
FT                   /locus_tag="AGOS_AGL299C"
FT                   /old_locus_tag="AGL299C"
FT   mRNA            complement(<144583..>145881)
FT                   /locus_tag="AGOS_AGL299C"
FT                   /old_locus_tag="AGL299C"
FT                   /product="AGL299Cp"
FT   CDS_pept        complement(144583..145881)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL299C"
FT                   /old_locus_tag="AGL299C"
FT                   /product="AGL299Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL082C
FT                   (ALG3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL299C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54192"
FT                   /db_xref="GOA:Q751K5"
FT                   /db_xref="InterPro:IPR007873"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751K5"
FT                   /protein_id="AAS54192.2"
FT   gene            complement(<146168..>149515)
FT                   /locus_tag="AGOS_AGL298C"
FT                   /old_locus_tag="AGL298C"
FT   mRNA            complement(<146168..>149515)
FT                   /locus_tag="AGOS_AGL298C"
FT                   /old_locus_tag="AGL298C"
FT                   /product="AGL298Cp"
FT   CDS_pept        complement(146168..149515)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL298C"
FT                   /old_locus_tag="AGL298C"
FT                   /product="AGL298Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER110C
FT                   (KAP123)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL298C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54193"
FT                   /db_xref="GOA:Q751K4"
FT                   /db_xref="InterPro:IPR001494"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR021133"
FT                   /db_xref="InterPro:IPR040122"
FT                   /db_xref="UniProtKB/TrEMBL:Q751K4"
FT                   /protein_id="AAS54193.2"
FT                   AVLAPVIA"
FT   gene            complement(<150249..>153161)
FT                   /locus_tag="AGOS_AGL297C"
FT                   /old_locus_tag="AGL297C"
FT   mRNA            complement(<150249..>153161)
FT                   /locus_tag="AGOS_AGL297C"
FT                   /old_locus_tag="AGL297C"
FT                   /product="AGL297Cp"
FT   CDS_pept        complement(150249..153161)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL297C"
FT                   /old_locus_tag="AGL297C"
FT                   /product="AGL297Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER111C
FT                   (SWI4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL297C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54194"
FT                   /db_xref="GOA:Q751K3"
FT                   /db_xref="InterPro:IPR002110"
FT                   /db_xref="InterPro:IPR003163"
FT                   /db_xref="InterPro:IPR018004"
FT                   /db_xref="InterPro:IPR020683"
FT                   /db_xref="InterPro:IPR029792"
FT                   /db_xref="InterPro:IPR036770"
FT                   /db_xref="InterPro:IPR036887"
FT                   /db_xref="UniProtKB/TrEMBL:Q751K3"
FT                   /protein_id="AAS54194.1"
FT   gene            <153801..>154307
FT                   /locus_tag="AGOS_AGL296W"
FT                   /old_locus_tag="AGL296W"
FT   mRNA            <153801..>154307
FT                   /locus_tag="AGOS_AGL296W"
FT                   /old_locus_tag="AGL296W"
FT                   /product="AGL296Wp"
FT   CDS_pept        153801..154307
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL296W"
FT                   /old_locus_tag="AGL296W"
FT                   /product="AGL296Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER112W
FT                   (LSM4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL296W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54195"
FT                   /db_xref="GOA:Q751K2"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR027141"
FT                   /db_xref="InterPro:IPR034101"
FT                   /db_xref="UniProtKB/TrEMBL:Q751K2"
FT                   /protein_id="AAS54195.1"
FT                   SQVQS"
FT   gene            complement(<154456..>156429)
FT                   /locus_tag="AGOS_AGL295C"
FT                   /old_locus_tag="AGL295C"
FT   mRNA            complement(<154456..>156429)
FT                   /locus_tag="AGOS_AGL295C"
FT                   /old_locus_tag="AGL295C"
FT                   /product="AGL295Cp"
FT   CDS_pept        complement(154456..156429)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL295C"
FT                   /old_locus_tag="AGL295C"
FT                   /product="AGL295Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER113C
FT                   (TMN3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL295C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54196"
FT                   /db_xref="GOA:Q751K1"
FT                   /db_xref="InterPro:IPR004240"
FT                   /db_xref="UniProtKB/TrEMBL:Q751K1"
FT                   /protein_id="AAS54196.1"
FT   gene            <156970..>158940
FT                   /locus_tag="AGOS_AGL294W"
FT                   /old_locus_tag="AGL294W"
FT   mRNA            <156970..>158940
FT                   /locus_tag="AGOS_AGL294W"
FT                   /old_locus_tag="AGL294W"
FT                   /product="AGL294Wp"
FT   CDS_pept        156970..158940
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL294W"
FT                   /old_locus_tag="AGL294W"
FT                   /product="AGL294Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL084C
FT                   (CDC27)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL294W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54197"
FT                   /db_xref="GOA:Q751K0"
FT                   /db_xref="InterPro:IPR001440"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="UniProtKB/TrEMBL:Q751K0"
FT                   /protein_id="AAS54197.1"
FT   gene            complement(<159161..>162115)
FT                   /locus_tag="AGOS_AGL293C"
FT                   /old_locus_tag="AGL293C"
FT   mRNA            complement(<159161..>162115)
FT                   /locus_tag="AGOS_AGL293C"
FT                   /old_locus_tag="AGL293C"
FT                   /product="AGL293Cp"
FT   CDS_pept        complement(159161..162115)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL293C"
FT                   /old_locus_tag="AGL293C"
FT                   /product="AGL293Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER114C
FT                   (BOI2) and YBL085W (BOI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL293C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54198"
FT                   /db_xref="GOA:Q751J9"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR001660"
FT                   /db_xref="InterPro:IPR001849"
FT                   /db_xref="InterPro:IPR011993"
FT                   /db_xref="InterPro:IPR013761"
FT                   /db_xref="InterPro:IPR035551"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="UniProtKB/TrEMBL:Q751J9"
FT                   /protein_id="AAS54198.1"
FT   gene            complement(<162598..>163701)
FT                   /locus_tag="AGOS_AGL292C"
FT                   /old_locus_tag="AGL292C"
FT   mRNA            complement(<162598..>163701)
FT                   /locus_tag="AGOS_AGL292C"
FT                   /old_locus_tag="AGL292C"
FT                   /product="AGL292Cp"
FT   CDS_pept        complement(162598..163701)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL292C"
FT                   /old_locus_tag="AGL292C"
FT                   /product="AGL292Cp"
FT                   /note="NOHBY716; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E20977g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL292C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54199"
FT                   /db_xref="UniProtKB/TrEMBL:Q751J8"
FT                   /protein_id="AAS54199.1"
FT   gene            <164248..>165588
FT                   /locus_tag="AGOS_AGL291W"
FT                   /old_locus_tag="AGL291W"
FT   mRNA            <164248..>165588
FT                   /locus_tag="AGOS_AGL291W"
FT                   /old_locus_tag="AGL291W"
FT                   /product="AGL291Wp"
FT   CDS_pept        164248..165588
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL291W"
FT                   /old_locus_tag="AGL291W"
FT                   /product="AGL291Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBL086C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL291W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54200"
FT                   /db_xref="InterPro:IPR019448"
FT                   /db_xref="InterPro:IPR039931"
FT                   /db_xref="UniProtKB/TrEMBL:Q751J7"
FT                   /protein_id="AAS54200.1"
FT   gene            complement(<165708..>166256)
FT                   /locus_tag="AGOS_AGL290C"
FT                   /old_locus_tag="AGL290C"
FT   mRNA            complement(<165708..>166256)
FT                   /locus_tag="AGOS_AGL290C"
FT                   /old_locus_tag="AGL290C"
FT                   /product="AGL290Cp"
FT   CDS_pept        complement(165708..166256)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL290C"
FT                   /old_locus_tag="AGL290C"
FT                   /product="AGL290Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER115C
FT                   (SPR6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL290C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54201"
FT                   /db_xref="UniProtKB/TrEMBL:Q751J6"
FT                   /protein_id="AAS54201.1"
FT   gene            complement(<166463..>167188)
FT                   /locus_tag="AGOS_AGL289C"
FT                   /old_locus_tag="AGL289C"
FT   mRNA            complement(<166463..>167188)
FT                   /locus_tag="AGOS_AGL289C"
FT                   /old_locus_tag="AGL289C"
FT                   /product="AGL289Cp"
FT   CDS_pept        complement(166463..167188)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL289C"
FT                   /old_locus_tag="AGL289C"
FT                   /product="AGL289Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER116C
FT                   (SLX8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL289C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54202"
FT                   /db_xref="GOA:Q751J5"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="InterPro:IPR018957"
FT                   /db_xref="UniProtKB/TrEMBL:Q751J5"
FT                   /protein_id="AAS54202.1"
FT   gene            <167484..>168104
FT                   /locus_tag="AGOS_AGL288W"
FT                   /old_locus_tag="AGL288W"
FT   mRNA            join(<167484..167525,167733..>168104)
FT                   /locus_tag="AGOS_AGL288W"
FT                   /old_locus_tag="AGL288W"
FT                   /product="AGL288Wp"
FT   CDS_pept        join(167484..167525,167733..168104)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL288W"
FT                   /old_locus_tag="AGL288W"
FT                   /product="AGL288Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL087C
FT                   (RPL23A) and YER117W (RPL23B); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL288W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54203"
FT                   /db_xref="GOA:Q751J4"
FT                   /db_xref="InterPro:IPR000218"
FT                   /db_xref="InterPro:IPR019972"
FT                   /db_xref="InterPro:IPR036853"
FT                   /db_xref="UniProtKB/TrEMBL:Q751J4"
FT                   /protein_id="AAS54203.1"
FT   gene            <168267..>176573
FT                   /locus_tag="AGOS_AGL287W"
FT                   /old_locus_tag="AGL287W"
FT   mRNA            <168267..>176573
FT                   /locus_tag="AGOS_AGL287W"
FT                   /old_locus_tag="AGL287W"
FT                   /product="AGL287Wp"
FT   CDS_pept        168267..176573
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL287W"
FT                   /old_locus_tag="AGL287W"
FT                   /product="AGL287Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL088C
FT                   (TEL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL287W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54204"
FT                   /db_xref="GOA:Q751J3"
FT                   /db_xref="InterPro:IPR000403"
FT                   /db_xref="InterPro:IPR003152"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR014009"
FT                   /db_xref="InterPro:IPR015519"
FT                   /db_xref="InterPro:IPR018936"
FT                   /db_xref="InterPro:IPR021668"
FT                   /db_xref="InterPro:IPR036940"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751J3"
FT                   /protein_id="AAS54204.1"
FT                   IFMGWSPFY"
FT   gene            complement(<176794..>177786)
FT                   /locus_tag="AGOS_AGL286C"
FT                   /old_locus_tag="AGL286C"
FT   mRNA            complement(<176794..>177786)
FT                   /locus_tag="AGOS_AGL286C"
FT                   /old_locus_tag="AGL286C"
FT                   /product="AGL286Cp"
FT   CDS_pept        complement(176794..177786)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL286C"
FT                   /old_locus_tag="AGL286C"
FT                   /product="AGL286Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER118C
FT                   (SHO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL286C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54205"
FT                   /db_xref="GOA:Q751J2"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR035522"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="InterPro:IPR039644"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751J2"
FT                   /protein_id="AAS54205.1"
FT   gene            complement(<178090..>179412)
FT                   /locus_tag="AGOS_AGL285C"
FT                   /old_locus_tag="AGL285C"
FT   mRNA            complement(<178090..>179412)
FT                   /locus_tag="AGOS_AGL285C"
FT                   /old_locus_tag="AGL285C"
FT                   /product="AGL285Cp"
FT   CDS_pept        complement(178090..179412)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL285C"
FT                   /old_locus_tag="AGL285C"
FT                   /product="AGL285Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER119C
FT                   (AVT6) and YBL089W (AVT5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL285C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54206"
FT                   /db_xref="GOA:Q751J1"
FT                   /db_xref="InterPro:IPR013057"
FT                   /db_xref="UniProtKB/TrEMBL:Q751J1"
FT                   /protein_id="AAS54206.2"
FT   gene            complement(<179597..>180031)
FT                   /locus_tag="AGOS_AGL284C"
FT                   /old_locus_tag="AGL284C"
FT   mRNA            complement(<179597..>180031)
FT                   /locus_tag="AGOS_AGL284C"
FT                   /old_locus_tag="AGL284C"
FT                   /product="AGL284Cp"
FT   CDS_pept        complement(179597..180031)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL284C"
FT                   /old_locus_tag="AGL284C"
FT                   /product="AGL284Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL090W
FT                   (MRP21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL284C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54207"
FT                   /db_xref="GOA:Q751J0"
FT                   /db_xref="InterPro:IPR001911"
FT                   /db_xref="UniProtKB/TrEMBL:Q751J0"
FT                   /protein_id="AAS54207.2"
FT   gene            <180323..>181372
FT                   /locus_tag="AGOS_AGL283W"
FT                   /old_locus_tag="AGL283W"
FT   mRNA            <180323..>181372
FT                   /locus_tag="AGOS_AGL283W"
FT                   /old_locus_tag="AGL283W"
FT                   /product="AGL283Wp"
FT   CDS_pept        180323..181372
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL283W"
FT                   /old_locus_tag="AGL283W"
FT                   /product="AGL283Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL091C
FT                   (MAP2); Newly annotated start codon according to
FT                   experimentaly determined 5 end of mRNA using 5 RACE."
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL283W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54208"
FT                   /db_xref="GOA:Q751I9"
FT                   /db_xref="InterPro:IPR000994"
FT                   /db_xref="InterPro:IPR001714"
FT                   /db_xref="InterPro:IPR002468"
FT                   /db_xref="InterPro:IPR018349"
FT                   /db_xref="InterPro:IPR036005"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="UniProtKB/TrEMBL:Q751I9"
FT                   /protein_id="AAS54208.2"
FT                   EVVSKGDDY"
FT   gene            <181606..>182541
FT                   /locus_tag="AGOS_AGL282W"
FT                   /old_locus_tag="AGL282W"
FT   mRNA            join(<181606..181642,181934..>182541)
FT                   /locus_tag="AGOS_AGL282W"
FT                   /old_locus_tag="AGL282W"
FT                   /product="AGL282Wp"
FT   CDS_pept        join(181606..181642,181934..182541)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL282W"
FT                   /old_locus_tag="AGL282W"
FT                   /product="AGL282Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER120W
FT                   (SCS2) and YBL091C-A (SCS22); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL282W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54209"
FT                   /db_xref="GOA:Q751I8"
FT                   /db_xref="InterPro:IPR000535"
FT                   /db_xref="InterPro:IPR008962"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR016763"
FT                   /db_xref="UniProtKB/TrEMBL:Q751I8"
FT                   /protein_id="AAS54209.1"
FT   gene            complement(<182863..>183390)
FT                   /locus_tag="AGOS_AGL281C"
FT                   /old_locus_tag="AGL281C"
FT   mRNA            complement(join(<182863..183258,183381..>183390))
FT                   /locus_tag="AGOS_AGL281C"
FT                   /old_locus_tag="AGL281C"
FT                   /product="AGL281Cp"
FT                   /note="5'UTR intron"
FT   CDS_pept        complement(182863..183258)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL281C"
FT                   /old_locus_tag="AGL281C"
FT                   /product="AGL281Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL092W
FT                   (RPL32); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL281C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54210"
FT                   /db_xref="GOA:Q751I7"
FT                   /db_xref="InterPro:IPR001515"
FT                   /db_xref="InterPro:IPR018263"
FT                   /db_xref="InterPro:IPR036351"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751I7"
FT                   /protein_id="AAS54210.1"
FT   gene            <183784..>184407
FT                   /locus_tag="AGOS_AGL280W"
FT                   /old_locus_tag="AGL280W"
FT   mRNA            <183784..>184407
FT                   /locus_tag="AGOS_AGL280W"
FT                   /old_locus_tag="AGL280W"
FT                   /product="AGL280Wp"
FT   CDS_pept        183784..184407
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL280W"
FT                   /old_locus_tag="AGL280W"
FT                   /product="AGL280Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL093C
FT                   (ROX3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL280W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54211"
FT                   /db_xref="GOA:Q751I6"
FT                   /db_xref="InterPro:IPR013942"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751I6"
FT                   /protein_id="AAS54211.1"
FT   gene            complement(<184446..>185801)
FT                   /locus_tag="AGOS_AGL279C"
FT                   /old_locus_tag="AGL279C"
FT   mRNA            complement(<184446..>185801)
FT                   /locus_tag="AGOS_AGL279C"
FT                   /old_locus_tag="AGL279C"
FT                   /product="AGL279Cp"
FT   CDS_pept        complement(184446..185801)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL279C"
FT                   /old_locus_tag="AGL279C"
FT                   /product="AGL279Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YER122C
FT                   (GLO3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL279C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54212"
FT                   /db_xref="GOA:Q751I5"
FT                   /db_xref="InterPro:IPR001164"
FT                   /db_xref="InterPro:IPR037278"
FT                   /db_xref="InterPro:IPR038508"
FT                   /db_xref="UniProtKB/TrEMBL:Q751I5"
FT                   /protein_id="AAS54212.1"
FT   gene            complement(<186323..>187015)
FT                   /locus_tag="AGOS_AGL278C"
FT                   /old_locus_tag="AGL278C"
FT   mRNA            complement(<186323..>187015)
FT                   /locus_tag="AGOS_AGL278C"
FT                   /old_locus_tag="AGL278C"
FT                   /product="AGL278Cp"
FT   CDS_pept        complement(186323..187015)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL278C"
FT                   /old_locus_tag="AGL278C"
FT                   /product="AGL278Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBL095W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL278C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54213"
FT                   /db_xref="GOA:Q751I4"
FT                   /db_xref="InterPro:IPR006683"
FT                   /db_xref="InterPro:IPR029069"
FT                   /db_xref="UniProtKB/TrEMBL:Q751I4"
FT                   /protein_id="AAS54213.1"
FT                   YAIRMGFM"
FT   gene            <187329..>189344
FT                   /locus_tag="AGOS_AGL277W"
FT                   /old_locus_tag="AGL277W"
FT   mRNA            <187329..>189344
FT                   /locus_tag="AGOS_AGL277W"
FT                   /old_locus_tag="AGL277W"
FT                   /product="AGL277Wp"
FT   CDS_pept        187329..189344
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL277W"
FT                   /old_locus_tag="AGL277W"
FT                   /product="AGL277Wp"
FT                   /note="NOHBY715; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E06743g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL277W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54214"
FT                   /db_xref="GOA:Q751I3"
FT                   /db_xref="InterPro:IPR003663"
FT                   /db_xref="InterPro:IPR005828"
FT                   /db_xref="InterPro:IPR005829"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q751I3"
FT                   /protein_id="AAS54214.1"
FT   gene            <189590..>190990
FT                   /locus_tag="AGOS_AGL276W"
FT                   /old_locus_tag="AGL276W"
FT   mRNA            <189590..>190990
FT                   /locus_tag="AGOS_AGL276W"
FT                   /old_locus_tag="AGL276W"
FT                   /product="AGL276Wp"
FT   CDS_pept        189590..190990
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL276W"
FT                   /old_locus_tag="AGL276W"
FT                   /product="AGL276Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL098W
FT                   (BNA4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL276W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54215"
FT                   /db_xref="GOA:Q751I2"
FT                   /db_xref="InterPro:IPR002938"
FT                   /db_xref="InterPro:IPR027545"
FT                   /db_xref="InterPro:IPR036188"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751I2"
FT                   /protein_id="AAS54215.1"
FT                   WIKQVRRV"
FT   gene            <191193..>193457
FT                   /locus_tag="AGOS_AGL275W"
FT                   /old_locus_tag="AGL275W"
FT   mRNA            <191193..>193457
FT                   /locus_tag="AGOS_AGL275W"
FT                   /old_locus_tag="AGL275W"
FT                   /product="AGL275Wp"
FT   CDS_pept        191193..193457
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL275W"
FT                   /old_locus_tag="AGL275W"
FT                   /product="AGL275Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL097W
FT                   (BRN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL275W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54216"
FT                   /db_xref="GOA:Q751I1"
FT                   /db_xref="InterPro:IPR022816"
FT                   /db_xref="UniProtKB/TrEMBL:Q751I1"
FT                   /protein_id="AAS54216.1"
FT                   A"
FT   gene            <193740..>195938
FT                   /locus_tag="AGOS_AGL274W"
FT                   /old_locus_tag="AGL274W"
FT   mRNA            <193740..>195938
FT                   /locus_tag="AGOS_AGL274W"
FT                   /old_locus_tag="AGL274W"
FT                   /product="AGL274Wp"
FT   CDS_pept        193740..195938
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL274W"
FT                   /old_locus_tag="AGL274W"
FT                   /product="AGL274Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR024W
FT                   (YME1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL274W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54217"
FT                   /db_xref="GOA:Q751I0"
FT                   /db_xref="InterPro:IPR000642"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR005936"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR037219"
FT                   /db_xref="InterPro:IPR041569"
FT                   /db_xref="UniProtKB/TrEMBL:Q751I0"
FT                   /protein_id="AAS54217.1"
FT   gene            complement(<196274..>197473)
FT                   /locus_tag="AGOS_AGL273C"
FT                   /old_locus_tag="AGL273C"
FT   mRNA            complement(<196274..>197473)
FT                   /locus_tag="AGOS_AGL273C"
FT                   /old_locus_tag="AGL273C"
FT                   /product="AGL273Cp"
FT   CDS_pept        complement(196274..197473)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL273C"
FT                   /old_locus_tag="AGL273C"
FT                   /product="AGL273Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR025C
FT                   (CCL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL273C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54218"
FT                   /db_xref="GOA:Q751H9"
FT                   /db_xref="InterPro:IPR006671"
FT                   /db_xref="InterPro:IPR013763"
FT                   /db_xref="InterPro:IPR027081"
FT                   /db_xref="InterPro:IPR031658"
FT                   /db_xref="InterPro:IPR036915"
FT                   /db_xref="UniProtKB/TrEMBL:Q751H9"
FT                   /protein_id="AAS54218.1"
FT                   "
FT   gene            complement(<197944..>199587)
FT                   /locus_tag="AGOS_AGL272C"
FT                   /old_locus_tag="AGL272C"
FT   mRNA            complement(<197944..>199587)
FT                   /locus_tag="AGOS_AGL272C"
FT                   /old_locus_tag="AGL272C"
FT                   /product="AGL272Cp"
FT   CDS_pept        complement(197944..199587)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL272C"
FT                   /old_locus_tag="AGL272C"
FT                   /product="AGL272Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL099W
FT                   (ATP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL272C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54219"
FT                   /db_xref="GOA:Q751H8"
FT                   /db_xref="InterPro:IPR000194"
FT                   /db_xref="InterPro:IPR000793"
FT                   /db_xref="InterPro:IPR004100"
FT                   /db_xref="InterPro:IPR005294"
FT                   /db_xref="InterPro:IPR020003"
FT                   /db_xref="InterPro:IPR023366"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR033732"
FT                   /db_xref="InterPro:IPR036121"
FT                   /db_xref="InterPro:IPR038376"
FT                   /db_xref="UniProtKB/TrEMBL:Q751H8"
FT                   /protein_id="AAS54219.1"
FT   gene            <199995..>203537
FT                   /locus_tag="AGOS_AGL271W"
FT                   /old_locus_tag="AGL271W"
FT   mRNA            <199995..>203537
FT                   /locus_tag="AGOS_AGL271W"
FT                   /old_locus_tag="AGL271W"
FT                   /product="AGL271Wp"
FT   CDS_pept        199995..203537
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL271W"
FT                   /old_locus_tag="AGL271W"
FT                   /product="AGL271Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR026W
FT                   (ATH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL271W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54220"
FT                   /db_xref="GOA:Q751H7"
FT                   /db_xref="InterPro:IPR005194"
FT                   /db_xref="InterPro:IPR005195"
FT                   /db_xref="InterPro:IPR005196"
FT                   /db_xref="InterPro:IPR008928"
FT                   /db_xref="InterPro:IPR012341"
FT                   /db_xref="InterPro:IPR037018"
FT                   /db_xref="UniProtKB/TrEMBL:Q751H7"
FT                   /protein_id="AAS54220.1"
FT                   GTIKEIALMVAPKN"
FT   gene            <204088..>205182
FT                   /locus_tag="AGOS_AGL270W"
FT                   /old_locus_tag="AGL270W"
FT   mRNA            <204088..>205182
FT                   /locus_tag="AGOS_AGL270W"
FT                   /old_locus_tag="AGL270W"
FT                   /product="AGL270Wp"
FT   CDS_pept        204088..205182
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL270W"
FT                   /old_locus_tag="AGL270W"
FT                   /product="AGL270Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR157C
FT                   (ICS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL270W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54221"
FT                   /db_xref="UniProtKB/TrEMBL:Q751H6"
FT                   /protein_id="AAS54221.1"
FT   gene            <205353..>208007
FT                   /locus_tag="AGOS_AGL269W"
FT                   /old_locus_tag="AGL269W"
FT   mRNA            <205353..>208007
FT                   /locus_tag="AGOS_AGL269W"
FT                   /old_locus_tag="AGL269W"
FT                   /product="AGL269Wp"
FT   CDS_pept        205353..208007
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL269W"
FT                   /old_locus_tag="AGL269W"
FT                   /product="AGL269Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR156C
FT                   (SLI15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL269W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54222"
FT                   /db_xref="InterPro:IPR005635"
FT                   /db_xref="UniProtKB/TrEMBL:Q751H5"
FT                   /protein_id="AAS54222.1"
FT                   LPRVSVGNNMELR"
FT   gene            complement(<208130..>209269)
FT                   /locus_tag="AGOS_AGL268C"
FT                   /old_locus_tag="AGL268C"
FT   mRNA            complement(<208130..>209269)
FT                   /locus_tag="AGOS_AGL268C"
FT                   /old_locus_tag="AGL268C"
FT                   /product="AGL268Cp"
FT   CDS_pept        complement(208130..209269)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL268C"
FT                   /old_locus_tag="AGL268C"
FT                   /product="AGL268Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR155W
FT                   (CNS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL268C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54223"
FT                   /db_xref="GOA:Q751H4"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="UniProtKB/TrEMBL:Q751H4"
FT                   /protein_id="AAS54223.1"
FT   gene            complement(<209407..>210690)
FT                   /locus_tag="AGOS_AGL267C"
FT                   /old_locus_tag="AGL267C"
FT   mRNA            complement(<209407..>210690)
FT                   /locus_tag="AGOS_AGL267C"
FT                   /old_locus_tag="AGL267C"
FT                   /product="AGL267Cp"
FT   CDS_pept        complement(209407..210690)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL267C"
FT                   /old_locus_tag="AGL267C"
FT                   /product="AGL267Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR483W
FT                   (KRE2) and YPL053C (KTR6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL267C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54224"
FT                   /db_xref="GOA:Q751H3"
FT                   /db_xref="InterPro:IPR002685"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q751H3"
FT                   /protein_id="AAS54224.1"
FT   gene            complement(<211090..>212013)
FT                   /locus_tag="AGOS_AGL266C"
FT                   /old_locus_tag="AGL266C"
FT   mRNA            complement(<211090..>212013)
FT                   /locus_tag="AGOS_AGL266C"
FT                   /old_locus_tag="AGL266C"
FT                   /product="AGL266Cp"
FT   CDS_pept        complement(211090..212013)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL266C"
FT                   /old_locus_tag="AGL266C"
FT                   /product="AGL266Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YPR192W (AQY1), YLL052C (AQY2) (AQY2) and YLL053C; YLL052C
FT                   and YLL053C represent one ORF in this genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL266C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54225"
FT                   /db_xref="GOA:Q751H2"
FT                   /db_xref="InterPro:IPR000425"
FT                   /db_xref="InterPro:IPR022357"
FT                   /db_xref="InterPro:IPR023271"
FT                   /db_xref="InterPro:IPR034294"
FT                   /db_xref="UniProtKB/TrEMBL:Q751H2"
FT                   /protein_id="AAS54225.2"
FT   gene            <212408..>213176
FT                   /locus_tag="AGOS_AGL265W"
FT                   /old_locus_tag="AGL265W"
FT   mRNA            <212408..>213176
FT                   /locus_tag="AGOS_AGL265W"
FT                   /old_locus_tag="AGL265W"
FT                   /product="AGL265Wp"
FT   CDS_pept        join(212408..212596,212598..213176)
FT                   /codon_start=1
FT                   /ribosomal_slippage
FT                   /locus_tag="AGOS_AGL265W"
FT                   /old_locus_tag="AGL265W"
FT                   /product="AGL265Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL052W
FT                   (OAZ1); +1 frameshift"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL265W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54226"
FT                   /db_xref="GOA:Q751H1"
FT                   /db_xref="InterPro:IPR002993"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751H1"
FT                   /protein_id="AAS54226.2"
FT   gene            <214287..>215660
FT                   /locus_tag="AGOS_AGL264W"
FT                   /old_locus_tag="AGL264W"
FT   mRNA            <214287..>215660
FT                   /locus_tag="AGOS_AGL264W"
FT                   /old_locus_tag="AGL264W"
FT                   /product="AGL264Wp"
FT   CDS_pept        214287..215660
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL264W"
FT                   /old_locus_tag="AGL264W"
FT                   /product="AGL264Wp"
FT                   /note="NOHBY714; No homolog in Saccharomyces cerevisiae;
FT                   Similar to Microcystisae ruginosa transposae MAE_33580"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL264W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54227"
FT                   /db_xref="InterPro:IPR001959"
FT                   /db_xref="InterPro:IPR010095"
FT                   /db_xref="InterPro:IPR021027"
FT                   /db_xref="UniProtKB/TrEMBL:Q751H0"
FT                   /protein_id="AAS54227.1"
FT   gene            <216980..>217357
FT                   /locus_tag="AGOS_AGL263W"
FT                   /old_locus_tag="AGL263W"
FT   mRNA            <216980..>217357
FT                   /locus_tag="AGOS_AGL263W"
FT                   /old_locus_tag="AGL263W"
FT                   /product="AGL263Wp"
FT   CDS_pept        216980..217357
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL263W"
FT                   /old_locus_tag="AGL263W"
FT                   /product="AGL263Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR482C
FT                   (CWC21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL263W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54228"
FT                   /db_xref="GOA:Q751G9"
FT                   /db_xref="InterPro:IPR013170"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751G9"
FT                   /protein_id="AAS54228.1"
FT   gene            complement(<217491..>218468)
FT                   /locus_tag="AGOS_AGL262C"
FT                   /old_locus_tag="AGL262C"
FT   mRNA            complement(<217491..>218468)
FT                   /locus_tag="AGOS_AGL262C"
FT                   /old_locus_tag="AGL262C"
FT                   /product="AGL262Cp"
FT   CDS_pept        complement(217491..218468)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL262C"
FT                   /old_locus_tag="AGL262C"
FT                   /product="AGL262Cp"
FT                   /note="NOHBY713; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0B10076g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL262C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54229"
FT                   /db_xref="UniProtKB/TrEMBL:Q751G8"
FT                   /protein_id="AAS54229.1"
FT   gene            <220470..>221066
FT                   /locus_tag="AGOS_AGL261W"
FT                   /old_locus_tag="AGL261W"
FT   mRNA            <220470..>221066
FT                   /locus_tag="AGOS_AGL261W"
FT                   /old_locus_tag="AGL261W"
FT                   /product="AGL261Wp"
FT   CDS_pept        220470..221066
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL261W"
FT                   /old_locus_tag="AGL261W"
FT                   /product="AGL261Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL051W
FT                   (ARL3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL261W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54230"
FT                   /db_xref="GOA:Q751G7"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR006689"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q751G7"
FT                   /protein_id="AAS54230.1"
FT   gene            <221933..>223474
FT                   /locus_tag="AGOS_AGL260W"
FT                   /old_locus_tag="AGL260W"
FT   mRNA            <221933..>223474
FT                   /locus_tag="AGOS_AGL260W"
FT                   /old_locus_tag="AGL260W"
FT                   /product="AGL260Wp"
FT   CDS_pept        221933..223474
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL260W"
FT                   /old_locus_tag="AGL260W"
FT                   /product="AGL260Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR481C
FT                   (PHO8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL260W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54231"
FT                   /db_xref="GOA:Q751G6"
FT                   /db_xref="InterPro:IPR001952"
FT                   /db_xref="InterPro:IPR017850"
FT                   /db_xref="InterPro:IPR018299"
FT                   /db_xref="UniProtKB/TrEMBL:Q751G6"
FT                   /protein_id="AAS54231.1"
FT   gene            complement(<223704..>224873)
FT                   /locus_tag="AGOS_AGL259C"
FT                   /old_locus_tag="AGL259C"
FT   mRNA            complement(<223704..>224873)
FT                   /locus_tag="AGOS_AGL259C"
FT                   /old_locus_tag="AGL259C"
FT                   /product="AGL259Cp"
FT   CDS_pept        complement(223704..224873)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL259C"
FT                   /old_locus_tag="AGL259C"
FT                   /product="AGL259Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL050C
FT                   (MNN9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL259C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54232"
FT                   /db_xref="GOA:Q751G5"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q751G5"
FT                   /protein_id="AAS54232.2"
FT   gene            complement(<225123..>225806)
FT                   /locus_tag="AGOS_AGL258C"
FT                   /old_locus_tag="AGL258C"
FT   mRNA            complement(<225123..>225806)
FT                   /locus_tag="AGOS_AGL258C"
FT                   /old_locus_tag="AGL258C"
FT                   /product="AGL258Cp"
FT   CDS_pept        complement(225123..225806)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL258C"
FT                   /old_locus_tag="AGL258C"
FT                   /product="AGL258Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL049C
FT                   (DIG1) and YDR480W (DIG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL258C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54233"
FT                   /db_xref="UniProtKB/TrEMBL:Q751G4"
FT                   /protein_id="AAS54233.1"
FT                   KKIKS"
FT   gene            <225947..>226603
FT                   /locus_tag="AGOS_AGL257W"
FT                   /old_locus_tag="AGL257W"
FT   mRNA            <225947..>226603
FT                   /locus_tag="AGOS_AGL257W"
FT                   /old_locus_tag="AGL257W"
FT                   /product="AGL257Wp"
FT   CDS_pept        225947..226603
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL257W"
FT                   /old_locus_tag="AGL257W"
FT                   /product="AGL257Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL048W
FT                   (CAM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL257W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54234"
FT                   /db_xref="GOA:Q751G3"
FT                   /db_xref="InterPro:IPR004045"
FT                   /db_xref="InterPro:IPR004046"
FT                   /db_xref="InterPro:IPR010987"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="InterPro:IPR036282"
FT                   /db_xref="UniProtKB/TrEMBL:Q751G3"
FT                   /protein_id="AAS54234.2"
FT   gene            <226711..>228234
FT                   /locus_tag="AGOS_AGL256W"
FT                   /old_locus_tag="AGL256W"
FT   mRNA            <226711..>228234
FT                   /locus_tag="AGOS_AGL256W"
FT                   /old_locus_tag="AGL256W"
FT                   /product="AGL256Wp"
FT   CDS_pept        226711..228234
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL256W"
FT                   /old_locus_tag="AGL256W"
FT                   /product="AGL256Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR256C
FT                   (CTA1) and Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YGR088W (CTT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL256W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54235"
FT                   /db_xref="GOA:Q751G2"
FT                   /db_xref="InterPro:IPR002226"
FT                   /db_xref="InterPro:IPR010582"
FT                   /db_xref="InterPro:IPR011614"
FT                   /db_xref="InterPro:IPR018028"
FT                   /db_xref="InterPro:IPR020835"
FT                   /db_xref="InterPro:IPR024708"
FT                   /db_xref="InterPro:IPR024711"
FT                   /db_xref="InterPro:IPR037060"
FT                   /db_xref="UniProtKB/TrEMBL:Q751G2"
FT                   /protein_id="AAS54235.1"
FT   gene            <228399..>228716
FT                   /locus_tag="AGOS_AGL255W"
FT                   /old_locus_tag="AGL255W"
FT   mRNA            <228399..>228716
FT                   /locus_tag="AGOS_AGL255W"
FT                   /old_locus_tag="AGL255W"
FT                   /product="AGL255Wp"
FT   CDS_pept        228399..228716
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL255W"
FT                   /old_locus_tag="AGL255W"
FT                   /product="AGL255Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL047W
FT                   (SGF11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL255W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54236"
FT                   /db_xref="GOA:Q751G1"
FT                   /db_xref="InterPro:IPR013246"
FT                   /db_xref="InterPro:IPR041216"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751G1"
FT                   /protein_id="AAS54236.1"
FT                   G"
FT   gene            <228794..>230089
FT                   /locus_tag="AGOS_AGL254W"
FT                   /old_locus_tag="AGL254W"
FT   mRNA            <228794..>230089
FT                   /locus_tag="AGOS_AGL254W"
FT                   /old_locus_tag="AGL254W"
FT                   /product="AGL254Wp"
FT   CDS_pept        228794..230089
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL254W"
FT                   /old_locus_tag="AGL254W"
FT                   /product="AGL254Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR255C
FT                   (RMD5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL254W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54237"
FT                   /db_xref="GOA:Q751G0"
FT                   /db_xref="InterPro:IPR006595"
FT                   /db_xref="InterPro:IPR024964"
FT                   /db_xref="InterPro:IPR027711"
FT                   /db_xref="InterPro:IPR037683"
FT                   /db_xref="UniProtKB/TrEMBL:Q751G0"
FT                   /protein_id="AAS54237.1"
FT   gene            complement(<230112..>230414)
FT                   /locus_tag="AGOS_AGL253C"
FT                   /old_locus_tag="AGL253C"
FT   mRNA            complement(<230112..>230414)
FT                   /locus_tag="AGOS_AGL253C"
FT                   /old_locus_tag="AGL253C"
FT                   /product="AGL253Cp"
FT   CDS_pept        complement(230112..230414)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL253C"
FT                   /old_locus_tag="AGL253C"
FT                   /product="AGL253Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL046C
FT                   (ELC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL253C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54238"
FT                   /db_xref="GOA:Q751F9"
FT                   /db_xref="InterPro:IPR001232"
FT                   /db_xref="InterPro:IPR011333"
FT                   /db_xref="InterPro:IPR016073"
FT                   /db_xref="InterPro:IPR039948"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751F9"
FT                   /protein_id="AAS54238.1"
FT   gene            <230549..>232936
FT                   /locus_tag="AGOS_AGL252W"
FT                   /old_locus_tag="AGL252W"
FT   mRNA            <230549..>232936
FT                   /locus_tag="AGOS_AGL252W"
FT                   /old_locus_tag="AGL252W"
FT                   /product="AGL252Wp"
FT   CDS_pept        230549..232936
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL252W"
FT                   /old_locus_tag="AGL252W"
FT                   /product="AGL252Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL045W
FT                   (VPS16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL252W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54239"
FT                   /db_xref="GOA:Q751F8"
FT                   /db_xref="InterPro:IPR006925"
FT                   /db_xref="InterPro:IPR006926"
FT                   /db_xref="InterPro:IPR016534"
FT                   /db_xref="InterPro:IPR038132"
FT                   /db_xref="UniProtKB/TrEMBL:Q751F8"
FT                   /protein_id="AAS54239.1"
FT   gene            complement(<232942..>234138)
FT                   /locus_tag="AGOS_AGL251C"
FT                   /old_locus_tag="AGL251C"
FT   mRNA            complement(<232942..>234138)
FT                   /locus_tag="AGOS_AGL251C"
FT                   /old_locus_tag="AGL251C"
FT                   /product="AGL251Cp"
FT   CDS_pept        complement(232942..234138)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL251C"
FT                   /old_locus_tag="AGL251C"
FT                   /product="AGL251Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR254W
FT                   (CHL4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL251C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54240"
FT                   /db_xref="GOA:Q751F7"
FT                   /db_xref="InterPro:IPR007902"
FT                   /db_xref="UniProtKB/TrEMBL:Q751F7"
FT                   /protein_id="AAS54240.2"
FT   gene            <234339..>236528
FT                   /locus_tag="AGOS_AGL250W"
FT                   /old_locus_tag="AGL250W"
FT   mRNA            <234339..>236528
FT                   /locus_tag="AGOS_AGL250W"
FT                   /old_locus_tag="AGL250W"
FT                   /product="AGL250Wp"
FT   CDS_pept        234339..236528
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL250W"
FT                   /old_locus_tag="AGL250W"
FT                   /product="AGL250Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL043W
FT                   (NOP4)"
FT                   /db_xref="GOA:Q751F6"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q751F6"
FT                   /protein_id="AAS54241.1"
FT   gene            complement(<236606..>238351)
FT                   /locus_tag="AGOS_AGL249C"
FT                   /old_locus_tag="AGL249C"
FT   mRNA            complement(<236606..>238351)
FT                   /locus_tag="AGOS_AGL249C"
FT                   /old_locus_tag="AGL249C"
FT                   /product="AGL249Cp"
FT   CDS_pept        complement(236606..238351)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL249C"
FT                   /old_locus_tag="AGL249C"
FT                   /product="AGL249Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL042C
FT                   (SSN3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL249C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54242"
FT                   /db_xref="GOA:Q751F5"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751F5"
FT                   /protein_id="AAS54242.2"
FT                   RKKKR"
FT   gene            complement(<238591..>239208)
FT                   /locus_tag="AGOS_AGL248C"
FT                   /old_locus_tag="AGL248C"
FT   mRNA            complement(<238591..>239208)
FT                   /locus_tag="AGOS_AGL248C"
FT                   /old_locus_tag="AGL248C"
FT                   /product="AGL248Cp"
FT   CDS_pept        complement(238591..239208)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL248C"
FT                   /old_locus_tag="AGL248C"
FT                   /product="AGL248Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL041C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL248C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54243"
FT                   /db_xref="InterPro:IPR018811"
FT                   /db_xref="UniProtKB/TrEMBL:Q751F4"
FT                   /protein_id="AAS54243.1"
FT   gene            complement(<239304..>242270)
FT                   /locus_tag="AGOS_AGL247C"
FT                   /old_locus_tag="AGL247C"
FT   mRNA            complement(<239304..>242270)
FT                   /locus_tag="AGOS_AGL247C"
FT                   /old_locus_tag="AGL247C"
FT                   /product="AGL247Cp"
FT   CDS_pept        complement(239304..242270)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL247C"
FT                   /old_locus_tag="AGL247C"
FT                   /product="AGL247Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL040C
