(data stored in ACNUC30630 zone)

EMBL: BX251410

ID   BX251410; SV 1; linear; genomic DNA; STD; PRO; 324050 BP.
AC   BX251410;
DT   17-FEB-2003 (Rel. 74, Created)
DT   06-FEB-2015 (Rel. 123, Last updated, Version 4)
DE   Tropheryma whipplei TW08/27, complete genome; segment 1/3
KW   complete genome.
OS   Tropheryma whipplei TW08/27
OC   Bacteria; Actinobacteria; Micrococcales; Tropheryma.
RN   [1]
RP   1-324050
RX   DOI; 10.1016/S0140-6736(03)12597-4.
RX   PUBMED; 12606174.
RA   Bentley S.D., Maiwald M., Murphy L.D., Pallen M.J., Yeats C.A., Dover L.,
RA   Norbertczak H.T., Besra G.S., Quail M.A., Harris D.E., von Herbay A.,
RA   Goble A., Rutter S., Squares R., Squares S., Barrell B.G., Parkhill J.,
RA   Relman D.A.;
RT   "Sequencing and analysis of the genome of the Whipple's disease bacterium
RT   Tropheryma whipplei";
RL   Lancet 361(9358):637-644(2003).
RN   [2]
RP   1-324050
RA   Bentley S.D.;
RT   ;
RL   Submitted (10-FEB-2003) to the INSDC.
RL   Submitted on behalf of the Pathogen Sequencing Unit, Sanger Institute,
RL   Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SA E-mail:
RL   sdb@sanger.ac.uk
DR   MD5; 6f7b15562888ad6f09ff5c3b3145bb9c.
DR   ENA-CON; BX072543.
DR   BioSample; SAMEA1705925.
DR   RFAM; RF00005; tRNA.
FH   Key             Location/Qualifiers
FT   source          1..324050
FT                   /organism="Tropheryma whipplei TW08/27"
FT                   /strain="TW08/27"
FT                   /mol_type="genomic DNA"
FT                   /db_xref="taxon:218496"
FT   CDS_pept        1..1437
FT                   /transl_table=11
FT                   /gene="dnaA"
FT                   /locus_tag="TW001"
FT                   /product="chromosomal replication initiator protein DnaA"
FT                   /note="Similar to Streptomyces coelicolor chromosomal
FT                   replication initiator protein DnaA or SCO3879 or SCH18.16c
FT                   SWALL:DNAA_STRCO (SWALL:P27902) (656 aa) fasta scores: E():
FT                   3.8e-67, 53.02% id in 347 aa, and to Micrococcus luteus
FT                   chromosomal replication initiator protein DnaA
FT                   SWALL:DNAA_MICLU (SWALL:P21173) (515 aa) fasta scores: E():
FT                   1.1e-64, 42.17% id in 505 aa"
FT                   /db_xref="GOA:Q83NZ5"
FT                   /db_xref="InterPro:IPR001957"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR010921"
FT                   /db_xref="InterPro:IPR013159"
FT                   /db_xref="InterPro:IPR013317"
FT                   /