FT                   (ISM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL247C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54244"
FT                   /db_xref="GOA:Q751F3"
FT                   /db_xref="InterPro:IPR001412"
FT                   /db_xref="InterPro:IPR002300"
FT                   /db_xref="InterPro:IPR002301"
FT                   /db_xref="InterPro:IPR009008"
FT                   /db_xref="InterPro:IPR009080"
FT                   /db_xref="InterPro:IPR013155"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR033708"
FT                   /db_xref="UniProtKB/TrEMBL:Q751F3"
FT                   /protein_id="AAS54244.1"
FT   gene            <243116..>243799
FT                   /locus_tag="AGOS_AGL246W"
FT                   /old_locus_tag="AGL246W"
FT   mRNA            <243116..>243799
FT                   /locus_tag="AGOS_AGL246W"
FT                   /old_locus_tag="AGL246W"
FT                   /product="AGL246Wp"
FT   CDS_pept        243116..243799
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL246W"
FT                   /old_locus_tag="AGL246W"
FT                   /product="AGL246Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR253C
FT                   (MET32) and YPL038W (MET31)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL246W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54245"
FT                   /db_xref="GOA:Q751F2"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q751F2"
FT                   /protein_id="AAS54245.1"
FT                   NGAKV"
FT   gene            complement(<243975..>244460)
FT                   /locus_tag="AGOS_AGL245C"
FT                   /old_locus_tag="AGL245C"
FT   mRNA            complement(<243975..>244460)
FT                   /locus_tag="AGOS_AGL245C"
FT                   /old_locus_tag="AGL245C"
FT                   /product="AGL245Cp"
FT   CDS_pept        complement(243975..244460)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL245C"
FT                   /old_locus_tag="AGL245C"
FT                   /product="AGL245Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL037C
FT                   (EGD1) and YDR252W (BTT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL245C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54246"
FT                   /db_xref="GOA:Q751F1"
FT                   /db_xref="InterPro:IPR002715"
FT                   /db_xref="InterPro:IPR038187"
FT                   /db_xref="InterPro:IPR039370"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751F1"
FT                   /protein_id="AAS54246.1"
FT   gene            244823..244896
FT                   /locus_tag="AGOS_t0174"
FT   tRNA            244823..244896
FT                   /locus_tag="AGOS_t0174"
FT                   /product="tRNA-Ile"
FT                   /note="codon recognized: AUU"
FT   gene            complement(<245009..>247537)
FT                   /locus_tag="AGOS_AGL244C"
FT                   /old_locus_tag="AGL244C"
FT   mRNA            complement(<245009..>247537)
FT                   /locus_tag="AGOS_AGL244C"
FT                   /old_locus_tag="AGL244C"
FT                   /product="AGL244Cp"
FT   CDS_pept        complement(245009..247537)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL244C"
FT                   /old_locus_tag="AGL244C"
FT                   /product="AGL244Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL032C
FT                   (SVL3) and YDR251W (PAM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL244C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54247"
FT                   /db_xref="GOA:Q751F0"
FT                   /db_xref="InterPro:IPR008927"
FT                   /db_xref="InterPro:IPR013328"
FT                   /db_xref="InterPro:IPR013752"
FT                   /db_xref="UniProtKB/TrEMBL:Q751F0"
FT                   /protein_id="AAS54247.1"
FT   gene            <248087..>249076
FT                   /locus_tag="AGOS_AGL243W"
FT                   /old_locus_tag="AGL243W"
FT   mRNA            <248087..>249076
FT                   /locus_tag="AGOS_AGL243W"
FT                   /old_locus_tag="AGL243W"
FT                   /product="AGL243Wp"
FT   CDS_pept        248087..249076
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL243W"
FT                   /old_locus_tag="AGL243W"
FT                   /product="AGL243Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR249C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL243W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54248"
FT                   /db_xref="UniProtKB/TrEMBL:Q751E9"
FT                   /protein_id="AAS54248.2"
FT   gene            complement(<249161..>250119)
FT                   /locus_tag="AGOS_AGL242C"
FT                   /old_locus_tag="AGL242C"
FT   mRNA            complement(join(<249161..250049,250103..>250119))
FT                   /locus_tag="AGOS_AGL242C"
FT                   /old_locus_tag="AGL242C"
FT                   /product="AGL242Cp"
FT   CDS_pept        complement(join(249161..250049,250103..250119))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL242C"
FT                   /old_locus_tag="AGL242C"
FT                   /product="AGL242Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL031C
FT                   (PHO85); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL242C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54249"
FT                   /db_xref="GOA:Q751E8"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751E8"
FT                   /protein_id="AAS54249.2"
FT   gene            <250644..>252239
FT                   /locus_tag="AGOS_AGL241W"
FT                   /old_locus_tag="AGL241W"
FT   mRNA            <250644..>252239
FT                   /locus_tag="AGOS_AGL241W"
FT                   /old_locus_tag="AGL241W"
FT                   /product="AGL241Wp"
FT   CDS_pept        250644..252239
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL241W"
FT                   /old_locus_tag="AGL241W"
FT                   /product="AGL241Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL030W
FT                   (TRM44)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL241W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54250"
FT                   /db_xref="GOA:Q751E7"
FT                   /db_xref="InterPro:IPR011671"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751E7"
FT                   /protein_id="AAS54250.1"
FT                   QSATALLKGTPKSH"
FT   gene            <252458..>254584
FT                   /locus_tag="AGOS_AGL240W"
FT                   /old_locus_tag="AGL240W"
FT   mRNA            <252458..>254584
FT                   /locus_tag="AGOS_AGL240W"
FT                   /old_locus_tag="AGL240W"
FT                   /product="AGL240Wp"
FT   CDS_pept        252458..254584
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL240W"
FT                   /old_locus_tag="AGL240W"
FT                   /product="AGL240Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL029W
FT                   (SUV3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL240W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54251"
FT                   /db_xref="GOA:Q751E6"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR022192"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q751E6"
FT                   /protein_id="AAS54251.1"
FT                   EKLKFLKRNPYKKS"
FT   gene            complement(<254740..>256080)
FT                   /locus_tag="AGOS_AGL239C"
FT                   /old_locus_tag="AGL239C"
FT   mRNA            complement(<254740..>256080)
FT                   /locus_tag="AGOS_AGL239C"
FT                   /old_locus_tag="AGL239C"
FT                   /product="AGL239Cp"
FT   CDS_pept        complement(254740..256080)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL239C"
FT                   /old_locus_tag="AGL239C"
FT                   /product="AGL239Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR045W
FT                   (PET494)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL239C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54252"
FT                   /db_xref="UniProtKB/TrEMBL:Q751E5"
FT                   /protein_id="AAS54252.2"
FT   gene            <256249..>256809
FT                   /locus_tag="AGOS_AGL238W"
FT                   /old_locus_tag="AGL238W"
FT   mRNA            <256249..>256809
FT                   /locus_tag="AGOS_AGL238W"
FT                   /old_locus_tag="AGL238W"
FT                   /product="AGL238Wp"
FT   CDS_pept        256249..256809
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL238W"
FT                   /old_locus_tag="AGL238W"
FT                   /product="AGL238Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YCR090C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL238W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54253"
FT                   /db_xref="InterPro:IPR008584"
FT                   /db_xref="UniProtKB/TrEMBL:Q751E4"
FT                   /protein_id="AAS54253.2"
FT   gene            complement(<256901..>258637)
FT                   /locus_tag="AGOS_AGL237C"
FT                   /old_locus_tag="AGL237C"
FT   mRNA            complement(<256901..>258637)
FT                   /locus_tag="AGOS_AGL237C"
FT                   /old_locus_tag="AGL237C"
FT                   /product="AGL237Cp"
FT   CDS_pept        complement(256901..258637)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL237C"
FT                   /old_locus_tag="AGL237C"
FT                   /product="AGL237Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR088W
FT                   (ABP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL237C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54254"
FT                   /db_xref="GOA:Q751E3"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR002108"
FT                   /db_xref="InterPro:IPR029006"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="UniProtKB/TrEMBL:Q751E3"
FT                   /protein_id="AAS54254.1"
FT                   QQ"
FT   gene            <258797..>259279
FT                   /locus_tag="AGOS_AGL236W"
FT                   /old_locus_tag="AGL236W"
FT   mRNA            <258797..>259279
FT                   /locus_tag="AGOS_AGL236W"
FT                   /old_locus_tag="AGL236W"
FT                   /product="AGL236Wp"
FT   CDS_pept        258797..259279
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL236W"
FT                   /old_locus_tag="AGL236W"
FT                   /product="AGL236Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YCR087C-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL236W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54255"
FT                   /db_xref="GOA:Q751E2"
FT                   /db_xref="InterPro:IPR014898"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="InterPro:IPR039999"
FT                   /db_xref="UniProtKB/TrEMBL:Q751E2"
FT                   /protein_id="AAS54255.2"
FT   gene            complement(<259316..>259873)
FT                   /locus_tag="AGOS_AGL235C"
FT                   /old_locus_tag="AGL235C"
FT   mRNA            complement(<259316..>259873)
FT                   /locus_tag="AGOS_AGL235C"
FT                   /old_locus_tag="AGL235C"
FT                   /product="AGL235Cp"
FT   CDS_pept        complement(259316..259873)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL235C"
FT                   /old_locus_tag="AGL235C"
FT                   /product="AGL235Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR086W
FT                   (CSM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL235C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54256"
FT                   /db_xref="GOA:Q751E1"
FT                   /db_xref="InterPro:IPR020981"
FT                   /db_xref="InterPro:IPR038608"
FT                   /db_xref="InterPro:IPR040349"
FT                   /db_xref="InterPro:IPR041671"
FT                   /db_xref="UniProtKB/TrEMBL:Q751E1"
FT                   /protein_id="AAS54256.1"
FT   gene            <260233..>262122
FT                   /locus_tag="AGOS_AGL234W"
FT                   /old_locus_tag="AGL234W"
FT   mRNA            <260233..>262122
FT                   /locus_tag="AGOS_AGL234W"
FT                   /old_locus_tag="AGL234W"
FT                   /product="AGL234Wp"
FT   CDS_pept        260233..262122
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL234W"
FT                   /old_locus_tag="AGL234W"
FT                   /product="AGL234Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR084C
FT                   (TUP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL234W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54257"
FT                   /db_xref="GOA:Q751E0"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR013890"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q751E0"
FT                   /protein_id="AAS54257.1"
FT   gene            complement(<262678..>265296)
FT                   /locus_tag="AGOS_AGL233C"
FT                   /old_locus_tag="AGL233C"
FT   mRNA            complement(<262678..>265296)
FT                   /locus_tag="AGOS_AGL233C"
FT                   /old_locus_tag="AGL233C"
FT                   /product="AGL233Cp"
FT   CDS_pept        complement(262678..265296)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL233C"
FT                   /old_locus_tag="AGL233C"
FT                   /product="AGL233Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YKL222C and YOR172W (YRM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL233C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54258"
FT                   /db_xref="GOA:Q751D9"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q751D9"
FT                   /protein_id="AAS54258.1"
FT                   S"
FT   gene            complement(<267782..>269038)
FT                   /locus_tag="AGOS_AGL232C"
FT                   /old_locus_tag="AGL232C"
FT   mRNA            complement(join(<267782..268930,268994..>269038))
FT                   /locus_tag="AGOS_AGL232C"
FT                   /old_locus_tag="AGL232C"
FT                   /product="AGL232Cp"
FT   CDS_pept        complement(join(267782..268930,268994..269038))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL232C"
FT                   /old_locus_tag="AGL232C"
FT                   /product="AGL232Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR043W
FT                   (MVD1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL232C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54259"
FT                   /db_xref="GOA:Q751D8"
FT                   /db_xref="InterPro:IPR005935"
FT                   /db_xref="InterPro:IPR006204"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR029765"
FT                   /db_xref="InterPro:IPR036554"
FT                   /db_xref="InterPro:IPR041431"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751D8"
FT                   /protein_id="AAS54259.2"
FT   gene            <269216..>270286
FT                   /locus_tag="AGOS_AGL231W"
FT                   /old_locus_tag="AGL231W"
FT   mRNA            <269216..>270286
FT                   /locus_tag="AGOS_AGL231W"
FT                   /old_locus_tag="AGL231W"
FT                   /product="AGL231Wp"
FT   CDS_pept        269216..270286
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL231W"
FT                   /old_locus_tag="AGL231W"
FT                   /product="AGL231Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR041C
FT                   (COQ2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL231W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54260"
FT                   /db_xref="GOA:Q751D7"
FT                   /db_xref="InterPro:IPR000537"
FT                   /db_xref="InterPro:IPR006370"
FT                   /db_xref="InterPro:IPR030470"
FT                   /db_xref="InterPro:IPR039653"
FT                   /db_xref="UniProtKB/TrEMBL:Q751D7"
FT                   /protein_id="AAS54260.1"
FT                   SAALFCDYLLTIFGVM"
FT   gene            complement(<270296..>271057)
FT                   /locus_tag="AGOS_AGL230C"
FT                   /old_locus_tag="AGL230C"
FT   mRNA            complement(<270296..>271057)
FT                   /locus_tag="AGOS_AGL230C"
FT                   /old_locus_tag="AGL230C"
FT                   /product="AGL230Cp"
FT   CDS_pept        complement(270296..271057)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL230C"
FT                   /old_locus_tag="AGL230C"
FT                   /product="AGL230Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YNR040W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL230C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54261"
FT                   /db_xref="GOA:Q751D6"
FT                   /db_xref="UniProtKB/TrEMBL:Q751D6"
FT                   /protein_id="AAS54261.2"
FT   gene            complement(<271118..>271465)
FT                   /locus_tag="AGOS_AGL229C"
FT                   /old_locus_tag="AGL229C"
FT   mRNA            complement(<271118..>271465)
FT                   /locus_tag="AGOS_AGL229C"
FT                   /old_locus_tag="AGL229C"
FT                   /product="AGL229Cp"
FT   CDS_pept        complement(271118..271465)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL229C"
FT                   /old_locus_tag="AGL229C"
FT                   /product="AGL229Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR083W
FT                   (TRX3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL229C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54262"
FT                   /db_xref="GOA:Q751D5"
FT                   /db_xref="InterPro:IPR005746"
FT                   /db_xref="InterPro:IPR013766"
FT                   /db_xref="InterPro:IPR017937"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q751D5"
FT                   /protein_id="AAS54262.1"
FT                   RALEQALTLDG"
FT   gene            complement(<271543..>271926)
FT                   /locus_tag="AGOS_AGL228C"
FT                   /old_locus_tag="AGL228C"
FT   mRNA            complement(<271543..>271926)
FT                   /locus_tag="AGOS_AGL228C"
FT                   /old_locus_tag="AGL228C"
FT                   /product="AGL228Cp"
FT   CDS_pept        complement(271543..271926)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL228C"
FT                   /old_locus_tag="AGL228C"
FT                   /product="AGL228Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR082W
FT                   (AHC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL228C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54263"
FT                   /db_xref="GOA:Q751D4"
FT                   /db_xref="UniProtKB/TrEMBL:Q751D4"
FT                   /protein_id="AAS54263.2"
FT   gene            <272146..>273705
FT                   /locus_tag="AGOS_AGL227W"
FT                   /old_locus_tag="AGL227W"
FT   mRNA            <272146..>273705
FT                   /locus_tag="AGOS_AGL227W"
FT                   /old_locus_tag="AGL227W"
FT                   /product="AGL227Wp"
FT   CDS_pept        272146..273705
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL227W"
FT                   /old_locus_tag="AGL227W"
FT                   /product="AGL227Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR039C
FT                   (ZRG17)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL227W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54264"
FT                   /db_xref="GOA:Q751D3"
FT                   /db_xref="UniProtKB/TrEMBL:Q751D3"
FT                   /protein_id="AAS54264.2"
FT                   RV"
FT   gene            complement(<273788..>277864)
FT                   /locus_tag="AGOS_AGL226C"
FT                   /old_locus_tag="AGL226C"
FT   mRNA            complement(<273788..>277864)
FT                   /locus_tag="AGOS_AGL226C"
FT                   /old_locus_tag="AGL226C"
FT                   /product="AGL226Cp"
FT   CDS_pept        complement(273788..277864)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL226C"
FT                   /old_locus_tag="AGL226C"
FT                   /product="AGL226Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR081W
FT                   (SRB8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL226C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54265"
FT                   /db_xref="GOA:Q751D2"
FT                   /db_xref="InterPro:IPR019035"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751D2"
FT                   /protein_id="AAS54265.2"
FT                   SLSLFDARFDKKNPT"
FT   gene            complement(<278091..>279914)
FT                   /locus_tag="AGOS_AGL225C"
FT                   /old_locus_tag="AGL225C"
FT   mRNA            complement(<278091..>279914)
FT                   /locus_tag="AGOS_AGL225C"
FT                   /old_locus_tag="AGL225C"
FT                   /product="AGL225Cp"
FT   CDS_pept        complement(278091..279914)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL225C"
FT                   /old_locus_tag="AGL225C"
FT                   /product="AGL225Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR038W
FT                   (DBP6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL225C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54266"
FT                   /db_xref="GOA:Q751D1"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751D1"
FT                   /protein_id="AAS54266.1"
FT   gene            <280112..>280387
FT                   /locus_tag="AGOS_AGL224W"
FT                   /old_locus_tag="AGL224W"
FT   mRNA            <280112..>280387
FT                   /locus_tag="AGOS_AGL224W"
FT                   /old_locus_tag="AGL224W"
FT                   /product="AGL224Wp"
FT   CDS_pept        280112..280387
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL224W"
FT                   /old_locus_tag="AGL224W"
FT                   /product="AGL224Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR037C
FT                   (RSM19)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL224W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54267"
FT                   /db_xref="GOA:Q751D0"
FT                   /db_xref="InterPro:IPR002222"
FT                   /db_xref="InterPro:IPR020934"
FT                   /db_xref="InterPro:IPR023575"
FT                   /db_xref="UniProtKB/TrEMBL:Q751D0"
FT                   /protein_id="AAS54267.1"
FT   gene            complement(<280474..>281910)
FT                   /locus_tag="AGOS_AGL223C"
FT                   /old_locus_tag="AGL223C"
FT   mRNA            complement(<280474..>281910)
FT                   /locus_tag="AGOS_AGL223C"
FT                   /old_locus_tag="AGL223C"
FT                   /product="AGL223Cp"
FT   CDS_pept        complement(280474..281910)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL223C"
FT                   /old_locus_tag="AGL223C"
FT                   /product="AGL223Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR079W
FT                   (PTC6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL223C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54268"
FT                   /db_xref="GOA:Q751C9"
FT                   /db_xref="InterPro:IPR001932"
FT                   /db_xref="InterPro:IPR015655"
FT                   /db_xref="InterPro:IPR036457"
FT                   /db_xref="UniProtKB/TrEMBL:Q751C9"
FT                   /protein_id="AAS54268.1"
FT   gene            <282235..>282717
FT                   /locus_tag="AGOS_AGL222W"
FT                   /old_locus_tag="AGL222W"
FT   mRNA            <282235..>282717
FT                   /locus_tag="AGOS_AGL222W"
FT                   /old_locus_tag="AGL222W"
FT                   /product="AGL222Wp"
FT   CDS_pept        282235..282717
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL222W"
FT                   /old_locus_tag="AGL222W"
FT                   /product="AGL222Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR036C
FT                   (MRPS12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL222W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54269"
FT                   /db_xref="GOA:Q751C8"
FT                   /db_xref="InterPro:IPR005679"
FT                   /db_xref="InterPro:IPR006032"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="UniProtKB/TrEMBL:Q751C8"
FT                   /protein_id="AAS54269.1"
FT   gene            <282863..>283876
FT                   /locus_tag="AGOS_AGL221W"
FT                   /old_locus_tag="AGL221W"
FT   mRNA            <282863..>283876
FT                   /locus_tag="AGOS_AGL221W"
FT                   /old_locus_tag="AGL221W"
FT                   /product="AGL221Wp"
FT   CDS_pept        282863..283876
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL221W"
FT                   /old_locus_tag="AGL221W"
FT                   /product="AGL221Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YNR035C
FT                   (ARC35)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL221W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54270"
FT                   /db_xref="GOA:Q751C7"
FT                   /db_xref="InterPro:IPR007188"
FT                   /db_xref="InterPro:IPR034666"
FT                   /db_xref="UniProtKB/TrEMBL:Q751C7"
FT                   /protein_id="AAS54270.1"
FT   gene            <284326..>286968
FT                   /locus_tag="AGOS_AGL220W"
FT                   /old_locus_tag="AGL220W"
FT   mRNA            <284326..>286968
FT                   /locus_tag="AGOS_AGL220W"
FT                   /old_locus_tag="AGL220W"
FT                   /product="AGL220Wp"
FT   CDS_pept        284326..286968
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL220W"
FT                   /old_locus_tag="AGL220W"
FT                   /product="AGL220Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YCR077C
FT                   (PAT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL220W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54271"
FT                   /db_xref="GOA:Q751C6"
FT                   /db_xref="InterPro:IPR019167"
FT                   /db_xref="InterPro:IPR039900"
FT                   /db_xref="UniProtKB/TrEMBL:Q751C6"
FT                   /protein_id="AAS54271.1"
FT                   RDGEISELK"
FT   gene            287167..287240
FT                   /locus_tag="AGOS_t0175"
FT   tRNA            287167..287240
FT                   /locus_tag="AGOS_t0175"
FT                   /product="tRNA-Asn"
FT                   /note="codon recognized: AAC"
FT   gene            <287393..>289045
FT                   /locus_tag="AGOS_AGL219W"
FT                   /old_locus_tag="AGL219W"
FT   mRNA            <287393..>289045
FT                   /locus_tag="AGOS_AGL219W"
FT                   /old_locus_tag="AGL219W"
FT                   /product="AGL219Wp"
FT   CDS_pept        287393..289045
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL219W"
FT                   /old_locus_tag="AGL219W"
FT                   /product="AGL219Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR258C
FT                   (ROY1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL219W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54272"
FT                   /db_xref="GOA:Q751C5"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:Q751C5"
FT                   /protein_id="AAS54272.2"
FT   gene            <289549..>292029
FT                   /locus_tag="AGOS_AGL218W"
FT                   /old_locus_tag="AGL218W"
FT   mRNA            <289549..>292029
FT                   /locus_tag="AGOS_AGL218W"
FT                   /old_locus_tag="AGL218W"
FT                   /product="AGL218Wp"
FT   CDS_pept        289549..292029
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL218W"
FT                   /old_locus_tag="AGL218W"
FT                   /product="AGL218Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR257C
FT                   (PET111)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL218W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54273"
FT                   /db_xref="UniProtKB/TrEMBL:Q751C4"
FT                   /protein_id="AAS54273.1"
FT                   KECEQSIGMHAELP"
FT   gene            <292270..>293552
FT                   /locus_tag="AGOS_AGL217W"
FT                   /old_locus_tag="AGL217W"
FT   mRNA            join(<292270..292305,292368..>293552)
FT                   /locus_tag="AGOS_AGL217W"
FT                   /old_locus_tag="AGL217W"
FT                   /product="AGL217Wp"
FT   CDS_pept        join(292270..292305,292368..293552)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL217W"
FT                   /old_locus_tag="AGL217W"
FT                   /product="AGL217Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL054W
FT                   (PSH1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL217W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54274"
FT                   /db_xref="GOA:Q751C3"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="UniProtKB/TrEMBL:Q751C3"
FT                   /protein_id="AAS54274.2"
FT                   VLDSDDD"
FT   gene            <293900..>294085
FT                   /locus_tag="AGOS_AGL216W"
FT                   /old_locus_tag="AGL216W"
FT   mRNA            <293900..>294085
FT                   /locus_tag="AGOS_AGL216W"
FT                   /old_locus_tag="AGL216W"
FT                   /product="AGL216Wp"
FT   CDS_pept        293900..294085
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL216W"
FT                   /old_locus_tag="AGL216W"
FT                   /product="AGL216Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR256C
FT                   (COX7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL216W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54275"
FT                   /db_xref="GOA:Q751C2"
FT                   /db_xref="InterPro:IPR014367"
FT                   /db_xref="InterPro:IPR039297"
FT                   /db_xref="UniProtKB/TrEMBL:Q751C2"
FT                   /protein_id="AAS54275.2"
FT                   IAHIPNAIMGIKAKRS"
FT   gene            <294460..>295461
FT                   /locus_tag="AGOS_AGL215W"
FT                   /old_locus_tag="AGL215W"
FT   mRNA            <294460..>295461
FT                   /locus_tag="AGOS_AGL215W"
FT                   /old_locus_tag="AGL215W"
FT                   /product="AGL215Wp"
FT   CDS_pept        294460..295461
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL215W"
FT                   /old_locus_tag="AGL215W"
FT                   /product="AGL215Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YOL053W
FT                   (AIM39)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL215W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54276"
FT                   /db_xref="GOA:Q751C1"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751C1"
FT                   /protein_id="AAS54276.1"
FT   gene            complement(<295561..>296241)
FT                   /locus_tag="AGOS_AGL214C"
FT                   /old_locus_tag="AGL214C"
FT   mRNA            complement(<295561..>296241)
FT                   /locus_tag="AGOS_AGL214C"
FT                   /old_locus_tag="AGL214C"
FT                   /product="AGL214Cp"
FT   CDS_pept        complement(295561..296241)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL214C"
FT                   /old_locus_tag="AGL214C"
FT                   /product="AGL214Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR255W
FT                   (GFD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL214C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54277"
FT                   /db_xref="InterPro:IPR020401"
FT                   /db_xref="UniProtKB/TrEMBL:Q751C0"
FT                   /protein_id="AAS54277.2"
FT                   LATR"
FT   gene            <296681..>297058
FT                   /locus_tag="AGOS_AGL213W"
FT                   /old_locus_tag="AGL213W"
FT   mRNA            <296681..>297058
FT                   /locus_tag="AGOS_AGL213W"
FT                   /old_locus_tag="AGL213W"
FT                   /product="AGL213Wp"
FT   CDS_pept        296681..297058
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL213W"
FT                   /old_locus_tag="AGL213W"
FT                   /product="AGL213Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR252C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL213W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54278"
FT                   /db_xref="UniProtKB/TrEMBL:Q751B9"
FT                   /protein_id="AAS54278.1"
FT   gene            <298073..>300784
FT                   /locus_tag="AGOS_AGL212W"
FT                   /old_locus_tag="AGL212W"
FT   mRNA            <298073..>300784
FT                   /locus_tag="AGOS_AGL212W"
FT                   /old_locus_tag="AGL212W"
FT                   /product="AGL212Wp"
FT   CDS_pept        298073..300784
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL212W"
FT                   /old_locus_tag="AGL212W"
FT                   /product="AGL212Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR073W
FT                   (RDH54)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL212W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54279"
FT                   /db_xref="GOA:Q751B8"
FT                   /db_xref="InterPro:IPR000330"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR038718"
FT                   /db_xref="UniProtKB/TrEMBL:Q751B8"
FT                   /protein_id="AAS54279.2"
FT   gene            complement(<300831..>302669)
FT                   /locus_tag="AGOS_AGL211C"
FT                   /old_locus_tag="AGL211C"
FT   mRNA            complement(<300831..>302669)
FT                   /locus_tag="AGOS_AGL211C"
FT                   /old_locus_tag="AGL211C"
FT                   /product="AGL211Cp"
FT   CDS_pept        complement(300831..302669)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL211C"
FT                   /old_locus_tag="AGL211C"
FT                   /product="AGL211Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR049W
FT                   (VMS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL211C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54280"
FT                   /db_xref="GOA:Q751B7"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="InterPro:IPR036770"
FT                   /db_xref="InterPro:IPR041175"
FT                   /db_xref="UniProtKB/TrEMBL:Q751B7"
FT                   /protein_id="AAS54280.1"
FT   gene            complement(<302861..>303964)
FT                   /locus_tag="AGOS_AGL210C"
FT                   /old_locus_tag="AGL210C"
FT   mRNA            complement(<302861..>303964)
FT                   /locus_tag="AGOS_AGL210C"
FT                   /old_locus_tag="AGL210C"
FT                   /product="AGL210Cp"
FT   CDS_pept        complement(302861..303964)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL210C"
FT                   /old_locus_tag="AGL210C"
FT                   /product="AGL210Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR047W
FT                   (HEM12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL210C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54281"
FT                   /db_xref="GOA:Q750Z7"
FT                   /db_xref="InterPro:IPR000257"
FT                   /db_xref="InterPro:IPR006361"
FT                   /db_xref="InterPro:IPR038071"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Z7"
FT                   /protein_id="AAS54281.1"
FT   gene            <304320..>307355
FT                   /locus_tag="AGOS_AGL209W"
FT                   /old_locus_tag="AGL209W"
FT   mRNA            <304320..>307355
FT                   /locus_tag="AGOS_AGL209W"
FT                   /old_locus_tag="AGL209W"
FT                   /product="AGL209Wp"
FT   CDS_pept        304320..307355
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL209W"
FT                   /old_locus_tag="AGL209W"
FT                   /product="AGL209Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBR074W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL209W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54282"
FT                   /db_xref="GOA:Q750Z6"
FT                   /db_xref="InterPro:IPR007484"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750Z6"
FT                   /protein_id="AAS54282.1"
FT   gene            complement(<307528..>310113)
FT                   /locus_tag="AGOS_AGL208C"
FT                   /old_locus_tag="AGL208C"
FT   mRNA            complement(<307528..>310113)
FT                   /locus_tag="AGOS_AGL208C"
FT                   /old_locus_tag="AGL208C"
FT                   /product="AGL208Cp"
FT   CDS_pept        complement(307528..310113)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL208C"
FT                   /old_locus_tag="AGL208C"
FT                   /product="AGL208Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YNR067C (DSE4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL208C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54283"
FT                   /db_xref="GOA:Q750Z5"
FT                   /db_xref="InterPro:IPR005200"
FT                   /db_xref="InterPro:IPR040451"
FT                   /db_xref="InterPro:IPR040720"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Z5"
FT                   /protein_id="AAS54283.2"
FT   gene            <313014..>313847
FT                   /locus_tag="AGOS_AGL207W"
FT                   /old_locus_tag="AGL207W"
FT   mRNA            <313014..>313847
FT                   /locus_tag="AGOS_AGL207W"
FT                   /old_locus_tag="AGL207W"
FT                   /product="AGL207Wp"
FT   CDS_pept        313014..313847
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL207W"
FT                   /old_locus_tag="AGL207W"
FT                   /product="AGL207Wp"
FT                   /note="NOHBY712; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F11682g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL207W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54284"
FT                   /db_xref="GOA:Q750Z4"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Z4"
FT                   /protein_id="AAS54284.1"
FT   gene            complement(<314110..>316317)
FT                   /locus_tag="AGOS_AGL206C"
FT                   /old_locus_tag="AGL206C"
FT   mRNA            complement(<314110..>316317)
FT                   /locus_tag="AGOS_AGL206C"
FT                   /old_locus_tag="AGL206C"
FT                   /product="AGL206Cp"
FT   CDS_pept        complement(314110..316317)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL206C"
FT                   /old_locus_tag="AGL206C"
FT                   /product="AGL206Cp"
FT                   /note="NOHBY711; No homolog in Saccharomyces cerevisiae;
FT                   Non-syntenic homolog of Kluyveromyces lactis KLLA0D12650g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL206C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54285"
FT                   /db_xref="GOA:Q750Z3"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR021858"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Z3"
FT                   /protein_id="AAS54285.2"
FT   gene            complement(<316910..>318757)
FT                   /locus_tag="AGOS_AGL205C"
FT                   /old_locus_tag="AGL205C"
FT   mRNA            complement(<316910..>318757)
FT                   /locus_tag="AGOS_AGL205C"
FT                   /old_locus_tag="AGL205C"
FT                   /product="AGL205Cp"
FT   CDS_pept        complement(316910..318757)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL205C"
FT                   /old_locus_tag="AGL205C"
FT                   /product="AGL205Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR052C
FT                   (DBF4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL205C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54286"
FT                   /db_xref="GOA:Q750Z2"
FT                   /db_xref="InterPro:IPR006572"
FT                   /db_xref="InterPro:IPR013939"
FT                   /db_xref="InterPro:IPR036420"
FT                   /db_xref="InterPro:IPR038545"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Z2"
FT                   /protein_id="AAS54286.1"
FT   gene            complement(<319130..>319825)
FT                   /locus_tag="AGOS_AGL204C"
FT                   /old_locus_tag="AGL204C"
FT   mRNA            complement(<319130..>319825)
FT                   /locus_tag="AGOS_AGL204C"
FT                   /old_locus_tag="AGL204C"
FT                   /product="AGL204Cp"
FT   CDS_pept        complement(319130..319825)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL204C"
FT                   /old_locus_tag="AGL204C"
FT                   /product="AGL204Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR077C
FT                   (SLM4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL204C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54287"
FT                   /db_xref="GOA:Q750Z1"
FT                   /db_xref="InterPro:IPR020233"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Z1"
FT                   /protein_id="AAS54287.2"
FT                   SEVYGYKLD"
FT   gene            complement(<320013..>320825)
FT                   /locus_tag="AGOS_AGL203C"
FT                   /old_locus_tag="AGL203C"
FT   mRNA            complement(<320013..>320825)
FT                   /locus_tag="AGOS_AGL203C"
FT                   /old_locus_tag="AGL203C"
FT                   /product="AGL203Cp"
FT   CDS_pept        complement(320013..320825)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL203C"
FT                   /old_locus_tag="AGL203C"
FT                   /product="AGL203Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR054C
FT                   (CDC34)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL203C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54288"
FT                   /db_xref="GOA:Q750Z0"
FT                   /db_xref="InterPro:IPR000608"
FT                   /db_xref="InterPro:IPR016135"
FT                   /db_xref="InterPro:IPR023313"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Z0"
FT                   /protein_id="AAS54288.1"
FT   gene            <321438..>322112
FT                   /locus_tag="AGOS_AGL202W"
FT                   /old_locus_tag="AGL202W"
FT   mRNA            <321438..>322112
FT                   /locus_tag="AGOS_AGL202W"
FT                   /old_locus_tag="AGL202W"
FT                   /product="AGL202Wp"
FT   CDS_pept        321438..322112
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL202W"
FT                   /old_locus_tag="AGL202W"
FT                   /product="AGL202Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR070C
FT                   (ALG14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL202W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54289"
FT                   /db_xref="GOA:Q750Y9"
FT                   /db_xref="InterPro:IPR013969"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750Y9"
FT                   /protein_id="AAS54289.1"
FT                   LV"
FT   gene            complement(<322148..>322894)
FT                   /locus_tag="AGOS_AGL201C"
FT                   /old_locus_tag="AGL201C"
FT   mRNA            complement(<322148..>322894)
FT                   /locus_tag="AGOS_AGL201C"
FT                   /old_locus_tag="AGL201C"
FT                   /product="AGL201Cp"
FT   CDS_pept        complement(322148..322894)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL201C"
FT                   /old_locus_tag="AGL201C"
FT                   /product="AGL201Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR050C
FT                   (TPI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL201C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54290"
FT                   /db_xref="GOA:Q750Y8"
FT                   /db_xref="InterPro:IPR000652"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR020861"
FT                   /db_xref="InterPro:IPR022896"
FT                   /db_xref="InterPro:IPR035990"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750Y8"
FT                   /protein_id="AAS54290.2"
FT   gene            <323344..>324654
FT                   /locus_tag="AGOS_AGL200W"
FT                   /old_locus_tag="AGL200W"
FT   mRNA            <323344..>324654
FT                   /locus_tag="AGOS_AGL200W"
FT                   /old_locus_tag="AGL200W"
FT                   /product="AGL200Wp"
FT   CDS_pept        323344..324654
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL200W"
FT                   /old_locus_tag="AGL200W"
FT                   /product="AGL200Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR148C
FT                   (KGD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL200W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54291"
FT                   /db_xref="GOA:Q751B0"
FT                   /db_xref="InterPro:IPR000089"
FT                   /db_xref="InterPro:IPR001078"
FT                   /db_xref="InterPro:IPR003016"
FT                   /db_xref="InterPro:IPR006255"
FT                   /db_xref="InterPro:IPR011053"
FT                   /db_xref="InterPro:IPR023213"
FT                   /db_xref="UniProtKB/TrEMBL:Q751B0"
FT                   /protein_id="AAS54291.1"
FT   gene            complement(<324892..>326571)
FT                   /locus_tag="AGOS_AGL199C"
FT                   /old_locus_tag="AGL199C"
FT   mRNA            complement(<324892..>326571)
FT                   /locus_tag="AGOS_AGL199C"
FT                   /old_locus_tag="AGL199C"
FT                   /product="AGL199Cp"
FT   CDS_pept        complement(324892..326571)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL199C"
FT                   /old_locus_tag="AGL199C"
FT                   /product="AGL199Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR133W
FT                   (CKI1) and YDR147W (EKI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL199C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54292"
FT                   /db_xref="GOA:Q751A9"
FT                   /db_xref="InterPro:IPR007521"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q751A9"
FT                   /protein_id="AAS54292.1"
FT   gene            <326760..>327572
FT                   /locus_tag="AGOS_AGL198W"
FT                   /old_locus_tag="AGL198W"
FT   mRNA            <326760..>327572
FT                   /locus_tag="AGOS_AGL198W"
FT                   /old_locus_tag="AGL198W"
FT                   /product="AGL198Wp"
FT   CDS_pept        326760..327572
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL198W"
FT                   /old_locus_tag="AGL198W"
FT                   /product="AGL198Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR132C
FT                   (USB1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL198W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54293"
FT                   /db_xref="GOA:Q750Y7"
FT                   /db_xref="InterPro:IPR027521"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Y7"
FT                   /protein_id="AAS54293.1"
FT   gene            <327981..>330515
FT                   /locus_tag="AGOS_AGL197W"
FT                   /old_locus_tag="AGL197W"
FT   mRNA            <327981..>330515
FT                   /locus_tag="AGOS_AGL197W"
FT                   /old_locus_tag="AGL197W"
FT                   /product="AGL197Wp"
FT   CDS_pept        327981..330515
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL197W"
FT                   /old_locus_tag="AGL197W"
FT                   /product="AGL197Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR146C
FT                   (SWI5) and YLR131C (ACE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL197W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54294"
FT                   /db_xref="GOA:Q750Y6"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Y6"
FT                   /protein_id="AAS54294.1"
FT   gene            complement(<331101..>333908)
FT                   /locus_tag="AGOS_AGL196C"
FT                   /old_locus_tag="AGL196C"
FT   mRNA            complement(<331101..>333908)
FT                   /locus_tag="AGOS_AGL196C"
FT                   /old_locus_tag="AGL196C"
FT                   /product="AGL196Cp"
FT   CDS_pept        complement(331101..333908)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL196C"
FT                   /old_locus_tag="AGL196C"
FT                   /product="AGL196Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR129W
FT                   (DIP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL196C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54295"
FT                   /db_xref="GOA:Q750Y5"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR007148"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR024977"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Y5"
FT                   /protein_id="AAS54295.2"
FT                   LFPTF"
FT   gene            complement(<334113..>335777)
FT                   /locus_tag="AGOS_AGL195C"
FT                   /old_locus_tag="AGL195C"
FT   mRNA            complement(<334113..>335777)
FT                   /locus_tag="AGOS_AGL195C"
FT                   /old_locus_tag="AGL195C"
FT                   /product="AGL195Cp"
FT   CDS_pept        complement(334113..335777)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL195C"
FT                   /old_locus_tag="AGL195C"
FT                   /product="AGL195Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR145W
FT                   (TAF12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL195C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54296"
FT                   /db_xref="GOA:Q750Y4"
FT                   /db_xref="InterPro:IPR003228"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="InterPro:IPR037794"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Y4"
FT                   /protein_id="AAS54296.1"
FT   gene            complement(<335917..>336735)
FT                   /locus_tag="AGOS_AGL194C"
FT                   /old_locus_tag="AGL194C"
FT   mRNA            complement(join(<335917..336681,336733..>336735))
FT                   /locus_tag="AGOS_AGL194C"
FT                   /old_locus_tag="AGL194C"
FT                   /product="AGL194Cp"
FT   CDS_pept        complement(join(335917..336681,336733..336735))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL194C"
FT                   /old_locus_tag="AGL194C"
FT                   /product="AGL194Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR128W
FT                   (DCN1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL194C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54297"
FT                   /db_xref="GOA:Q750Y3"
FT                   /db_xref="InterPro:IPR005176"
FT                   /db_xref="InterPro:IPR009060"
FT                   /db_xref="InterPro:IPR014764"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750Y3"
FT                   /protein_id="AAS54297.2"
FT   gene            <337086..>339215
FT                   /locus_tag="AGOS_AGL193W"
FT                   /old_locus_tag="AGL193W"
FT   mRNA            <337086..>339215
FT                   /locus_tag="AGOS_AGL193W"
FT                   /old_locus_tag="AGL193W"
FT                   /product="AGL193Wp"
FT   CDS_pept        337086..339215
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL193W"
FT                   /old_locus_tag="AGL193W"
FT                   /product="AGL193Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR127C
FT                   (APC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL193W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54298"
FT                   /db_xref="GOA:Q750Y2"
FT                   /db_xref="InterPro:IPR016158"
FT                   /db_xref="InterPro:IPR036317"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Y2"
FT                   /protein_id="AAS54298.1"
FT                   ASVPAFHPVSSAYAT"
FT   gene            <339708..>341207
FT                   /locus_tag="AGOS_AGL192W"
FT                   /old_locus_tag="AGL192W"
FT   mRNA            <339708..>341207
FT                   /locus_tag="AGOS_AGL192W"
FT                   /old_locus_tag="AGL192W"
FT                   /product="AGL192Wp"
FT   CDS_pept        339708..341207
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL192W"
FT                   /old_locus_tag="AGL192W"
FT                   /product="AGL192Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR121C
FT                   (YPS3), YDR144C (MKC7) and YLR120C (YPS1); Tandem gene
FT                   duplication in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL192W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54299"
FT                   /db_xref="GOA:Q750Y1"
FT                   /db_xref="InterPro:IPR001461"
FT                   /db_xref="InterPro:IPR001969"
FT                   /db_xref="InterPro:IPR021109"
FT                   /db_xref="InterPro:IPR033121"
FT                   /db_xref="InterPro:IPR033876"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Y1"
FT                   /protein_id="AAS54299.2"
FT   gene            <341558..>343306
FT                   /locus_tag="AGOS_AGL191W"
FT                   /old_locus_tag="AGL191W"
FT   mRNA            <341558..>343306
FT                   /locus_tag="AGOS_AGL191W"
FT                   /old_locus_tag="AGL191W"
FT                   /product="AGL191Wp"
FT   CDS_pept        341558..343306
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL191W"
FT                   /old_locus_tag="AGL191W"
FT                   /product="AGL191Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR143C
FT                   (SAN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL191W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54300"
FT                   /db_xref="GOA:Q750Y0"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Y0"
FT                   /protein_id="AAS54300.2"
FT                   PTQETE"
FT   gene            <343645..>344757
FT                   /locus_tag="AGOS_AGL190W"
FT                   /old_locus_tag="AGL190W"
FT   mRNA            <343645..>344757
FT                   /locus_tag="AGOS_AGL190W"
FT                   /old_locus_tag="AGL190W"
FT                   /product="AGL190Wp"
FT   CDS_pept        343645..344757
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL190W"
FT                   /old_locus_tag="AGL190W"
FT                   /product="AGL190Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR142C
FT                   (PEX7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL190W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54301"
FT                   /db_xref="GOA:Q750X9"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q750X9"
FT                   /protein_id="AAS54301.1"
FT   gene            complement(<344798..>345337)
FT                   /locus_tag="AGOS_AGL189C"
FT                   /old_locus_tag="AGL189C"
FT   mRNA            complement(<344798..>345337)
FT                   /locus_tag="AGOS_AGL189C"
FT                   /old_locus_tag="AGL189C"
FT                   /product="AGL189Cp"
FT   CDS_pept        complement(344798..345337)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL189C"
FT                   /old_locus_tag="AGL189C"
FT                   /product="AGL189Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR119W
FT                   (SRN2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL189C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54302"
FT                   /db_xref="GOA:Q750X8"
FT                   /db_xref="InterPro:IPR009851"
FT                   /db_xref="InterPro:IPR017435"
FT                   /db_xref="InterPro:IPR029012"
FT                   /db_xref="InterPro:IPR037202"
FT                   /db_xref="InterPro:IPR037859"
FT                   /db_xref="UniProtKB/TrEMBL:Q750X8"
FT                   /protein_id="AAS54302.1"
FT                   RREKLETWEVQGALRR"
FT   gene            <345838..>346545
FT                   /locus_tag="AGOS_AGL188W"
FT                   /old_locus_tag="AGL188W"
FT   mRNA            <345838..>346545
FT                   /locus_tag="AGOS_AGL188W"
FT                   /old_locus_tag="AGL188W"
FT                   /product="AGL188Wp"
FT   CDS_pept        345838..346545
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL188W"
FT                   /old_locus_tag="AGL188W"
FT                   /product="AGL188Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR118C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL188W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54303"
FT                   /db_xref="GOA:Q750X7"
FT                   /db_xref="InterPro:IPR003140"
FT                   /db_xref="InterPro:IPR029058"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750X7"
FT                   /protein_id="AAS54303.1"
FT                   NLDAEKPAPRPAL"
FT   gene            <346809..>351827
FT                   /locus_tag="AGOS_AGL187W"
FT                   /old_locus_tag="AGL187W"
FT   mRNA            <346809..>351827
FT                   /locus_tag="AGOS_AGL187W"
FT                   /old_locus_tag="AGL187W"
FT                   /product="AGL187Wp"
FT   CDS_pept        346809..351827
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL187W"
FT                   /old_locus_tag="AGL187W"
FT                   /product="AGL187Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR141C
FT                   (DOP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL187W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54304"
FT                   /db_xref="GOA:Q750X6"
FT                   /db_xref="InterPro:IPR007249"
FT                   /db_xref="InterPro:IPR040314"
FT                   /db_xref="UniProtKB/TrEMBL:Q750X6"
FT                   /protein_id="AAS54304.2"
FT   gene            complement(<351824..>352483)
FT                   /locus_tag="AGOS_AGL186C"
FT                   /old_locus_tag="AGL186C"
FT   mRNA            complement(<351824..>352483)
FT                   /locus_tag="AGOS_AGL186C"
FT                   /old_locus_tag="AGL186C"
FT                   /product="AGL186Cp"
FT   CDS_pept        complement(351824..352483)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL186C"
FT                   /old_locus_tag="AGL186C"
FT                   /product="AGL186Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR140W
FT                   (MTQ2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL186C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54305"
FT                   /db_xref="GOA:Q750X5"
FT                   /db_xref="InterPro:IPR002052"
FT                   /db_xref="InterPro:IPR004557"
FT                   /db_xref="InterPro:IPR007848"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q750X5"
FT                   /protein_id="AAS54305.1"
FT   gene            <352585..>352863
FT                   /locus_tag="AGOS_AGL185W"
FT                   /old_locus_tag="AGL185W"
FT   mRNA            join(<352585..352733,352782..>352863)
FT                   /locus_tag="AGOS_AGL185W"
FT                   /old_locus_tag="AGL185W"
FT                   /product="AGL185Wp"
FT   CDS_pept        join(352585..352733,352782..352863)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL185W"
FT                   /old_locus_tag="AGL185W"
FT                   /product="AGL185Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR139C
FT                   (RUB1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL185W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54306"
FT                   /db_xref="GOA:Q750X4"
FT                   /db_xref="InterPro:IPR000626"
FT                   /db_xref="InterPro:IPR019954"
FT                   /db_xref="InterPro:IPR019956"
FT                   /db_xref="InterPro:IPR029071"
FT                   /db_xref="InterPro:IPR038738"
FT                   /db_xref="UniProtKB/TrEMBL:Q750X4"
FT                   /protein_id="AAS54306.2"
FT   gene            <353065..>355116
FT                   /locus_tag="AGOS_AGL184W"
FT                   /old_locus_tag="AGL184W"
FT   mRNA            <353065..>355116
FT                   /locus_tag="AGOS_AGL184W"
FT                   /old_locus_tag="AGL184W"
FT                   /product="AGL184Wp"
FT   CDS_pept        353065..355116
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL184W"
FT                   /old_locus_tag="AGL184W"
FT                   /product="AGL184Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR117C
FT                   (CLF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL184W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54307"
FT                   /db_xref="GOA:Q750X3"
FT                   /db_xref="InterPro:IPR003107"
FT                   /db_xref="InterPro:IPR008847"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR013026"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750X3"
FT                   /protein_id="AAS54307.1"
FT   gene            complement(<355256..>356779)
FT                   /locus_tag="AGOS_AGL183C"
FT                   /old_locus_tag="AGL183C"
FT   mRNA            complement(<355256..>356779)
FT                   /locus_tag="AGOS_AGL183C"
FT                   /old_locus_tag="AGL183C"
FT                   /product="AGL183Cp"
FT   CDS_pept        complement(355256..356779)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL183C"
FT                   /old_locus_tag="AGL183C"
FT                   /product="AGL183Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR116W
FT                   (MSL5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL183C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54308"
FT                   /db_xref="GOA:Q750X2"
FT                   /db_xref="InterPro:IPR001878"
FT                   /db_xref="InterPro:IPR004087"
FT                   /db_xref="InterPro:IPR004088"
FT                   /db_xref="InterPro:IPR031150"
FT                   /db_xref="InterPro:IPR032570"
FT                   /db_xref="InterPro:IPR036612"
FT                   /db_xref="InterPro:IPR036875"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750X2"
FT                   /protein_id="AAS54308.2"
FT   gene            complement(<356900..>359311)
FT                   /locus_tag="AGOS_AGL182C"
FT                   /old_locus_tag="AGL182C"
FT   mRNA            complement(<356900..>359311)
FT                   /locus_tag="AGOS_AGL182C"
FT                   /old_locus_tag="AGL182C"
FT                   /product="AGL182Cp"
FT   CDS_pept        complement(356900..359311)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL182C"
FT                   /old_locus_tag="AGL182C"
FT                   /product="AGL182Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR115W
FT                   (CFT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL182C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54309"
FT                   /db_xref="GOA:Q750X1"
FT                   /db_xref="InterPro:IPR001279"
FT                   /db_xref="InterPro:IPR022712"
FT                   /db_xref="InterPro:IPR025069"
FT                   /db_xref="InterPro:IPR027075"
FT                   /db_xref="InterPro:IPR035639"
FT                   /db_xref="InterPro:IPR036866"
FT                   /db_xref="UniProtKB/TrEMBL:Q750X1"
FT                   /protein_id="AAS54309.2"
FT   gene            complement(<359604..>361739)
FT                   /locus_tag="AGOS_AGL181C"
FT                   /old_locus_tag="AGL181C"
FT   mRNA            complement(<359604..>361739)
FT                   /locus_tag="AGOS_AGL181C"
FT                   /old_locus_tag="AGL181C"
FT                   /product="AGL181Cp"
FT   CDS_pept        complement(359604..361739)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL181C"
FT                   /old_locus_tag="AGL181C"
FT                   /product="AGL181Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR138W
FT                   (HPR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL181C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54310"
FT                   /db_xref="InterPro:IPR021861"
FT                   /db_xref="UniProtKB/TrEMBL:Q750X0"
FT                   /protein_id="AAS54310.1"
FT                   KEQESDDDDDDEAVPEC"
FT   gene            <361953..>363788
FT                   /locus_tag="AGOS_AGL180W"
FT                   /old_locus_tag="AGL180W"
FT   mRNA            <361953..>363788
FT                   /locus_tag="AGOS_AGL180W"
FT                   /old_locus_tag="AGL180W"
FT                   /product="AGL180Wp"
FT   CDS_pept        361953..363788
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL180W"
FT                   /old_locus_tag="AGL180W"
FT                   /product="AGL180Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR114C
FT                   (AVL9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL180W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54311"
FT                   /db_xref="GOA:Q750W9"
FT                   /db_xref="InterPro:IPR018307"
FT                   /db_xref="InterPro:IPR037516"
FT                   /db_xref="UniProtKB/TrEMBL:Q750W9"
FT                   /protein_id="AAS54311.1"
FT   gene            complement(<363901..>365745)
FT                   /locus_tag="AGOS_AGL179C"
FT                   /old_locus_tag="AGL179C"
FT   mRNA            complement(<363901..>365745)
FT                   /locus_tag="AGOS_AGL179C"
FT                   /old_locus_tag="AGL179C"
FT                   /product="AGL179Cp"
FT   CDS_pept        complement(363901..365745)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL179C"
FT                   /old_locus_tag="AGL179C"
FT                   /product="AGL179Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR137W
FT                   (RGP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL179C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54312"
FT                   /db_xref="GOA:Q750W8"
FT                   /db_xref="InterPro:IPR014848"
FT                   /db_xref="UniProtKB/TrEMBL:Q750W8"
FT                   /protein_id="AAS54312.1"
FT   gene            complement(365790..365879)
FT                   /locus_tag="AGOS_t0176"
FT   tRNA            complement(join(365790..365825,365843..365879))
FT                   /locus_tag="AGOS_t0176"
FT                   /product="tRNA-Arg"
FT                   /note="codon recognized: CGU"
FT   gene            <366137..>368077
FT                   /locus_tag="AGOS_AGL178W"
FT                   /old_locus_tag="AGL178W"
FT   mRNA            <366137..>368077
FT                   /locus_tag="AGOS_AGL178W"
FT                   /old_locus_tag="AGL178W"
FT                   /product="AGL178Wp"
FT   CDS_pept        366137..368077
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL178W"
FT                   /old_locus_tag="AGL178W"
FT                   /product="AGL178Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YGR109W-B, YIL082W-A and YIL080W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL178W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54313"
FT                   /db_xref="InterPro:IPR000477"
FT                   /db_xref="InterPro:IPR005162"
FT                   /db_xref="InterPro:IPR041577"
FT                   /db_xref="UniProtKB/TrEMBL:Q750W7"
FT                   /protein_id="AAS54313.1"
FT                   TLEYYLDQSAS"
FT   gene            complement(<368220..>368708)
FT                   /locus_tag="AGOS_AGL177C"
FT                   /old_locus_tag="AGL177C"
FT   mRNA            complement(<368220..>368708)
FT                   /locus_tag="AGOS_AGL177C"
FT                   /old_locus_tag="AGL177C"
FT                   /product="AGL177Cp"
FT   CDS_pept        complement(368220..368708)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL177C"
FT                   /old_locus_tag="AGL177C"
FT                   /product="AGL177Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR155C
FT                   (CPR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL177C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54314"
FT                   /db_xref="GOA:Q750W6"
FT                   /db_xref="InterPro:IPR002130"
FT                   /db_xref="InterPro:IPR020892"
FT                   /db_xref="InterPro:IPR024936"
FT                   /db_xref="InterPro:IPR029000"
FT                   /db_xref="UniProtKB/TrEMBL:Q750W6"
FT                   /protein_id="AAS54314.1"
FT   gene            <369015..>369479
FT                   /locus_tag="AGOS_AGL176W"
FT                   /old_locus_tag="AGL176W"
FT   mRNA            <369015..>369479
FT                   /locus_tag="AGOS_AGL176W"
FT                   /old_locus_tag="AGL176W"
FT                   /product="AGL176Wp"
FT   CDS_pept        369015..369479
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL176W"
FT                   /old_locus_tag="AGL176W"
FT                   /product="AGL176Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR156W
FT                   (RPA14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL176W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54315"
FT                   /db_xref="InterPro:IPR013239"
FT                   /db_xref="UniProtKB/TrEMBL:Q750W5"
FT                   /protein_id="AAS54315.1"
FT   gene            <369511..>370725
FT                   /locus_tag="AGOS_AGL175W"
FT                   /old_locus_tag="AGL175W"
FT   mRNA            <369511..>370725
FT                   /locus_tag="AGOS_AGL175W"
FT                   /old_locus_tag="AGL175W"
FT                   /product="AGL175Wp"
FT   CDS_pept        369511..370725
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL175W"
FT                   /old_locus_tag="AGL175W"
FT                   /product="AGL175Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR158W
FT                   (HOM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL175W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54316"
FT                   /db_xref="GOA:Q750W4"
FT                   /db_xref="InterPro:IPR000319"
FT                   /db_xref="InterPro:IPR000534"
FT                   /db_xref="InterPro:IPR005676"
FT                   /db_xref="InterPro:IPR012280"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q750W4"
FT                   /protein_id="AAS54316.1"
FT                   AQQMI"
FT   gene            <370788..>371741
FT                   /locus_tag="AGOS_AGL174W"
FT                   /old_locus_tag="AGL174W"
FT   mRNA            <370788..>371741
FT                   /locus_tag="AGOS_AGL174W"
FT                   /old_locus_tag="AGL174W"
FT                   /product="AGL174Wp"
FT   CDS_pept        370788..371741
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL174W"
FT                   /old_locus_tag="AGL174W"
FT                   /product="AGL174Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR137W
FT                   (RKM5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL174W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54317"
FT                   /db_xref="GOA:Q750W3"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750W3"
FT                   /protein_id="AAS54317.1"
FT   gene            <371888..>376012
FT                   /locus_tag="AGOS_AGL173W"
FT                   /old_locus_tag="AGL173W"
FT   mRNA            <371888..>376012
FT                   /locus_tag="AGOS_AGL173W"
FT                   /old_locus_tag="AGL173W"
FT                   /product="AGL173Wp"
FT   CDS_pept        371888..376012
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL173W"
FT                   /old_locus_tag="AGL173W"
FT                   /product="AGL173Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR159W
FT                   (SAC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL173W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54318"
FT                   /db_xref="GOA:Q750W2"
FT                   /db_xref="InterPro:IPR000717"
FT                   /db_xref="InterPro:IPR005062"
FT                   /db_xref="InterPro:IPR017173"
FT                   /db_xref="InterPro:IPR024293"
FT                   /db_xref="UniProtKB/TrEMBL:Q750W2"
FT                   /protein_id="AAS54318.1"
FT   gene            <376329..>379180
FT                   /locus_tag="AGOS_AGL172W"
FT                   /old_locus_tag="AGL172W"
FT   mRNA            join(<376329..376352,376508..>379180)
FT                   /locus_tag="AGOS_AGL172W"
FT                   /old_locus_tag="AGL172W"
FT                   /product="AGL172Wp"
FT   CDS_pept        join(376329..376352,376508..379180)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL172W"
FT                   /old_locus_tag="AGL172W"
FT                   /product="AGL172Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR138W
FT                   (NHA1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL172W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54319"
FT                   /db_xref="GOA:Q750W1"
FT                   /db_xref="InterPro:IPR004712"
FT                   /db_xref="InterPro:IPR006153"
FT                   /db_xref="InterPro:IPR013928"
FT                   /db_xref="UniProtKB/TrEMBL:Q750W1"
FT                   /protein_id="AAS54319.2"
FT   gene            <379516..>382071
FT                   /locus_tag="AGOS_AGL171W"
FT                   /old_locus_tag="AGL171W"
FT   mRNA            <379516..>382071
FT                   /locus_tag="AGOS_AGL171W"
FT                   /old_locus_tag="AGL171W"
FT                   /product="AGL171Wp"
FT   CDS_pept        379516..382071
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL171W"
FT                   /old_locus_tag="AGL171W"
FT                   /product="AGL171Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR160W
FT                   (SSY1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL171W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54320"
FT                   /db_xref="GOA:Q750W0"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="UniProtKB/TrEMBL:Q750W0"
FT                   /protein_id="AAS54320.2"
FT   gene            <382228..>383364
FT                   /locus_tag="AGOS_AGL170W"
FT                   /old_locus_tag="AGL170W"
FT   mRNA            <382228..>383364
FT                   /locus_tag="AGOS_AGL170W"
FT                   /old_locus_tag="AGL170W"
FT                   /product="AGL170Wp"
FT   CDS_pept        382228..383364
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL170W"
FT                   /old_locus_tag="AGL170W"
FT                   /product="AGL170Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR161W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL170W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54321"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR019734"
FT                   /db_xref="UniProtKB/TrEMBL:Q750V9"
FT                   /protein_id="AAS54321.1"
FT   gene            complement(<383587..>384345)
FT                   /locus_tag="AGOS_AGL169C"
FT                   /old_locus_tag="AGL169C"
FT   mRNA            complement(<383587..>384345)
FT                   /locus_tag="AGOS_AGL169C"
FT                   /old_locus_tag="AGL169C"
FT                   /product="AGL169Cp"
FT   CDS_pept        complement(383587..384345)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL169C"
FT                   /old_locus_tag="AGL169C"
FT                   /product="AGL169Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR162C
FT                   (NBP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL169C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54322"
FT                   /db_xref="GOA:Q750V8"
FT                   /db_xref="InterPro:IPR001452"
FT                   /db_xref="InterPro:IPR036028"
FT                   /db_xref="UniProtKB/TrEMBL:Q750V8"
FT                   /protein_id="AAS54322.2"
FT   gene            <384563..>385117
FT                   /locus_tag="AGOS_AGL168W"
FT                   /old_locus_tag="AGL168W"
FT   mRNA            <384563..>385117
FT                   /locus_tag="AGOS_AGL168W"
FT                   /old_locus_tag="AGL168W"
FT                   /product="AGL168Wp"
FT   CDS_pept        384563..385117
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL168W"
FT                   /old_locus_tag="AGL168W"
FT                   /product="AGL168Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR163W
FT                   (CWC15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL168W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54323"
FT                   /db_xref="GOA:Q750V7"
FT                   /db_xref="InterPro:IPR006973"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750V7"
FT                   /protein_id="AAS54323.1"
FT   gene            complement(<385140..>387323)
FT                   /locus_tag="AGOS_AGL167C"
FT                   /old_locus_tag="AGL167C"
FT   mRNA            complement(<385140..>387323)
FT                   /locus_tag="AGOS_AGL167C"
FT                   /old_locus_tag="AGL167C"
FT                   /product="AGL167Cp"
FT   CDS_pept        complement(385140..387323)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL167C"
FT                   /old_locus_tag="AGL167C"
FT                   /product="AGL167Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR139C
FT                   (SLS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL167C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54324"
FT                   /db_xref="GOA:Q750V6"
FT                   /db_xref="InterPro:IPR032741"
FT                   /db_xref="UniProtKB/TrEMBL:Q750V6"
FT                   /protein_id="AAS54324.2"
FT   gene            <387605..>389128
FT                   /locus_tag="AGOS_AGL166W"
FT                   /old_locus_tag="AGL166W"
FT   mRNA            <387605..>389128
FT                   /locus_tag="AGOS_AGL166W"
FT                   /old_locus_tag="AGL166W"
FT                   /product="AGL166Wp"
FT   CDS_pept        387605..389128
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL166W"
FT                   /old_locus_tag="AGL166W"
FT                   /product="AGL166Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR141W
FT                   (RRN5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL166W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54325"
FT                   /db_xref="GOA:Q750V5"
FT                   /db_xref="InterPro:IPR039601"
FT                   /db_xref="UniProtKB/TrEMBL:Q750V5"
FT                   /protein_id="AAS54325.2"
FT   gene            <389418..>390809
FT                   /locus_tag="AGOS_AGL165W"
FT                   /old_locus_tag="AGL165W"
FT   mRNA            <389418..>390809
FT                   /locus_tag="AGOS_AGL165W"
FT                   /old_locus_tag="AGL165W"
FT                   /product="AGL165Wp"
FT   CDS_pept        389418..390809
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL165W"
FT                   /old_locus_tag="AGL165W"
FT                   /product="AGL165Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR142W
FT                   (PUT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL165W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54326"
FT                   /db_xref="GOA:Q750V4"
FT                   /db_xref="InterPro:IPR002872"
FT                   /db_xref="InterPro:IPR015659"
FT                   /db_xref="InterPro:IPR029041"
FT                   /db_xref="UniProtKB/TrEMBL:Q750V4"
FT                   /protein_id="AAS54326.1"
FT                   ALFYR"
FT   gene            <391101..>393161
FT                   /locus_tag="AGOS_AGL164W"
FT                   /old_locus_tag="AGL164W"
FT   mRNA            <391101..>393161
FT                   /locus_tag="AGOS_AGL164W"
FT                   /old_locus_tag="AGL164W"
FT                   /product="AGL164Wp"
FT   CDS_pept        391101..393161
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL164W"
FT                   /old_locus_tag="AGL164W"
FT                   /product="AGL164Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR143W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL164W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54327"
FT                   /db_xref="GOA:Q750V3"
FT                   /db_xref="InterPro:IPR002761"
FT                   /db_xref="InterPro:IPR006175"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR030662"
FT                   /db_xref="InterPro:IPR035959"
FT                   /db_xref="UniProtKB/TrEMBL:Q750V3"
FT                   /protein_id="AAS54327.1"
FT   gene            <393324..>394532
FT                   /locus_tag="AGOS_AGL163W"
FT                   /old_locus_tag="AGL163W"
FT   mRNA            <393324..>394532
FT                   /locus_tag="AGOS_AGL163W"
FT                   /old_locus_tag="AGL163W"
FT                   /product="AGL163Wp"
FT   CDS_pept        393324..394532
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL163W"
FT                   /old_locus_tag="AGL163W"
FT                   /product="AGL163Wp"
FT                   /note="NOHBY710; No homolog in Saccharomyces cerevisiae:
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0D17006g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL163W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54328"
FT                   /db_xref="UniProtKB/TrEMBL:Q750V2"
FT                   /protein_id="AAS54328.1"
FT                   YNL"
FT   gene            complement(<394607..>396790)
FT                   /locus_tag="AGOS_AGL162C"
FT                   /old_locus_tag="AGL162C"
FT   mRNA            complement(join(<394607..396690,396760..>396790))
FT                   /locus_tag="AGOS_AGL162C"
FT                   /old_locus_tag="AGL162C"
FT                   /product="AGL162Cp"
FT   CDS_pept        complement(join(394607..396690,396760..396790))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL162C"
FT                   /old_locus_tag="AGL162C"
FT                   /product="AGL162Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR164C
FT                   (SEC1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL162C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54329"
FT                   /db_xref="GOA:Q750V1"
FT                   /db_xref="InterPro:IPR001619"
FT                   /db_xref="InterPro:IPR027482"
FT                   /db_xref="InterPro:IPR036045"
FT                   /db_xref="UniProtKB/TrEMBL:Q750V1"
FT                   /protein_id="AAS54329.1"
FT                   RHKFTKFLRK"
FT   gene            complement(<397145..>399457)
FT                   /locus_tag="AGOS_AGL161C"
FT                   /old_locus_tag="AGL161C"
FT   mRNA            complement(<397145..>399457)
FT                   /locus_tag="AGOS_AGL161C"
FT                   /old_locus_tag="AGL161C"
FT                   /product="AGL161Cp"
FT   CDS_pept        complement(397145..399457)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL161C"
FT                   /old_locus_tag="AGL161C"
FT                   /product="AGL161Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR144C
FT                   (ACF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL161C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54330"
FT                   /db_xref="GOA:Q750V0"
FT                   /db_xref="InterPro:IPR005200"
FT                   /db_xref="InterPro:IPR040451"
FT                   /db_xref="InterPro:IPR040720"
FT                   /db_xref="UniProtKB/TrEMBL:Q750V0"
FT                   /protein_id="AAS54330.1"
FT                   DNGQSRTWSLAYSGAFL"
FT   gene            <399817..>400392
FT                   /locus_tag="AGOS_AGL160W"
FT                   /old_locus_tag="AGL160W"
FT   mRNA            <399817..>400392
FT                   /locus_tag="AGOS_AGL160W"
FT                   /old_locus_tag="AGL160W"
FT                   /product="AGL160Wp"
FT   CDS_pept        399817..400392
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL160W"
FT                   /old_locus_tag="AGL160W"
FT                   /product="AGL160Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR145W
FT                   (RMP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL160W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54331"
FT                   /db_xref="GOA:Q750U9"
FT                   /db_xref="UniProtKB/TrEMBL:Q750U9"
FT                   /protein_id="AAS54331.1"
FT   gene            <400726..>402078
FT                   /locus_tag="AGOS_AGL159W"
FT                   /old_locus_tag="AGL159W"
FT   mRNA            <400726..>402078
FT                   /locus_tag="AGOS_AGL159W"
FT                   /old_locus_tag="AGL159W"
FT                   /product="AGL159Wp"
FT   CDS_pept        400726..402078
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL159W"
FT                   /old_locus_tag="AGL159W"
FT                   /product="AGL159Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR165W
FT                   (TRM82)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL159W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54332"
FT                   /db_xref="GOA:Q750U8"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR028884"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750U8"
FT                   /protein_id="AAS54332.1"
FT   gene            <402276..>402605
FT                   /locus_tag="AGOS_AGL159WA"
FT   mRNA            <402276..>402605
FT                   /locus_tag="AGOS_AGL159WA"
FT                   /product="AGL159W-Ap"
FT   CDS_pept        402276..402605
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL159WA"
FT                   /product="AGL159W-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR146WA"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL159WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41735"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGH0"
FT                   /protein_id="ADJ41735.1"
FT                   NDSSF"
FT   gene            complement(<402847..>405426)
FT                   /locus_tag="AGOS_AGL158C"
FT                   /old_locus_tag="AGL158C"
FT   mRNA            complement(<402847..>405426)
FT                   /locus_tag="AGOS_AGL158C"
FT                   /old_locus_tag="AGL158C"
FT                   /product="AGL158Cp"
FT   CDS_pept        complement(402847..405426)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL158C"
FT                   /old_locus_tag="AGL158C"
FT                   /product="AGL158Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR166C
FT                   (SEC5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL158C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54333"
FT                   /db_xref="GOA:Q750U7"
FT                   /db_xref="InterPro:IPR029175"
FT                   /db_xref="InterPro:IPR039481"
FT                   /db_xref="UniProtKB/TrEMBL:Q750U7"
FT                   /protein_id="AAS54333.1"
FT   gene            complement(<405605..>405913)
FT                   /locus_tag="AGOS_AGL157C"
FT                   /old_locus_tag="AGL157C"
FT   mRNA            complement(<405605..>405913)
FT                   /locus_tag="AGOS_AGL157C"
FT                   /old_locus_tag="AGL157C"
FT                   /product="AGL157Cp"
FT   CDS_pept        complement(405605..405913)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL157C"
FT                   /old_locus_tag="AGL157C"
FT                   /product="AGL157Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR147C
FT                   (SMD3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL157C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54334"
FT                   /db_xref="GOA:Q750U6"
FT                   /db_xref="InterPro:IPR001163"
FT                   /db_xref="InterPro:IPR010920"
FT                   /db_xref="InterPro:IPR027141"
FT                   /db_xref="InterPro:IPR034099"
FT                   /db_xref="UniProtKB/TrEMBL:Q750U6"
FT                   /protein_id="AAS54334.1"
FT   gene            <406087..>408819
FT                   /locus_tag="AGOS_AGL156W"
FT                   /old_locus_tag="AGL156W"
FT   mRNA            <406087..>408819
FT                   /locus_tag="AGOS_AGL156W"
FT                   /old_locus_tag="AGL156W"
FT                   /product="AGL156Wp"
FT   CDS_pept        406087..408819
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL156W"
FT                   /old_locus_tag="AGL156W"
FT                   /product="AGL156Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR148W
FT                   (PEP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL156W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54335"
FT                   /db_xref="GOA:Q750U5"
FT                   /db_xref="InterPro:IPR000547"
FT                   /db_xref="InterPro:IPR007810"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q750U5"
FT                   /protein_id="AAS54335.1"
FT   gene            <408950..>409546
FT                   /locus_tag="AGOS_AGL155W"
FT                   /old_locus_tag="AGL155W"
FT   mRNA            <408950..>409546
FT                   /locus_tag="AGOS_AGL155W"
FT                   /old_locus_tag="AGL155W"
FT                   /product="AGL155Wp"
FT   CDS_pept        408950..409546
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL155W"
FT                   /old_locus_tag="AGL155W"
FT                   /product="AGL155Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR167W
FT                   (TAF10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL155W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54336"
FT                   /db_xref="GOA:Q750U4"
FT                   /db_xref="InterPro:IPR003923"
FT                   /db_xref="UniProtKB/TrEMBL:Q750U4"
FT                   /protein_id="AAS54336.1"
FT   gene            <409718..>411202
FT                   /locus_tag="AGOS_AGL154W"
FT                   /old_locus_tag="AGL154W"
FT   mRNA            <409718..>411202
FT                   /locus_tag="AGOS_AGL154W"
FT                   /old_locus_tag="AGL154W"
FT                   /product="AGL154Wp"
FT   CDS_pept        409718..411202
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL154W"
FT                   /old_locus_tag="AGL154W"
FT                   /product="AGL154Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR168W
FT                   (CDC37)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL154W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54337"
FT                   /db_xref="GOA:Q750U3"
FT                   /db_xref="InterPro:IPR004918"
FT                   /db_xref="InterPro:IPR013855"
FT                   /db_xref="InterPro:IPR013873"
FT                   /db_xref="InterPro:IPR013874"
FT                   /db_xref="InterPro:IPR038189"
FT                   /db_xref="UniProtKB/TrEMBL:Q750U3"
FT                   /protein_id="AAS54337.1"
FT   gene            complement(<411436..>413610)
FT                   /locus_tag="AGOS_AGL153C"
FT                   /old_locus_tag="AGL153C"
FT   mRNA            complement(<411436..>413610)
FT                   /locus_tag="AGOS_AGL153C"
FT                   /old_locus_tag="AGL153C"
FT                   /product="AGL153Cp"
FT   CDS_pept        complement(411436..413610)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL153C"
FT                   /old_locus_tag="AGL153C"
FT                   /product="AGL153Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR149C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL153C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54338"
FT                   /db_xref="InterPro:IPR011044"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR019417"
FT                   /db_xref="UniProtKB/TrEMBL:Q750U2"
FT                   /protein_id="AAS54338.1"
FT   gene            complement(<413931..>415466)
FT                   /locus_tag="AGOS_AGL152C"
FT                   /old_locus_tag="AGL152C"
FT   mRNA            complement(<413931..>415466)
FT                   /locus_tag="AGOS_AGL152C"
FT                   /old_locus_tag="AGL152C"
FT                   /product="AGL152Cp"
FT   CDS_pept        complement(413931..415466)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL152C"
FT                   /old_locus_tag="AGL152C"
FT                   /product="AGL152Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR169C
FT                   (STB3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL152C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54339"
FT                   /db_xref="GOA:Q750U1"
FT                   /db_xref="InterPro:IPR018818"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750U1"
FT                   /protein_id="AAS54339.1"
FT   gene            <415822..>416668
FT                   /locus_tag="AGOS_AGL151W"
FT                   /old_locus_tag="AGL151W"
FT   mRNA            join(<415822..415827,415913..>416668)
FT                   /locus_tag="AGOS_AGL151W"
FT                   /old_locus_tag="AGL151W"
FT                   /product="AGL151Wp"
FT   CDS_pept        join(415822..415827,415913..416668)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL151W"
FT                   /old_locus_tag="AGL151W"
FT                   /product="AGL151Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR150W
FT                   (STM1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL151W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54340"
FT                   /db_xref="GOA:Q750U0"
FT                   /db_xref="InterPro:IPR006861"
FT                   /db_xref="InterPro:IPR019084"
FT                   /db_xref="InterPro:IPR039764"
FT                   /db_xref="UniProtKB/TrEMBL:Q750U0"
FT                   /protein_id="AAS54340.1"
FT   gene            complement(<416858..>417841)
FT                   /locus_tag="AGOS_AGL150C"
FT                   /old_locus_tag="AGL150C"
FT   mRNA            complement(<416858..>417841)
FT                   /locus_tag="AGOS_AGL150C"
FT                   /old_locus_tag="AGL150C"
FT                   /product="AGL150Cp"
FT   CDS_pept        complement(416858..417841)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL150C"
FT                   /old_locus_tag="AGL150C"
FT                   /product="AGL150Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR151C
FT                   (PCD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL150C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54341"
FT                   /db_xref="GOA:Q750T9"
FT                   /db_xref="InterPro:IPR000086"
FT                   /db_xref="InterPro:IPR015797"
FT                   /db_xref="UniProtKB/TrEMBL:Q750T9"
FT                   /protein_id="AAS54341.1"
FT   gene            complement(<418069..>419997)
FT                   /locus_tag="AGOS_AGL149C"
FT                   /old_locus_tag="AGL149C"
FT   mRNA            complement(<418069..>419997)
FT                   /locus_tag="AGOS_AGL149C"
FT                   /old_locus_tag="AGL149C"
FT                   /product="AGL149Cp"
FT   CDS_pept        complement(418069..419997)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL149C"
FT                   /old_locus_tag="AGL149C"
FT                   /product="AGL149Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR152C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL149C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54342"
FT                   /db_xref="GOA:Q750T8"
FT                   /db_xref="InterPro:IPR004776"
FT                   /db_xref="InterPro:IPR040254"
FT                   /db_xref="UniProtKB/TrEMBL:Q750T8"
FT                   /protein_id="AAS54342.1"
FT                   TIKFQLN"
FT   gene            complement(<420365..>422428)
FT                   /locus_tag="AGOS_AGL148C"
FT                   /old_locus_tag="AGL148C"
FT   mRNA            complement(<420365..>422428)
FT                   /locus_tag="AGOS_AGL148C"
FT                   /old_locus_tag="AGL148C"
FT                   /product="AGL148Cp"
FT   CDS_pept        complement(420365..422428)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL148C"
FT                   /old_locus_tag="AGL148C"
FT                   /product="AGL148Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR153C
FT                   (ACS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL148C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54343"
FT                   /db_xref="GOA:Q750T7"
FT                   /db_xref="InterPro:IPR000873"
FT                   /db_xref="InterPro:IPR011904"
FT                   /db_xref="InterPro:IPR020845"
FT                   /db_xref="InterPro:IPR025110"
FT                   /db_xref="InterPro:IPR032387"
FT                   /db_xref="InterPro:IPR042099"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750T7"
FT                   /protein_id="AAS54343.1"
FT   gene            complement(<423010..>428700)
FT                   /locus_tag="AGOS_AGL147C"
FT                   /old_locus_tag="AGL147C"
FT   mRNA            complement(<423010..>428700)
FT                   /locus_tag="AGOS_AGL147C"
FT                   /old_locus_tag="AGL147C"
FT                   /product="AGL147Cp"
FT   CDS_pept        complement(423010..428700)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL147C"
FT                   /old_locus_tag="AGL147C"
FT                   /product="AGL147Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR170C
FT                   (SEC7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL147C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54344"
FT                   /db_xref="GOA:Q750T6"
FT                   /db_xref="InterPro:IPR000904"
FT                   /db_xref="InterPro:IPR015403"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR023394"
FT                   /db_xref="InterPro:IPR032629"
FT                   /db_xref="InterPro:IPR032691"
FT                   /db_xref="InterPro:IPR035999"
FT                   /db_xref="UniProtKB/TrEMBL:Q750T6"
FT                   /protein_id="AAS54344.2"
FT   gene            <429133..>430449
FT                   /locus_tag="AGOS_AGL146W"
FT                   /old_locus_tag="AGL146W"
FT   mRNA            <429133..>430449
FT                   /locus_tag="AGOS_AGL146W"
FT                   /old_locus_tag="AGL146W"
FT                   /product="AGL146Wp"
FT   CDS_pept        429133..430449
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL146W"
FT                   /old_locus_tag="AGL146W"
FT                   /product="AGL146Wp"
FT                   /note="NOHBY709; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0D17380g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL146W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54345"
FT                   /db_xref="GOA:Q750T5"
FT                   /db_xref="InterPro:IPR000926"
FT                   /db_xref="InterPro:IPR022163"
FT                   /db_xref="InterPro:IPR032677"
FT                   /db_xref="InterPro:IPR036144"
FT                   /db_xref="UniProtKB/TrEMBL:Q750T5"
FT                   /protein_id="AAS54345.1"
FT   gene            <430809..>432884
FT                   /locus_tag="AGOS_AGL145W"
FT                   /old_locus_tag="AGL145W"
FT   mRNA            <430809..>432884
FT                   /locus_tag="AGOS_AGL145W"
FT                   /old_locus_tag="AGL145W"
FT                   /product="AGL145Wp"
FT   CDS_pept        430809..432884
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL145W"
FT                   /old_locus_tag="AGL145W"
FT                   /product="AGL145Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR172W
FT                   (SUP35)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL145W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54346"
FT                   /db_xref="GOA:Q750T4"
FT                   /db_xref="InterPro:IPR000795"
FT                   /db_xref="InterPro:IPR003285"
FT                   /db_xref="InterPro:IPR004160"
FT                   /db_xref="InterPro:IPR004161"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR009001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR031157"
FT                   /db_xref="UniProtKB/TrEMBL:Q750T4"
FT                   /protein_id="AAS54346.2"
FT   gene            complement(<432968..>433987)
FT                   /locus_tag="AGOS_AGL144C"
FT                   /old_locus_tag="AGL144C"
FT   mRNA            complement(<432968..>433987)
FT                   /locus_tag="AGOS_AGL144C"
FT                   /old_locus_tag="AGL144C"
FT                   /product="AGL144Cp"
FT   CDS_pept        complement(432968..433987)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL144C"
FT                   /old_locus_tag="AGL144C"
FT                   /product="AGL144Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR173C
FT                   (ARG82)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL144C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54347"
FT                   /db_xref="GOA:Q750T3"
FT                   /db_xref="InterPro:IPR005522"
FT                   /db_xref="InterPro:IPR038286"
FT                   /db_xref="UniProtKB/TrEMBL:Q750T3"
FT                   /protein_id="AAS54347.2"
FT   gene            complement(<434218..>435342)
FT                   /locus_tag="AGOS_AGL143C"
FT                   /old_locus_tag="AGL143C"
FT   mRNA            complement(<434218..>435342)
FT                   /locus_tag="AGOS_AGL143C"
FT                   /old_locus_tag="AGL143C"
FT                   /product="AGL143Cp"
FT   CDS_pept        complement(434218..435342)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL143C"
FT                   /old_locus_tag="AGL143C"
FT                   /product="AGL143Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YLR130C (ZRT2) and YGL255W (ZRT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL143C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54348"
FT                   /db_xref="GOA:Q750T2"
FT                   /db_xref="InterPro:IPR003689"
FT                   /db_xref="InterPro:IPR004698"
FT                   /db_xref="UniProtKB/TrEMBL:Q750T2"
FT                   /protein_id="AAS54348.2"
FT   gene            complement(435890..435971)
FT                   /locus_tag="AGOS_t0177"
FT   tRNA            complement(435890..435971)
FT                   /locus_tag="AGOS_t0177"
FT                   /product="tRNA-Ser"
FT                   /note="codon recognized: UCU"
FT   gene            complement(<436505..>440998)
FT                   /locus_tag="AGOS_AGL142C"
FT                   /old_locus_tag="AGL142C"
FT   mRNA            complement(<436505..>440998)
FT                   /locus_tag="AGOS_AGL142C"
FT                   /old_locus_tag="AGL142C"
FT                   /product="AGL142Cp"
FT   CDS_pept        complement(436505..440998)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL142C"
FT                   /old_locus_tag="AGL142C"
FT                   /product="AGL142Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YPL058C (PDR12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL142C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54349"
FT                   /db_xref="GOA:Q750T1"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR005285"
FT                   /db_xref="InterPro:IPR010929"
FT                   /db_xref="InterPro:IPR013525"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR029481"
FT                   /db_xref="InterPro:IPR034001"
FT                   /db_xref="InterPro:IPR034003"
FT                   /db_xref="UniProtKB/TrEMBL:Q750T1"
FT                   /protein_id="AAS54349.2"
FT   repeat_region   441317..762344
FT                   /rpt_type=TANDEM
FT                   /note="rDNA repeat including RDN25, RDN5.8, RDN18S, RDN5,
FT                   and spacer sequences composed of 39 identical tandem copies
FT                   of an 8197 base pair unit."
FT   gene            complement(441868..445257)
FT                   /locus_tag="AGOS_RDNA25_1"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(441868..445257)
FT                   /locus_tag="AGOS_RDNA25_1"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 1"
FT   gene            complement(445258..445467)
FT                   /locus_tag="AGOS_ITS2_1"
FT   misc_RNA        complement(445258..445467)
FT                   /locus_tag="AGOS_ITS2_1"
FT                   /product="internal transcribed spacer 2 copy 1"
FT   gene            complement(445468..445625)
FT                   /locus_tag="AGOS_RDN58_1"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(445468..445625)
FT                   /locus_tag="AGOS_RDN58_1"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 1"
FT   gene            complement(445621..445832)
FT                   /locus_tag="AGOS_ITS1_1"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(445621..445832)
FT                   /locus_tag="AGOS_ITS1_1"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 1"
FT   gene            complement(445833..447627)
FT                   /locus_tag="AGOS_RDN18_1"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(445833..447627)
FT                   /locus_tag="AGOS_RDN18_1"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 1"
FT   gene            complement(447628..448245)
FT                   /locus_tag="AGOS_ETS1_1"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(447628..448245)
FT                   /locus_tag="AGOS_ETS1_1"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 1"
FT   misc_feature    complement(448246..448978)
FT                   /note="AGOS_NTS2_1"
FT   gene            448979..449099
FT                   /locus_tag="AGOS_RDN5_1"
FT                   /old_locus_tag="RDN5"
FT   rRNA            448979..449099
FT                   /locus_tag="AGOS_RDN5_1"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 1"
FT   misc_feature    complement(449100..450064)
FT                   /note="AGOS_NTS1_1"
FT   gene            complement(450065..453454)
FT                   /locus_tag="AGOS_RDNA25_2"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(450065..453454)
FT                   /locus_tag="AGOS_RDNA25_2"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 2"
FT   gene            complement(453455..453664)
FT                   /locus_tag="AGOS_ITS2_2"
FT   misc_RNA        complement(453455..453664)
FT                   /locus_tag="AGOS_ITS2_2"
FT                   /product="internal transcribed spacer 2 copy 2"
FT   gene            complement(453665..453822)
FT                   /locus_tag="AGOS_RDN58_2"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(453665..453822)
FT                   /locus_tag="AGOS_RDN58_2"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 2"
FT   gene            complement(453818..454029)
FT                   /locus_tag="AGOS_ITS1_2"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(453818..454029)
FT                   /locus_tag="AGOS_ITS1_2"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 2"
FT   gene            complement(454030..455824)
FT                   /locus_tag="AGOS_RDN18_2"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(454030..455824)
FT                   /locus_tag="AGOS_RDN18_2"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 2"
FT   gene            complement(455825..456442)
FT                   /locus_tag="AGOS_ETS1_2"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(455825..456442)
FT                   /locus_tag="AGOS_ETS1_2"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 2"
FT   misc_feature    complement(456443..457175)
FT                   /note="AGOS_NTS2_2"
FT   gene            457176..457296
FT                   /locus_tag="AGOS_RDN5_2"
FT                   /old_locus_tag="RDN5"
FT   rRNA            457176..457296
FT                   /locus_tag="AGOS_RDN5_2"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 2"
FT   misc_feature    complement(457297..458261)
FT                   /note="AGOS_NTS1_2"
FT   gene            complement(458262..461651)
FT                   /locus_tag="AGOS_RDNA25_3"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(458262..461651)
FT                   /locus_tag="AGOS_RDNA25_3"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 3"
FT   gene            complement(461652..461861)
FT                   /locus_tag="AGOS_ITS2_3"
FT   misc_RNA        complement(461652..461861)
FT                   /locus_tag="AGOS_ITS2_3"
FT                   /product="internal transcribed spacer 2 copy 3"
FT   gene            complement(461862..462019)
FT                   /locus_tag="AGOS_RDN58_3"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(461862..462019)
FT                   /locus_tag="AGOS_RDN58_3"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 3"
FT   gene            complement(462015..462226)
FT                   /locus_tag="AGOS_ITS1_3"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(462015..462226)
FT                   /locus_tag="AGOS_ITS1_3"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 3"
FT   gene            complement(462227..464021)
FT                   /locus_tag="AGOS_RDN18_3"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(462227..464021)
FT                   /locus_tag="AGOS_RDN18_3"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 3"
FT   gene            complement(464022..464639)
FT                   /locus_tag="AGOS_ETS1_3"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(464022..464639)
FT                   /locus_tag="AGOS_ETS1_3"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 3"
FT   misc_feature    complement(464640..465372)
FT                   /note="AGOS_NTS2_3"
FT   gene            465373..465493
FT                   /locus_tag="AGOS_RDN5_3"
FT                   /old_locus_tag="RDN5"
FT   rRNA            465373..465493
FT                   /locus_tag="AGOS_RDN5_3"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 3"
FT   misc_feature    complement(465494..466458)
FT                   /note="AGOS_NTS1_3"
FT   gene            complement(466459..469848)
FT                   /locus_tag="AGOS_RDNA25_4"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(466459..469848)
FT                   /locus_tag="AGOS_RDNA25_4"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 4"
FT   gene            complement(469849..470058)
FT                   /locus_tag="AGOS_ITS2_4"
FT   misc_RNA        complement(469849..470058)
FT                   /locus_tag="AGOS_ITS2_4"
FT                   /product="internal transcribed spacer 2 copy 4"
FT   gene            complement(470059..470216)
FT                   /locus_tag="AGOS_RDN58_4"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(470059..470216)
FT                   /locus_tag="AGOS_RDN58_4"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 4"
FT   gene            complement(470212..470423)
FT                   /locus_tag="AGOS_ITS1_4"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(470212..470423)
FT                   /locus_tag="AGOS_ITS1_4"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 4"
FT   gene            complement(470424..472218)
FT                   /locus_tag="AGOS_RDN18_4"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(470424..472218)
FT                   /locus_tag="AGOS_RDN18_4"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 4"
FT   gene            complement(472219..472836)
FT                   /locus_tag="AGOS_ETS1_4"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(472219..472836)
FT                   /locus_tag="AGOS_ETS1_4"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 4"
FT   misc_feature    complement(472837..473569)
FT                   /note="AGOS_NTS2_4"
FT   gene            473570..473690
FT                   /locus_tag="AGOS_RDN5_4"
FT                   /old_locus_tag="RDN5"
FT   rRNA            473570..473690
FT                   /locus_tag="AGOS_RDN5_4"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 4"
FT   misc_feature    complement(473691..474655)
FT                   /note="AGOS_NTS1_4"
FT   gene            complement(474656..478045)
FT                   /locus_tag="AGOS_RDNA25_5"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(474656..478045)
FT                   /locus_tag="AGOS_RDNA25_5"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 5"
FT   gene            complement(478046..478255)
FT                   /locus_tag="AGOS_ITS2_5"
FT   misc_RNA        complement(478046..478255)
FT                   /locus_tag="AGOS_ITS2_5"
FT                   /product="internal transcribed spacer 2 copy 5"
FT   gene            complement(478256..478413)
FT                   /locus_tag="AGOS_RDN58_5"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(478256..478413)
FT                   /locus_tag="AGOS_RDN58_5"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 5"
FT   gene            complement(478409..478620)
FT                   /locus_tag="AGOS_ITS1_5"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(478409..478620)
FT                   /locus_tag="AGOS_ITS1_5"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 5"
FT   gene            complement(478621..480415)
FT                   /locus_tag="AGOS_RDN18_5"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(478621..480415)
FT                   /locus_tag="AGOS_RDN18_5"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 5"
FT   gene            complement(480416..481033)
FT                   /locus_tag="AGOS_ETS1_5"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(480416..481033)
FT                   /locus_tag="AGOS_ETS1_5"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 5"
FT   misc_feature    complement(481034..481766)
FT                   /note="AGOS_NTS2_5"
FT   gene            481767..481887
FT                   /locus_tag="AGOS_RDN5_5"
FT                   /old_locus_tag="RDN5"
FT   rRNA            481767..481887
FT                   /locus_tag="AGOS_RDN5_5"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 5"
FT   misc_feature    complement(481888..482852)
FT                   /note="AGOS_NTS1_5"
FT   gene            complement(482853..486242)
FT                   /locus_tag="AGOS_RDNA25_6"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(482853..486242)
FT                   /locus_tag="AGOS_RDNA25_6"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 6"
FT   gene            complement(486243..486452)
FT                   /locus_tag="AGOS_ITS2_6"
FT   misc_RNA        complement(486243..486452)
FT                   /locus_tag="AGOS_ITS2_6"
FT                   /product="internal transcribed spacer 2 copy 6"
FT   gene            complement(486453..486610)
FT                   /locus_tag="AGOS_RDN58_6"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(486453..486610)
FT                   /locus_tag="AGOS_RDN58_6"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 6"
FT   gene            complement(486606..486817)
FT                   /locus_tag="AGOS_ITS1_6"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(486606..486817)
FT                   /locus_tag="AGOS_ITS1_6"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 6"
FT   gene            complement(486818..488612)
FT                   /locus_tag="AGOS_RDN18_6"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(486818..488612)
FT                   /locus_tag="AGOS_RDN18_6"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 6"
FT   gene            complement(488613..489230)
FT                   /locus_tag="AGOS_ETS1_6"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(488613..489230)
FT                   /locus_tag="AGOS_ETS1_6"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 6"
FT   misc_feature    complement(489231..489963)
FT                   /note="AGOS_NTS2_6"
FT   gene            489964..490084
FT                   /locus_tag="AGOS_RDN5_6"
FT                   /old_locus_tag="RDN5"
FT   rRNA            489964..490084
FT                   /locus_tag="AGOS_RDN5_6"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 6"
FT   misc_feature    complement(490085..491049)
FT                   /note="AGOS_NTS1_6"
FT   gene            complement(491050..494439)
FT                   /locus_tag="AGOS_RDNA25_7"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(491050..494439)
FT                   /locus_tag="AGOS_RDNA25_7"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 7"
FT   gene            complement(494440..494649)
FT                   /locus_tag="AGOS_ITS2_7"
FT   misc_RNA        complement(494440..494649)
FT                   /locus_tag="AGOS_ITS2_7"
FT                   /product="internal transcribed spacer 2 copy 7"
FT   gene            complement(494650..494807)
FT                   /locus_tag="AGOS_RDN58_7"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(494650..494807)
FT                   /locus_tag="AGOS_RDN58_7"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 7"
FT   gene            complement(494803..495014)
FT                   /locus_tag="AGOS_ITS1_7"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(494803..495014)
FT                   /locus_tag="AGOS_ITS1_7"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 7"
FT   gene            complement(495015..496809)
FT                   /locus_tag="AGOS_RDN18_7"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(495015..496809)
FT                   /locus_tag="AGOS_RDN18_7"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 7"
FT   gene            complement(496810..497427)
FT                   /locus_tag="AGOS_ETS1_7"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(496810..497427)
FT                   /locus_tag="AGOS_ETS1_7"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 7"
FT   misc_feature    complement(497428..498160)
FT                   /note="AGOS_NTS2_7"
FT   gene            498161..498281
FT                   /locus_tag="AGOS_RDN5_7"
FT                   /old_locus_tag="RDN5"
FT   rRNA            498161..498281
FT                   /locus_tag="AGOS_RDN5_7"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 7"
FT   misc_feature    complement(498282..499246)
FT                   /note="AGOS_NTS1_7"
FT   gene            complement(499247..502636)
FT                   /locus_tag="AGOS_RDNA25_8"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(499247..502636)
FT                   /locus_tag="AGOS_RDNA25_8"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 8"
FT   gene            complement(502637..502846)
FT                   /locus_tag="AGOS_ITS2_8"
FT   misc_RNA        complement(502637..502846)
FT                   /locus_tag="AGOS_ITS2_8"
FT                   /product="internal transcribed spacer 2 copy 8"
FT   gene            complement(502847..503004)
FT                   /locus_tag="AGOS_RDN58_8"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(502847..503004)
FT                   /locus_tag="AGOS_RDN58_8"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 8"
FT   gene            complement(503000..503211)
FT                   /locus_tag="AGOS_ITS1_8"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(503000..503211)
FT                   /locus_tag="AGOS_ITS1_8"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 8"
FT   gene            complement(503212..505006)
FT                   /locus_tag="AGOS_RDN18_8"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(503212..505006)
FT                   /locus_tag="AGOS_RDN18_8"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 8"
FT   gene            complement(505007..505624)
FT                   /locus_tag="AGOS_ETS1_8"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(505007..505624)
FT                   /locus_tag="AGOS_ETS1_8"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 8"
FT   misc_feature    complement(505625..506357)
FT                   /note="AGOS_NTS2_8"
FT   gene            506358..506478
FT                   /locus_tag="AGOS_RDN5_8"
FT                   /old_locus_tag="RDN5"
FT   rRNA            506358..506478
FT                   /locus_tag="AGOS_RDN5_8"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 8"
FT   misc_feature    complement(506479..507443)
FT                   /note="AGOS_NTS1_8"
FT   gene            complement(507444..510833)
FT                   /locus_tag="AGOS_RDNA25_9"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(507444..510833)
FT                   /locus_tag="AGOS_RDNA25_9"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 9"
FT   gene            complement(510834..511043)
FT                   /locus_tag="AGOS_ITS2_9"
FT   misc_RNA        complement(510834..511043)
FT                   /locus_tag="AGOS_ITS2_9"
FT                   /product="internal transcribed spacer 2 copy 9"
FT   gene            complement(511044..511201)
FT                   /locus_tag="AGOS_RDN58_9"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(511044..511201)
FT                   /locus_tag="AGOS_RDN58_9"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 9"
FT   gene            complement(511197..511408)
FT                   /locus_tag="AGOS_ITS1_9"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(511197..511408)
FT                   /locus_tag="AGOS_ITS1_9"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 9"
FT   gene            complement(511409..513203)
FT                   /locus_tag="AGOS_RDN18_9"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(511409..513203)
FT                   /locus_tag="AGOS_RDN18_9"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 9"
FT   gene            complement(513204..513821)
FT                   /locus_tag="AGOS_ETS1_9"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(513204..513821)
FT                   /locus_tag="AGOS_ETS1_9"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 9"
FT   misc_feature    complement(513822..514554)
FT                   /note="AGOS_NTS2_9"
FT   gene            514555..514675
FT                   /locus_tag="AGOS_RDN5_9"
FT                   /old_locus_tag="RDN5"
FT   rRNA            514555..514675
FT                   /locus_tag="AGOS_RDN5_9"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 9"
FT   misc_feature    complement(514676..515640)
FT                   /note="AGOS_NTS1_9"
FT   gene            complement(515641..519030)
FT                   /locus_tag="AGOS_RDNA25_10"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(515641..519030)
FT                   /locus_tag="AGOS_RDNA25_10"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 10"
FT   gene            complement(519031..519240)
FT                   /locus_tag="AGOS_ITS2_10"
FT   misc_RNA        complement(519031..519240)
FT                   /locus_tag="AGOS_ITS2_10"
FT                   /product="internal transcribed spacer 2 copy 10"
FT   gene            complement(519241..519398)
FT                   /locus_tag="AGOS_RDN58_10"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(519241..519398)
FT                   /locus_tag="AGOS_RDN58_10"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 10"
FT   gene            complement(519394..519605)
FT                   /locus_tag="AGOS_ITS1_10"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(519394..519605)
FT                   /locus_tag="AGOS_ITS1_10"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 10"
FT   gene            complement(519606..521400)
FT                   /locus_tag="AGOS_RDN18_10"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(519606..521400)
FT                   /locus_tag="AGOS_RDN18_10"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 10"
FT   gene            complement(521401..522018)
FT                   /locus_tag="AGOS_ETS1_10"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(521401..522018)
FT                   /locus_tag="AGOS_ETS1_10"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 10"
FT   misc_feature    complement(522019..522751)
FT                   /note="AGOS_NTS2_10"
FT   gene            522752..522872
FT                   /locus_tag="AGOS_RDN5_10"
FT                   /old_locus_tag="RDN5"
FT   rRNA            522752..522872
FT                   /locus_tag="AGOS_RDN5_10"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 10"
FT   misc_feature    complement(522873..523837)
FT                   /note="AGOS_NTS1_10"
FT   gene            complement(523838..527227)
FT                   /locus_tag="AGOS_RDNA25_11"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(523838..527227)
FT                   /locus_tag="AGOS_RDNA25_11"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 11"
FT   gene            complement(527228..527437)
FT                   /locus_tag="AGOS_ITS2_11"
FT   misc_RNA        complement(527228..527437)
FT                   /locus_tag="AGOS_ITS2_11"
FT                   /product="internal transcribed spacer 2 copy 11"
FT   gene            complement(527438..527595)
FT                   /locus_tag="AGOS_RDN58_11"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(527438..527595)
FT                   /locus_tag="AGOS_RDN58_11"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 11"
FT   gene            complement(527591..527802)
FT                   /locus_tag="AGOS_ITS1_11"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(527591..527802)
FT                   /locus_tag="AGOS_ITS1_11"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 11"
FT   gene            complement(527803..529597)
FT                   /locus_tag="AGOS_RDN18_11"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(527803..529597)
FT                   /locus_tag="AGOS_RDN18_11"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 11"
FT   gene            complement(529598..530215)
FT                   /locus_tag="AGOS_ETS1_11"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(529598..530215)
FT                   /locus_tag="AGOS_ETS1_11"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 11"
FT   misc_feature    complement(530216..530948)
FT                   /note="AGOS_NTS2_11"
FT   gene            530949..531069
FT                   /locus_tag="AGOS_RDN5_11"
FT                   /old_locus_tag="RDN5"
FT   rRNA            530949..531069
FT                   /locus_tag="AGOS_RDN5_11"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 11"
FT   misc_feature    complement(531070..532034)
FT                   /note="AGOS_NTS1_11"
FT   gene            complement(532035..535424)
FT                   /locus_tag="AGOS_RDNA25_12"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(532035..535424)
FT                   /locus_tag="AGOS_RDNA25_12"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 12"
FT   gene            complement(535425..535634)
FT                   /locus_tag="AGOS_ITS2_12"
FT   misc_RNA        complement(535425..535634)
FT                   /locus_tag="AGOS_ITS2_12"
FT                   /product="internal transcribed spacer 2 copy 12"
FT   gene            complement(535635..535792)
FT                   /locus_tag="AGOS_RDN58_12"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(535635..535792)
FT                   /locus_tag="AGOS_RDN58_12"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 12"
FT   gene            complement(535788..535999)
FT                   /locus_tag="AGOS_ITS1_12"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(535788..535999)
FT                   /locus_tag="AGOS_ITS1_12"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 12"
FT   gene            complement(536000..537794)
FT                   /locus_tag="AGOS_RDN18_12"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(536000..537794)
FT                   /locus_tag="AGOS_RDN18_12"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 12"
FT   gene            complement(537795..538412)
FT                   /locus_tag="AGOS_ETS1_12"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(537795..538412)
FT                   /locus_tag="AGOS_ETS1_12"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 12"
FT   misc_feature    complement(538413..539145)
FT                   /note="AGOS_NTS2_12"
FT   gene            539146..539266
FT                   /locus_tag="AGOS_RDN5_12"
FT                   /old_locus_tag="RDN5"
FT   rRNA            539146..539266
FT                   /locus_tag="AGOS_RDN5_12"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 12"
FT   misc_feature    complement(539267..540231)
FT                   /note="AGOS_NTS1_12"
FT   gene            complement(540232..543621)
FT                   /locus_tag="AGOS_RDNA25_13"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(540232..543621)
FT                   /locus_tag="AGOS_RDNA25_13"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 13"
FT   gene            complement(543622..543831)
FT                   /locus_tag="AGOS_ITS2_13"
FT   misc_RNA        complement(543622..543831)
FT                   /locus_tag="AGOS_ITS2_13"
FT                   /product="internal transcribed spacer 2 copy 13"
FT   gene            complement(543832..543989)
FT                   /locus_tag="AGOS_RDN58_13"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(543832..543989)
FT                   /locus_tag="AGOS_RDN58_13"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 13"
FT   gene            complement(543985..544196)
FT                   /locus_tag="AGOS_ITS1_13"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(543985..544196)
FT                   /locus_tag="AGOS_ITS1_13"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 13"
FT   gene            complement(544197..545991)
FT                   /locus_tag="AGOS_RDN18_13"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(544197..545991)
FT                   /locus_tag="AGOS_RDN18_13"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 13"
FT   gene            complement(545992..546609)
FT                   /locus_tag="AGOS_ETS1_13"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(545992..546609)
FT                   /locus_tag="AGOS_ETS1_13"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 13"
FT   misc_feature    complement(546610..547342)
FT                   /note="AGOS_NTS2_13"
FT   gene            547343..547463
FT                   /locus_tag="AGOS_RDN5_13"
FT                   /old_locus_tag="RDN5"
FT   rRNA            547343..547463
FT                   /locus_tag="AGOS_RDN5_13"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 13"
FT   misc_feature    complement(547464..548428)
FT                   /note="AGOS_NTS1_13"
FT   gene            complement(548429..551818)
FT                   /locus_tag="AGOS_RDNA25_14"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(548429..551818)
FT                   /locus_tag="AGOS_RDNA25_14"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 14"
FT   gene            complement(551819..552028)
FT                   /locus_tag="AGOS_ITS2_14"
FT   misc_RNA        complement(551819..552028)
FT                   /locus_tag="AGOS_ITS2_14"
FT                   /product="internal transcribed spacer 2 copy 14"
FT   gene            complement(552029..552186)
FT                   /locus_tag="AGOS_RDN58_14"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(552029..552186)
FT                   /locus_tag="AGOS_RDN58_14"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 14"
FT   gene            complement(552182..552393)
FT                   /locus_tag="AGOS_ITS1_14"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(552182..552393)
FT                   /locus_tag="AGOS_ITS1_14"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 14"
FT   gene            complement(552394..554188)
FT                   /locus_tag="AGOS_RDN18_14"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(552394..554188)
FT                   /locus_tag="AGOS_RDN18_14"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 14"
FT   gene            complement(554189..554806)
FT                   /locus_tag="AGOS_ETS1_14"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(554189..554806)
FT                   /locus_tag="AGOS_ETS1_14"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 14"
FT   misc_feature    complement(554807..555539)
FT                   /note="AGOS_NTS2_14"
FT   gene            555540..555660
FT                   /locus_tag="AGOS_RDN5_14"
FT                   /old_locus_tag="RDN5"
FT   rRNA            555540..555660
FT                   /locus_tag="AGOS_RDN5_14"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 14"
FT   misc_feature    complement(555661..556625)
FT                   /note="AGOS_NTS1_14"
FT   gene            complement(556626..560015)
FT                   /locus_tag="AGOS_RDNA25_15"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(556626..560015)
FT                   /locus_tag="AGOS_RDNA25_15"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 15"
FT   gene            complement(560016..560225)
FT                   /locus_tag="AGOS_ITS2_15"
FT   misc_RNA        complement(560016..560225)
FT                   /locus_tag="AGOS_ITS2_15"
FT                   /product="internal transcribed spacer 2 copy 15"
FT   gene            complement(560226..560383)
FT                   /locus_tag="AGOS_RDN58_15"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(560226..560383)
FT                   /locus_tag="AGOS_RDN58_15"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 15"
FT   gene            complement(560379..560590)
FT                   /locus_tag="AGOS_ITS1_15"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(560379..560590)
FT                   /locus_tag="AGOS_ITS1_15"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 15"
FT   gene            complement(560591..562385)
FT                   /locus_tag="AGOS_RDN18_15"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(560591..562385)
FT                   /locus_tag="AGOS_RDN18_15"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 15"
FT   gene            complement(562386..563003)
FT                   /locus_tag="AGOS_ETS1_15"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(562386..563003)
FT                   /locus_tag="AGOS_ETS1_15"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 15"
FT   misc_feature    complement(563004..563736)
FT                   /note="AGOS_NTS2_15"
FT   gene            563737..563857
FT                   /locus_tag="AGOS_RDN5_15"
FT                   /old_locus_tag="RDN5"
FT   rRNA            563737..563857
FT                   /locus_tag="AGOS_RDN5_15"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 15"
FT   misc_feature    complement(563858..564822)
FT                   /note="AGOS_NTS1_15"
FT   gene            complement(564823..568212)
FT                   /locus_tag="AGOS_RDNA25_16"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(564823..568212)
FT                   /locus_tag="AGOS_RDNA25_16"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 16"
FT   gene            complement(568213..568422)
FT                   /locus_tag="AGOS_ITS2_16"
FT   misc_RNA        complement(568213..568422)
FT                   /locus_tag="AGOS_ITS2_16"
FT                   /product="internal transcribed spacer 2 copy 16"
FT   gene            complement(568423..568580)
FT                   /locus_tag="AGOS_RDN58_16"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(568423..568580)
FT                   /locus_tag="AGOS_RDN58_16"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 16"
FT   gene            complement(568576..568787)
FT                   /locus_tag="AGOS_ITS1_16"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(568576..568787)
FT                   /locus_tag="AGOS_ITS1_16"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 16"
FT   gene            complement(568788..570582)
FT                   /locus_tag="AGOS_RDN18_16"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(568788..570582)
FT                   /locus_tag="AGOS_RDN18_16"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 16"
FT   gene            complement(570583..571200)
FT                   /locus_tag="AGOS_ETS1_16"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(570583..571200)
FT                   /locus_tag="AGOS_ETS1_16"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 16"
FT   misc_feature    complement(571201..571933)
FT                   /note="AGOS_NTS2_16"
FT   gene            571934..572054
FT                   /locus_tag="AGOS_RDN5_16"
FT                   /old_locus_tag="RDN5"
FT   rRNA            571934..572054
FT                   /locus_tag="AGOS_RDN5_16"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 16"
FT   misc_feature    complement(572055..573019)
FT                   /note="AGOS_NTS1_16"
FT   gene            complement(573020..576409)
FT                   /locus_tag="AGOS_RDNA25_17"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(573020..576409)
FT                   /locus_tag="AGOS_RDNA25_17"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 17"
FT   gene            complement(576410..576619)
FT                   /locus_tag="AGOS_ITS2_17"
FT   misc_RNA        complement(576410..576619)
FT                   /locus_tag="AGOS_ITS2_17"
FT                   /product="internal transcribed spacer 2 copy 17"
FT   gene            complement(576620..576777)
FT                   /locus_tag="AGOS_RDN58_17"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(576620..576777)
FT                   /locus_tag="AGOS_RDN58_17"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 17"
FT   gene            complement(576773..576984)
FT                   /locus_tag="AGOS_ITS1_17"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(576773..576984)
FT                   /locus_tag="AGOS_ITS1_17"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 17"
FT   gene            complement(576985..578779)
FT                   /locus_tag="AGOS_RDN18_17"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(576985..578779)
FT                   /locus_tag="AGOS_RDN18_17"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 17"
FT   gene            complement(578780..579397)
FT                   /locus_tag="AGOS_ETS1_17"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(578780..579397)
FT                   /locus_tag="AGOS_ETS1_17"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 17"
FT   misc_feature    complement(579398..580130)
FT                   /note="AGOS_NTS2_17"
FT   gene            580131..580251
FT                   /locus_tag="AGOS_RDN5_17"
FT                   /old_locus_tag="RDN5"
FT   rRNA            580131..580251
FT                   /locus_tag="AGOS_RDN5_17"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 17"
FT   misc_feature    complement(580252..581216)
FT                   /note="AGOS_NTS1_17"
FT   gene            complement(581217..584606)
FT                   /locus_tag="AGOS_RDNA25_18"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(581217..584606)
FT                   /locus_tag="AGOS_RDNA25_18"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 18"
FT   gene            complement(584607..584816)
FT                   /locus_tag="AGOS_ITS2_18"
FT   misc_RNA        complement(584607..584816)
FT                   /locus_tag="AGOS_ITS2_18"
FT                   /product="internal transcribed spacer 2 copy 18"
FT   gene            complement(584817..584974)
FT                   /locus_tag="AGOS_RDN58_18"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(584817..584974)
FT                   /locus_tag="AGOS_RDN58_18"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 18"
FT   gene            complement(584970..585181)
FT                   /locus_tag="AGOS_ITS1_18"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(584970..585181)
FT                   /locus_tag="AGOS_ITS1_18"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 18"
FT   gene            complement(585182..586976)
FT                   /locus_tag="AGOS_RDN18_18"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(585182..586976)
FT                   /locus_tag="AGOS_RDN18_18"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 18"
FT   gene            complement(586977..587594)
FT                   /locus_tag="AGOS_ETS1_18"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(586977..587594)
FT                   /locus_tag="AGOS_ETS1_18"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 18"
FT   misc_feature    complement(587595..588327)
FT                   /note="AGOS_NTS2_18"
FT   gene            588328..588448
FT                   /locus_tag="AGOS_RDN5_18"
FT                   /old_locus_tag="RDN5"
FT   rRNA            588328..588448
FT                   /locus_tag="AGOS_RDN5_18"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 18"
FT   misc_feature    complement(588449..589413)
FT                   /note="AGOS_NTS1_18"
FT   gene            complement(589414..592803)
FT                   /locus_tag="AGOS_RDNA25_19"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(589414..592803)
FT                   /locus_tag="AGOS_RDNA25_19"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 19"
FT   gene            complement(592804..593013)
FT                   /locus_tag="AGOS_ITS2_19"
FT   misc_RNA        complement(592804..593013)
FT                   /locus_tag="AGOS_ITS2_19"
FT                   /product="internal transcribed spacer 2 copy 19"
FT   gene            complement(593014..593171)
FT                   /locus_tag="AGOS_RDN58_19"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(593014..593171)
FT                   /locus_tag="AGOS_RDN58_19"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 19"
FT   gene            complement(593167..593378)
FT                   /locus_tag="AGOS_ITS1_19"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(593167..593378)
FT                   /locus_tag="AGOS_ITS1_19"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 19"
FT   gene            complement(593379..595173)
FT                   /locus_tag="AGOS_RDN18_19"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(593379..595173)
FT                   /locus_tag="AGOS_RDN18_19"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 19"
FT   gene            complement(595174..595791)
FT                   /locus_tag="AGOS_ETS1_19"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(595174..595791)
FT                   /locus_tag="AGOS_ETS1_19"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 19"
FT   misc_feature    complement(595792..596524)
FT                   /note="AGOS_NTS2_19"
FT   gene            596525..596645
FT                   /locus_tag="AGOS_RDN5_19"
FT                   /old_locus_tag="RDN5"
FT   rRNA            596525..596645
FT                   /locus_tag="AGOS_RDN5_19"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 19"
FT   misc_feature    complement(596646..597610)
FT                   /note="AGOS_NTS1_19"
FT   gene            complement(597611..601000)
FT                   /locus_tag="AGOS_RDNA25_20"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(597611..601000)
FT                   /locus_tag="AGOS_RDNA25_20"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 20"
FT   gene            complement(601001..601210)
FT                   /locus_tag="AGOS_ITS2_20"
FT   misc_RNA        complement(601001..601210)
FT                   /locus_tag="AGOS_ITS2_20"
FT                   /product="internal transcribed spacer 2 copy 20"
FT   gene            complement(601211..601368)
FT                   /locus_tag="AGOS_RDN58_20"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(601211..601368)
FT                   /locus_tag="AGOS_RDN58_20"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 20"
FT   gene            complement(601364..601575)
FT                   /locus_tag="AGOS_ITS1_20"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(601364..601575)
FT                   /locus_tag="AGOS_ITS1_20"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 20"
FT   gene            complement(601576..603370)
FT                   /locus_tag="AGOS_RDN18_20"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(601576..603370)
FT                   /locus_tag="AGOS_RDN18_20"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 20"
FT   gene            complement(603371..603988)
FT                   /locus_tag="AGOS_ETS1_20"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(603371..603988)
FT                   /locus_tag="AGOS_ETS1_20"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 20"
FT   misc_feature    complement(603989..604721)
FT                   /note="AGOS_NTS2_20"
FT   gene            604722..604842
FT                   /locus_tag="AGOS_RDN5_20"
FT                   /old_locus_tag="RDN5"
FT   rRNA            604722..604842
FT                   /locus_tag="AGOS_RDN5_20"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 20"
FT   misc_feature    complement(604843..605807)
FT                   /note="AGOS_NTS1_20"
FT   gene            complement(605808..609197)
FT                   /locus_tag="AGOS_RDNA25_21"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(605808..609197)
FT                   /locus_tag="AGOS_RDNA25_21"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 21"
FT   gene            complement(609198..609407)
FT                   /locus_tag="AGOS_ITS2_21"
FT   misc_RNA        complement(609198..609407)
FT                   /locus_tag="AGOS_ITS2_21"
FT                   /product="internal transcribed spacer 2 copy 21"
FT   gene            complement(609408..609565)
FT                   /locus_tag="AGOS_RDN58_21"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(609408..609565)
FT                   /locus_tag="AGOS_RDN58_21"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 21"
FT   gene            complement(609561..609772)
FT                   /locus_tag="AGOS_ITS1_21"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(609561..609772)
FT                   /locus_tag="AGOS_ITS1_21"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 21"
FT   gene            complement(609773..611567)
FT                   /locus_tag="AGOS_RDN18_21"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(609773..611567)
FT                   /locus_tag="AGOS_RDN18_21"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 21"
FT   gene            complement(611568..612185)
FT                   /locus_tag="AGOS_ETS1_21"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(611568..612185)
FT                   /locus_tag="AGOS_ETS1_21"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 21"
FT   misc_feature    complement(612186..612918)
FT                   /note="AGOS_NTS2_21"
FT   gene            612919..613039
FT                   /locus_tag="AGOS_RDN5_21"
FT                   /old_locus_tag="RDN5"
FT   rRNA            612919..613039
FT                   /locus_tag="AGOS_RDN5_21"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 21"
FT   misc_feature    complement(613040..614004)
FT                   /note="AGOS_NTS1_21"
FT   gene            complement(614005..617394)
FT                   /locus_tag="AGOS_RDNA25_22"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(614005..617394)
FT                   /locus_tag="AGOS_RDNA25_22"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 22"
FT   gene            complement(617395..617604)
FT                   /locus_tag="AGOS_ITS2_22"
FT   misc_RNA        complement(617395..617604)
FT                   /locus_tag="AGOS_ITS2_22"
FT                   /product="internal transcribed spacer 2 copy 22"
FT   gene            complement(617605..617762)
FT                   /locus_tag="AGOS_RDN58_22"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(617605..617762)
FT                   /locus_tag="AGOS_RDN58_22"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 22"
FT   gene            complement(617758..617969)
FT                   /locus_tag="AGOS_ITS1_22"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(617758..617969)
FT                   /locus_tag="AGOS_ITS1_22"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 22"
FT   gene            complement(617970..619764)
FT                   /locus_tag="AGOS_RDN18_22"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(617970..619764)
FT                   /locus_tag="AGOS_RDN18_22"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 22"
FT   gene            complement(619765..620382)
FT                   /locus_tag="AGOS_ETS1_22"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(619765..620382)
FT                   /locus_tag="AGOS_ETS1_22"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 22"
FT   misc_feature    complement(620383..621115)
FT                   /note="AGOS_NTS2_22"
FT   gene            621116..621236
FT                   /locus_tag="AGOS_RDN5_22"
FT                   /old_locus_tag="RDN5"
FT   rRNA            621116..621236
FT                   /locus_tag="AGOS_RDN5_22"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 22"
FT   misc_feature    complement(621237..622201)
FT                   /note="AGOS_NTS1_22"
FT   gene            complement(622202..625591)
FT                   /locus_tag="AGOS_RDNA25_23"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(622202..625591)
FT                   /locus_tag="AGOS_RDNA25_23"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 23"
FT   gene            complement(625592..625801)
FT                   /locus_tag="AGOS_ITS2_23"
FT   misc_RNA        complement(625592..625801)
FT                   /locus_tag="AGOS_ITS2_23"
FT                   /product="internal transcribed spacer 2 copy 23"
FT   gene            complement(625802..625959)
FT                   /locus_tag="AGOS_RDN58_23"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(625802..625959)
FT                   /locus_tag="AGOS_RDN58_23"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 23"
FT   gene            complement(625955..626166)
FT                   /locus_tag="AGOS_ITS1_23"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(625955..626166)
FT                   /locus_tag="AGOS_ITS1_23"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 23"
FT   gene            complement(626167..627961)
FT                   /locus_tag="AGOS_RDN18_23"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(626167..627961)
FT                   /locus_tag="AGOS_RDN18_23"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 23"
FT   gene            complement(627962..628579)
FT                   /locus_tag="AGOS_ETS1_23"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(627962..628579)
FT                   /locus_tag="AGOS_ETS1_23"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 23"
FT   misc_feature    complement(628580..629312)
FT                   /note="AGOS_NTS2_23"
FT   gene            629313..629433
FT                   /locus_tag="AGOS_RDN5_23"
FT                   /old_locus_tag="RDN5"
FT   rRNA            629313..629433
FT                   /locus_tag="AGOS_RDN5_23"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 23"
FT   misc_feature    complement(629434..630398)
FT                   /note="AGOS_NTS1_23"
FT   gene            complement(630399..633788)
FT                   /locus_tag="AGOS_RDNA25_24"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(630399..633788)
FT                   /locus_tag="AGOS_RDNA25_24"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 24"
FT   gene            complement(633789..633998)
FT                   /locus_tag="AGOS_ITS2_24"
FT   misc_RNA        complement(633789..633998)
FT                   /locus_tag="AGOS_ITS2_24"
FT                   /product="internal transcribed spacer 2 copy 24"
FT   gene            complement(633999..634156)
FT                   /locus_tag="AGOS_RDN58_24"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(633999..634156)
FT                   /locus_tag="AGOS_RDN58_24"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 24"
FT   gene            complement(634152..634363)
FT                   /locus_tag="AGOS_ITS1_24"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(634152..634363)
FT                   /locus_tag="AGOS_ITS1_24"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 24"
FT   gene            complement(634364..636158)
FT                   /locus_tag="AGOS_RDN18_24"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(634364..636158)
FT                   /locus_tag="AGOS_RDN18_24"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 24"
FT   gene            complement(636159..636776)
FT                   /locus_tag="AGOS_ETS1_24"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(636159..636776)
FT                   /locus_tag="AGOS_ETS1_24"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 24"
FT   misc_feature    complement(636777..637509)
FT                   /note="AGOS_NTS2_24"
FT   gene            637510..637630
FT                   /locus_tag="AGOS_RDN5_24"
FT                   /old_locus_tag="RDN5"
FT   rRNA            637510..637630
FT                   /locus_tag="AGOS_RDN5_24"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 24"
FT   misc_feature    complement(637631..638595)
FT                   /note="AGOS_NTS1_24"
FT   gene            complement(638596..641985)
FT                   /locus_tag="AGOS_RDNA25_25"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(638596..641985)
FT                   /locus_tag="AGOS_RDNA25_25"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 25"
FT   gene            complement(641986..642195)
FT                   /locus_tag="AGOS_ITS2_25"
FT   misc_RNA        complement(641986..642195)
FT                   /locus_tag="AGOS_ITS2_25"
FT                   /product="internal transcribed spacer 2 copy 25"
FT   gene            complement(642196..642353)
FT                   /locus_tag="AGOS_RDN58_25"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(642196..642353)
FT                   /locus_tag="AGOS_RDN58_25"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 25"
FT   gene            complement(642349..642560)
FT                   /locus_tag="AGOS_ITS1_25"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(642349..642560)
FT                   /locus_tag="AGOS_ITS1_25"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 25"
FT   gene            complement(642561..644355)
FT                   /locus_tag="AGOS_RDN18_25"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(642561..644355)
FT                   /locus_tag="AGOS_RDN18_25"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 25"
FT   gene            complement(644356..644973)
FT                   /locus_tag="AGOS_ETS1_25"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(644356..644973)
FT                   /locus_tag="AGOS_ETS1_25"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 25"
FT   misc_feature    complement(644974..645706)
FT                   /note="AGOS_NTS2_25"
FT   gene            645707..645827
FT                   /locus_tag="AGOS_RDN5_25"
FT                   /old_locus_tag="RDN5"
FT   rRNA            645707..645827
FT                   /locus_tag="AGOS_RDN5_25"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 25"
FT   misc_feature    complement(645828..646792)
FT                   /note="AGOS_NTS1_25"
FT   gene            complement(646793..650182)
FT                   /locus_tag="AGOS_RDNA25_26"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(646793..650182)
FT                   /locus_tag="AGOS_RDNA25_26"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 26"
FT   gene            complement(650183..650392)
FT                   /locus_tag="AGOS_ITS2_26"
FT   misc_RNA        complement(650183..650392)
FT                   /locus_tag="AGOS_ITS2_26"
FT                   /product="internal transcribed spacer 2 copy 26"
FT   gene            complement(650393..650550)
FT                   /locus_tag="AGOS_RDN58_26"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(650393..650550)
FT                   /locus_tag="AGOS_RDN58_26"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 26"
FT   gene            complement(650546..650757)
FT                   /locus_tag="AGOS_ITS1_26"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(650546..650757)
FT                   /locus_tag="AGOS_ITS1_26"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 26"
FT   gene            complement(650758..652552)
FT                   /locus_tag="AGOS_RDN18_26"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(650758..652552)
FT                   /locus_tag="AGOS_RDN18_26"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 26"
FT   gene            complement(652553..653170)
FT                   /locus_tag="AGOS_ETS1_26"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(652553..653170)
FT                   /locus_tag="AGOS_ETS1_26"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 26"
FT   misc_feature    complement(653171..653903)
FT                   /note="AGOS_NTS2_26"
FT   gene            653904..654024
FT                   /locus_tag="AGOS_RDN5_26"
FT                   /old_locus_tag="RDN5"
FT   rRNA            653904..654024
FT                   /locus_tag="AGOS_RDN5_26"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 26"
FT   misc_feature    complement(654025..654989)
FT                   /note="AGOS_NTS1_26"
FT   gene            complement(654990..658379)
FT                   /locus_tag="AGOS_RDNA25_27"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(654990..658379)
FT                   /locus_tag="AGOS_RDNA25_27"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 27"
FT   gene            complement(658380..658589)
FT                   /locus_tag="AGOS_ITS2_27"
FT   misc_RNA        complement(658380..658589)
FT                   /locus_tag="AGOS_ITS2_27"
FT                   /product="internal transcribed spacer 2 copy 27"
FT   gene            complement(658590..658747)
FT                   /locus_tag="AGOS_RDN58_27"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(658590..658747)
FT                   /locus_tag="AGOS_RDN58_27"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 27"
FT   gene            complement(658743..658954)
FT                   /locus_tag="AGOS_ITS1_27"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(658743..658954)
FT                   /locus_tag="AGOS_ITS1_27"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 27"
FT   gene            complement(658955..660749)
FT                   /locus_tag="AGOS_RDN18_27"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(658955..660749)
FT                   /locus_tag="AGOS_RDN18_27"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 27"
FT   gene            complement(660750..661367)
FT                   /locus_tag="AGOS_ETS1_27"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(660750..661367)
FT                   /locus_tag="AGOS_ETS1_27"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 27"
FT   misc_feature    complement(661368..662100)
FT                   /note="AGOS_NTS2_27"
FT   gene            662101..662221
FT                   /locus_tag="AGOS_RDN5_27"
FT                   /old_locus_tag="RDN5"
FT   rRNA            662101..662221
FT                   /locus_tag="AGOS_RDN5_27"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 27"
FT   misc_feature    complement(662222..663186)
FT                   /note="AGOS_NTS1_27"
FT   gene            complement(663187..666576)
FT                   /locus_tag="AGOS_RDNA25_28"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(663187..666576)
FT                   /locus_tag="AGOS_RDNA25_28"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 28"
FT   gene            complement(666577..666786)
FT                   /locus_tag="AGOS_ITS2_28"
FT   misc_RNA        complement(666577..666786)
FT                   /locus_tag="AGOS_ITS2_28"
FT                   /product="internal transcribed spacer 2 copy 28"
FT   gene            complement(666787..666944)
FT                   /locus_tag="AGOS_RDN58_28"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(666787..666944)
FT                   /locus_tag="AGOS_RDN58_28"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 28"
FT   gene            complement(666940..667151)
FT                   /locus_tag="AGOS_ITS1_28"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(666940..667151)
FT                   /locus_tag="AGOS_ITS1_28"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 28"
FT   gene            complement(667152..668946)
FT                   /locus_tag="AGOS_RDN18_28"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(667152..668946)
FT                   /locus_tag="AGOS_RDN18_28"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 28"
FT   gene            complement(668947..669564)
FT                   /locus_tag="AGOS_ETS1_28"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(668947..669564)
FT                   /locus_tag="AGOS_ETS1_28"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 28"
FT   misc_feature    complement(669565..670297)
FT                   /note="AGOS_NTS2_28"
FT   gene            670298..670418
FT                   /locus_tag="AGOS_RDN5_28"
FT                   /old_locus_tag="RDN5"
FT   rRNA            670298..670418
FT                   /locus_tag="AGOS_RDN5_28"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 28"
FT   misc_feature    complement(670419..671383)
FT                   /note="AGOS_NTS1_28"
FT   gene            complement(671384..674773)
FT                   /locus_tag="AGOS_RDNA25_29"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(671384..674773)
FT                   /locus_tag="AGOS_RDNA25_29"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 29"
FT   gene            complement(674774..674983)
FT                   /locus_tag="AGOS_ITS2_29"
FT   misc_RNA        complement(674774..674983)
FT                   /locus_tag="AGOS_ITS2_29"
FT                   /product="internal transcribed spacer 2 copy 29"
FT   gene            complement(674984..675141)
FT                   /locus_tag="AGOS_RDN58_29"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(674984..675141)
FT                   /locus_tag="AGOS_RDN58_29"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 29"
FT   gene            complement(675137..675348)
FT                   /locus_tag="AGOS_ITS1_29"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(675137..675348)
FT                   /locus_tag="AGOS_ITS1_29"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 29"
FT   gene            complement(675349..677143)
FT                   /locus_tag="AGOS_RDN18_29"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(675349..677143)
FT                   /locus_tag="AGOS_RDN18_29"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 29"
FT   gene            complement(677144..677761)
FT                   /locus_tag="AGOS_ETS1_29"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(677144..677761)
FT                   /locus_tag="AGOS_ETS1_29"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 29"
FT   misc_feature    complement(677762..678494)
FT                   /note="AGOS_NTS2_29"
FT   gene            678495..678615
FT                   /locus_tag="AGOS_RDN5_29"
FT                   /old_locus_tag="RDN5"
FT   rRNA            678495..678615
FT                   /locus_tag="AGOS_RDN5_29"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 29"
FT   misc_feature    complement(678616..679580)
FT                   /note="AGOS_NTS1_29"
FT   gene            complement(679581..682970)
FT                   /locus_tag="AGOS_RDNA25_30"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(679581..682970)
FT                   /locus_tag="AGOS_RDNA25_30"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 30"
FT   gene            complement(682971..683180)
FT                   /locus_tag="AGOS_ITS2_30"
FT   misc_RNA        complement(682971..683180)
FT                   /locus_tag="AGOS_ITS2_30"
FT                   /product="internal transcribed spacer 2 copy 30"
FT   gene            complement(683181..683338)
FT                   /locus_tag="AGOS_RDN58_30"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(683181..683338)
FT                   /locus_tag="AGOS_RDN58_30"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 30"
FT   gene            complement(683334..683545)
FT                   /locus_tag="AGOS_ITS1_30"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(683334..683545)
FT                   /locus_tag="AGOS_ITS1_30"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 30"
FT   gene            complement(683546..685340)
FT                   /locus_tag="AGOS_RDN18_30"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(683546..685340)
FT                   /locus_tag="AGOS_RDN18_30"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 30"
FT   gene            complement(685341..685958)
FT                   /locus_tag="AGOS_ETS1_30"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(685341..685958)
FT                   /locus_tag="AGOS_ETS1_30"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 30"
FT   misc_feature    complement(685959..686691)
FT                   /note="AGOS_NTS2_30"
FT   gene            686692..686812
FT                   /locus_tag="AGOS_RDN5_30"
FT                   /old_locus_tag="RDN5"
FT   rRNA            686692..686812
FT                   /locus_tag="AGOS_RDN5_30"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 30"
FT   misc_feature    complement(686813..687777)
FT                   /note="AGOS_NTS1_30"
FT   gene            complement(687778..691167)
FT                   /locus_tag="AGOS_RDNA25_31"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(687778..691167)
FT                   /locus_tag="AGOS_RDNA25_31"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 31"
FT   gene            complement(691168..691377)
FT                   /locus_tag="AGOS_ITS2_31"
FT   misc_RNA        complement(691168..691377)
FT                   /locus_tag="AGOS_ITS2_31"
FT                   /product="internal transcribed spacer 2 copy 31"
FT   gene            complement(691378..691535)
FT                   /locus_tag="AGOS_RDN58_31"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(691378..691535)
FT                   /locus_tag="AGOS_RDN58_31"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 31"
FT   gene            complement(691531..691742)
FT                   /locus_tag="AGOS_ITS1_31"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(691531..691742)
FT                   /locus_tag="AGOS_ITS1_31"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 31"
FT   gene            complement(691743..693537)
FT                   /locus_tag="AGOS_RDN18_31"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(691743..693537)
FT                   /locus_tag="AGOS_RDN18_31"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 31"
FT   gene            complement(693538..694155)
FT                   /locus_tag="AGOS_ETS1_31"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(693538..694155)
FT                   /locus_tag="AGOS_ETS1_31"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 31"
FT   misc_feature    complement(694156..694888)
FT                   /note="AGOS_NTS2_31"
FT   gene            694889..695009
FT                   /locus_tag="AGOS_RDN5_31"
FT                   /old_locus_tag="RDN5"
FT   rRNA            694889..695009
FT                   /locus_tag="AGOS_RDN5_31"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 31"
FT   misc_feature    complement(695010..695974)
FT                   /note="AGOS_NTS1_31"
FT   gene            complement(695975..699364)
FT                   /locus_tag="AGOS_RDNA25_32"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(695975..699364)
FT                   /locus_tag="AGOS_RDNA25_32"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 32"
FT   gene            complement(699365..699574)
FT                   /locus_tag="AGOS_ITS2_32"
FT   misc_RNA        complement(699365..699574)
FT                   /locus_tag="AGOS_ITS2_32"
FT                   /product="internal transcribed spacer 2 copy 32"
FT   gene            complement(699575..699732)
FT                   /locus_tag="AGOS_RDN58_32"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(699575..699732)
FT                   /locus_tag="AGOS_RDN58_32"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 32"
FT   gene            complement(699728..699939)
FT                   /locus_tag="AGOS_ITS1_32"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(699728..699939)
FT                   /locus_tag="AGOS_ITS1_32"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 32"
FT   gene            complement(699940..701734)
FT                   /locus_tag="AGOS_RDN18_32"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(699940..701734)
FT                   /locus_tag="AGOS_RDN18_32"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 32"
FT   gene            complement(701735..702352)
FT                   /locus_tag="AGOS_ETS1_32"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(701735..702352)
FT                   /locus_tag="AGOS_ETS1_32"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 32"
FT   misc_feature    complement(702353..703085)
FT                   /note="AGOS_NTS2_32"
FT   gene            703086..703206
FT                   /locus_tag="AGOS_RDN5_32"
FT                   /old_locus_tag="RDN5"
FT   rRNA            703086..703206
FT                   /locus_tag="AGOS_RDN5_32"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 32"
FT   misc_feature    complement(703207..704171)
FT                   /note="AGOS_NTS1_32"
FT   gene            complement(704172..707561)
FT                   /locus_tag="AGOS_RDNA25_33"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(704172..707561)
FT                   /locus_tag="AGOS_RDNA25_33"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 33"
FT   gene            complement(707562..707771)
FT                   /locus_tag="AGOS_ITS2_33"
FT   misc_RNA        complement(707562..707771)
FT                   /locus_tag="AGOS_ITS2_33"
FT                   /product="internal transcribed spacer 2 copy 33"
FT   gene            complement(707772..707929)
FT                   /locus_tag="AGOS_RDN58_33"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(707772..707929)
FT                   /locus_tag="AGOS_RDN58_33"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 33"
FT   gene            complement(707925..708136)
FT                   /locus_tag="AGOS_ITS1_33"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(707925..708136)
FT                   /locus_tag="AGOS_ITS1_33"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 33"
FT   gene            complement(708137..709931)
FT                   /locus_tag="AGOS_RDN18_33"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(708137..709931)
FT                   /locus_tag="AGOS_RDN18_33"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 33"
FT   gene            complement(709932..710549)
FT                   /locus_tag="AGOS_ETS1_33"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(709932..710549)
FT                   /locus_tag="AGOS_ETS1_33"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 33"
FT   misc_feature    complement(710550..711282)
FT                   /note="AGOS_NTS2_33"
FT   gene            711283..711403
FT                   /locus_tag="AGOS_RDN5_33"
FT                   /old_locus_tag="RDN5"
FT   rRNA            711283..711403
FT                   /locus_tag="AGOS_RDN5_33"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 33"
FT   misc_feature    complement(711404..712368)
FT                   /note="AGOS_NTS1_33"
FT   gene            complement(712369..715758)
FT                   /locus_tag="AGOS_RDNA25_34"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(712369..715758)
FT                   /locus_tag="AGOS_RDNA25_34"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 34"
FT   gene            complement(715759..715968)
FT                   /locus_tag="AGOS_ITS2_34"
FT   misc_RNA        complement(715759..715968)
FT                   /locus_tag="AGOS_ITS2_34"
FT                   /product="internal transcribed spacer 2 copy 34"
FT   gene            complement(715969..716126)
FT                   /locus_tag="AGOS_RDN58_34"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(715969..716126)
FT                   /locus_tag="AGOS_RDN58_34"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 34"
FT   gene            complement(716122..716333)
FT                   /locus_tag="AGOS_ITS1_34"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(716122..716333)
FT                   /locus_tag="AGOS_ITS1_34"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 34"
FT   gene            complement(716334..718128)
FT                   /locus_tag="AGOS_RDN18_34"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(716334..718128)
FT                   /locus_tag="AGOS_RDN18_34"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 34"
FT   gene            complement(718129..718746)
FT                   /locus_tag="AGOS_ETS1_34"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(718129..718746)
FT                   /locus_tag="AGOS_ETS1_34"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 34"
FT   misc_feature    complement(718747..719479)
FT                   /note="AGOS_NTS2_34"
FT   gene            719480..719600
FT                   /locus_tag="AGOS_RDN5_34"
FT                   /old_locus_tag="RDN5"
FT   rRNA            719480..719600
FT                   /locus_tag="AGOS_RDN5_34"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 34"
FT   misc_feature    complement(719601..720565)
FT                   /note="AGOS_NTS1_34"
FT   gene            complement(720566..723955)
FT                   /locus_tag="AGOS_RDNA25_35"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(720566..723955)
FT                   /locus_tag="AGOS_RDNA25_35"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 35"
FT   gene            complement(723956..724165)
FT                   /locus_tag="AGOS_ITS2_35"
FT   misc_RNA        complement(723956..724165)
FT                   /locus_tag="AGOS_ITS2_35"
FT                   /product="internal transcribed spacer 2 copy 35"
FT   gene            complement(724166..724323)
FT                   /locus_tag="AGOS_RDN58_35"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(724166..724323)
FT                   /locus_tag="AGOS_RDN58_35"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 35"
FT   gene            complement(724319..724530)
FT                   /locus_tag="AGOS_ITS1_35"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(724319..724530)
FT                   /locus_tag="AGOS_ITS1_35"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 35"
FT   gene            complement(724531..726325)
FT                   /locus_tag="AGOS_RDN18_35"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(724531..726325)
FT                   /locus_tag="AGOS_RDN18_35"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 35"
FT   gene            complement(726326..726943)
FT                   /locus_tag="AGOS_ETS1_35"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(726326..726943)
FT                   /locus_tag="AGOS_ETS1_35"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 35"
FT   misc_feature    complement(726944..727676)
FT                   /note="AGOS_NTS2_35"
FT   gene            727677..727797
FT                   /locus_tag="AGOS_RDN5_35"
FT                   /old_locus_tag="RDN5"
FT   rRNA            727677..727797
FT                   /locus_tag="AGOS_RDN5_35"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 35"
FT   misc_feature    complement(727798..728762)
FT                   /note="AGOS_NTS1_35"
FT   gene            complement(728763..732152)
FT                   /locus_tag="AGOS_RDNA25_36"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(728763..732152)
FT                   /locus_tag="AGOS_RDNA25_36"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 36"
FT   gene            complement(732153..732362)
FT                   /locus_tag="AGOS_ITS2_36"
FT   misc_RNA        complement(732153..732362)
FT                   /locus_tag="AGOS_ITS2_36"
FT                   /product="internal transcribed spacer 2 copy 36"
FT   gene            complement(732363..732520)
FT                   /locus_tag="AGOS_RDN58_36"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(732363..732520)
FT                   /locus_tag="AGOS_RDN58_36"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 36"
FT   gene            complement(732516..732727)
FT                   /locus_tag="AGOS_ITS1_36"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(732516..732727)
FT                   /locus_tag="AGOS_ITS1_36"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 36"
FT   gene            complement(732728..734522)
FT                   /locus_tag="AGOS_RDN18_36"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(732728..734522)
FT                   /locus_tag="AGOS_RDN18_36"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 36"
FT   gene            complement(734523..735140)
FT                   /locus_tag="AGOS_ETS1_36"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(734523..735140)
FT                   /locus_tag="AGOS_ETS1_36"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 36"
FT   misc_feature    complement(735141..735873)
FT                   /note="AGOS_NTS2_36"
FT   gene            735874..735994
FT                   /locus_tag="AGOS_RDN5_36"
FT                   /old_locus_tag="RDN5"
FT   rRNA            735874..735994
FT                   /locus_tag="AGOS_RDN5_36"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 36"
FT   misc_feature    complement(735995..736959)
FT                   /note="AGOS_NTS1_36"
FT   gene            complement(736960..740349)
FT                   /locus_tag="AGOS_RDNA25_37"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(736960..740349)
FT                   /locus_tag="AGOS_RDNA25_37"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 37"
FT   gene            complement(740350..740559)
FT                   /locus_tag="AGOS_ITS2_37"
FT   misc_RNA        complement(740350..740559)
FT                   /locus_tag="AGOS_ITS2_37"
FT                   /product="internal transcribed spacer 2 copy 37"
FT   gene            complement(740560..740717)
FT                   /locus_tag="AGOS_RDN58_37"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(740560..740717)
FT                   /locus_tag="AGOS_RDN58_37"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 37"
FT   gene            complement(740713..740924)
FT                   /locus_tag="AGOS_ITS1_37"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(740713..740924)
FT                   /locus_tag="AGOS_ITS1_37"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 37"
FT   gene            complement(740925..742719)
FT                   /locus_tag="AGOS_RDN18_37"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(740925..742719)
FT                   /locus_tag="AGOS_RDN18_37"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 37"
FT   gene            complement(742720..743337)
FT                   /locus_tag="AGOS_ETS1_37"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(742720..743337)
FT                   /locus_tag="AGOS_ETS1_37"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 37"
FT   misc_feature    complement(743338..744070)
FT                   /note="AGOS_NTS2_37"
FT   gene            744071..744191
FT                   /locus_tag="AGOS_RDN5_37"
FT                   /old_locus_tag="RDN5"
FT   rRNA            744071..744191
FT                   /locus_tag="AGOS_RDN5_37"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 37"
FT   misc_feature    complement(744192..745156)
FT                   /note="AGOS_NTS1_37"
FT   gene            complement(745157..748546)
FT                   /locus_tag="AGOS_RDNA25_38"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(745157..748546)
FT                   /locus_tag="AGOS_RDNA25_38"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 38"
FT   gene            complement(748547..748756)
FT                   /locus_tag="AGOS_ITS2_38"
FT   misc_RNA        complement(748547..748756)
FT                   /locus_tag="AGOS_ITS2_38"
FT                   /product="internal transcribed spacer 2 copy 38"
FT   gene            complement(748757..748914)
FT                   /locus_tag="AGOS_RDN58_38"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(748757..748914)
FT                   /locus_tag="AGOS_RDN58_38"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 38"
FT   gene            complement(748910..749121)
FT                   /locus_tag="AGOS_ITS1_38"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(748910..749121)
FT                   /locus_tag="AGOS_ITS1_38"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 38"
FT   gene            complement(749122..750916)
FT                   /locus_tag="AGOS_RDN18_38"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(749122..750916)
FT                   /locus_tag="AGOS_RDN18_38"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 38"
FT   gene            complement(750917..751534)
FT                   /locus_tag="AGOS_ETS1_38"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(750917..751534)
FT                   /locus_tag="AGOS_ETS1_38"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 38"
FT   misc_feature    complement(751535..752267)
FT                   /note="AGOS_NTS2_38"
FT   gene            752268..752388
FT                   /locus_tag="AGOS_RDN5_38"
FT                   /old_locus_tag="RDN5"
FT   rRNA            752268..752388
FT                   /locus_tag="AGOS_RDN5_38"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 38"
FT   misc_feature    complement(752389..753353)
FT                   /note="AGOS_NTS1_38"
FT   gene            complement(753354..756743)
FT                   /locus_tag="AGOS_RDNA25_39"
FT                   /old_locus_tag="RDN25"
FT   rRNA            complement(753354..756743)
FT                   /locus_tag="AGOS_RDNA25_39"
FT                   /old_locus_tag="RDN25"
FT                   /product="25S ribosomal RNA copy 39"
FT   gene            complement(756744..756953)
FT                   /locus_tag="AGOS_ITS2_39"
FT   misc_RNA        complement(756744..756953)
FT                   /locus_tag="AGOS_ITS2_39"
FT                   /product="internal transcribed spacer 2 copy 39"
FT   gene            complement(756954..757111)
FT                   /locus_tag="AGOS_RDN58_39"
FT                   /old_locus_tag="RDN5.8"
FT   rRNA            complement(756954..757111)
FT                   /locus_tag="AGOS_RDN58_39"
FT                   /old_locus_tag="RDN5.8"
FT                   /product="5.8S ribosomal RNA copy 39"
FT   gene            complement(757107..757318)
FT                   /locus_tag="AGOS_ITS1_39"
FT                   /old_locus_tag="ITS1"
FT   misc_RNA        complement(757107..757318)
FT                   /locus_tag="AGOS_ITS1_39"
FT                   /old_locus_tag="ITS1"
FT                   /product="internal transcribed spacer 1 copy 39"
FT   gene            complement(757319..759113)
FT                   /locus_tag="AGOS_RDN18_39"
FT                   /old_locus_tag="RDN18"
FT   rRNA            complement(757319..759113)
FT                   /locus_tag="AGOS_RDN18_39"
FT                   /old_locus_tag="RDN18"
FT                   /product="18S ribosomal RNA copy 39"
FT   gene            complement(759114..759731)
FT                   /locus_tag="AGOS_ETS1_39"
FT                   /old_locus_tag="ETS1"
FT   misc_RNA        complement(759114..759731)
FT                   /locus_tag="AGOS_ETS1_39"
FT                   /old_locus_tag="ETS1"
FT                   /product="external transcribed spacer copy 39"
FT   misc_feature    complement(759732..760464)
FT                   /note="AGOS_NTS2_39"
FT   gene            760465..760585
FT                   /locus_tag="AGOS_RDN5_39"
FT                   /old_locus_tag="RDN5"
FT   rRNA            760465..760585
FT                   /locus_tag="AGOS_RDN5_39"
FT                   /old_locus_tag="RDN5"
FT                   /product="5S ribosomal RNA copy 39"
FT   misc_feature    complement(760586..761550)
FT                   /note="AGOS_NTS1_39"
FT   gene            <762818..>763664
FT                   /locus_tag="AGOS_AGL141W"
FT                   /old_locus_tag="AGL141W"
FT   mRNA            join(<762818..762859,762948..>763664)
FT                   /locus_tag="AGOS_AGL141W"
FT                   /old_locus_tag="AGL141W"
FT                   /product="AGL141Wp"
FT   CDS_pept        join(762818..762859,762948..763664)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL141W"
FT                   /old_locus_tag="AGL141W"
FT                   /product="AGL141Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR174W
FT                   (HMO1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL141W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54350"
FT                   /db_xref="GOA:Q750T0"
FT                   /db_xref="InterPro:IPR009071"
FT                   /db_xref="InterPro:IPR036910"
FT                   /db_xref="UniProtKB/TrEMBL:Q750T0"
FT                   /protein_id="AAS54350.1"
FT   gene            complement(<764068..>764979)
FT                   /locus_tag="AGOS_AGL140C"
FT                   /old_locus_tag="AGL140C"
FT   mRNA            complement(<764068..>764979)
FT                   /locus_tag="AGOS_AGL140C"
FT                   /old_locus_tag="AGL140C"
FT                   /product="AGL140Cp"
FT   CDS_pept        complement(764068..764979)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL140C"
FT                   /old_locus_tag="AGL140C"
FT                   /product="AGL140Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR175C
FT                   (RSM24)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL140C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54351"
FT                   /db_xref="GOA:Q750S9"
FT                   /db_xref="InterPro:IPR017081"
FT                   /db_xref="InterPro:IPR019349"
FT                   /db_xref="InterPro:IPR039848"
FT                   /db_xref="UniProtKB/TrEMBL:Q750S9"
FT                   /protein_id="AAS54351.1"
FT   gene            <765210..>767405
FT                   /locus_tag="AGOS_AGL139W"
FT                   /old_locus_tag="AGL139W"
FT   mRNA            <765210..>767405
FT                   /locus_tag="AGOS_AGL139W"
FT                   /old_locus_tag="AGL139W"
FT                   /product="AGL139Wp"
FT   CDS_pept        765210..767405
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL139W"
FT                   /old_locus_tag="AGL139W"
FT                   /product="AGL139Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR176W
FT                   (NGG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL139W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54352"
FT                   /db_xref="GOA:Q750S8"
FT                   /db_xref="InterPro:IPR019340"
FT                   /db_xref="UniProtKB/TrEMBL:Q750S8"
FT                   /protein_id="AAS54352.1"
FT   gene            complement(<767481..>768893)
FT                   /locus_tag="AGOS_AGL138C"
FT                   /old_locus_tag="AGL138C"
FT   mRNA            complement(<767481..>768893)
FT                   /locus_tag="AGOS_AGL138C"
FT                   /old_locus_tag="AGL138C"
FT                   /product="AGL138Cp"
FT   CDS_pept        complement(767481..768893)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL138C"
FT                   /old_locus_tag="AGL138C"
FT                   /product="AGL138Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR163C
FT                   (MAS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL138C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54353"
FT                   /db_xref="GOA:Q750S7"
FT                   /db_xref="InterPro:IPR001431"
FT                   /db_xref="InterPro:IPR007863"
FT                   /db_xref="InterPro:IPR011249"
FT                   /db_xref="InterPro:IPR011765"
FT                   /db_xref="UniProtKB/TrEMBL:Q750S7"
FT                   /protein_id="AAS54353.1"
FT                   IQRSLNGDLQRQ"
FT   gene            <769497..>770012
FT                   /locus_tag="AGOS_AGL137W"
FT                   /old_locus_tag="AGL137W"
FT   mRNA            <769497..>770012
FT                   /locus_tag="AGOS_AGL137W"
FT                   /old_locus_tag="AGL137W"
FT                   /product="AGL137Wp"
FT   CDS_pept        769497..770012
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL137W"
FT                   /old_locus_tag="AGL137W"
FT                   /product="AGL137Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR164W
FT                   and YDR178W (SDH4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL137W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54354"
FT                   /db_xref="GOA:Q750S6"
FT                   /db_xref="InterPro:IPR007992"
FT                   /db_xref="InterPro:IPR034804"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750S6"
FT                   /protein_id="AAS54354.1"
FT                   KAAREEKA"
FT   gene            complement(<770081..>770572)
FT                   /locus_tag="AGOS_AGL136C"
FT                   /old_locus_tag="AGL136C"
FT   mRNA            complement(<770081..>770572)
FT                   /locus_tag="AGOS_AGL136C"
FT                   /old_locus_tag="AGL136C"
FT                   /product="AGL136Cp"
FT   CDS_pept        complement(770081..770572)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL136C"
FT                   /old_locus_tag="AGL136C"
FT                   /product="AGL136Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR179C
FT                   (CSN9)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL136C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54355"
FT                   /db_xref="GOA:Q750S5"
FT                   /db_xref="InterPro:IPR016806"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750S5"
FT                   /protein_id="AAS54355.1"
FT                   "
FT   gene            <770714..>771979
FT                   /locus_tag="AGOS_AGL135W"
FT                   /old_locus_tag="AGL135W"
FT   mRNA            <770714..>771979
FT                   /locus_tag="AGOS_AGL135W"
FT                   /old_locus_tag="AGL135W"
FT                   /product="AGL135Wp"
FT   CDS_pept        770714..771979
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL135W"
FT                   /old_locus_tag="AGL135W"
FT                   /product="AGL135Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR179W-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL135W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54356"
FT                   /db_xref="GOA:Q750S4"
FT                   /db_xref="InterPro:IPR003114"
FT                   /db_xref="UniProtKB/TrEMBL:Q750S4"
FT                   /protein_id="AAS54356.1"
FT   gene            complement(<771930..>772712)
FT                   /locus_tag="AGOS_AGL134C"
FT                   /old_locus_tag="AGL134C"
FT   mRNA            complement(<771930..>772712)
FT                   /locus_tag="AGOS_AGL134C"
FT                   /old_locus_tag="AGL134C"
FT                   /product="AGL134Cp"
FT   CDS_pept        complement(771930..772712)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL134C"
FT                   /old_locus_tag="AGL134C"
FT                   /product="AGL134Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR165C
FT                   (PUS5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL134C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54357"
FT                   /db_xref="GOA:Q750S3"
FT                   /db_xref="InterPro:IPR006145"
FT                   /db_xref="InterPro:IPR006224"
FT                   /db_xref="InterPro:IPR020103"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750S3"
FT                   /protein_id="AAS54357.1"
FT   gene            <773041..>777480
FT                   /locus_tag="AGOS_AGL133W"
FT                   /old_locus_tag="AGL133W"
FT   mRNA            <773041..>777480
FT                   /locus_tag="AGOS_AGL133W"
FT                   /old_locus_tag="AGL133W"
FT                   /product="AGL133Wp"
FT   CDS_pept        773041..777480
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL133W"
FT                   /old_locus_tag="AGL133W"
FT                   /product="AGL133Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR180W
FT                   (SCC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL133W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54358"
FT                   /db_xref="GOA:Q750S2"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR024986"
FT                   /db_xref="InterPro:IPR026003"
FT                   /db_xref="InterPro:IPR033031"
FT                   /db_xref="PDB:5C6G"
FT                   /db_xref="PDB:5ME3"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750S2"
FT                   /protein_id="AAS54358.1"
FT                   NNKDYCWKYISTLHRDEI"
FT   gene            complement(<777498..>778748)
FT                   /locus_tag="AGOS_AGL132C"
FT                   /old_locus_tag="AGL132C"
FT   mRNA            complement(<777498..>778748)
FT                   /locus_tag="AGOS_AGL132C"
FT                   /old_locus_tag="AGL132C"
FT                   /product="AGL132Cp"
FT   CDS_pept        complement(777498..778748)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL132C"
FT                   /old_locus_tag="AGL132C"
FT                   /product="AGL132Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR181C
FT                   (SAS4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL132C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54359"
FT                   /db_xref="GOA:Q750S1"
FT                   /db_xref="InterPro:IPR029184"
FT                   /db_xref="InterPro:IPR038988"
FT                   /db_xref="UniProtKB/TrEMBL:Q750S1"
FT                   /protein_id="AAS54359.2"
FT                   QEFSATAAVSAPDDKLS"
FT   gene            <778920..>780383
FT                   /locus_tag="AGOS_AGL131W"
FT                   /old_locus_tag="AGL131W"
FT   mRNA            <778920..>780383
FT                   /locus_tag="AGOS_AGL131W"
FT                   /old_locus_tag="AGL131W"
FT                   /product="AGL131Wp"
FT   CDS_pept        778920..780383
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL131W"
FT                   /old_locus_tag="AGL131W"
FT                   /product="AGL131Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR182W
FT                   (CDC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL131W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54360"
FT                   /db_xref="GOA:Q750S0"
FT                   /db_xref="InterPro:IPR004843"
FT                   /db_xref="InterPro:IPR029052"
FT                   /db_xref="InterPro:IPR033308"
FT                   /db_xref="UniProtKB/TrEMBL:Q750S0"
FT                   /protein_id="AAS54360.2"
FT   gene            complement(<780442..>782937)
FT                   /locus_tag="AGOS_AGL130C"
FT                   /old_locus_tag="AGL130C"
FT   mRNA            complement(<780442..>782937)
FT                   /locus_tag="AGOS_AGL130C"
FT                   /old_locus_tag="AGL130C"
FT                   /product="AGL130Cp"
FT   CDS_pept        complement(780442..782937)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL130C"
FT                   /old_locus_tag="AGL130C"
FT                   /product="AGL130Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR166C
FT                   (SEC10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL130C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54361"
FT                   /db_xref="GOA:Q750R9"
FT                   /db_xref="InterPro:IPR009976"
FT                   /db_xref="InterPro:IPR033960"
FT                   /db_xref="UniProtKB/TrEMBL:Q750R9"
FT                   /protein_id="AAS54361.2"
FT   gene            <783106..>783702
FT                   /locus_tag="AGOS_AGL129W"
FT                   /old_locus_tag="AGL129W"
FT   mRNA            <783106..>783702
FT                   /locus_tag="AGOS_AGL129W"
FT                   /old_locus_tag="AGL129W"
FT                   /product="AGL129Wp"
FT   CDS_pept        783106..783702
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL129W"
FT                   /old_locus_tag="AGL129W"
FT                   /product="AGL129Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR183W
FT                   (PLP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL129W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54362"
FT                   /db_xref="GOA:Q750R8"
FT                   /db_xref="InterPro:IPR024253"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q750R8"
FT                   /protein_id="AAS54362.1"
FT   gene            <783918..>784376
FT                   /locus_tag="AGOS_AGL128W"
FT                   /old_locus_tag="AGL128W"
FT   mRNA            <783918..>784376
FT                   /locus_tag="AGOS_AGL128W"
FT                   /old_locus_tag="AGL128W"
FT                   /product="AGL128Wp"
FT   CDS_pept        783918..784376
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL128W"
FT                   /old_locus_tag="AGL128W"
FT                   /product="AGL128Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR167W
FT                   (RPS31)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL128W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54363"
FT                   /db_xref="GOA:Q751A8"
FT                   /db_xref="InterPro:IPR000626"
FT                   /db_xref="InterPro:IPR002906"
FT                   /db_xref="InterPro:IPR011332"
FT                   /db_xref="InterPro:IPR019954"
FT                   /db_xref="InterPro:IPR019956"
FT                   /db_xref="InterPro:IPR029071"
FT                   /db_xref="InterPro:IPR038582"
FT                   /db_xref="UniProtKB/TrEMBL:Q751A8"
FT                   /protein_id="AAS54363.1"
FT   gene            complement(<784702..>785925)
FT                   /locus_tag="AGOS_AGL127C"
FT                   /old_locus_tag="AGL127C"
FT   mRNA            complement(<784702..>785925)
FT                   /locus_tag="AGOS_AGL127C"
FT                   /old_locus_tag="AGL127C"
FT                   /product="AGL127Cp"
FT   CDS_pept        complement(784702..785925)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL127C"
FT                   /old_locus_tag="AGL127C"
FT                   /product="AGL127Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR184C
FT                   (ATC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL127C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54364"
FT                   /db_xref="GOA:Q751A7"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751A7"
FT                   /protein_id="AAS54364.2"
FT                   ERMKNPSK"
FT   gene            complement(<786364..>787032)
FT                   /locus_tag="AGOS_AGL126C"
FT                   /old_locus_tag="AGL126C"
FT   mRNA            complement(<786364..>787032)
FT                   /locus_tag="AGOS_AGL126C"
FT                   /old_locus_tag="AGL126C"
FT                   /product="AGL126Cp"
FT   CDS_pept        complement(786364..787032)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL126C"
FT                   /old_locus_tag="AGL126C"
FT                   /product="AGL126Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR168C
FT                   (UPS2) and YDR185C (UPS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL126C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54365"
FT                   /db_xref="GOA:Q751A6"
FT                   /db_xref="InterPro:IPR006797"
FT                   /db_xref="InterPro:IPR037365"
FT                   /db_xref="UniProtKB/TrEMBL:Q751A6"
FT                   /protein_id="AAS54365.1"
FT                   "
FT   gene            complement(<787240..>788343)
FT                   /locus_tag="AGOS_AGL125C"
FT                   /old_locus_tag="AGL125C"
FT   mRNA            complement(<787240..>788343)
FT                   /locus_tag="AGOS_AGL125C"
FT                   /old_locus_tag="AGL125C"
FT                   /product="AGL125Cp"
FT   CDS_pept        complement(787240..788343)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL125C"
FT                   /old_locus_tag="AGL125C"
FT                   /product="AGL125Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR246W
FT                   (ERF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL125C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54366"
FT                   /db_xref="GOA:Q750R7"
FT                   /db_xref="InterPro:IPR001594"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750R7"
FT                   /protein_id="AAS54366.1"
FT   gene            complement(<788774..>790870)
FT                   /locus_tag="AGOS_AGL124C"
FT                   /old_locus_tag="AGL124C"
FT   mRNA            complement(<788774..>790870)
FT                   /locus_tag="AGOS_AGL124C"
FT                   /old_locus_tag="AGL124C"
FT                   /product="AGL124Cp"
FT   CDS_pept        complement(788774..790870)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL124C"
FT                   /old_locus_tag="AGL124C"
FT                   /product="AGL124Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR186C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL124C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54367"
FT                   /db_xref="UniProtKB/TrEMBL:Q750R6"
FT                   /protein_id="AAS54367.2"
FT                   ANNR"
FT   gene            <791404..>791823
FT                   /locus_tag="AGOS_AGL123W"
FT                   /old_locus_tag="AGL123W"
FT   mRNA            <791404..>791823
FT                   /locus_tag="AGOS_AGL123W"
FT                   /old_locus_tag="AGL123W"
FT                   /product="AGL123Wp"
FT   CDS_pept        791404..791823
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL123W"
FT                   /old_locus_tag="AGL123W"
FT                   /product="AGL123Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR245C
FT                   (CDD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL123W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54368"
FT                   /db_xref="GOA:Q750R5"
FT                   /db_xref="InterPro:IPR002125"
FT                   /db_xref="InterPro:IPR006262"
FT                   /db_xref="InterPro:IPR016192"
FT                   /db_xref="InterPro:IPR016193"
FT                   /db_xref="UniProtKB/TrEMBL:Q750R5"
FT                   /protein_id="AAS54368.1"
FT   gene            <791980..>793092
FT                   /locus_tag="AGOS_AGL122W"
FT                   /old_locus_tag="AGL122W"
FT   mRNA            <791980..>793092
FT                   /locus_tag="AGOS_AGL122W"
FT                   /old_locus_tag="AGL122W"
FT                   /product="AGL122Wp"
FT   CDS_pept        791980..793092
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL122W"
FT                   /old_locus_tag="AGL122W"
FT                   /product="AGL122Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR244C
FT                   (MAP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL122W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54369"
FT                   /db_xref="GOA:Q750R4"
FT                   /db_xref="InterPro:IPR000994"
FT                   /db_xref="InterPro:IPR001714"
FT                   /db_xref="InterPro:IPR002467"
FT                   /db_xref="InterPro:IPR031615"
FT                   /db_xref="InterPro:IPR036005"
FT                   /db_xref="UniProtKB/TrEMBL:Q750R4"
FT                   /protein_id="AAS54369.1"
FT   gene            <793249..>794949
FT                   /locus_tag="AGOS_AGL121W"
FT                   /old_locus_tag="AGL121W"
FT   mRNA            <793249..>794949
FT                   /locus_tag="AGOS_AGL121W"
FT                   /old_locus_tag="AGL121W"
FT                   /product="AGL121Wp"
FT   CDS_pept        793249..794949
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL121W"
FT                   /old_locus_tag="AGL121W"
FT                   /product="AGL121Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR188W
FT                   (CCT6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL121W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54370"
FT                   /db_xref="GOA:Q750R3"
FT                   /db_xref="InterPro:IPR002194"
FT                   /db_xref="InterPro:IPR002423"
FT                   /db_xref="InterPro:IPR012722"
FT                   /db_xref="InterPro:IPR017998"
FT                   /db_xref="InterPro:IPR027409"
FT                   /db_xref="InterPro:IPR027410"
FT                   /db_xref="InterPro:IPR027413"
FT                   /db_xref="UniProtKB/TrEMBL:Q750R3"
FT                   /protein_id="AAS54370.1"
FT   gene            <795196..>797217
FT                   /locus_tag="AGOS_AGL120W"
FT                   /old_locus_tag="AGL120W"
FT   mRNA            join(<795196..795238,795332..>797217)
FT                   /locus_tag="AGOS_AGL120W"
FT                   /old_locus_tag="AGL120W"
FT                   /product="AGL120Wp"
FT   CDS_pept        join(795196..795238,795332..797217)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL120W"
FT                   /old_locus_tag="AGL120W"
FT                   /product="AGL120Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR189W
FT                   (SLY1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL120W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54371"
FT                   /db_xref="GOA:Q750R2"
FT                   /db_xref="InterPro:IPR001619"
FT                   /db_xref="InterPro:IPR027482"
FT                   /db_xref="InterPro:IPR036045"
FT                   /db_xref="UniProtKB/TrEMBL:Q750R2"
FT                   /protein_id="AAS54371.1"
FT                   EELSKLG"
FT   gene            complement(<797396..>798775)
FT                   /locus_tag="AGOS_AGL119C"
FT                   /old_locus_tag="AGL119C"
FT   mRNA            complement(<797396..>798775)
FT                   /locus_tag="AGOS_AGL119C"
FT                   /old_locus_tag="AGL119C"
FT                   /product="AGL119Cp"
FT   CDS_pept        complement(797396..798775)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL119C"
FT                   /old_locus_tag="AGL119C"
FT                   /product="AGL119Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR190C
FT                   (RVB1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL119C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54372"
FT                   /db_xref="GOA:Q750R1"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR010339"
FT                   /db_xref="InterPro:IPR027238"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR037938"
FT                   /db_xref="InterPro:IPR041048"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750R1"
FT                   /protein_id="AAS54372.1"
FT                   L"
FT   gene            <799134..>800378
FT                   /locus_tag="AGOS_AGL118W"
FT                   /old_locus_tag="AGL118W"
FT   mRNA            <799134..>800378
FT                   /locus_tag="AGOS_AGL118W"
FT                   /old_locus_tag="AGL118W"
FT                   /product="AGL118Wp"
FT   CDS_pept        799134..800378
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL118W"
FT                   /old_locus_tag="AGL118W"
FT                   /product="AGL118Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR191W
FT                   (HST4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL118W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54373"
FT                   /db_xref="GOA:Q750R0"
FT                   /db_xref="InterPro:IPR003000"
FT                   /db_xref="InterPro:IPR026590"
FT                   /db_xref="InterPro:IPR026591"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="UniProtKB/TrEMBL:Q750R0"
FT                   /protein_id="AAS54373.1"
FT                   VGDCQDLTTLAPSFN"
FT   gene            complement(<800474..>801289)
FT                   /locus_tag="AGOS_AGL117C"
FT                   /old_locus_tag="AGL117C"
FT   mRNA            complement(<800474..>801289)
FT                   /locus_tag="AGOS_AGL117C"
FT                   /old_locus_tag="AGL117C"
FT                   /product="AGL117Cp"
FT   CDS_pept        complement(800474..801289)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL117C"
FT                   /old_locus_tag="AGL117C"
FT                   /product="AGL117Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR243W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL117C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54374"
FT                   /db_xref="GOA:Q750Q9"
FT                   /db_xref="InterPro:IPR004130"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR030228"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750Q9"
FT                   /protein_id="AAS54374.1"
FT   gene            complement(<801440..>803008)
FT                   /locus_tag="AGOS_AGL116C"
FT                   /old_locus_tag="AGL116C"
FT   mRNA            complement(<801440..>803008)
FT                   /locus_tag="AGOS_AGL116C"
FT                   /old_locus_tag="AGL116C"
FT                   /product="AGL116Cp"
FT   CDS_pept        complement(801440..803008)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL116C"
FT                   /old_locus_tag="AGL116C"
FT                   /product="AGL116Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR192C
FT                   (NUP42)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL116C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54375"
FT                   /db_xref="GOA:Q750Q8"
FT                   /db_xref="InterPro:IPR000571"
FT                   /db_xref="InterPro:IPR036855"
FT                   /db_xref="InterPro:IPR037686"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Q8"
FT                   /protein_id="AAS54375.2"
FT                   LTLIH"
FT   gene            <803157..>804056
FT                   /locus_tag="AGOS_AGL115W"
FT                   /old_locus_tag="AGL115W"
FT   mRNA            <803157..>804056
FT                   /locus_tag="AGOS_AGL115W"
FT                   /old_locus_tag="AGL115W"
FT                   /product="AGL115Wp"
FT   CDS_pept        803157..804056
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL115W"
FT                   /old_locus_tag="AGL115W"
FT                   /product="AGL115Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR242C
FT                   (ARV1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL115W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54376"
FT                   /db_xref="GOA:Q750Q7"
FT                   /db_xref="InterPro:IPR007290"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750Q7"
FT                   /protein_id="AAS54376.1"
FT                   GEYELFKFRFLTKRDIFL"
FT   gene            complement(<804116..>806476)
FT                   /locus_tag="AGOS_AGL114C"
FT                   /old_locus_tag="AGL114C"
FT   mRNA            complement(<804116..>806476)
FT                   /locus_tag="AGOS_AGL114C"
FT                   /old_locus_tag="AGL114C"
FT                   /product="AGL114Cp"
FT   CDS_pept        complement(804116..806476)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL114C"
FT                   /old_locus_tag="AGL114C"
FT                   /product="AGL114Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YLR241W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL114C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54377"
FT                   /db_xref="GOA:Q750Q6"
FT                   /db_xref="InterPro:IPR003864"
FT                   /db_xref="InterPro:IPR027815"
FT                   /db_xref="InterPro:IPR032880"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Q6"
FT                   /protein_id="AAS54377.1"
FT   gene            complement(<806736..>809348)
FT                   /locus_tag="AGOS_AGL113C"
FT                   /old_locus_tag="AGL113C"
FT   mRNA            complement(<806736..>809348)
FT                   /locus_tag="AGOS_AGL113C"
FT                   /old_locus_tag="AGL113C"
FT                   /product="AGL113Cp"
FT   CDS_pept        complement(806736..809348)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL113C"
FT                   /old_locus_tag="AGL113C"
FT                   /product="AGL113Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR240W
FT                   (VPS34)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL113C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54378"
FT                   /db_xref="GOA:Q750Q5"
FT                   /db_xref="InterPro:IPR000403"
FT                   /db_xref="InterPro:IPR001263"
FT                   /db_xref="InterPro:IPR002420"
FT                   /db_xref="InterPro:IPR008290"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR015433"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR018936"
FT                   /db_xref="InterPro:IPR036940"
FT                   /db_xref="InterPro:IPR042236"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Q5"
FT                   /protein_id="AAS54378.1"
FT   gene            complement(<809625..>811601)
FT                   /locus_tag="AGOS_AGL112C"
FT                   /old_locus_tag="AGL112C"
FT   mRNA            complement(<809625..>811601)
FT                   /locus_tag="AGOS_AGL112C"
FT                   /old_locus_tag="AGL112C"
FT                   /product="AGL112Cp"
FT   CDS_pept        complement(809625..811601)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL112C"
FT                   /old_locus_tag="AGL112C"
FT                   /product="AGL112Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR194C
FT                   (MSS116)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL112C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54379"
FT                   /db_xref="GOA:Q750Q4"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750Q4"
FT                   /protein_id="AAS54379.1"
FT   gene            <811845..>813260
FT                   /locus_tag="AGOS_AGL111W"
FT                   /old_locus_tag="AGL111W"
FT   mRNA            <811845..>813260
FT                   /locus_tag="AGOS_AGL111W"
FT                   /old_locus_tag="AGL111W"
FT                   /product="AGL111Wp"
FT   CDS_pept        811845..813260
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL111W"
FT                   /old_locus_tag="AGL111W"
FT                   /product="AGL111Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR195W
FT                   (REF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL111W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54380"
FT                   /db_xref="GOA:Q750Q3"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Q3"
FT                   /protein_id="AAS54380.1"
FT                   RRNEYPVRPEDNF"
FT   gene            complement(<813439..>814272)
FT                   /locus_tag="AGOS_AGL110C"
FT                   /old_locus_tag="AGL110C"
FT   mRNA            complement(<813439..>814272)
FT                   /locus_tag="AGOS_AGL110C"
FT                   /old_locus_tag="AGL110C"
FT                   /product="AGL110Cp"
FT   CDS_pept        complement(813439..814272)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL110C"
FT                   /old_locus_tag="AGL110C"
FT                   /product="AGL110Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR196C
FT                   (CAB5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL110C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54381"
FT                   /db_xref="GOA:Q750Q2"
FT                   /db_xref="InterPro:IPR001977"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Q2"
FT                   /protein_id="AAS54381.1"
FT   gene            <814514..>815689
FT                   /locus_tag="AGOS_AGL109W"
FT                   /old_locus_tag="AGL109W"
FT   mRNA            <814514..>815689
FT                   /locus_tag="AGOS_AGL109W"
FT                   /old_locus_tag="AGL109W"
FT                   /product="AGL109Wp"
FT   CDS_pept        814514..815689
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL109W"
FT                   /old_locus_tag="AGL109W"
FT                   /product="AGL109Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR197W
FT                   (CBS2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL109W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54382"
FT                   /db_xref="GOA:Q750Q1"
FT                   /db_xref="InterPro:IPR008927"
FT                   /db_xref="InterPro:IPR013328"
FT                   /db_xref="InterPro:IPR013752"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Q1"
FT                   /protein_id="AAS54382.1"
FT   gene            complement(<815677..>817041)
FT                   /locus_tag="AGOS_AGL108C"
FT                   /old_locus_tag="AGL108C"
FT   mRNA            complement(<815677..>817041)
FT                   /locus_tag="AGOS_AGL108C"
FT                   /old_locus_tag="AGL108C"
FT                   /product="AGL108Cp"
FT   CDS_pept        complement(815677..817041)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL108C"
FT                   /old_locus_tag="AGL108C"
FT                   /product="AGL108Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR198C
FT                   (RKM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL108C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54383"
FT                   /db_xref="GOA:Q750Q0"
FT                   /db_xref="InterPro:IPR001214"
FT                   /db_xref="InterPro:IPR016852"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Q0"
FT                   /protein_id="AAS54383.1"
FT   gene            <817185..>818213
FT                   /locus_tag="AGOS_AGL107W"
FT                   /old_locus_tag="AGL107W"
FT   mRNA            <817185..>818213
FT                   /locus_tag="AGOS_AGL107W"
FT                   /old_locus_tag="AGL107W"
FT                   /product="AGL107Wp"
FT   CDS_pept        817185..818213
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL107W"
FT                   /old_locus_tag="AGL107W"
FT                   /product="AGL107Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR239C
FT                   (LIP2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL107W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54384"
FT                   /db_xref="GOA:Q750P9"
FT                   /db_xref="InterPro:IPR000544"
FT                   /db_xref="InterPro:IPR004143"
FT                   /db_xref="InterPro:IPR020605"
FT                   /db_xref="UniProtKB/TrEMBL:Q750P9"
FT                   /protein_id="AAS54384.1"
FT                   DI"
FT   gene            complement(<818562..>819974)
FT                   /locus_tag="AGOS_AGL106C"
FT                   /old_locus_tag="AGL106C"
FT   mRNA            complement(<818562..>819974)
FT                   /locus_tag="AGOS_AGL106C"
FT                   /old_locus_tag="AGL106C"
FT                   /product="AGL106Cp"
FT   CDS_pept        complement(818562..819974)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL106C"
FT                   /old_locus_tag="AGL106C"
FT                   /product="AGL106Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR238W
FT                   (FAR10) and YDR200C (VPS64)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL106C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54385"
FT                   /db_xref="GOA:Q750P8"
FT                   /db_xref="InterPro:IPR000253"
FT                   /db_xref="InterPro:IPR008984"
FT                   /db_xref="UniProtKB/TrEMBL:Q750P8"
FT                   /protein_id="AAS54385.3"
FT                   AAIKYITMKGGA"
FT   gene            <820160..>820606
FT                   /locus_tag="AGOS_AGL105W"
FT                   /old_locus_tag="AGL105W"
FT   mRNA            <820160..>820606
FT                   /locus_tag="AGOS_AGL105W"
FT                   /old_locus_tag="AGL105W"
FT                   /product="AGL105Wp"
FT   CDS_pept        820160..820606
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL105W"
FT                   /old_locus_tag="AGL105W"
FT                   /product="AGL105Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR201W
FT                   (SPC19)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL105W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54386"
FT                   /db_xref="GOA:Q750P7"
FT                   /db_xref="InterPro:IPR013251"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750P7"
FT                   /protein_id="AAS54386.1"
FT   gene            complement(<820608..>821627)
FT                   /locus_tag="AGOS_AGL104C"
FT                   /old_locus_tag="AGL104C"
FT   mRNA            complement(<820608..>821627)
FT                   /locus_tag="AGOS_AGL104C"
FT                   /old_locus_tag="AGL104C"
FT                   /product="AGL104Cp"
FT   CDS_pept        complement(820608..821627)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL104C"
FT                   /old_locus_tag="AGL104C"
FT                   /product="AGL104Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR202C
FT                   (RAV2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL104C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54387"
FT                   /db_xref="GOA:Q750Z8"
FT                   /db_xref="InterPro:IPR028241"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Z8"
FT                   /protein_id="AAS54387.1"
FT   gene            <821752..>822723
FT                   /locus_tag="AGOS_AGL103W"
FT                   /old_locus_tag="AGL103W"
FT   mRNA            <821752..>822723
FT                   /locus_tag="AGOS_AGL103W"
FT                   /old_locus_tag="AGL103W"
FT                   /product="AGL103Wp"
FT   CDS_pept        821752..822723
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL103W"
FT                   /old_locus_tag="AGL103W"
FT                   /product="AGL103Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR204W
FT                   (COQ4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL103W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54388"
FT                   /db_xref="GOA:Q751B5"
FT                   /db_xref="InterPro:IPR007715"
FT                   /db_xref="InterPro:IPR027540"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751B5"
FT                   /protein_id="AAS54388.1"
FT   gene            <823121..>825196
FT                   /locus_tag="AGOS_AGL102W"
FT                   /old_locus_tag="AGL102W"
FT   mRNA            <823121..>825196
FT                   /locus_tag="AGOS_AGL102W"
FT                   /old_locus_tag="AGL102W"
FT                   /product="AGL102Wp"
FT   CDS_pept        823121..825196
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL102W"
FT                   /old_locus_tag="AGL102W"
FT                   /product="AGL102Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR205W
FT                   (MSC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL102W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54389"
FT                   /db_xref="GOA:Q751B4"
FT                   /db_xref="InterPro:IPR002524"
FT                   /db_xref="InterPro:IPR027469"
FT                   /db_xref="UniProtKB/TrEMBL:Q751B4"
FT                   /protein_id="AAS54389.1"
FT   gene            complement(<825325..>827220)
FT                   /locus_tag="AGOS_AGL101C"
FT                   /old_locus_tag="AGL101C"
FT   mRNA            complement(<825325..>827220)
FT                   /locus_tag="AGOS_AGL101C"
FT                   /old_locus_tag="AGL101C"
FT                   /product="AGL101Cp"
FT   CDS_pept        complement(825325..827220)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL101C"
FT                   /old_locus_tag="AGL101C"
FT                   /product="AGL101Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR234W
FT                   (TOP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL101C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54390"
FT                   /db_xref="GOA:Q751B3"
FT                   /db_xref="InterPro:IPR000380"
FT                   /db_xref="InterPro:IPR003601"
FT                   /db_xref="InterPro:IPR003602"
FT                   /db_xref="InterPro:IPR006171"
FT                   /db_xref="InterPro:IPR013497"
FT                   /db_xref="InterPro:IPR013824"
FT                   /db_xref="InterPro:IPR013825"
FT                   /db_xref="InterPro:IPR013826"
FT                   /db_xref="InterPro:IPR023405"
FT                   /db_xref="InterPro:IPR023406"
FT                   /db_xref="InterPro:IPR034144"
FT                   /db_xref="UniProtKB/TrEMBL:Q751B3"
FT                   /protein_id="AAS54390.1"
FT   gene            <827553..>829880
FT                   /locus_tag="AGOS_AGL100W"
FT                   /old_locus_tag="AGL100W"
FT   mRNA            <827553..>829880
FT                   /locus_tag="AGOS_AGL100W"
FT                   /old_locus_tag="AGL100W"
FT                   /product="AGL100Wp"
FT   CDS_pept        827553..829880
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL100W"
FT                   /old_locus_tag="AGL100W"
FT                   /product="AGL100Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR233C
FT                   (EST1) and YDR206W (EBS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL100W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54391"
FT                   /db_xref="GOA:Q751B2"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="InterPro:IPR018834"
FT                   /db_xref="InterPro:IPR019458"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q751B2"
FT                   /protein_id="AAS54391.1"
FT   gene            complement(<830333..>832576)
FT                   /locus_tag="AGOS_AGL099C"
FT                   /old_locus_tag="AGL099C"
FT   mRNA            complement(<830333..>832576)
FT                   /locus_tag="AGOS_AGL099C"
FT                   /old_locus_tag="AGL099C"
FT                   /product="AGL099Cp"
FT   CDS_pept        complement(830333..832576)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL099C"
FT                   /old_locus_tag="AGL099C"
FT                   /product="AGL099Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR207C
FT                   (UME6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL099C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54392"
FT                   /db_xref="GOA:Q750P6"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q750P6"
FT                   /protein_id="AAS54392.1"
FT   gene            <833135..>834478
FT                   /locus_tag="AGOS_AGL098W"
FT                   /old_locus_tag="AGL098W"
FT   mRNA            <833135..>834478
FT                   /locus_tag="AGOS_AGL098W"
FT                   /old_locus_tag="AGL098W"
FT                   /product="AGL098Wp"
FT   CDS_pept        833135..834478
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL098W"
FT                   /old_locus_tag="AGL098W"
FT                   /product="AGL098Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR231C
FT                   (BNA5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL098W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54393"
FT                   /db_xref="GOA:Q750P5"
FT                   /db_xref="InterPro:IPR000192"
FT                   /db_xref="InterPro:IPR010111"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750P5"
FT                   /protein_id="AAS54393.2"
FT   gene            complement(<834661..>837951)
FT                   /locus_tag="AGOS_AGL097C"
FT                   /old_locus_tag="AGL097C"
FT   mRNA            complement(<834661..>837951)
FT                   /locus_tag="AGOS_AGL097C"
FT                   /old_locus_tag="AGL097C"
FT                   /product="AGL097Cp"
FT   CDS_pept        complement(834661..837951)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL097C"
FT                   /old_locus_tag="AGL097C"
FT                   /product="AGL097Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YDR039C (ENA2), YDR038C (ENA5) and YDR040C (ENA1); Tandem
FT                   gene triplication in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL097C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54394"
FT                   /db_xref="GOA:Q750P4"
FT                   /db_xref="InterPro:IPR001757"
FT                   /db_xref="InterPro:IPR004014"
FT                   /db_xref="InterPro:IPR006068"
FT                   /db_xref="InterPro:IPR006414"
FT                   /db_xref="InterPro:IPR008250"
FT                   /db_xref="InterPro:IPR018303"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR023298"
FT                   /db_xref="InterPro:IPR023299"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q750P4"
FT                   /protein_id="AAS54394.2"
FT   gene            <838509..>840152
FT                   /locus_tag="AGOS_AGL096W"
FT                   /old_locus_tag="AGL096W"
FT   mRNA            <838509..>840152
FT                   /locus_tag="AGOS_AGL096W"
FT                   /old_locus_tag="AGL096W"
FT                   /product="AGL096Wp"
FT   CDS_pept        838509..840152
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL096W"
FT                   /old_locus_tag="AGL096W"
FT                   /product="AGL096Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR208W
FT                   (MSS4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL096W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54395"
FT                   /db_xref="GOA:Q750P3"
FT                   /db_xref="InterPro:IPR002498"
FT                   /db_xref="InterPro:IPR023610"
FT                   /db_xref="InterPro:IPR027483"
FT                   /db_xref="InterPro:IPR027484"
FT                   /db_xref="UniProtKB/TrEMBL:Q750P3"
FT                   /protein_id="AAS54395.1"
FT   gene            <840531..>840845
FT                   /locus_tag="AGOS_AGL095W"
FT   mRNA            <840531..>840845
FT                   /locus_tag="AGOS_AGL095W"
FT                   /product="AGL095Wp"
FT   CDS_pept        840531..840845
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL095W"
FT                   /product="AGL095Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YDR034W-B and YBR056W-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL095W"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41736"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGF9"
FT                   /protein_id="ADJ41736.1"
FT                   "
FT   gene            842778..842916
FT                   /locus_tag="AGOS_t0178"
FT   tRNA            join(842778..842814,842881..842916)
FT                   /locus_tag="AGOS_t0178"
FT                   /product="tRNA-Ile"
FT                   /note="codon recognized: AUA"
FT   gene            <843063..>845258
FT                   /locus_tag="AGOS_AGL094W"
FT                   /old_locus_tag="AGL094W"
FT   mRNA            <843063..>845258
FT                   /locus_tag="AGOS_AGL094W"
FT                   /old_locus_tag="AGL094W"
FT                   /product="AGL094Wp"
FT   CDS_pept        843063..845258
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL094W"
FT                   /old_locus_tag="AGL094W"
FT                   /product="AGL094Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR211W
FT                   (GCD6)"
FT                   /db_xref="GOA:Q750P2"
FT                   /db_xref="InterPro:IPR001451"
FT                   /db_xref="InterPro:IPR003307"
FT                   /db_xref="InterPro:IPR005835"
FT                   /db_xref="InterPro:IPR016021"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="InterPro:IPR035543"
FT                   /db_xref="UniProtKB/TrEMBL:Q750P2"
FT                   /protein_id="AAS54396.1"
FT   gene            <845744..>846319
FT                   /locus_tag="AGOS_AGL093W"
FT                   /old_locus_tag="AGL093W"
FT   mRNA            <845744..>846319
FT                   /locus_tag="AGOS_AGL093W"
FT                   /old_locus_tag="AGL093W"
FT                   /product="AGL093Wp"
FT   CDS_pept        845744..846319
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL093W"
FT                   /old_locus_tag="AGL093W"
FT                   /product="AGL093Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR229C
FT                   (CDC42)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL093W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54397"
FT                   /db_xref="GOA:Q9HF56"
FT                   /db_xref="InterPro:IPR001806"
FT                   /db_xref="InterPro:IPR003578"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR037874"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9HF56"
FT                   /protein_id="AAS54397.1"
FT   gene            <846798..>848474
FT                   /locus_tag="AGOS_AGL092W"
FT                   /old_locus_tag="AGL092W"
FT   mRNA            <846798..>848474
FT                   /locus_tag="AGOS_AGL092W"
FT                   /old_locus_tag="AGL092W"
FT                   /product="AGL092Wp"
FT   CDS_pept        846798..848474
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL092W"
FT                   /old_locus_tag="AGL092W"
FT                   /product="AGL092Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR212W
FT                   (TCP1)"
FT                   /db_xref="GOA:Q751B1"
FT                   /db_xref="InterPro:IPR002194"
FT                   /db_xref="InterPro:IPR002423"
FT                   /db_xref="InterPro:IPR012715"
FT                   /db_xref="InterPro:IPR017998"
FT                   /db_xref="InterPro:IPR027409"
FT                   /db_xref="InterPro:IPR027410"
FT                   /db_xref="InterPro:IPR027413"
FT                   /db_xref="UniProtKB/TrEMBL:Q751B1"
FT                   /protein_id="AAS54398.2"
FT   gene            <849059..>851659
FT                   /locus_tag="AGOS_AGL091W"
FT                   /old_locus_tag="AGL091W"
FT   mRNA            <849059..>851659
FT                   /locus_tag="AGOS_AGL091W"
FT                   /old_locus_tag="AGL091W"
FT                   /product="AGL091Wp"
FT   CDS_pept        849059..851659
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL091W"
FT                   /old_locus_tag="AGL091W"
FT                   /product="AGL091Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR228C
FT                   (ECM22) and YDR213W (UPC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL091W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54399"
FT                   /db_xref="GOA:Q751B6"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR021858"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/TrEMBL:Q751B6"
FT                   /protein_id="AAS54399.1"
FT   gene            <851806..>852849
FT                   /locus_tag="AGOS_AGL090W"
FT                   /old_locus_tag="AGL090W"
FT   mRNA            <851806..>852849
FT                   /locus_tag="AGOS_AGL090W"
FT                   /old_locus_tag="AGL090W"
FT                   /product="AGL090Wp"
FT   CDS_pept        851806..852849
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL090W"
FT                   /old_locus_tag="AGL090W"
FT                   /product="AGL090Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR214W
FT                   (AHA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL090W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54400"
FT                   /db_xref="GOA:Q750P0"
FT                   /db_xref="InterPro:IPR013538"
FT                   /db_xref="InterPro:IPR015310"
FT                   /db_xref="InterPro:IPR023393"
FT                   /db_xref="InterPro:IPR036338"
FT                   /db_xref="InterPro:IPR039981"
FT                   /db_xref="UniProtKB/TrEMBL:Q750P0"
FT                   /protein_id="AAS54400.1"
FT                   FGFGSVL"
FT   gene            <853141..>853881
FT                   /locus_tag="AGOS_AGL089W"
FT                   /old_locus_tag="AGL089W"
FT   mRNA            <853141..>853881
FT                   /locus_tag="AGOS_AGL089W"
FT                   /old_locus_tag="AGL089W"
FT                   /product="AGL089Wp"
FT   CDS_pept        853141..853881
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL089W"
FT                   /old_locus_tag="AGL089W"
FT                   /product="AGL089Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL011C
FT                   (SCL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL089W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54401"
FT                   /db_xref="GOA:Q750N9"
FT                   /db_xref="InterPro:IPR000426"
FT                   /db_xref="InterPro:IPR001353"
FT                   /db_xref="InterPro:IPR023332"
FT                   /db_xref="InterPro:IPR029055"
FT                   /db_xref="InterPro:IPR034642"
FT                   /db_xref="UniProtKB/TrEMBL:Q750N9"
FT                   /protein_id="AAS54401.1"
FT   gene            complement(<854010..>854699)
FT                   /locus_tag="AGOS_AGL088C"
FT                   /old_locus_tag="AGL088C"
FT   mRNA            complement(<854010..>854699)
FT                   /locus_tag="AGOS_AGL088C"
FT                   /old_locus_tag="AGL088C"
FT                   /product="AGL088Cp"
FT   CDS_pept        complement(854010..854699)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL088C"
FT                   /old_locus_tag="AGL088C"
FT                   /product="AGL088Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBL006C
FT                   (LDB7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL088C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54402"
FT                   /db_xref="GOA:Q750N8"
FT                   /db_xref="InterPro:IPR013895"
FT                   /db_xref="UniProtKB/TrEMBL:Q750N8"
FT                   /protein_id="AAS54402.1"
FT                   NHMCMKG"
FT   gene            complement(<855115..>856503)
FT                   /locus_tag="AGOS_AGL087C"
FT                   /old_locus_tag="AGL087C"
FT   mRNA            complement(<855115..>856503)
FT                   /locus_tag="AGOS_AGL087C"
FT                   /old_locus_tag="AGL087C"
FT                   /product="AGL087Cp"
FT   CDS_pept        complement(855115..856503)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL087C"
FT                   /old_locus_tag="AGL087C"
FT                   /product="AGL087Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL012W
FT                   (ERG4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL087C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54403"
FT                   /db_xref="GOA:Q750N7"
FT                   /db_xref="InterPro:IPR001171"
FT                   /db_xref="InterPro:IPR018083"
FT                   /db_xref="UniProtKB/TrEMBL:Q750N7"
FT                   /protein_id="AAS54403.1"
FT                   PYVF"
FT   gene            complement(<856918..>859125)
FT                   /locus_tag="AGOS_AGL086C"
FT                   /old_locus_tag="AGL086C"
FT   mRNA            complement(<856918..>859125)
FT                   /locus_tag="AGOS_AGL086C"
FT                   /old_locus_tag="AGL086C"
FT                   /product="AGL086Cp"
FT   CDS_pept        complement(856918..859125)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL086C"
FT                   /old_locus_tag="AGL086C"
FT                   /product="AGL086Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL014W
FT                   (PUF4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL086C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54404"
FT                   /db_xref="GOA:Q750N6"
FT                   /db_xref="InterPro:IPR001313"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR033133"
FT                   /db_xref="InterPro:IPR033712"
FT                   /db_xref="UniProtKB/TrEMBL:Q750N6"
FT                   /protein_id="AAS54404.2"
FT   gene            complement(<860027..>862756)
FT                   /locus_tag="AGOS_AGL085C"
FT                   /old_locus_tag="AGL085C"
FT   mRNA            complement(<860027..>862756)
FT                   /locus_tag="AGOS_AGL085C"
FT                   /old_locus_tag="AGL085C"
FT                   /product="AGL085Cp"
FT   CDS_pept        complement(860027..862756)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL085C"
FT                   /old_locus_tag="AGL085C"
FT                   /product="AGL085Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL008C
FT                   (PMA1) and Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YPL036W (PMA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL085C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54405"
FT                   /db_xref="GOA:Q750N5"
FT                   /db_xref="InterPro:IPR001757"
FT                   /db_xref="InterPro:IPR004014"
FT                   /db_xref="InterPro:IPR006534"
FT                   /db_xref="InterPro:IPR008250"
FT                   /db_xref="InterPro:IPR018303"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR023298"
FT                   /db_xref="InterPro:IPR023299"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q750N5"
FT                   /protein_id="AAS54405.1"
FT   gene            complement(<863025..>863552)
FT                   /locus_tag="AGOS_AGL084C"
FT                   /old_locus_tag="AGL084C"
FT   mRNA            complement(<863025..>863552)
FT                   /locus_tag="AGOS_AGL084C"
FT                   /old_locus_tag="AGL084C"
FT                   /product="AGL084Cp"
FT   CDS_pept        complement(863025..863552)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL084C"
FT                   /old_locus_tag="AGL084C"
FT                   /product="AGL084Cp"
FT                   /note="NOHBY708; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL084C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54406"
FT                   /db_xref="UniProtKB/TrEMBL:Q750N4"
FT                   /protein_id="AAS54406.1"
FT                   RKEKKSSSRQQV"
FT   gene            complement(863577..863649)
FT                   /locus_tag="AGOS_t0179"
FT   tRNA            complement(863577..863649)
FT                   /locus_tag="AGOS_t0179"
FT                   /product="tRNA-Ala"
FT                   /note="codon recognized: GCA"
FT   gene            <864033..>866603
FT                   /locus_tag="AGOS_AGL083W"
FT                   /old_locus_tag="AGL083W"
FT   mRNA            <864033..>866603
FT                   /locus_tag="AGOS_AGL083W"
FT                   /old_locus_tag="AGL083W"
FT                   /product="AGL083Wp"
FT   CDS_pept        864033..866603
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL083W"
FT                   /old_locus_tag="AGL083W"
FT                   /product="AGL083Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL038W
FT                   (RGT1) and Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YBR033W (EDS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL083W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54407"
FT                   /db_xref="GOA:Q750N3"
FT                   /db_xref="InterPro:IPR001138"
FT                   /db_xref="InterPro:IPR036864"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750N3"
FT                   /protein_id="AAS54407.1"
FT   gene            <866907..>868406
FT                   /locus_tag="AGOS_AGL082W"
FT                   /old_locus_tag="AGL082W"
FT   mRNA            <866907..>868406
FT                   /locus_tag="AGOS_AGL082W"
FT                   /old_locus_tag="AGL082W"
FT                   /product="AGL082Wp"
FT   CDS_pept        866907..868406
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL082W"
FT                   /old_locus_tag="AGL082W"
FT                   /product="AGL082Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL035W
FT                   (UGP1) and YHL012W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL082W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54408"
FT                   /db_xref="GOA:Q751A1"
FT                   /db_xref="InterPro:IPR002618"
FT                   /db_xref="InterPro:IPR016267"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q751A1"
FT                   /protein_id="AAS54408.1"
FT   gene            <869107..>869778
FT                   /locus_tag="AGOS_AGL081W"
FT                   /old_locus_tag="AGL081W"
FT   mRNA            <869107..>869778
FT                   /locus_tag="AGOS_AGL081W"
FT                   /old_locus_tag="AGL081W"
FT                   /product="AGL081Wp"
FT   CDS_pept        869107..869778
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL081W"
FT                   /old_locus_tag="AGL081W"
FT                   /product="AGL081Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YKL033W-A"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL081W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54409"
FT                   /db_xref="GOA:Q751A5"
FT                   /db_xref="InterPro:IPR006439"
FT                   /db_xref="InterPro:IPR023198"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="InterPro:IPR041492"
FT                   /db_xref="UniProtKB/TrEMBL:Q751A5"
FT                   /protein_id="AAS54409.1"
FT                   L"
FT   gene            complement(<869922..>870884)
FT                   /locus_tag="AGOS_AGL080C"
FT                   /old_locus_tag="AGL080C"
FT   mRNA            complement(<869922..>870884)
FT                   /locus_tag="AGOS_AGL080C"
FT                   /old_locus_tag="AGL080C"
FT                   /product="AGL080Cp"
FT   CDS_pept        complement(869922..870884)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL080C"
FT                   /old_locus_tag="AGL080C"
FT                   /product="AGL080Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL011C
FT                   (PRS3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL080C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54410"
FT                   /db_xref="GOA:Q751A4"
FT                   /db_xref="InterPro:IPR000836"
FT                   /db_xref="InterPro:IPR000842"
FT                   /db_xref="InterPro:IPR005946"
FT                   /db_xref="InterPro:IPR029057"
FT                   /db_xref="InterPro:IPR029099"
FT                   /db_xref="UniProtKB/TrEMBL:Q751A4"
FT                   /protein_id="AAS54410.1"
FT   gene            complement(<871164..>872684)
FT                   /locus_tag="AGOS_AGL079C"
FT                   /old_locus_tag="AGL079C"
FT   mRNA            complement(<871164..>872684)
FT                   /locus_tag="AGOS_AGL079C"
FT                   /old_locus_tag="AGL079C"
FT                   /product="AGL079Cp"
FT   CDS_pept        complement(871164..872684)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL079C"
FT                   /old_locus_tag="AGL079C"
FT                   /product="AGL079Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL010C
FT                   (ETP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL079C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54411"
FT                   /db_xref="GOA:Q751A3"
FT                   /db_xref="InterPro:IPR001607"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR011422"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR034931"
FT                   /db_xref="UniProtKB/TrEMBL:Q751A3"
FT                   /protein_id="AAS54411.1"
FT   gene            <873071..>876184
FT                   /locus_tag="AGOS_AGL078W"
FT                   /old_locus_tag="AGL078W"
FT   mRNA            <873071..>876184
FT                   /locus_tag="AGOS_AGL078W"
FT                   /old_locus_tag="AGL078W"
FT                   /product="AGL078Wp"
FT   CDS_pept        873071..876184
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL078W"
FT                   /old_locus_tag="AGL078W"
FT                   /product="AGL078Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL033W
FT                   (TTI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL078W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54412"
FT                   /db_xref="GOA:Q751A2"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR016441"
FT                   /db_xref="UniProtKB/TrEMBL:Q751A2"
FT                   /protein_id="AAS54412.1"
FT   gene            <876482..>878284
FT                   /locus_tag="AGOS_AGL077W"
FT                   /old_locus_tag="AGL077W"
FT   mRNA            <876482..>878284
FT                   /locus_tag="AGOS_AGL077W"
FT                   /old_locus_tag="AGL077W"
FT                   /product="AGL077Wp"
FT   CDS_pept        876482..878284
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL077W"
FT                   /old_locus_tag="AGL077W"
FT                   /product="AGL077Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHL008C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL077W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54413"
FT                   /db_xref="GOA:Q751A0"
FT                   /db_xref="InterPro:IPR000292"
FT                   /db_xref="InterPro:IPR023271"
FT                   /db_xref="InterPro:IPR024002"
FT                   /db_xref="UniProtKB/TrEMBL:Q751A0"
FT                   /protein_id="AAS54413.2"
FT   gene            <878521..>882327
FT                   /locus_tag="AGOS_AGL076W"
FT                   /old_locus_tag="AGL076W"
FT   mRNA            <878521..>882327
FT                   /locus_tag="AGOS_AGL076W"
FT                   /old_locus_tag="AGL076W"
FT                   /product="AGL076Wp"
FT   CDS_pept        878521..882327
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL076W"
FT                   /old_locus_tag="AGL076W"
FT                   /product="AGL076Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR076C
FT                   (PDS5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL076W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54414"
FT                   /db_xref="GOA:Q750N2"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR039776"
FT                   /db_xref="UniProtKB/TrEMBL:Q750N2"
FT                   /protein_id="AAS54414.1"
FT   gene            complement(<882479..>884263)
FT                   /locus_tag="AGOS_AGL075C"
FT                   /old_locus_tag="AGL075C"
FT   mRNA            complement(<882479..>884263)
FT                   /locus_tag="AGOS_AGL075C"
FT                   /old_locus_tag="AGL075C"
FT                   /product="AGL075Cp"
FT   CDS_pept        complement(882479..884263)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL075C"
FT                   /old_locus_tag="AGL075C"
FT                   /product="AGL075Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR075W
FT                   (RCO1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL075C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54415"
FT                   /db_xref="GOA:Q750N1"
FT                   /db_xref="InterPro:IPR001965"
FT                   /db_xref="InterPro:IPR011011"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR019786"
FT                   /db_xref="InterPro:IPR019787"
FT                   /db_xref="InterPro:IPR036427"
FT                   /db_xref="UniProtKB/TrEMBL:Q750N1"
FT                   /protein_id="AAS54415.1"
FT                   LLESKPRKDVFSFLGLDN"
FT   gene            <884748..>885113
FT                   /locus_tag="AGOS_AGL074W"
FT                   /old_locus_tag="AGL074W"
FT   mRNA            <884748..>885113
FT                   /locus_tag="AGOS_AGL074W"
FT                   /old_locus_tag="AGL074W"
FT                   /product="AGL074Wp"
FT   CDS_pept        884748..885113
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL074W"
FT                   /old_locus_tag="AGL074W"
FT                   /product="AGL074Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YMR074C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL074W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54416"
FT                   /db_xref="GOA:Q750N0"
FT                   /db_xref="InterPro:IPR002836"
FT                   /db_xref="InterPro:IPR036883"
FT                   /db_xref="UniProtKB/TrEMBL:Q750N0"
FT                   /protein_id="AAS54416.2"
FT                   PDRTAGTSADSDDDFFD"
FT   gene            <885220..>887253
FT                   /locus_tag="AGOS_AGL073W"
FT                   /old_locus_tag="AGL073W"
FT   mRNA            <885220..>887253
FT                   /locus_tag="AGOS_AGL073W"
FT                   /old_locus_tag="AGL073W"
FT                   /product="AGL073Wp"
FT   CDS_pept        885220..887253
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL073W"
FT                   /old_locus_tag="AGL073W"
FT                   /product="AGL073Wp"
FT                   /note="NOHBY707; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E18436g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL073W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54417"
FT                   /db_xref="GOA:Q750M9"
FT                   /db_xref="InterPro:IPR000269"
FT                   /db_xref="InterPro:IPR015798"
FT                   /db_xref="InterPro:IPR016182"
FT                   /db_xref="InterPro:IPR036460"
FT                   /db_xref="UniProtKB/TrEMBL:Q750M9"
FT                   /protein_id="AAS54417.2"
FT   gene            <887391..>887936
FT                   /locus_tag="AGOS_AGL073WC"
FT   mRNA            <887391..>887936
FT                   /locus_tag="AGOS_AGL073WC"
FT                   /product="AGL073W-Cp"
FT   CDS_pept        887391..887936
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL073WC"
FT                   /product="AGL073W-Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR073C
FT                   (IRC21)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL073WC"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41737"
FT                   /db_xref="GOA:D8FGG0"
FT                   /db_xref="InterPro:IPR001199"
FT                   /db_xref="InterPro:IPR018506"
FT                   /db_xref="InterPro:IPR036400"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGG0"
FT                   /protein_id="ADJ41737.1"
FT                   RWVNFERLLECCQVGVYV"
FT   gene            complement(<888191..>889315)
FT                   /locus_tag="AGOS_AGL073CA"
FT   mRNA            complement(<888191..>889315)
FT                   /locus_tag="AGOS_AGL073CA"
FT                   /product="AGL073C-Ap"
FT   CDS_pept        complement(888191..889315)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL073CA"
FT                   /product="AGL073C-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL032C
FT                   (IXR1) and YMR072W (ABF2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL073CA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41738"
FT                   /db_xref="GOA:D8FGG1"
FT                   /db_xref="InterPro:IPR009071"
FT                   /db_xref="InterPro:IPR033311"
FT                   /db_xref="InterPro:IPR036910"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGG1"
FT                   /protein_id="ADJ41738.1"
FT   gene            complement(<889596..>891044)
FT                   /locus_tag="AGOS_AGL073CB"
FT   mRNA            complement(<889596..>891044)
FT                   /locus_tag="AGOS_AGL073CB"
FT                   /product="AGL073C-Bp"
FT   CDS_pept        complement(889596..891044)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL073CB"
FT                   /product="AGL073C-Bp"
FT                   /note="NOHBY747; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E18601g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL073CB"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41739"
FT                   /db_xref="GOA:D8FGG2"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR008913"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR017921"
FT                   /db_xref="InterPro:IPR037274"
FT                   /db_xref="InterPro:IPR037275"
FT                   /db_xref="InterPro:IPR039512"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGG2"
FT                   /protein_id="ADJ41739.1"
FT   gene            <891170..>891673
FT                   /locus_tag="AGOS_AGL072W"
FT                   /old_locus_tag="AGL072W"
FT   mRNA            <891170..>891673
FT                   /locus_tag="AGOS_AGL072W"
FT                   /old_locus_tag="AGL072W"
FT                   /product="AGL072Wp"
FT   CDS_pept        891170..891673
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL072W"
FT                   /old_locus_tag="AGL072W"
FT                   /product="AGL072Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR071C
FT                   (TVP18)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL072W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54418"
FT                   /db_xref="GOA:Q750M8"
FT                   /db_xref="InterPro:IPR019365"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750M8"
FT                   /protein_id="AAS54418.1"
FT                   REVL"
FT   gene            complement(<891884..>893074)
FT                   /locus_tag="AGOS_AGL071C"
FT                   /old_locus_tag="AGL071C"
FT   mRNA            complement(<891884..>893074)
FT                   /locus_tag="AGOS_AGL071C"
FT                   /old_locus_tag="AGL071C"
FT                   /product="AGL071Cp"
FT   CDS_pept        complement(891884..893074)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL071C"
FT                   /old_locus_tag="AGL071C"
FT                   /product="AGL071Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR070W
FT                   (MOT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL071C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54419"
FT                   /db_xref="GOA:Q750M7"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q750M7"
FT                   /protein_id="AAS54419.1"
FT   gene            complement(<893543..>894106)
FT                   /locus_tag="AGOS_AGL071CA"
FT   mRNA            complement(<893543..>894106)
FT                   /locus_tag="AGOS_AGL071CA"
FT                   /product="AGL071C-Ap"
FT   CDS_pept        complement(893543..894106)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL071CA"
FT                   /product="AGL071C-Ap"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YMR069W
FT                   (NAT4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL071CA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41740"
FT                   /db_xref="GOA:D8FGG3"
FT                   /db_xref="InterPro:IPR000182"
FT                   /db_xref="InterPro:IPR016181"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGG3"
FT                   /protein_id="ADJ41740.1"
FT   gene            <894253..>895284
FT                   /locus_tag="AGOS_AGL070W"
FT                   /old_locus_tag="AGL070W"
FT   mRNA            <894253..>895284
FT                   /locus_tag="AGOS_AGL070W"
FT                   /old_locus_tag="AGL070W"
FT                   /product="AGL070Wp"
FT   CDS_pept        894253..895284
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL070W"
FT                   /old_locus_tag="AGL070W"
FT                   /product="AGL070Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR004C
FT                   (NEM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL070W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54420"
FT                   /db_xref="GOA:Q750M6"
FT                   /db_xref="InterPro:IPR004274"
FT                   /db_xref="InterPro:IPR011948"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q750M6"
FT                   /protein_id="AAS54420.1"
FT                   AFI"
FT   gene            complement(<895396..>897180)
FT                   /locus_tag="AGOS_AGL069C"
FT                   /old_locus_tag="AGL069C"
FT   mRNA            complement(<895396..>897180)
FT                   /locus_tag="AGOS_AGL069C"
FT                   /old_locus_tag="AGL069C"
FT                   /product="AGL069Cp"
FT   CDS_pept        complement(895396..897180)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL069C"
FT                   /old_locus_tag="AGL069C"
FT                   /product="AGL069Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YNR055C (HOL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL069C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54421"
FT                   /db_xref="GOA:Q750M5"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q750M5"
FT                   /protein_id="AAS54421.1"
FT                   RKALMQFSYHRGERESSV"
FT   gene            <897851..>899716
FT                   /locus_tag="AGOS_AGL068W"
FT                   /old_locus_tag="AGL068W"
FT   mRNA            <897851..>899716
FT                   /locus_tag="AGOS_AGL068W"
FT                   /old_locus_tag="AGL068W"
FT                   /product="AGL068Wp"
FT   CDS_pept        897851..899716
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL068W"
FT                   /old_locus_tag="AGL068W"
FT                   /product="AGL068Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL029C
FT                   (MAE1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL068W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54422"
FT                   /db_xref="GOA:Q750Z9"
FT                   /db_xref="InterPro:IPR001891"
FT                   /db_xref="InterPro:IPR012301"
FT                   /db_xref="InterPro:IPR012302"
FT                   /db_xref="InterPro:IPR015884"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="InterPro:IPR037062"
FT                   /db_xref="UniProtKB/TrEMBL:Q750Z9"
FT                   /protein_id="AAS54422.2"
FT   gene            <900043..>901488
FT                   /locus_tag="AGOS_AGL067W"
FT                   /old_locus_tag="AGL067W"
FT   mRNA            <900043..>901488
FT                   /locus_tag="AGOS_AGL067W"
FT                   /old_locus_tag="AGL067W"
FT                   /product="AGL067Wp"
FT   CDS_pept        900043..901488
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL067W"
FT                   /old_locus_tag="AGL067W"
FT                   /product="AGL067Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL028W
FT                   (TFA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL067W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54423"
FT                   /db_xref="GOA:Q750M4"
FT                   /db_xref="InterPro:IPR002853"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR013137"
FT                   /db_xref="InterPro:IPR017919"
FT                   /db_xref="InterPro:IPR024550"
FT                   /db_xref="InterPro:IPR039997"
FT                   /db_xref="UniProtKB/TrEMBL:Q750M4"
FT                   /protein_id="AAS54423.2"
FT   gene            <901626..>902978
FT                   /locus_tag="AGOS_AGL066W"
FT                   /old_locus_tag="AGL066W"
FT   mRNA            <901626..>902978
FT                   /locus_tag="AGOS_AGL066W"
FT                   /old_locus_tag="AGL066W"
FT                   /product="AGL066Wp"
FT   CDS_pept        901626..902978
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL066W"
FT                   /old_locus_tag="AGL066W"
FT                   /product="AGL066Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKL027W
FT                   and YHR003C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL066W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54424"
FT                   /db_xref="GOA:Q750M3"
FT                   /db_xref="InterPro:IPR000594"
FT                   /db_xref="InterPro:IPR035985"
FT                   /db_xref="UniProtKB/TrEMBL:Q750M3"
FT                   /protein_id="AAS54424.2"
FT   gene            complement(<903124..>904131)
FT                   /locus_tag="AGOS_AGL065C"
FT                   /old_locus_tag="AGL065C"
FT   mRNA            complement(<903124..>904131)
FT                   /locus_tag="AGOS_AGL065C"
FT                   /old_locus_tag="AGL065C"
FT                   /product="AGL065Cp"
FT   CDS_pept        complement(903124..904131)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL065C"
FT                   /old_locus_tag="AGL065C"
FT                   /product="AGL065Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHR002W
FT                   (LEU5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL065C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54425"
FT                   /db_xref="GOA:Q750M2"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR002167"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q750M2"
FT                   /protein_id="AAS54425.1"
FT   gene            <904784..>905674
FT                   /locus_tag="AGOS_AGL064W"
FT                   /old_locus_tag="AGL064W"
FT   mRNA            <904784..>905674
FT                   /locus_tag="AGOS_AGL064W"
FT                   /old_locus_tag="AGL064W"
FT                   /product="AGL064Wp"
FT   CDS_pept        904784..905674
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL064W"
FT                   /old_locus_tag="AGL064W"
FT                   /product="AGL064Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR291C
FT                   (CTP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL064W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54426"
FT                   /db_xref="GOA:Q750M1"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q750M1"
FT                   /protein_id="AAS54426.1"
FT                   GIVFTAYEKLLVLLP"
FT   gene            complement(<905724..>906581)
FT                   /locus_tag="AGOS_AGL063C"
FT                   /old_locus_tag="AGL063C"
FT   mRNA            complement(<905724..>906581)
FT                   /locus_tag="AGOS_AGL063C"
FT                   /old_locus_tag="AGL063C"
FT                   /product="AGL063Cp"
FT   CDS_pept        complement(905724..906581)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL063C"
FT                   /old_locus_tag="AGL063C"
FT                   /product="AGL063Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR290W
FT                   (BSD2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL063C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54427"
FT                   /db_xref="GOA:Q750M0"
FT                   /db_xref="InterPro:IPR019325"
FT                   /db_xref="UniProtKB/TrEMBL:Q750M0"
FT                   /protein_id="AAS54427.2"
FT                   ESPA"
FT   gene            complement(<906858..>910190)
FT                   /locus_tag="AGOS_AGL062C"
FT                   /old_locus_tag="AGL062C"
FT   mRNA            complement(<906858..>910190)
FT                   /locus_tag="AGOS_AGL062C"
FT                   /old_locus_tag="AGL062C"
FT                   /product="AGL062Cp"
FT   CDS_pept        complement(906858..910190)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL062C"
FT                   /old_locus_tag="AGL062C"
FT                   /product="AGL062Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR289W
FT                   (SNF5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL062C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54428"
FT                   /db_xref="GOA:Q750L9"
FT                   /db_xref="InterPro:IPR006939"
FT                   /db_xref="UniProtKB/TrEMBL:Q750L9"
FT                   /protein_id="AAS54428.2"
FT                   RHR"
FT   gene            <910629..>912043
FT                   /locus_tag="AGOS_AGL061W"
FT                   /old_locus_tag="AGL061W"
FT   mRNA            join(<910629..910663,910723..>912043)
FT                   /locus_tag="AGOS_AGL061W"
FT                   /old_locus_tag="AGL061W"
FT                   /product="AGL061Wp"
FT   CDS_pept        join(910629..910663,910723..912043)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL061W"
FT                   /old_locus_tag="AGL061W"
FT                   /product="AGL061Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR288C
FT                   (APM3); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL061W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54429"
FT                   /db_xref="GOA:Q750L8"
FT                   /db_xref="InterPro:IPR001392"
FT                   /db_xref="InterPro:IPR011012"
FT                   /db_xref="InterPro:IPR018240"
FT                   /db_xref="InterPro:IPR028565"
FT                   /db_xref="InterPro:IPR036168"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750L8"
FT                   /protein_id="AAS54429.2"
FT   gene            <912431..>915106
FT                   /locus_tag="AGOS_AGL060W"
FT                   /old_locus_tag="AGL060W"
FT   mRNA            <912431..>915106
FT                   /locus_tag="AGOS_AGL060W"
FT                   /old_locus_tag="AGL060W"
FT                   /product="AGL060Wp"
FT   CDS_pept        912431..915106
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL060W"
FT                   /old_locus_tag="AGL060W"
FT                   /product="AGL060Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YKR009C
FT                   (FOX2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL060W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54430"
FT                   /db_xref="GOA:Q750L7"
FT                   /db_xref="InterPro:IPR002347"
FT                   /db_xref="InterPro:IPR002539"
FT                   /db_xref="InterPro:IPR020904"
FT                   /db_xref="InterPro:IPR029069"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q750L7"
FT                   /protein_id="AAS54430.1"
FT   gene            complement(<915452..>915819)
FT                   /locus_tag="AGOS_AGL059C"
FT                   /old_locus_tag="AGL059C"
FT   mRNA            complement(join(<915452..915679,915802..>915819))
FT                   /locus_tag="AGOS_AGL059C"
FT                   /old_locus_tag="AGL059C"
FT                   /product="AGL059Cp"
FT   CDS_pept        complement(join(915452..915679,915802..915819))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL059C"
FT                   /old_locus_tag="AGL059C"
FT                   /product="AGL059Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YHR001W-A (QCR10); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL059C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54431"
FT                   /db_xref="GOA:Q750L6"
FT                   /db_xref="InterPro:IPR019182"
FT                   /db_xref="UniProtKB/TrEMBL:Q750L6"
FT                   /protein_id="AAS54431.2"
FT   gene            complement(<916450..>919359)
FT                   /locus_tag="AGOS_AGL058C"
FT                   /old_locus_tag="AGL058C"
FT   mRNA            complement(<916450..>919359)
FT                   /locus_tag="AGOS_AGL058C"
FT                   /old_locus_tag="AGL058C"
FT                   /product="AGL058Cp"
FT   CDS_pept        complement(916450..919359)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL058C"
FT                   /old_locus_tag="AGL058C"
FT                   /product="AGL058Cp"
FT                   /note="NOHBY706; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0E13926g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL058C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54432"
FT                   /db_xref="UniProtKB/TrEMBL:Q750L5"
FT                   /protein_id="AAS54432.1"
FT   gene            <920110..>921783
FT                   /locus_tag="AGOS_AGL057W"
FT                   /old_locus_tag="AGL057W"
FT   mRNA            <920110..>921783
FT                   /locus_tag="AGOS_AGL057W"
FT                   /old_locus_tag="AGL057W"
FT                   /product="AGL057Wp"
FT   CDS_pept        920110..921783
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL057W"
FT                   /old_locus_tag="AGL057W"
FT                   /product="AGL057Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR006C
FT                   (ICL2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL057W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54433"
FT                   /db_xref="GOA:Q750K8"
FT                   /db_xref="InterPro:IPR006254"
FT                   /db_xref="InterPro:IPR015813"
FT                   /db_xref="InterPro:IPR018523"
FT                   /db_xref="InterPro:IPR039556"
FT                   /db_xref="InterPro:IPR040442"
FT                   /db_xref="UniProtKB/TrEMBL:Q750K8"
FT                   /protein_id="AAS54433.2"
FT   gene            <922385..>923575
FT                   /locus_tag="AGOS_AGL056W"
FT                   /old_locus_tag="AGL056W"
FT   mRNA            <922385..>923575
FT                   /locus_tag="AGOS_AGL056W"
FT                   /old_locus_tag="AGL056W"
FT                   /product="AGL056Wp"
FT   CDS_pept        922385..923575
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL056W"
FT                   /old_locus_tag="AGL056W"
FT                   /product="AGL056Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR005C
FT                   (HAL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL056W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54434"
FT                   /db_xref="UniProtKB/TrEMBL:Q750K7"
FT                   /protein_id="AAS54434.2"
FT   gene            complement(<923783..>924787)
FT                   /locus_tag="AGOS_AGL055C"
FT                   /old_locus_tag="AGL055C"
FT   mRNA            complement(<923783..>924787)
FT                   /locus_tag="AGOS_AGL055C"
FT                   /old_locus_tag="AGL055C"
FT                   /product="AGL055Cp"
FT   CDS_pept        complement(923783..924787)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL055C"
FT                   /old_locus_tag="AGL055C"
FT                   /product="AGL055Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR007W
FT                   (YFH7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL055C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54435"
FT                   /db_xref="GOA:Q750K6"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750K6"
FT                   /protein_id="AAS54435.1"
FT   gene            <925346..>926386
FT                   /locus_tag="AGOS_AGL054W"
FT                   /old_locus_tag="AGL054W"
FT   mRNA            <925346..>926386
FT                   /locus_tag="AGOS_AGL054W"
FT                   /old_locus_tag="AGL054W"
FT                   /product="AGL054Wp"
FT   CDS_pept        925346..926386
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL054W"
FT                   /old_locus_tag="AGL054W"
FT                   /product="AGL054Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR004C
FT                   (AIM45)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL054W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54436"
FT                   /db_xref="GOA:Q750K5"
FT                   /db_xref="InterPro:IPR001308"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR014730"
FT                   /db_xref="InterPro:IPR014731"
FT                   /db_xref="InterPro:IPR018206"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="InterPro:IPR033947"
FT                   /db_xref="UniProtKB/TrEMBL:Q750K5"
FT                   /protein_id="AAS54436.1"
FT                   TQKLAK"
FT   gene            complement(<926467..>927312)
FT                   /locus_tag="AGOS_AGL053C"
FT                   /old_locus_tag="AGL053C"
FT   mRNA            complement(<926467..>927312)
FT                   /locus_tag="AGOS_AGL053C"
FT                   /old_locus_tag="AGL053C"
FT                   /product="AGL053Cp"
FT   CDS_pept        complement(926467..927312)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL053C"
FT                   /old_locus_tag="AGL053C"
FT                   /product="AGL053Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR021W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL053C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54437"
FT                   /db_xref="GOA:Q750K4"
FT                   /db_xref="InterPro:IPR002876"
FT                   /db_xref="InterPro:IPR017856"
FT                   /db_xref="InterPro:IPR026564"
FT                   /db_xref="InterPro:IPR029072"
FT                   /db_xref="UniProtKB/TrEMBL:Q750K4"
FT                   /protein_id="AAS54437.1"
FT                   "
FT   gene            <927661..>928017
FT                   /locus_tag="AGOS_AGL052W"
FT                   /old_locus_tag="AGL052W"
FT   mRNA            <927661..>928017
FT                   /locus_tag="AGOS_AGL052W"
FT                   /old_locus_tag="AGL052W"
FT                   /product="AGL052Wp"
FT   CDS_pept        927661..928017
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL052W"
FT                   /old_locus_tag="AGL052W"
FT                   /product="AGL052Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR020C
FT                   (VMA7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL052W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54438"
FT                   /db_xref="GOA:Q750K3"
FT                   /db_xref="InterPro:IPR005772"
FT                   /db_xref="InterPro:IPR008218"
FT                   /db_xref="InterPro:IPR036906"
FT                   /db_xref="UniProtKB/TrEMBL:Q750K3"
FT                   /protein_id="AAS54438.1"
FT                   KDTVLRRVRRLFGE"
FT   gene            complement(<928099..>929913)
FT                   /locus_tag="AGOS_AGL051C"
FT                   /old_locus_tag="AGL051C"
FT   mRNA            complement(<928099..>929913)
FT                   /locus_tag="AGOS_AGL051C"
FT                   /old_locus_tag="AGL051C"
FT                   /product="AGL051Cp"
FT   CDS_pept        complement(928099..929913)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL051C"
FT                   /old_locus_tag="AGL051C"
FT                   /product="AGL051Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR330W
FT                   (CHS5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL051C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54439"
FT                   /db_xref="GOA:Q750K2"
FT                   /db_xref="InterPro:IPR001357"
FT                   /db_xref="InterPro:IPR003961"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR031669"
FT                   /db_xref="InterPro:IPR031673"
FT                   /db_xref="InterPro:IPR036116"
FT                   /db_xref="InterPro:IPR036420"
FT                   /db_xref="UniProtKB/TrEMBL:Q750K2"
FT                   /protein_id="AAS54439.2"
FT   gene            complement(<930224..>931675)
FT                   /locus_tag="AGOS_AGL050C"
FT                   /old_locus_tag="AGL050C"
FT   mRNA            complement(<930224..>931675)
FT                   /locus_tag="AGOS_AGL050C"
FT                   /old_locus_tag="AGL050C"
FT                   /product="AGL050Cp"
FT   CDS_pept        complement(930224..931675)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL050C"
FT                   /old_locus_tag="AGL050C"
FT                   /product="AGL050Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR019W
FT                   (UGA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL050C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54440"
FT                   /db_xref="GOA:Q750K1"
FT                   /db_xref="InterPro:IPR004631"
FT                   /db_xref="InterPro:IPR005814"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="UniProtKB/TrEMBL:Q750K1"
FT                   /protein_id="AAS54440.1"
FT   gene            complement(<932033..>932947)
FT                   /locus_tag="AGOS_AGL049C"
FT                   /old_locus_tag="AGL049C"
FT   mRNA            complement(<932033..>932947)
FT                   /locus_tag="AGOS_AGL049C"
FT                   /old_locus_tag="AGL049C"
FT                   /product="AGL049Cp"
FT   CDS_pept        complement(932033..932947)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL049C"
FT                   /old_locus_tag="AGL049C"
FT                   /product="AGL049Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR017W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL049C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54441"
FT                   /db_xref="GOA:Q750K0"
FT                   /db_xref="InterPro:IPR024624"
FT                   /db_xref="UniProtKB/TrEMBL:Q750K0"
FT                   /protein_id="AAS54441.2"
FT   gene            complement(<933358..>933621)
FT                   /locus_tag="AGOS_AGL048C"
FT   mRNA            complement(join(<933358..933537,933589..>933621))
FT                   /locus_tag="AGOS_AGL048C"
FT                   /product="AGL048Cp"
FT   CDS_pept        complement(join(933358..933537,933589..933621))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL048C"
FT                   /product="AGL048Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPR010C-A; 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL048C"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41741"
FT                   /db_xref="GOA:D8FGG4"
FT                   /db_xref="InterPro:IPR010530"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGG4"
FT                   /protein_id="ADJ41741.1"
FT   gene            complement(<934014..>934964)
FT                   /locus_tag="AGOS_AGL047C"
FT                   /old_locus_tag="AGL047C"
FT   mRNA            complement(<934014..>934964)
FT                   /locus_tag="AGOS_AGL047C"
FT                   /old_locus_tag="AGL047C"
FT                   /product="AGL047Cp"
FT   CDS_pept        complement(934014..934964)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL047C"
FT                   /old_locus_tag="AGL047C"
FT                   /product="AGL047Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YPR011C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL047C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54443"
FT                   /db_xref="GOA:Q750J8"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="UniProtKB/TrEMBL:Q750J8"
FT                   /protein_id="AAS54443.1"
FT   gene            936332..936403
FT                   /locus_tag="AGOS_t0180"
FT   tRNA            936332..936403
FT                   /locus_tag="AGOS_t0180"
FT                   /product="tRNA-Arg"
FT                   /note="codon recognized: AGA"
FT   gene            complement(<936518..>937587)
FT                   /locus_tag="AGOS_AGL046C"
FT                   /old_locus_tag="AGL046C"
FT   mRNA            complement(join(<936518..937487,937538..>937587))
FT                   /locus_tag="AGOS_AGL046C"
FT                   /old_locus_tag="AGL046C"
FT                   /product="AGL046Cp"
FT   CDS_pept        complement(join(936518..937487,937538..937587))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL046C"
FT                   /old_locus_tag="AGL046C"
FT                   /product="AGL046Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR163W
FT                   (GTR2); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL046C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54444"
FT                   /db_xref="GOA:Q750J7"
FT                   /db_xref="InterPro:IPR006762"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR039400"
FT                   /db_xref="UniProtKB/TrEMBL:Q750J7"
FT                   /protein_id="AAS54444.1"
FT   gene            <937971..>938750
FT                   /locus_tag="AGOS_AGL045W"
FT                   /old_locus_tag="AGL045W"
FT   mRNA            <937971..>938750
FT                   /locus_tag="AGOS_AGL045W"
FT                   /old_locus_tag="AGL045W"
FT                   /product="AGL045Wp"
FT   CDS_pept        937971..938750
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL045W"
FT                   /old_locus_tag="AGL045W"
FT                   /product="AGL045Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL050W
FT                   (TYW3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL045W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54445"
FT                   /db_xref="GOA:Q750J6"
FT                   /db_xref="InterPro:IPR003827"
FT                   /db_xref="InterPro:IPR036602"
FT                   /db_xref="UniProtKB/TrEMBL:Q750J6"
FT                   /protein_id="AAS54445.1"
FT   gene            complement(<939109..>942180)
FT                   /locus_tag="AGOS_AGL044C"
FT                   /old_locus_tag="AGL044C"
FT   mRNA            complement(<939109..>942180)
FT                   /locus_tag="AGOS_AGL044C"
FT                   /old_locus_tag="AGL044C"
FT                   /product="AGL044Cp"
FT   CDS_pept        complement(939109..942180)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL044C"
FT                   /old_locus_tag="AGL044C"
FT                   /product="AGL044Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL049C
FT                   (TIF4632) and YGR162W (TIF4631)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL044C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54446"
FT                   /db_xref="GOA:Q750J5"
FT                   /db_xref="InterPro:IPR003890"
FT                   /db_xref="InterPro:IPR016021"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR022745"
FT                   /db_xref="InterPro:IPR036211"
FT                   /db_xref="UniProtKB/TrEMBL:Q750J5"
FT                   /protein_id="AAS54446.2"
FT   gene            complement(<942596..>943813)
FT                   /locus_tag="AGOS_AGL043C"
FT                   /old_locus_tag="AGL043C"
FT   mRNA            complement(<942596..>943813)
FT                   /locus_tag="AGOS_AGL043C"
FT                   /old_locus_tag="AGL043C"
FT                   /product="AGL043Cp"
FT   CDS_pept        complement(942596..943813)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL043C"
FT                   /old_locus_tag="AGL043C"
FT                   /product="AGL043Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL048C
FT                   (RPT6)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL043C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54447"
FT                   /db_xref="GOA:Q750J4"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR003960"
FT                   /db_xref="InterPro:IPR005937"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR032501"
FT                   /db_xref="InterPro:IPR041569"
FT                   /db_xref="UniProtKB/TrEMBL:Q750J4"
FT                   /protein_id="AAS54447.1"
FT                   VAKLFK"
FT   gene            <943947..>944558
FT                   /locus_tag="AGOS_AGL042W"
FT                   /old_locus_tag="AGL042W"
FT   mRNA            <943947..>944558
FT                   /locus_tag="AGOS_AGL042W"
FT                   /old_locus_tag="AGL042W"
FT                   /product="AGL042Wp"
FT   CDS_pept        943947..944558
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL042W"
FT                   /old_locus_tag="AGL042W"
FT                   /product="AGL042Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL047W
FT                   (ALG13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL042W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54448"
FT                   /db_xref="GOA:Q750J3"
FT                   /db_xref="InterPro:IPR007235"
FT                   /db_xref="InterPro:IPR039042"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750J3"
FT                   /protein_id="AAS54448.1"
FT   gene            complement(944582..944653)
FT                   /locus_tag="AGOS_t0181"
FT   tRNA            complement(944582..944653)
FT                   /locus_tag="AGOS_t0181"
FT                   /product="tRNA-Asp"
FT                   /note="codon recognized: GAC"
FT   gene            complement(<945586..>949287)
FT                   /locus_tag="AGOS_AGL041C"
FT                   /old_locus_tag="AGL041C"
FT   mRNA            complement(<945586..>949287)
FT                   /locus_tag="AGOS_AGL041C"
FT                   /old_locus_tag="AGL041C"
FT                   /product="AGL041Cp"
FT   CDS_pept        complement(945586..949287)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL041C"
FT                   /old_locus_tag="AGL041C"
FT                   /product="AGL041Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YDR270W (CCC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL041C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54449"
FT                   /db_xref="GOA:Q750J2"
FT                   /db_xref="InterPro:IPR001757"
FT                   /db_xref="InterPro:IPR006121"
FT                   /db_xref="InterPro:IPR008250"
FT                   /db_xref="InterPro:IPR018303"
FT                   /db_xref="InterPro:IPR023214"
FT                   /db_xref="InterPro:IPR023298"
FT                   /db_xref="InterPro:IPR023299"
FT                   /db_xref="InterPro:IPR027256"
FT                   /db_xref="InterPro:IPR036163"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="UniProtKB/TrEMBL:Q750J2"
FT                   /protein_id="AAS54449.1"
FT                   RRLQWPSK"
FT   gene            complement(<949548..>952649)
FT                   /locus_tag="AGOS_AGL040C"
FT                   /old_locus_tag="AGL040C"
FT   mRNA            complement(<949548..>952649)
FT                   /locus_tag="AGOS_AGL040C"
FT                   /old_locus_tag="AGL040C"
FT                   /product="AGL040Cp"
FT   CDS_pept        complement(949548..952649)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL040C"
FT                   /old_locus_tag="AGL040C"
FT                   /product="AGL040Cp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YDL215C (GDH2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL040C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54450"
FT                   /db_xref="GOA:Q750J1"
FT                   /db_xref="InterPro:IPR006096"
FT                   /db_xref="InterPro:IPR016210"
FT                   /db_xref="InterPro:IPR028971"
FT                   /db_xref="InterPro:IPR033524"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/TrEMBL:Q750J1"
FT                   /protein_id="AAS54450.1"
FT   gene            <953204..>956221
FT                   /locus_tag="AGOS_AGL039W"
FT                   /old_locus_tag="AGL039W"
FT   mRNA            <953204..>956221
FT                   /locus_tag="AGOS_AGL039W"
FT                   /old_locus_tag="AGL039W"
FT                   /product="AGL039Wp"
FT   CDS_pept        953204..956221
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL039W"
FT                   /old_locus_tag="AGL039W"
FT                   /product="AGL039Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL023C
FT                   (NPR3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL039W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54451"
FT                   /db_xref="GOA:Q750J0"
FT                   /db_xref="InterPro:IPR005365"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750J0"
FT                   /protein_id="AAS54451.2"
FT                   KLIACLDKYVVELKHW"
FT   gene            complement(<956464..>958602)
FT                   /locus_tag="AGOS_AGL038C"
FT                   /old_locus_tag="AGL038C"
FT   mRNA            complement(<956464..>958602)
FT                   /locus_tag="AGOS_AGL038C"
FT                   /old_locus_tag="AGL038C"
FT                   /product="AGL038Cp"
FT   CDS_pept        complement(956464..958602)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL038C"
FT                   /old_locus_tag="AGL038C"
FT                   /product="AGL038Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YHL024W
FT                   (RIM4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL038C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54452"
FT                   /db_xref="GOA:Q750I9"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR003954"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q750I9"
FT                   /protein_id="AAS54452.1"
FT                   GQDASSGNGNELPQSLDY"
FT   gene            <959315..>959842
FT                   /locus_tag="AGOS_AGL037W"
FT                   /old_locus_tag="AGL037W"
FT   mRNA            <959315..>959842
FT                   /locus_tag="AGOS_AGL037W"
FT                   /old_locus_tag="AGL037W"
FT                   /product="AGL037Wp"
FT   CDS_pept        959315..959842
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL037W"
FT                   /old_locus_tag="AGL037W"
FT                   /product="AGL037Wp"
FT                   /note="NOHBY704; No homolog in Saccharomyces cerevisiae"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL037W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54453"
FT                   /db_xref="UniProtKB/TrEMBL:Q750I8"
FT                   /protein_id="AAS54453.1"
FT                   GGGQRGALHAAP"
FT   gene            complement(<960420..>963134)
FT                   /locus_tag="AGOS_AGL036C"
FT                   /old_locus_tag="AGL036C"
FT   mRNA            complement(<960420..>963134)
FT                   /locus_tag="AGOS_AGL036C"
FT                   /old_locus_tag="AGL036C"
FT                   /product="AGL036Cp"
FT   CDS_pept        complement(960420..963134)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL036C"
FT                   /old_locus_tag="AGL036C"
FT                   /product="AGL036Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL026W
FT                   (HSP104)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL036C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54454"
FT                   /db_xref="GOA:Q750I7"
FT                   /db_xref="InterPro:IPR001270"
FT                   /db_xref="InterPro:IPR002078"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR004176"
FT                   /db_xref="InterPro:IPR018368"
FT                   /db_xref="InterPro:IPR019489"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR028299"
FT                   /db_xref="InterPro:IPR036628"
FT                   /db_xref="InterPro:IPR041546"
FT                   /db_xref="UniProtKB/TrEMBL:Q750I7"
FT                   /protein_id="AAS54454.1"
FT   gene            complement(<963688..>965373)
FT                   /locus_tag="AGOS_AGL034C"
FT                   /old_locus_tag="AGL034C"
FT   mRNA            complement(<963688..>965373)
FT                   /locus_tag="AGOS_AGL034C"
FT                   /old_locus_tag="AGL034C"
FT                   /product="AGL034Cp"
FT   CDS_pept        complement(963688..965373)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL034C"
FT                   /old_locus_tag="AGL034C"
FT                   /product="AGL034Cp"
FT                   /note="NOHBY702; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F18172g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL034C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54456"
FT                   /db_xref="GOA:Q750I5"
FT                   /db_xref="InterPro:IPR001424"
FT                   /db_xref="InterPro:IPR024134"
FT                   /db_xref="InterPro:IPR036423"
FT                   /db_xref="UniProtKB/TrEMBL:Q750I5"
FT                   /protein_id="AAS54456.2"
FT   gene            complement(<966027..>966824)
FT                   /locus_tag="AGOS_AGL033C"
FT                   /old_locus_tag="AGL033C"
FT   mRNA            complement(<966027..>966824)
FT                   /locus_tag="AGOS_AGL033C"
FT                   /old_locus_tag="AGL033C"
FT                   /product="AGL033Cp"
FT   CDS_pept        complement(966027..966824)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL033C"
FT                   /old_locus_tag="AGL033C"
FT                   /product="AGL033Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL027W
FT                   (ISA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL033C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54457"
FT                   /db_xref="GOA:Q750I4"
FT                   /db_xref="InterPro:IPR000361"
FT                   /db_xref="InterPro:IPR016092"
FT                   /db_xref="InterPro:IPR017870"
FT                   /db_xref="InterPro:IPR035903"
FT                   /db_xref="UniProtKB/TrEMBL:Q750I4"
FT                   /protein_id="AAS54457.1"
FT   gene            complement(<967168..>969339)
FT                   /locus_tag="AGOS_AGL032C"
FT                   /old_locus_tag="AGL032C"
FT   mRNA            complement(<967168..>969339)
FT                   /locus_tag="AGOS_AGL032C"
FT                   /old_locus_tag="AGL032C"
FT                   /product="AGL032Cp"
FT   CDS_pept        complement(967168..969339)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL032C"
FT                   /old_locus_tag="AGL032C"
FT                   /product="AGL032Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLL029W
FT                   (FRA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL032C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54458"
FT                   /db_xref="GOA:Q750I3"
FT                   /db_xref="InterPro:IPR000587"
FT                   /db_xref="InterPro:IPR000994"
FT                   /db_xref="InterPro:IPR001131"
FT                   /db_xref="InterPro:IPR029149"
FT                   /db_xref="InterPro:IPR032416"
FT                   /db_xref="InterPro:IPR033740"
FT                   /db_xref="InterPro:IPR036005"
FT                   /db_xref="UniProtKB/TrEMBL:Q750I3"
FT                   /protein_id="AAS54458.1"
FT   gene            <969843..>970289
FT                   /locus_tag="AGOS_AGL031W"
FT                   /old_locus_tag="AGL031W"
FT   mRNA            <969843..>970289
FT                   /locus_tag="AGOS_AGL031W"
FT                   /old_locus_tag="AGL031W"
FT                   /product="AGL031Wp"
FT   CDS_pept        969843..970289
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL031W"
FT                   /old_locus_tag="AGL031W"
FT                   /product="AGL031Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR063W
FT                   (AIM7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL031W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54459"
FT                   /db_xref="GOA:Q750I2"
FT                   /db_xref="InterPro:IPR002108"
FT                   /db_xref="InterPro:IPR011171"
FT                   /db_xref="InterPro:IPR029006"
FT                   /db_xref="UniProtKB/TrEMBL:Q750I2"
FT                   /protein_id="AAS54459.1"
FT   gene            <970472..>971216
FT                   /locus_tag="AGOS_AGL030W"
FT                   /old_locus_tag="AGL030W"
FT   mRNA            join(<970472..970492,970782..>971216)
FT                   /locus_tag="AGOS_AGL030W"
FT                   /old_locus_tag="AGL030W"
FT                   /product="AGL030Wp"
FT   CDS_pept        join(970472..970492,970782..971216)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL030W"
FT                   /old_locus_tag="AGL030W"
FT                   /product="AGL030Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR064W
FT                   (RPS13); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL030W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54460"
FT                   /db_xref="GOA:Q750I1"
FT                   /db_xref="InterPro:IPR000589"
FT                   /db_xref="InterPro:IPR009068"
FT                   /db_xref="InterPro:IPR012606"
FT                   /db_xref="InterPro:IPR023029"
FT                   /db_xref="UniProtKB/TrEMBL:Q750I1"
FT                   /protein_id="AAS54460.1"
FT   gene            <971352..>972386
FT                   /locus_tag="AGOS_AGL029W"
FT                   /old_locus_tag="AGL029W"
FT   mRNA            <971352..>972386
FT                   /locus_tag="AGOS_AGL029W"
FT                   /old_locus_tag="AGL029W"
FT                   /product="AGL029Wp"
FT   CDS_pept        971352..972386
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL029W"
FT                   /old_locus_tag="AGL029W"
FT                   /product="AGL029Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL018W
FT                   (CTF19)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL029W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54461"
FT                   /db_xref="UniProtKB/TrEMBL:Q750I0"
FT                   /protein_id="AAS54461.1"
FT                   SLYI"
FT   gene            complement(<972409..>974187)
FT                   /locus_tag="AGOS_AGL028C"
FT                   /old_locus_tag="AGL028C"
FT   mRNA            complement(<972409..>974187)
FT                   /locus_tag="AGOS_AGL028C"
FT                   /old_locus_tag="AGL028C"
FT                   /product="AGL028Cp"
FT   CDS_pept        complement(972409..974187)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL028C"
FT                   /old_locus_tag="AGL028C"
FT                   /product="AGL028Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL013C
FT                   (IES1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL028C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54462"
FT                   /db_xref="GOA:Q750H9"
FT                   /db_xref="InterPro:IPR038014"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H9"
FT                   /protein_id="AAS54462.1"
FT                   FLKKLDEPLPNENFCL"
FT   gene            <975113..>977746
FT                   /locus_tag="AGOS_AGL027W"
FT                   /old_locus_tag="AGL027W"
FT   mRNA            <975113..>977746
FT                   /locus_tag="AGOS_AGL027W"
FT                   /old_locus_tag="AGL027W"
FT                   /product="AGL027Wp"
FT   CDS_pept        975113..977746
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL027W"
FT                   /old_locus_tag="AGL027W"
FT                   /product="AGL027Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YPR194C (OPT2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL027W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54463"
FT                   /db_xref="GOA:Q750H8"
FT                   /db_xref="InterPro:IPR004648"
FT                   /db_xref="InterPro:IPR004813"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H8"
FT                   /protein_id="AAS54463.1"
FT                   PRGSLP"
FT   gene            <981484..>983124
FT                   /locus_tag="AGOS_AGL026W"
FT                   /old_locus_tag="AGL026W"
FT   mRNA            <981484..>983124
FT                   /locus_tag="AGOS_AGL026W"
FT                   /old_locus_tag="AGL026W"
FT                   /product="AGL026Wp"
FT   CDS_pept        981484..983124
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL026W"
FT                   /old_locus_tag="AGL026W"
FT                   /product="AGL026Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YGR260W (TNA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL026W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54464"
FT                   /db_xref="GOA:Q750H7"
FT                   /db_xref="InterPro:IPR011701"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H7"
FT                   /protein_id="AAS54464.2"
FT   gene            complement(<983628..>984305)
FT                   /locus_tag="AGOS_AGL025C"
FT                   /old_locus_tag="AGL025C"
FT   mRNA            complement(<983628..>984305)
FT                   /locus_tag="AGOS_AGL025C"
FT                   /old_locus_tag="AGL025C"
FT                   /product="AGL025Cp"
FT   CDS_pept        complement(983628..984305)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL025C"
FT                   /old_locus_tag="AGL025C"
FT                   /product="AGL025Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL010C
FT                   (WWM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL025C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54465"
FT                   /db_xref="GOA:Q750H6"
FT                   /db_xref="InterPro:IPR001202"
FT                   /db_xref="InterPro:IPR009765"
FT                   /db_xref="InterPro:IPR036020"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H6"
FT                   /protein_id="AAS54465.1"
FT                   GDF"
FT   gene            <984688..>986958
FT                   /locus_tag="AGOS_AGL024W"
FT                   /old_locus_tag="AGL024W"
FT   mRNA            <984688..>986958
FT                   /locus_tag="AGOS_AGL024W"
FT                   /old_locus_tag="AGL024W"
FT                   /product="AGL024Wp"
FT   CDS_pept        984688..986958
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL024W"
FT                   /old_locus_tag="AGL024W"
FT                   /product="AGL024Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL009W
FT                   (CDC4) and Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YER066W (RRT13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL024W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54466"
FT                   /db_xref="GOA:Q750H5"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR001810"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR019775"
FT                   /db_xref="InterPro:IPR020472"
FT                   /db_xref="InterPro:IPR031740"
FT                   /db_xref="InterPro:IPR036047"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H5"
FT                   /protein_id="AAS54466.1"
FT                   ASS"
FT   gene            <987240..>987656
FT                   /locus_tag="AGOS_AGL024WA"
FT   mRNA            <987240..>987656
FT                   /locus_tag="AGOS_AGL024WA"
FT                   /product="AGL024W-Ap"
FT   CDS_pept        987240..987656
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL024WA"
FT                   /product="AGL024W-Ap"
FT                   /note="NOHBY748; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0D07524g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL024WA"
FT                   /db_xref="EnsemblGenomes-Tr:ADJ41742"
FT                   /db_xref="GOA:D8FGG5"
FT                   /db_xref="UniProtKB/TrEMBL:D8FGG5"
FT                   /protein_id="ADJ41742.1"
FT   gene            <988032..>991700
FT                   /locus_tag="AGOS_AGL023W"
FT                   /old_locus_tag="AGL023W"
FT   mRNA            <988032..>991700
FT                   /locus_tag="AGOS_AGL023W"
FT                   /old_locus_tag="AGL023W"
FT                   /product="AGL023Wp"
FT   CDS_pept        988032..991700
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL023W"
FT                   /old_locus_tag="AGL023W"
FT                   /product="AGL023Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL008W
FT                   (SMC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL023W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54467"
FT                   /db_xref="GOA:Q750H4"
FT                   /db_xref="InterPro:IPR003395"
FT                   /db_xref="InterPro:IPR010935"
FT                   /db_xref="InterPro:IPR024704"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR028468"
FT                   /db_xref="InterPro:IPR036277"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H4"
FT                   /protein_id="AAS54467.1"
FT   gene            <992102..>998539
FT                   /locus_tag="AGOS_AGL022W"
FT                   /old_locus_tag="AGL022W"
FT   mRNA            <992102..>998539
FT                   /locus_tag="AGOS_AGL022W"
FT                   /old_locus_tag="AGL022W"
FT                   /product="AGL022Wp"
FT   CDS_pept        992102..998539
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL022W"
FT                   /old_locus_tag="AGL022W"
FT                   /product="AGL022Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL007W
FT                   (BLM10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL022W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54468"
FT                   /db_xref="GOA:Q750L4"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR021843"
FT                   /db_xref="InterPro:IPR032372"
FT                   /db_xref="InterPro:IPR032430"
FT                   /db_xref="InterPro:IPR035309"
FT                   /db_xref="UniProtKB/TrEMBL:Q750L4"
FT                   /protein_id="AAS54468.2"
FT   gene            <998909..>999547
FT                   /locus_tag="AGOS_AGL021W"
FT                   /old_locus_tag="AGL021W"
FT   mRNA            <998909..>999547
FT                   /locus_tag="AGOS_AGL021W"
FT                   /old_locus_tag="AGL021W"
FT                   /product="AGL021Wp"
FT   CDS_pept        998909..999547
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL021W"
FT                   /old_locus_tag="AGL021W"
FT                   /product="AGL021Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL005W
FT                   (SEC4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL021W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54469"
FT                   /db_xref="GOA:Q750L3"
FT                   /db_xref="InterPro:IPR001806"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/TrEMBL:Q750L3"
FT                   /protein_id="AAS54469.1"
FT   gene            complement(999597..999997)
FT                   /locus_tag="AGOS_AgRUF20"
FT   ncRNA           complement(999597..999997)
FT                   /locus_tag="AGOS_AgRUF20"
FT                   /product="AgRUF20"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae RUF20;
FT                   start and end coordinates are approximate."
FT                   /ncRNA_class="other"
FT   gene            <1000113..>1002647
FT                   /locus_tag="AGOS_AGL020W"
FT                   /old_locus_tag="AGL020W"
FT   mRNA            <1000113..>1002647
FT                   /locus_tag="AGOS_AGL020W"
FT                   /old_locus_tag="AGL020W"
FT                   /product="AGL020Wp"
FT   CDS_pept        1000113..1002647
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL020W"
FT                   /old_locus_tag="AGL020W"
FT                   /product="AGL020Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL004W
FT                   (VTC2) and YPL019C (VTC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL020W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54470"
FT                   /db_xref="GOA:Q750H3"
FT                   /db_xref="InterPro:IPR003807"
FT                   /db_xref="InterPro:IPR004331"
FT                   /db_xref="InterPro:IPR018966"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H3"
FT                   /protein_id="AAS54470.1"
FT   gene            <1003174..>1004745
FT                   /locus_tag="AGOS_AGL019W"
FT                   /old_locus_tag="AGL019W"
FT   mRNA            <1003174..>1004745
FT                   /locus_tag="AGOS_AGL019W"
FT                   /old_locus_tag="AGL019W"
FT                   /product="AGL019Wp"
FT   CDS_pept        1003174..1004745
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL019W"
FT                   /old_locus_tag="AGL019W"
FT                   /product="AGL019Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL020C
FT                   (ULP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL019W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54471"
FT                   /db_xref="GOA:Q750H2"
FT                   /db_xref="InterPro:IPR003653"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H2"
FT                   /protein_id="AAS54471.2"
FT                   LSEGKK"
FT   gene            complement(<1005021..>1006043)
FT                   /locus_tag="AGOS_AGL018C"
FT                   /old_locus_tag="AGL018C"
FT   mRNA            complement(<1005021..>1006043)
FT                   /locus_tag="AGOS_AGL018C"
FT                   /old_locus_tag="AGL018C"
FT                   /product="AGL018Cp"
FT   CDS_pept        complement(1005021..1006043)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL018C"
FT                   /old_locus_tag="AGL018C"
FT                   /product="AGL018Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL015C
FT                   (HST2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL018C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54472"
FT                   /db_xref="GOA:Q750H1"
FT                   /db_xref="InterPro:IPR003000"
FT                   /db_xref="InterPro:IPR017328"
FT                   /db_xref="InterPro:IPR026590"
FT                   /db_xref="InterPro:IPR026591"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H1"
FT                   /protein_id="AAS54472.1"
FT                   "
FT   gene            complement(1006147..1006220)
FT                   /locus_tag="AGOS_t0182"
FT   tRNA            complement(1006147..1006220)
FT                   /locus_tag="AGOS_t0182"
FT                   /product="tRNA-Asn"
FT                   /note="codon recognized: AAC"
FT   gene            <1006555..>1009575
FT                   /locus_tag="AGOS_AGL017W"
FT                   /old_locus_tag="AGL017W"
FT   mRNA            <1006555..>1009575
FT                   /locus_tag="AGOS_AGL017W"
FT                   /old_locus_tag="AGL017W"
FT                   /product="AGL017Wp"
FT   CDS_pept        1006555..1009575
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL017W"
FT                   /old_locus_tag="AGL017W"
FT                   /product="AGL017Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL009C
FT                   (TAE2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL017W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54473"
FT                   /db_xref="GOA:Q750H0"
FT                   /db_xref="InterPro:IPR008532"
FT                   /db_xref="InterPro:IPR021846"
FT                   /db_xref="UniProtKB/TrEMBL:Q750H0"
FT                   /protein_id="AAS54473.2"
FT                   IPGGGEKQGSKTKSKKK"
FT   gene            complement(<1009682..>1010248)
FT                   /locus_tag="AGOS_AGL016C"
FT                   /old_locus_tag="AGL016C"
FT   mRNA            complement(<1009682..>1010248)
FT                   /locus_tag="AGOS_AGL016C"
FT                   /old_locus_tag="AGL016C"
FT                   /product="AGL016Cp"
FT   CDS_pept        complement(1009682..1010248)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL016C"
FT                   /old_locus_tag="AGL016C"
FT                   /product="AGL016Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL010W
FT                   (RET3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL016C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54474"
FT                   /db_xref="GOA:Q750G9"
FT                   /db_xref="InterPro:IPR011012"
FT                   /db_xref="InterPro:IPR022775"
FT                   /db_xref="InterPro:IPR039652"
FT                   /db_xref="UniProtKB/TrEMBL:Q750G9"
FT                   /protein_id="AAS54474.1"
FT   gene            <1010616..>1011677
FT                   /locus_tag="AGOS_AGL015W"
FT                   /old_locus_tag="AGL015W"
FT   mRNA            <1010616..>1011677
FT                   /locus_tag="AGOS_AGL015W"
FT                   /old_locus_tag="AGL015W"
FT                   /product="AGL015Wp"
FT   CDS_pept        1010616..1011677
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL015W"
FT                   /old_locus_tag="AGL015W"
FT                   /product="AGL015Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL011C
FT                   (TAF3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL015W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54475"
FT                   /db_xref="GOA:Q750G8"
FT                   /db_xref="InterPro:IPR006565"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="UniProtKB/TrEMBL:Q750G8"
FT                   /protein_id="AAS54475.1"
FT                   FNNGDSPTYDTGI"
FT   gene            complement(<1011773..>1015411)
FT                   /locus_tag="AGOS_AGL014C"
FT                   /old_locus_tag="AGL014C"
FT   mRNA            complement(<1011773..>1015411)
FT                   /locus_tag="AGOS_AGL014C"
FT                   /old_locus_tag="AGL014C"
FT                   /product="AGL014Cp"
FT   CDS_pept        complement(1011773..1015411)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL014C"
FT                   /old_locus_tag="AGL014C"
FT                   /product="AGL014Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL012W
FT                   (RRP12)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL014C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54476"
FT                   /db_xref="GOA:Q750G7"
FT                   /db_xref="InterPro:IPR012978"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/TrEMBL:Q750G7"
FT                   /protein_id="AAS54476.2"
FT   gene            <1015802..>1016158
FT                   /locus_tag="AGOS_AGL013W"
FT                   /old_locus_tag="AGL013W"
FT   mRNA            <1015802..>1016158
FT                   /locus_tag="AGOS_AGL013W"
FT                   /old_locus_tag="AGL013W"
FT                   /product="AGL013Wp"
FT   CDS_pept        1015802..1016158
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL013W"
FT                   /old_locus_tag="AGL013W"
FT                   /product="AGL013Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL013C
FT                   (MRPS16)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL013W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54477"
FT                   /db_xref="GOA:Q750G6"
FT                   /db_xref="InterPro:IPR000307"
FT                   /db_xref="InterPro:IPR020592"
FT                   /db_xref="InterPro:IPR023803"
FT                   /db_xref="UniProtKB/TrEMBL:Q750G6"
FT                   /protein_id="AAS54477.2"
FT                   SSTKVVEPVKEVVE"
FT   gene            complement(<1016557..>1017807)
FT                   /locus_tag="AGOS_AGL012C"
FT                   /old_locus_tag="AGL012C"
FT   mRNA            complement(<1016557..>1017807)
FT                   /locus_tag="AGOS_AGL012C"
FT                   /old_locus_tag="AGL012C"
FT                   /product="AGL012Cp"
FT   CDS_pept        complement(1016557..1017807)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL012C"
FT                   /old_locus_tag="AGL012C"
FT                   /product="AGL012Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YPL014W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL012C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54478"
FT                   /db_xref="UniProtKB/TrEMBL:Q750G5"
FT                   /protein_id="AAS54478.1"
FT                   LDVLGESFLATGPNPVC"
FT   gene            complement(<1018481..>1019434)
FT                   /locus_tag="AGOS_AGL011C"
FT                   /old_locus_tag="AGL011C"
FT   mRNA            complement(<1018481..>1019434)
FT                   /locus_tag="AGOS_AGL011C"
FT                   /old_locus_tag="AGL011C"
FT                   /product="AGL011Cp"
FT   CDS_pept        complement(1018481..1019434)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL011C"
FT                   /old_locus_tag="AGL011C"
FT                   /product="AGL011Cp"
FT                   /note="NOHBY701; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F27203g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL011C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54479"
FT                   /db_xref="GOA:Q750G4"
FT                   /db_xref="UniProtKB/TrEMBL:Q750G4"
FT                   /protein_id="AAS54479.1"
FT   gene            <1019939..>1022344
FT                   /locus_tag="AGOS_AGL010W"
FT                   /old_locus_tag="AGL010W"
FT   mRNA            <1019939..>1022344
FT                   /locus_tag="AGOS_AGL010W"
FT                   /old_locus_tag="AGL010W"
FT                   /product="AGL010Wp"
FT   CDS_pept        1019939..1022344
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL010W"
FT                   /old_locus_tag="AGL010W"
FT                   /product="AGL010Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL008W
FT                   (CHL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL010W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54480"
FT                   /db_xref="GOA:Q750G3"
FT                   /db_xref="InterPro:IPR006554"
FT                   /db_xref="InterPro:IPR006555"
FT                   /db_xref="InterPro:IPR010614"
FT                   /db_xref="InterPro:IPR013020"
FT                   /db_xref="InterPro:IPR014013"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR028331"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750G3"
FT                   /protein_id="AAS54480.1"
FT   gene            complement(<1022374..>1024095)
FT                   /locus_tag="AGOS_AGL009C"
FT                   /old_locus_tag="AGL009C"
FT   mRNA            complement(<1022374..>1024095)
FT                   /locus_tag="AGOS_AGL009C"
FT                   /old_locus_tag="AGL009C"
FT                   /product="AGL009Cp"
FT   CDS_pept        complement(1022374..1024095)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL009C"
FT                   /old_locus_tag="AGL009C"
FT                   /product="AGL009Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL007C
FT                   (TFC8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL009C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54481"
FT                   /db_xref="GOA:Q750G2"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR024764"
FT                   /db_xref="UniProtKB/TrEMBL:Q750G2"
FT                   /protein_id="AAS54481.2"
FT   gene            <1024201..>1027737
FT                   /locus_tag="AGOS_AGL008W"
FT                   /old_locus_tag="AGL008W"
FT   mRNA            <1024201..>1027737
FT                   /locus_tag="AGOS_AGL008W"
FT                   /old_locus_tag="AGL008W"
FT                   /product="AGL008Wp"
FT   CDS_pept        1024201..1027737
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL008W"
FT                   /old_locus_tag="AGL008W"
FT                   /product="AGL008Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL006W
FT                   (NCR1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL008W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54482"
FT                   /db_xref="GOA:Q750G1"
FT                   /db_xref="InterPro:IPR000731"
FT                   /db_xref="InterPro:IPR003392"
FT                   /db_xref="InterPro:IPR032190"
FT                   /db_xref="UniProtKB/TrEMBL:Q750G1"
FT                   /protein_id="AAS54482.1"
FT                   EGNSEVRLVDAE"
FT   gene            <1027911..>1029521
FT                   /locus_tag="AGOS_AGL007W"
FT                   /old_locus_tag="AGL007W"
FT   mRNA            <1027911..>1029521
FT                   /locus_tag="AGOS_AGL007W"
FT                   /old_locus_tag="AGL007W"
FT                   /product="AGL007Wp"
FT   CDS_pept        1027911..1029521
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL007W"
FT                   /old_locus_tag="AGL007W"
FT                   /product="AGL007Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL005W
FT                   (AEP3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL007W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54483"
FT                   /db_xref="GOA:Q750L0"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750L0"
FT                   /protein_id="AAS54483.1"
FT   gene            complement(<1029946..>1030863)
FT                   /locus_tag="AGOS_AGL006C"
FT                   /old_locus_tag="AGL006C"
FT   mRNA            complement(<1029946..>1030863)
FT                   /locus_tag="AGOS_AGL006C"
FT                   /old_locus_tag="AGL006C"
FT                   /product="AGL006Cp"
FT   CDS_pept        complement(1029946..1030863)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL006C"
FT                   /old_locus_tag="AGL006C"
FT                   /product="AGL006Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL004C
FT                   (LSP1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL006C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54484"
FT                   /db_xref="GOA:Q750G0"
FT                   /db_xref="InterPro:IPR027267"
FT                   /db_xref="InterPro:IPR028245"
FT                   /db_xref="UniProtKB/TrEMBL:Q750G0"
FT                   /protein_id="AAS54484.1"
FT   gene            <1031231..>1032607
FT                   /locus_tag="AGOS_AGL005W"
FT                   /old_locus_tag="AGL005W"
FT   mRNA            <1031231..>1032607
FT                   /locus_tag="AGOS_AGL005W"
FT                   /old_locus_tag="AGL005W"
FT                   /product="AGL005Wp"
FT   CDS_pept        1031231..1032607
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL005W"
FT                   /old_locus_tag="AGL005W"
FT                   /product="AGL005Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL003W
FT                   (ULA1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL005W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54485"
FT                   /db_xref="GOA:Q750F9"
FT                   /db_xref="InterPro:IPR030667"
FT                   /db_xref="InterPro:IPR035985"
FT                   /db_xref="UniProtKB/TrEMBL:Q750F9"
FT                   /protein_id="AAS54485.1"
FT                   "
FT   gene            complement(<1032636..>1034564)
FT                   /locus_tag="AGOS_AGL004C"
FT                   /old_locus_tag="AGL004C"
FT   mRNA            complement(<1032636..>1034564)
FT                   /locus_tag="AGOS_AGL004C"
FT                   /old_locus_tag="AGL004C"
FT                   /product="AGL004Cp"
FT   CDS_pept        complement(1032636..1034564)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL004C"
FT                   /old_locus_tag="AGL004C"
FT                   /product="AGL004Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL002C
FT                   (SPB4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL004C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54486"
FT                   /db_xref="GOA:Q750F8"
FT                   /db_xref="InterPro:IPR000629"
FT                   /db_xref="InterPro:IPR001650"
FT                   /db_xref="InterPro:IPR011545"
FT                   /db_xref="InterPro:IPR014001"
FT                   /db_xref="InterPro:IPR014014"
FT                   /db_xref="InterPro:IPR025313"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750F8"
FT                   /protein_id="AAS54486.1"
FT                   QGDFGDL"
FT   gene            <1034603..>1035901
FT                   /locus_tag="AGOS_AGL003W"
FT                   /old_locus_tag="AGL003W"
FT   mRNA            <1034603..>1035901
FT                   /locus_tag="AGOS_AGL003W"
FT                   /old_locus_tag="AGL003W"
FT                   /product="AGL003Wp"
FT   CDS_pept        1034603..1035901
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL003W"
FT                   /old_locus_tag="AGL003W"
FT                   /product="AGL003Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFL001W
FT                   (DEG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL003W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54487"
FT                   /db_xref="GOA:Q750F7"
FT                   /db_xref="InterPro:IPR001406"
FT                   /db_xref="InterPro:IPR020095"
FT                   /db_xref="InterPro:IPR020097"
FT                   /db_xref="InterPro:IPR020103"
FT                   /db_xref="InterPro:IPR041707"
FT                   /db_xref="UniProtKB/TrEMBL:Q750F7"
FT                   /protein_id="AAS54487.2"
FT   gene            complement(<1036075..>1036773)
FT                   /locus_tag="AGOS_AGL002C"
FT                   /old_locus_tag="AGL002C"
FT   mRNA            complement(<1036075..>1036773)
FT                   /locus_tag="AGOS_AGL002C"
FT                   /old_locus_tag="AGL002C"
FT                   /product="AGL002Cp"
FT   CDS_pept        complement(1036075..1036773)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL002C"
FT                   /old_locus_tag="AGL002C"
FT                   /product="AGL002Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL002C
FT                   (SNF8)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL002C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54488"
FT                   /db_xref="GOA:Q750F6"
FT                   /db_xref="InterPro:IPR016689"
FT                   /db_xref="InterPro:IPR036388"
FT                   /db_xref="InterPro:IPR036390"
FT                   /db_xref="InterPro:IPR040608"
FT                   /db_xref="UniProtKB/TrEMBL:Q750F6"
FT                   /protein_id="AAS54488.1"
FT                   WDPAWIMRTY"
FT   gene            <1036882..>1038057
FT                   /locus_tag="AGOS_AGL001W"
FT                   /old_locus_tag="AGL001W"
FT   mRNA            <1036882..>1038057
FT                   /locus_tag="AGOS_AGL001W"
FT                   /old_locus_tag="AGL001W"
FT                   /product="AGL001Wp"
FT   CDS_pept        1036882..1038057
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGL001W"
FT                   /old_locus_tag="AGL001W"
FT                   /product="AGL001Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPL001W
FT                   (HAT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGL001W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54489"
FT                   /db_xref="GOA:Q750F5"
FT                   /db_xref="InterPro:IPR016181"
FT                   /db_xref="InterPro:IPR017380"
FT                   /db_xref="InterPro:IPR019467"
FT                   /db_xref="InterPro:IPR037113"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750F5"
FT                   /protein_id="AAS54489.2"
FT   centromere      1038620..1038811
FT                   /note="Chromosome VII centromere"
FT   centromere      1038620..1038627
FT                   /note="Chromosome VII centromere CDE I element"
FT   centromere      1038628..1038794
FT                   /note="Chromosome VII centromere CDE II element"
FT   centromere      1038795..1038811
FT                   /note="Chromosome VII centromere CDE III element"
FT   gene            <1039149..>1039748
FT                   /locus_tag="AGOS_AGR001W"
FT                   /old_locus_tag="AGR001W"
FT   mRNA            <1039149..>1039748
FT                   /locus_tag="AGOS_AGR001W"
FT                   /old_locus_tag="AGR001W"
FT                   /product="AGR001Wp"
FT   CDS_pept        1039149..1039748
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR001W"
FT                   /old_locus_tag="AGR001W"
FT                   /product="AGR001Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR001W
FT                   (LOC1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR001W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54490"
FT                   /db_xref="GOA:Q750F4"
FT                   /db_xref="InterPro:IPR037650"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750F4"
FT                   /protein_id="AAS54490.1"
FT   gene            <1040244..>1041692
FT                   /locus_tag="AGOS_AGR002W"
FT                   /old_locus_tag="AGR002W"
FT   mRNA            <1040244..>1041692
FT                   /locus_tag="AGOS_AGR002W"
FT                   /old_locus_tag="AGR002W"
FT                   /product="AGR002Wp"
FT   CDS_pept        1040244..1041692
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR002W"
FT                   /old_locus_tag="AGR002W"
FT                   /product="AGR002Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR001W
FT                   (CIT3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR002W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54491"
FT                   /db_xref="GOA:Q750F3"
FT                   /db_xref="InterPro:IPR002020"
FT                   /db_xref="InterPro:IPR016142"
FT                   /db_xref="InterPro:IPR016143"
FT                   /db_xref="InterPro:IPR019810"
FT                   /db_xref="InterPro:IPR036969"
FT                   /db_xref="UniProtKB/TrEMBL:Q750F3"
FT                   /protein_id="AAS54491.1"
FT   gene            <1042268..>1043824
FT                   /locus_tag="AGOS_AGR003W"
FT                   /old_locus_tag="AGR003W"
FT   mRNA            <1042268..>1043824
FT                   /locus_tag="AGOS_AGR003W"
FT                   /old_locus_tag="AGR003W"
FT                   /product="AGR003Wp"
FT   CDS_pept        1042268..1043824
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR003W"
FT                   /old_locus_tag="AGR003W"
FT                   /product="AGR003Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YPR002W
FT                   (PDH1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR003W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54492"
FT                   /db_xref="GOA:Q750F2"
FT                   /db_xref="InterPro:IPR005656"
FT                   /db_xref="InterPro:IPR012705"
FT                   /db_xref="InterPro:IPR036148"
FT                   /db_xref="InterPro:IPR042183"
FT                   /db_xref="InterPro:IPR042188"
FT                   /db_xref="UniProtKB/TrEMBL:Q750F2"
FT                   /protein_id="AAS54492.1"
FT                   R"
FT   gene            <1044046..>1046601
FT                   /locus_tag="AGOS_AGR004W"
FT                   /old_locus_tag="AGR004W"
FT   mRNA            <1044046..>1046601
FT                   /locus_tag="AGOS_AGR004W"
FT                   /old_locus_tag="AGR004W"
FT                   /product="AGR004Wp"
FT   CDS_pept        1044046..1046601
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR004W"
FT                   /old_locus_tag="AGR004W"
FT                   /product="AGR004Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR002W
FT                   (NIC96)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR004W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54493"
FT                   /db_xref="GOA:Q750F1"
FT                   /db_xref="InterPro:IPR007231"
FT                   /db_xref="UniProtKB/TrEMBL:Q750F1"
FT                   /protein_id="AAS54493.1"
FT   gene            complement(<1046672..>1047127)
FT                   /locus_tag="AGOS_AGR005C"
FT                   /old_locus_tag="AGR005C"
FT   mRNA            complement(<1046672..>1047127)
FT                   /locus_tag="AGOS_AGR005C"
FT                   /old_locus_tag="AGR005C"
FT                   /product="AGR005Cp"
FT   CDS_pept        complement(1046672..1047127)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR005C"
FT                   /old_locus_tag="AGR005C"
FT                   /product="AGR005Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR003C
FT                   (YPI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR005C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54494"
FT                   /db_xref="GOA:Q750F0"
FT                   /db_xref="InterPro:IPR011107"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750F0"
FT                   /protein_id="AAS54494.1"
FT   gene            <1047366..>1048301
FT                   /locus_tag="AGOS_AGR006W"
FT                   /old_locus_tag="AGR006W"
FT   mRNA            <1047366..>1048301
FT                   /locus_tag="AGOS_AGR006W"
FT                   /old_locus_tag="AGR006W"
FT                   /product="AGR006Wp"
FT   CDS_pept        1047366..1048301
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR006W"
FT                   /old_locus_tag="AGR006W"
FT                   /product="AGR006Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR004W
FT                   (RPN11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR006W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54495"
FT                   /db_xref="GOA:Q750E9"
FT                   /db_xref="InterPro:IPR000555"
FT                   /db_xref="InterPro:IPR024969"
FT                   /db_xref="InterPro:IPR035299"
FT                   /db_xref="InterPro:IPR037518"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750E9"
FT                   /protein_id="AAS54495.1"
FT   gene            complement(<1048359..>1049855)
FT                   /locus_tag="AGOS_AGR007C"
FT                   /old_locus_tag="AGR007C"
FT   mRNA            complement(<1048359..>1049855)
FT                   /locus_tag="AGOS_AGR007C"
FT                   /old_locus_tag="AGR007C"
FT                   /product="AGR007Cp"
FT   CDS_pept        complement(1048359..1049855)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR007C"
FT                   /old_locus_tag="AGR007C"
FT                   /product="AGR007Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YFR005C
FT                   (SAD1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR007C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54496"
FT                   /db_xref="GOA:Q750E8"
FT                   /db_xref="InterPro:IPR001394"
FT                   /db_xref="InterPro:IPR001607"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR028889"
FT                   /db_xref="InterPro:IPR033809"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="UniProtKB/TrEMBL:Q750E8"
FT                   /protein_id="AAS54496.2"
FT   gene            <1049997..>1051541
FT                   /locus_tag="AGOS_AGR008W"
FT                   /old_locus_tag="AGR008W"
FT   mRNA            <1049997..>1051541
FT                   /locus_tag="AGOS_AGR008W"
FT                   /old_locus_tag="AGR008W"
FT                   /product="AGR008Wp"
FT   CDS_pept        1049997..1051541
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR008W"
FT                   /old_locus_tag="AGR008W"
FT                   /product="AGR008Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YFR006W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR008W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54497"
FT                   /db_xref="GOA:Q750E7"
FT                   /db_xref="InterPro:IPR000994"
FT                   /db_xref="InterPro:IPR007865"
FT                   /db_xref="InterPro:IPR029149"
FT                   /db_xref="InterPro:IPR036005"
FT                   /db_xref="UniProtKB/TrEMBL:Q750E7"
FT                   /protein_id="AAS54497.1"
FT   gene            complement(1051747..1051835)
FT                   /locus_tag="AGOS_t0183"
FT   tRNA            complement(join(1051747..1051782,1051799..1051835))
FT                   /locus_tag="AGOS_t0183"
FT                   /product="tRNA-Phe"
FT                   /note="codon recognized: UUC"
FT   gene            1052123..1052234
FT                   /locus_tag="AGOS_t0184"
FT   tRNA            join(1052123..1052160,1052191..1052234)
FT                   /locus_tag="AGOS_t0184"
FT                   /product="tRNA-Leu"
FT                   /note="codon recognized: UUG"
FT   gene            complement(<1052357..>1053472)
FT                   /locus_tag="AGOS_AGR009C"
FT                   /old_locus_tag="AGR009C"
FT   mRNA            complement(<1052357..>1053472)
FT                   /locus_tag="AGOS_AGR009C"
FT                   /old_locus_tag="AGR009C"
FT                   /product="AGR009Cp"
FT   CDS_pept        complement(1052357..1053472)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR009C"
FT                   /old_locus_tag="AGR009C"
FT                   /product="AGR009Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR156W
FT                   (PTI1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR009C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54498"
FT                   /db_xref="GOA:Q750E6"
FT                   /db_xref="InterPro:IPR025742"
FT                   /db_xref="InterPro:IPR026896"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="UniProtKB/TrEMBL:Q750E6"
FT                   /protein_id="AAS54498.2"
FT   gene            complement(<1053756..>1054556)
FT                   /locus_tag="AGOS_AGR010C"
FT                   /old_locus_tag="AGR010C"
FT   mRNA            complement(<1053756..>1054556)
FT                   /locus_tag="AGOS_AGR010C"
FT                   /old_locus_tag="AGR010C"
FT                   /product="AGR010Cp"
FT   CDS_pept        complement(1053756..1054556)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR010C"
FT                   /old_locus_tag="AGR010C"
FT                   /product="AGR010Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL044C
FT                   (RNA15)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR010C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54499"
FT                   /db_xref="GOA:Q750E5"
FT                   /db_xref="InterPro:IPR000504"
FT                   /db_xref="InterPro:IPR012677"
FT                   /db_xref="InterPro:IPR025742"
FT                   /db_xref="InterPro:IPR026896"
FT                   /db_xref="InterPro:IPR035979"
FT                   /db_xref="InterPro:IPR038192"
FT                   /db_xref="UniProtKB/TrEMBL:Q750E5"
FT                   /protein_id="AAS54499.1"
FT   gene            <1054753..>1055667
FT                   /locus_tag="AGOS_AGR011W"
FT                   /old_locus_tag="AGR011W"
FT   mRNA            <1054753..>1055667
FT                   /locus_tag="AGOS_AGR011W"
FT                   /old_locus_tag="AGR011W"
FT                   /product="AGR011Wp"
FT   CDS_pept        1054753..1055667
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR011W"
FT                   /old_locus_tag="AGR011W"
FT                   /product="AGR011Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL043W
FT                   (DST1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR011W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54500"
FT                   /db_xref="GOA:Q750E4"
FT                   /db_xref="InterPro:IPR001222"
FT                   /db_xref="InterPro:IPR003617"
FT                   /db_xref="InterPro:IPR003618"
FT                   /db_xref="InterPro:IPR006289"
FT                   /db_xref="InterPro:IPR017923"
FT                   /db_xref="InterPro:IPR035100"
FT                   /db_xref="InterPro:IPR035441"
FT                   /db_xref="InterPro:IPR036575"
FT                   /db_xref="UniProtKB/TrEMBL:Q750E4"
FT                   /protein_id="AAS54500.2"
FT   gene            complement(<1056080..>1057558)
FT                   /locus_tag="AGOS_AGR012C"
FT                   /old_locus_tag="AGR012C"
FT   mRNA            complement(<1056080..>1057558)
FT                   /locus_tag="AGOS_AGR012C"
FT                   /old_locus_tag="AGR012C"
FT                   /product="AGR012Cp"
FT   CDS_pept        complement(1056080..1057558)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR012C"
FT                   /old_locus_tag="AGR012C"
FT                   /product="AGR012Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR155W
FT                   (CYS4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR012C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54501"
FT                   /db_xref="GOA:Q750E3"
FT                   /db_xref="InterPro:IPR000644"
FT                   /db_xref="InterPro:IPR001216"
FT                   /db_xref="InterPro:IPR001926"
FT                   /db_xref="InterPro:IPR005857"
FT                   /db_xref="InterPro:IPR036052"
FT                   /db_xref="UniProtKB/TrEMBL:Q750E3"
FT                   /protein_id="AAS54501.2"
FT   gene            complement(<1057838..>1058752)
FT                   /locus_tag="AGOS_AGR013C"
FT                   /old_locus_tag="AGR013C"
FT   mRNA            complement(<1057838..>1058752)
FT                   /locus_tag="AGOS_AGR013C"
FT                   /old_locus_tag="AGR013C"
FT                   /product="AGR013Cp"
FT   CDS_pept        complement(1057838..1058752)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR013C"
FT                   /old_locus_tag="AGR013C"
FT                   /product="AGR013Cp"
FT                   /note="NOHBY730; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Saccharomyces kluyveri SAKL0H23386g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR013C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54502"
FT                   /db_xref="InterPro:IPR018959"
FT                   /db_xref="InterPro:IPR028896"
FT                   /db_xref="UniProtKB/TrEMBL:Q750E2"
FT                   /protein_id="AAS54502.2"
FT   gene            <1059161..>1059820
FT                   /locus_tag="AGOS_AGR014W"
FT                   /old_locus_tag="AGR014W"
FT   mRNA            <1059161..>1059820
FT                   /locus_tag="AGOS_AGR014W"
FT                   /old_locus_tag="AGR014W"
FT                   /product="AGR014Wp"
FT   CDS_pept        1059161..1059820
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR014W"
FT                   /old_locus_tag="AGR014W"
FT                   /product="AGR014Wp"
FT                   /note="Non-syntenic homolog of Saccharomyces cerevisiae
FT                   YMR077C (VPS20)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR014W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54503"
FT                   /db_xref="GOA:Q750E1"
FT                   /db_xref="InterPro:IPR005024"
FT                   /db_xref="UniProtKB/TrEMBL:Q750E1"
FT                   /protein_id="AAS54503.1"
FT   gene            complement(<1059920..>1060942)
FT                   /locus_tag="AGOS_AGR015C"
FT                   /old_locus_tag="AGR015C"
FT   mRNA            complement(<1059920..>1060942)
FT                   /locus_tag="AGOS_AGR015C"
FT                   /old_locus_tag="AGR015C"
FT                   /product="AGR015Cp"
FT   CDS_pept        complement(1059920..1060942)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR015C"
FT                   /old_locus_tag="AGR015C"
FT                   /product="AGR015Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGL040C
FT                   (HEM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR015C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54504"
FT                   /db_xref="GOA:Q750E0"
FT                   /db_xref="InterPro:IPR001731"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR030656"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750E0"
FT                   /protein_id="AAS54504.1"
FT                   "
FT   gene            <1061381..>1062097
FT                   /locus_tag="AGOS_AGR016W"
FT                   /old_locus_tag="AGR016W"
FT   mRNA            <1061381..>1062097
FT                   /locus_tag="AGOS_AGR016W"
FT                   /old_locus_tag="AGR016W"
FT                   /product="AGR016Wp"
FT   CDS_pept        1061381..1062097
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR016W"
FT                   /old_locus_tag="AGR016W"
FT                   /product="AGR016Wp"
FT                   /note="NOHBY731; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F09251g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR016W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54505"
FT                   /db_xref="GOA:Q750D9"
FT                   /db_xref="InterPro:IPR008979"
FT                   /db_xref="InterPro:IPR010400"
FT                   /db_xref="InterPro:IPR037047"
FT                   /db_xref="UniProtKB/TrEMBL:Q750D9"
FT                   /protein_id="AAS54505.1"
FT                   EHVKLESEHERLHLGM"
FT   gene            <1062566..>1063387
FT                   /locus_tag="AGOS_AGR017W"
FT                   /old_locus_tag="AGR017W"
FT   mRNA            join(<1062566..1062721,1062785..>1063387)
FT                   /locus_tag="AGOS_AGR017W"
FT                   /old_locus_tag="AGR017W"
FT                   /product="AGR017Wp"
FT   CDS_pept        join(1062566..1062721,1062785..1063387)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR017W"
FT                   /old_locus_tag="AGR017W"
FT                   /product="AGR017Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR329W
FT                   (REC102); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR017W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54506"
FT                   /db_xref="UniProtKB/TrEMBL:Q750D8"
FT                   /protein_id="AAS54506.1"
FT   gene            complement(<1063374..>1063949)
FT                   /locus_tag="AGOS_AGR018C"
FT                   /old_locus_tag="AGR018C"
FT   mRNA            complement(<1063374..>1063949)
FT                   /locus_tag="AGOS_AGR018C"
FT                   /old_locus_tag="AGR018C"
FT                   /product="AGR018Cp"
FT   CDS_pept        complement(1063374..1063949)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR018C"
FT                   /old_locus_tag="AGR018C"
FT                   /product="AGR018Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR016W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR018C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54507"
FT                   /db_xref="GOA:Q750D7"
FT                   /db_xref="InterPro:IPR016564"
FT                   /db_xref="UniProtKB/TrEMBL:Q750D7"
FT                   /protein_id="AAS54507.1"
FT   gene            complement(<1064797..>1068114)
FT                   /locus_tag="AGOS_AGR019C"
FT                   /old_locus_tag="AGR019C"
FT   mRNA            complement(<1064797..>1068114)
FT                   /locus_tag="AGOS_AGR019C"
FT                   /old_locus_tag="AGR019C"
FT                   /product="AGR019Cp"
FT   CDS_pept        complement(1064797..1068114)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR019C"
FT                   /old_locus_tag="AGR019C"
FT                   /product="AGR019Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR014W
FT                   (MSB2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR019C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54508"
FT                   /db_xref="GOA:Q750D6"
FT                   /db_xref="InterPro:IPR039295"
FT                   /db_xref="UniProtKB/TrEMBL:Q750D6"
FT                   /protein_id="AAS54508.1"
FT   gene            complement(<1068974..>1070734)
FT                   /locus_tag="AGOS_AGR020C"
FT                   /old_locus_tag="AGR020C"
FT   mRNA            complement(<1068974..>1070734)
FT                   /locus_tag="AGOS_AGR020C"
FT                   /old_locus_tag="AGR020C"
FT                   /product="AGR020Cp"
FT   CDS_pept        complement(1068974..1070734)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR020C"
FT                   /old_locus_tag="AGR020C"
FT                   /product="AGR020Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YGR013W
FT                   (SNU71)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR020C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54509"
FT                   /db_xref="GOA:Q750D5"
FT                   /db_xref="InterPro:IPR002483"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750D5"
FT                   /protein_id="AAS54509.2"
FT                   DAIWAKLLKH"
FT   gene            complement(<1070910..>1072073)
FT                   /locus_tag="AGOS_AGR021C"
FT                   /old_locus_tag="AGR021C"
FT   mRNA            complement(<1070910..>1072073)
FT                   /locus_tag="AGOS_AGR021C"
FT                   /old_locus_tag="AGR021C"
FT                   /product="AGR021Cp"
FT   CDS_pept        complement(1070910..1072073)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR021C"
FT                   /old_locus_tag="AGR021C"
FT                   /product="AGR021Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YGR012W"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR021C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54510"
FT                   /db_xref="GOA:Q750D4"
FT                   /db_xref="InterPro:IPR001216"
FT                   /db_xref="InterPro:IPR001926"
FT                   /db_xref="InterPro:IPR036052"
FT                   /db_xref="UniProtKB/TrEMBL:Q750D4"
FT                   /protein_id="AAS54510.1"
FT   gene            complement(<1072437..>1073639)
FT                   /locus_tag="AGOS_AGR022C"
FT                   /old_locus_tag="AGR022C"
FT   mRNA            complement(<1072437..>1073639)
FT                   /locus_tag="AGOS_AGR022C"
FT                   /old_locus_tag="AGR022C"
FT                   /product="AGR022Cp"
FT   CDS_pept        complement(1072437..1073639)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR022C"
FT                   /old_locus_tag="AGR022C"
FT                   /product="AGR022Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR328W
FT                   (NMA1) and YGR010W (NMA2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR022C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54511"
FT                   /db_xref="GOA:Q750D3"
FT                   /db_xref="InterPro:IPR004821"
FT                   /db_xref="InterPro:IPR005248"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="UniProtKB/TrEMBL:Q750D3"
FT                   /protein_id="AAS54511.2"
FT                   D"
FT   gene            complement(<1074114..>1076456)
FT                   /locus_tag="AGOS_AGR023C"
FT                   /old_locus_tag="AGR023C"
FT   mRNA            complement(<1074114..>1076456)
FT                   /locus_tag="AGOS_AGR023C"
FT                   /old_locus_tag="AGR023C"
FT                   /product="AGR023Cp"
FT   CDS_pept        complement(1074114..1076456)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR023C"
FT                   /old_locus_tag="AGR023C"
FT                   /product="AGR023Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR058C
FT                   (UBP14)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR023C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54512"
FT                   /db_xref="GOA:Q750D2"
FT                   /db_xref="InterPro:IPR001394"
FT                   /db_xref="InterPro:IPR001607"
FT                   /db_xref="InterPro:IPR009060"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR015940"
FT                   /db_xref="InterPro:IPR016652"
FT                   /db_xref="InterPro:IPR018200"
FT                   /db_xref="InterPro:IPR028889"
FT                   /db_xref="InterPro:IPR033864"
FT                   /db_xref="InterPro:IPR038765"
FT                   /db_xref="InterPro:IPR041432"
FT                   /db_xref="UniProtKB/TrEMBL:Q750D2"
FT                   /protein_id="AAS54512.1"
FT   gene            complement(<1076692..>1078125)
FT                   /locus_tag="AGOS_AGR024C"
FT                   /old_locus_tag="AGR024C"
FT   mRNA            complement(<1076692..>1078125)
FT                   /locus_tag="AGOS_AGR024C"
FT                   /old_locus_tag="AGR024C"
FT                   /product="AGR024Cp"
FT   CDS_pept        complement(1076692..1078125)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR024C"
FT                   /old_locus_tag="AGR024C"
FT                   /product="AGR024Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR036C
FT                   (EHD3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR024C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54513"
FT                   /db_xref="GOA:Q750D1"
FT                   /db_xref="InterPro:IPR000048"
FT                   /db_xref="InterPro:IPR029045"
FT                   /db_xref="InterPro:IPR032259"
FT                   /db_xref="UniProtKB/TrEMBL:Q750D1"
FT                   /protein_id="AAS54513.1"
FT   gene            <1078662..>1079798
FT                   /locus_tag="AGOS_AGR025W"
FT                   /old_locus_tag="AGR025W"
FT   mRNA            <1078662..>1079798
FT                   /locus_tag="AGOS_AGR025W"
FT                   /old_locus_tag="AGR025W"
FT                   /product="AGR025Wp"
FT   CDS_pept        1078662..1079798
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR025W"
FT                   /old_locus_tag="AGR025W"
FT                   /product="AGR025Wp"
FT                   /note="NOHBY732; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F18656g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR025W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54514"
FT                   /db_xref="GOA:Q750D0"
FT                   /db_xref="InterPro:IPR005804"
FT                   /db_xref="InterPro:IPR011388"
FT                   /db_xref="InterPro:IPR013866"
FT                   /db_xref="UniProtKB/TrEMBL:Q750D0"
FT                   /protein_id="AAS54514.2"
FT   gene            complement(<1079889..>1080212)
FT                   /locus_tag="AGOS_AGR026C"
FT                   /old_locus_tag="AGR026C"
FT   mRNA            complement(<1079889..>1080212)
FT                   /locus_tag="AGOS_AGR026C"
FT                   /old_locus_tag="AGR026C"
FT                   /product="AGR026Cp"
FT   CDS_pept        complement(1079889..1080212)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR026C"
FT                   /old_locus_tag="AGR026C"
FT                   /product="AGR026Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBR058C-A (TSC3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR026C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54515"
FT                   /db_xref="GOA:Q750C9"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750C9"
FT                   /protein_id="AAS54515.1"
FT                   TGQ"
FT   gene            complement(<1080453..>1083338)
FT                   /locus_tag="AGOS_AGR027C"
FT                   /old_locus_tag="AGR027C"
FT   mRNA            complement(<1080453..>1083338)
FT                   /locus_tag="AGOS_AGR027C"
FT                   /old_locus_tag="AGR027C"
FT                   /product="AGR027Cp"
FT   CDS_pept        complement(1080453..1083338)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR027C"
FT                   /old_locus_tag="AGR027C"
FT                   /product="AGR027Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR059C
FT                   (AKL1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR027C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54516"
FT                   /db_xref="GOA:Q750C8"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:Q750C8"
FT                   /protein_id="AAS54516.1"
FT   gene            complement(<1083624..>1085363)
FT                   /locus_tag="AGOS_AGR028C"
FT                   /old_locus_tag="AGR028C"
FT   mRNA            complement(<1083624..>1085363)
FT                   /locus_tag="AGOS_AGR028C"
FT                   /old_locus_tag="AGR028C"
FT                   /product="AGR028Cp"
FT   CDS_pept        complement(1083624..1085363)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR028C"
FT                   /old_locus_tag="AGR028C"
FT                   /product="AGR028Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR060C
FT                   (ORC2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR028C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54517"
FT                   /db_xref="GOA:Q750C7"
FT                   /db_xref="InterPro:IPR007220"
FT                   /db_xref="UniProtKB/TrEMBL:Q750C7"
FT                   /protein_id="AAS54517.2"
FT                   SSV"
FT   gene            <1085384..>1085722
FT                   /locus_tag="AGOS_AGR029W"
FT                   /old_locus_tag="AGR029W"
FT   mRNA            <1085384..>1085722
FT                   /locus_tag="AGOS_AGR029W"
FT                   /old_locus_tag="AGR029W"
FT                   /product="AGR029Wp"
FT   CDS_pept        1085384..1085722
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR029W"
FT                   /old_locus_tag="AGR029W"
FT                   /product="AGR029Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR045C
FT                   (RPC11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR029W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54518"
FT                   /db_xref="GOA:Q750C6"
FT                   /db_xref="InterPro:IPR001222"
FT                   /db_xref="InterPro:IPR001529"
FT                   /db_xref="InterPro:IPR012164"
FT                   /db_xref="InterPro:IPR034014"
FT                   /db_xref="UniProtKB/TrEMBL:Q750C6"
FT                   /protein_id="AAS54518.1"
FT                   CGHKWREN"
FT   gene            complement(<1085753..>1086727)
FT                   /locus_tag="AGOS_AGR030C"
FT                   /old_locus_tag="AGR030C"
FT   mRNA            complement(<1085753..>1086727)
FT                   /locus_tag="AGOS_AGR030C"
FT                   /old_locus_tag="AGR030C"
FT                   /product="AGR030Cp"
FT   CDS_pept        complement(1085753..1086727)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR030C"
FT                   /old_locus_tag="AGR030C"
FT                   /product="AGR030Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR044W
FT                   (HEM13)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR030C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54519"
FT                   /db_xref="GOA:Q750C5"
FT                   /db_xref="InterPro:IPR001260"
FT                   /db_xref="InterPro:IPR018375"
FT                   /db_xref="InterPro:IPR036406"
FT                   /db_xref="UniProtKB/TrEMBL:Q750C5"
FT                   /protein_id="AAS54519.1"
FT   gene            <1087070..>1087492
FT                   /locus_tag="AGOS_AGR031W"
FT                   /old_locus_tag="AGR031W"
FT   mRNA            <1087070..>1087492
FT                   /locus_tag="AGOS_AGR031W"
FT                   /old_locus_tag="AGR031W"
FT                   /product="AGR031Wp"
FT   CDS_pept        1087070..1087492
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR031W"
FT                   /old_locus_tag="AGR031W"
FT                   /product="AGR031Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR043C
FT                   (NRG1) and YBR066C (NRG2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR031W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54520"
FT                   /db_xref="GOA:Q750L1"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q750L1"
FT                   /protein_id="AAS54520.1"
FT   gene            1087651..1087696
FT                   /locus_tag="AGOS_AgSNR47"
FT                   /old_locus_tag="AgSNR47"
FT   ncRNA           1087651..1087696
FT                   /locus_tag="AGOS_AgSNR47"
FT                   /old_locus_tag="AgSNR47"
FT                   /product="AgSNR47"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR47; start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <1087803..>1088798
FT                   /locus_tag="AGOS_AGR032W"
FT                   /old_locus_tag="AGR032W"
FT   mRNA            <1087803..>1088798
FT                   /locus_tag="AGOS_AGR032W"
FT                   /old_locus_tag="AGR032W"
FT                   /product="AGR032Wp"
FT   CDS_pept        1087803..1088798
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR032W"
FT                   /old_locus_tag="AGR032W"
FT                   /product="AGR032Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR065C
FT                   (ECM2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR032W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54521"
FT                   /db_xref="GOA:Q750K9"
FT                   /db_xref="InterPro:IPR034356"
FT                   /db_xref="InterPro:IPR039171"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750K9"
FT                   /protein_id="AAS54521.1"
FT   gene            <1088961..>1089722
FT                   /locus_tag="AGOS_AGR033W"
FT                   /old_locus_tag="AGR033W"
FT   mRNA            <1088961..>1089722
FT                   /locus_tag="AGOS_AGR033W"
FT                   /old_locus_tag="AGR033W"
FT                   /product="AGR033Wp"
FT   CDS_pept        1088961..1089722
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR033W"
FT                   /old_locus_tag="AGR033W"
FT                   /product="AGR033Wp"
FT                   /note="NOHBY733; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F18480g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR033W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54522"
FT                   /db_xref="GOA:Q750C4"
FT                   /db_xref="UniProtKB/TrEMBL:Q750C4"
FT                   /protein_id="AAS54522.1"
FT   gene            <1089915..>1090394
FT                   /locus_tag="AGOS_AGR034W"
FT                   /old_locus_tag="AGR034W"
FT   mRNA            <1089915..>1090394
FT                   /locus_tag="AGOS_AGR034W"
FT                   /old_locus_tag="AGR034W"
FT                   /product="AGR034Wp"
FT   CDS_pept        1089915..1090394
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR034W"
FT                   /old_locus_tag="AGR034W"
FT                   /product="AGR034Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBR062C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR034W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54523"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="UniProtKB/TrEMBL:Q750C3"
FT                   /protein_id="AAS54523.1"
FT   gene            complement(<1090437..>1091060)
FT                   /locus_tag="AGOS_AGR035C"
FT                   /old_locus_tag="AGR035C"
FT   mRNA            complement(<1090437..>1091060)
FT                   /locus_tag="AGOS_AGR035C"
FT                   /old_locus_tag="AGR035C"
FT                   /product="AGR035Cp"
FT   CDS_pept        complement(1090437..1091060)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR035C"
FT                   /old_locus_tag="AGR035C"
FT                   /product="AGR035Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR041W
FT                   (RSM10)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR035C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54524"
FT                   /db_xref="GOA:Q750C2"
FT                   /db_xref="InterPro:IPR001848"
FT                   /db_xref="InterPro:IPR027486"
FT                   /db_xref="InterPro:IPR036838"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750C2"
FT                   /protein_id="AAS54524.1"
FT   gene            <1091422..>1092342
FT                   /locus_tag="AGOS_AGR036W"
FT                   /old_locus_tag="AGR036W"
FT   mRNA            <1091422..>1092342
FT                   /locus_tag="AGOS_AGR036W"
FT                   /old_locus_tag="AGR036W"
FT                   /product="AGR036Wp"
FT   CDS_pept        1091422..1092342
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR036W"
FT                   /old_locus_tag="AGR036W"
FT                   /product="AGR036Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR061C
FT                   (TRM7)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR036W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54525"
FT                   /db_xref="GOA:Q750C1"
FT                   /db_xref="InterPro:IPR002877"
FT                   /db_xref="InterPro:IPR015507"
FT                   /db_xref="InterPro:IPR028590"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q750C1"
FT                   /protein_id="AAS54525.1"
FT   gene            complement(<1092475..>1094244)
FT                   /locus_tag="AGOS_AGR037C"
FT                   /old_locus_tag="AGR037C"
FT   mRNA            complement(<1092475..>1094244)
FT                   /locus_tag="AGOS_AGR037C"
FT                   /old_locus_tag="AGR037C"
FT                   /product="AGR037Cp"
FT   CDS_pept        complement(1092475..1094244)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR037C"
FT                   /old_locus_tag="AGR037C"
FT                   /product="AGR037Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR037W
FT                   (KRS1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR037C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54526"
FT                   /db_xref="GOA:Q750C0"
FT                   /db_xref="InterPro:IPR002313"
FT                   /db_xref="InterPro:IPR004364"
FT                   /db_xref="InterPro:IPR004365"
FT                   /db_xref="InterPro:IPR006195"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR018149"
FT                   /db_xref="InterPro:IPR034762"
FT                   /db_xref="UniProtKB/TrEMBL:Q750C0"
FT                   /protein_id="AAS54526.1"
FT                   KPDVLKEDLKKEN"
FT   gene            complement(<1094678..>1096420)
FT                   /locus_tag="AGOS_AGR038C"
FT                   /old_locus_tag="AGR038C"
FT   mRNA            complement(<1094678..>1096420)
FT                   /locus_tag="AGOS_AGR038C"
FT                   /old_locus_tag="AGR038C"
FT                   /product="AGR038Cp"
FT   CDS_pept        complement(1094678..1096420)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR038C"
FT                   /old_locus_tag="AGR038C"
FT                   /product="AGR038Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR046C
FT                   (BAP3) and YBR068C (BAP2); Tandem gene duplication in this
FT                   genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR038C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54527"
FT                   /db_xref="GOA:Q750B9"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="InterPro:IPR004762"
FT                   /db_xref="InterPro:IPR004840"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="UniProtKB/TrEMBL:Q750B9"
FT                   /protein_id="AAS54527.1"
FT                   NFWC"
FT   gene            complement(<1096869..>1098629)
FT                   /locus_tag="AGOS_AGR039C"
FT                   /old_locus_tag="AGR039C"
FT   mRNA            complement(<1096869..>1098629)
FT                   /locus_tag="AGOS_AGR039C"
FT                   /old_locus_tag="AGR039C"
FT                   /product="AGR039Cp"
FT   CDS_pept        complement(1096869..1098629)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR039C"
FT                   /old_locus_tag="AGR039C"
FT                   /product="AGR039Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR046C
FT                   (BAP3) and YBR068C (BAP2); Tandem gene duplication in this
FT                   genome"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR039C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54528"
FT                   /db_xref="GOA:Q750B8"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="InterPro:IPR004762"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="UniProtKB/TrEMBL:Q750B8"
FT                   /protein_id="AAS54528.1"
FT                   LFKRLLDFWC"
FT   gene            complement(<1099432..>1101153)
FT                   /locus_tag="AGOS_AGR040C"
FT                   /old_locus_tag="AGR040C"
FT   mRNA            complement(<1099432..>1101153)
FT                   /locus_tag="AGOS_AGR040C"
FT                   /old_locus_tag="AGR040C"
FT                   /product="AGR040Cp"
FT   CDS_pept        complement(1099432..1101153)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR040C"
FT                   /old_locus_tag="AGR040C"
FT                   /product="AGR040Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YBR069C
FT                   (TAT1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR040C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54529"
FT                   /db_xref="GOA:Q750B7"
FT                   /db_xref="InterPro:IPR002293"
FT                   /db_xref="InterPro:IPR004762"
FT                   /db_xref="InterPro:IPR004840"
FT                   /db_xref="InterPro:IPR004841"
FT                   /db_xref="UniProtKB/TrEMBL:Q750B7"
FT                   /protein_id="AAS54529.1"
FT   gene            complement(<1101568..>1102113)
FT                   /locus_tag="AGOS_AGR041C"
FT                   /old_locus_tag="AGR041C"
FT   mRNA            complement(<1101568..>1102113)
FT                   /locus_tag="AGOS_AGR041C"
FT                   /old_locus_tag="AGR041C"
FT                   /product="AGR041Cp"
FT   CDS_pept        complement(1101568..1102113)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR041C"
FT                   /old_locus_tag="AGR041C"
FT                   /product="AGR041Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae
FT                   YBR063C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR041C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54530"
FT                   /db_xref="UniProtKB/TrEMBL:Q750B6"
FT                   /protein_id="AAS54530.1"
FT                   EVNWLRLKAWIERNADDW"
FT   gene            <1102383..>1103879
FT                   /locus_tag="AGOS_AGR042W"
FT                   /old_locus_tag="AGR042W"
FT   mRNA            <1102383..>1103879
FT                   /locus_tag="AGOS_AGR042W"
FT                   /old_locus_tag="AGR042W"
FT                   /product="AGR042Wp"
FT   CDS_pept        1102383..1103879
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR042W"
FT                   /old_locus_tag="AGR042W"
FT                   /product="AGR042Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR135W
FT                   (SLX4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR042W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54531"
FT                   /db_xref="GOA:Q750B5"
FT                   /db_xref="InterPro:IPR018574"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750B5"
FT                   /protein_id="AAS54531.1"
FT   gene            <1104269..>1115206
FT                   /locus_tag="AGOS_AGR043W"
FT                   /old_locus_tag="AGR043W"
FT   mRNA            <1104269..>1115206
FT                   /locus_tag="AGOS_AGR043W"
FT                   /old_locus_tag="AGR043W"
FT                   /product="AGR043Wp"
FT   CDS_pept        1104269..1115206
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR043W"
FT                   /old_locus_tag="AGR043W"
FT                   /product="AGR043Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR150W
FT                   (NUM1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR043W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54532"
FT                   /db_xref="GOA:Q750B4"
FT                   /db_xref="InterPro:IPR001849"
FT                   /db_xref="InterPro:IPR024774"
FT                   /db_xref="UniProtKB/TrEMBL:Q750B4"
FT                   /protein_id="AAS54532.2"
FT                   R"
FT   gene            complement(<1115568..>1116470)
FT                   /locus_tag="AGOS_AGR044C"
FT                   /old_locus_tag="AGR044C"
FT   mRNA            complement(<1115568..>1116470)
FT                   /locus_tag="AGOS_AGR044C"
FT                   /old_locus_tag="AGR044C"
FT                   /product="AGR044Cp"
FT   CDS_pept        complement(1115568..1116470)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR044C"
FT                   /old_locus_tag="AGR044C"
FT                   /product="AGR044Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR151C
FT                   (CTH1) and YLR136C (TIS11)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR044C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54533"
FT                   /db_xref="GOA:Q750B3"
FT                   /db_xref="InterPro:IPR000571"
FT                   /db_xref="InterPro:IPR036855"
FT                   /db_xref="UniProtKB/TrEMBL:Q750B3"
FT                   /protein_id="AAS54533.1"
FT   gene            <1117144..>1117914
FT                   /locus_tag="AGOS_AGR045W"
FT                   /old_locus_tag="AGR045W"
FT   mRNA            <1117144..>1117914
FT                   /locus_tag="AGOS_AGR045W"
FT                   /old_locus_tag="AGR045W"
FT                   /product="AGR045Wp"
FT   CDS_pept        1117144..1117914
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR045W"
FT                   /old_locus_tag="AGR045W"
FT                   /product="AGR045Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR152W
FT                   (GIR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR045W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54534"
FT                   /db_xref="GOA:Q750B2"
FT                   /db_xref="InterPro:IPR006575"
FT                   /db_xref="InterPro:IPR016135"
FT                   /db_xref="InterPro:IPR040213"
FT                   /db_xref="UniProtKB/TrEMBL:Q750B2"
FT                   /protein_id="AAS54534.1"
FT   gene            complement(<1118059..>1119222)
FT                   /locus_tag="AGOS_AGR046C"
FT                   /old_locus_tag="AGR046C"
FT   mRNA            complement(<1118059..>1119222)
FT                   /locus_tag="AGOS_AGR046C"
FT                   /old_locus_tag="AGR046C"
FT                   /product="AGR046Cp"
FT   CDS_pept        complement(1118059..1119222)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR046C"
FT                   /old_locus_tag="AGR046C"
FT                   /product="AGR046Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR153C
FT                   (ENT5)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR046C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54535"
FT                   /db_xref="GOA:Q750B1"
FT                   /db_xref="InterPro:IPR008942"
FT                   /db_xref="InterPro:IPR013809"
FT                   /db_xref="UniProtKB/TrEMBL:Q750B1"
FT                   /protein_id="AAS54535.1"
FT   gene            <1119828..>1124306
FT                   /locus_tag="AGOS_AGR047W"
FT                   /old_locus_tag="AGR047W"
FT   mRNA            <1119828..>1124306
FT                   /locus_tag="AGOS_AGR047W"
FT                   /old_locus_tag="AGR047W"
FT                   /product="AGR047Wp"
FT   CDS_pept        1119828..1124306
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR047W"
FT                   /old_locus_tag="AGR047W"
FT                   /product="AGR047Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR135C
FT                   (YCF1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR047W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54536"
FT                   /db_xref="GOA:Q750B0"
FT                   /db_xref="InterPro:IPR003439"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR011527"
FT                   /db_xref="InterPro:IPR017871"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036640"
FT                   /db_xref="UniProtKB/TrEMBL:Q750B0"
FT                   /protein_id="AAS54536.2"
FT   gene            complement(<1124613..>1125974)
FT                   /locus_tag="AGOS_AGR048C"
FT                   /old_locus_tag="AGR048C"
FT   mRNA            complement(<1124613..>1125974)
FT                   /locus_tag="AGOS_AGR048C"
FT                   /old_locus_tag="AGR048C"
FT                   /product="AGR048Cp"
FT   CDS_pept        complement(1124613..1125974)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR048C"
FT                   /old_locus_tag="AGR048C"
FT                   /product="AGR048Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR113W
FT                   (HOG1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR048C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54537"
FT                   /db_xref="GOA:Q750A9"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR003527"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR008352"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR038783"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750A9"
FT                   /protein_id="AAS54537.1"
FT   gene            <1126486..>1126884
FT                   /locus_tag="AGOS_AGR049W"
FT                   /old_locus_tag="AGR049W"
FT   mRNA            <1126486..>1126884
FT                   /locus_tag="AGOS_AGR049W"
FT                   /old_locus_tag="AGR049W"
FT                   /product="AGR049Wp"
FT   CDS_pept        1126486..1126884
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR049W"
FT                   /old_locus_tag="AGR049W"
FT                   /product="AGR049Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR110C
FT                   (CCW12) and YDR134C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR049W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54538"
FT                   /db_xref="InterPro:IPR025928"
FT                   /db_xref="UniProtKB/TrEMBL:Q750A8"
FT                   /protein_id="AAS54538.1"
FT   gene            <1127338..>1128711
FT                   /locus_tag="AGOS_AGR050W"
FT                   /old_locus_tag="AGR050W"
FT   mRNA            <1127338..>1128711
FT                   /locus_tag="AGOS_AGR050W"
FT                   /old_locus_tag="AGR050W"
FT                   /product="AGR050Wp"
FT   CDS_pept        1127338..1128711
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR050W"
FT                   /old_locus_tag="AGR050W"
FT                   /product="AGR050Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR132C
FT                   and YLR108C"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR050W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54539"
FT                   /db_xref="GOA:Q750A7"
FT                   /db_xref="InterPro:IPR000210"
FT                   /db_xref="InterPro:IPR003131"
FT                   /db_xref="InterPro:IPR011333"
FT                   /db_xref="UniProtKB/TrEMBL:Q750A7"
FT                   /protein_id="AAS54539.2"
FT   gene            complement(1128929..1129022)
FT                   /locus_tag="AGOS_AgSNR6U6"
FT                   /old_locus_tag="AgSNR6_U6"
FT   ncRNA           complement(1128929..1129022)
FT                   /locus_tag="AGOS_AgSNR6U6"
FT                   /old_locus_tag="AgSNR6_U6"
FT                   /product="AgSNR6_U6"
FT                   /note="Identified by similarity to Saccharomyces cerevisiae
FT                   SNR6_U6; start and end coordinates are approximate; in
FT                   synteny"
FT                   /ncRNA_class="snRNA"
FT   gene            <1129481..>1130167
FT                   /locus_tag="AGOS_AGR051W"
FT                   /old_locus_tag="AGR051W"
FT   mRNA            <1129481..>1130167
FT                   /locus_tag="AGOS_AGR051W"
FT                   /old_locus_tag="AGR051W"
FT                   /product="AGR051Wp"
FT   CDS_pept        1129481..1130167
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR051W"
FT                   /old_locus_tag="AGR051W"
FT                   /product="AGR051Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR130C
FT                   (FIN1)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR051W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54540"
FT                   /db_xref="GOA:Q750A6"
FT                   /db_xref="InterPro:IPR035260"
FT                   /db_xref="UniProtKB/TrEMBL:Q750A6"
FT                   /protein_id="AAS54540.1"
FT                   RLEEQP"
FT   gene            complement(<1130170..>1131318)
FT                   /locus_tag="AGOS_AGR052C"
FT                   /old_locus_tag="AGR052C"
FT   mRNA            complement(<1130170..>1131318)
FT                   /locus_tag="AGOS_AGR052C"
FT                   /old_locus_tag="AGR052C"
FT                   /product="AGR052Cp"
FT   CDS_pept        complement(1130170..1131318)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR052C"
FT                   /old_locus_tag="AGR052C"
FT                   /product="AGR052Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR107W
FT                   (REX3)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR052C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54541"
FT                   /db_xref="GOA:Q750A5"
FT                   /db_xref="InterPro:IPR012337"
FT                   /db_xref="InterPro:IPR013520"
FT                   /db_xref="InterPro:IPR034922"
FT                   /db_xref="InterPro:IPR036397"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750A5"
FT                   /protein_id="AAS54541.1"
FT   gene            <1131617..>1132231
FT                   /locus_tag="AGOS_AGR053W"
FT                   /old_locus_tag="AGR053W"
FT   mRNA            <1131617..>1132231
FT                   /locus_tag="AGOS_AGR053W"
FT                   /old_locus_tag="AGR053W"
FT                   /product="AGR053Wp"
FT   CDS_pept        1131617..1132231
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR053W"
FT                   /old_locus_tag="AGR053W"
FT                   /product="AGR053Wp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YDR121W
FT                   (DPB4)"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR053W"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54542"
FT                   /db_xref="GOA:Q750A4"
FT                   /db_xref="InterPro:IPR003958"
FT                   /db_xref="InterPro:IPR009072"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q750A4"
FT                   /protein_id="AAS54542.1"
FT   gene            complement(<1132253..>1133016)
FT                   /locus_tag="AGOS_AGR054C"
FT                   /old_locus_tag="AGR054C"
FT   mRNA            complement(join(<1132253..1132938,1133001..>1133016))
FT                   /locus_tag="AGOS_AGR054C"
FT                   /old_locus_tag="AGR054C"
FT                   /product="AGR054Cp"
FT   CDS_pept        complement(join(1132253..1132938,1133001..1133016))
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR054C"
FT                   /old_locus_tag="AGR054C"
FT                   /product="AGR054Cp"
FT                   /note="Syntenic homolog of Saccharomyces cerevisiae YLR093C
FT                   (NYV1); 1-intron"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR054C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54543"
FT                   /db_xref="GOA:Q750A3"
FT                   /db_xref="InterPro:IPR001388"
FT                   /db_xref="InterPro:IPR019005"
FT                   /db_xref="InterPro:IPR038426"
FT                   /db_xref="UniProtKB/TrEMBL:Q750A3"
FT                   /protein_id="AAS54543.2"
FT                   ALFILWMILHI"
FT   gene            complement(<1133758..>1135266)
FT                   /locus_tag="AGOS_AGR055C"
FT                   /old_locus_tag="AGR055C"
FT   mRNA            complement(<1133758..>1135266)
FT                   /locus_tag="AGOS_AGR055C"
FT                   /old_locus_tag="AGR055C"
FT                   /product="AGR055Cp"
FT   CDS_pept        complement(1133758..1135266)
FT                   /codon_start=1
FT                   /locus_tag="AGOS_AGR055C"
FT                   /old_locus_tag="AGR055C"
FT                   /product="AGR055Cp"
FT                   /note="NOHBY735; No homolog in Saccharomyces cerevisiae;
FT                   Syntenic homolog of Kluyveromyces lactis KLLA0F19470g"
FT                   /db_xref="EnsemblGenomes-Gn:AGOS_AGR055C"
FT                   /db_xref="EnsemblGenomes-Tr:AAS54544"
FT                   /db_xref="GOA:Q750A2"
FT                   /db_xref="InterPro:IPR000960"
FT                   /db_xref="InterPro:IPR020946"
FT                   /db_xref="InterPro:IPR036188"
FT                   /db_xref="UniProtKB/TrEMBL:Q750A2"
FT                   /protein_id="AAS54544.1"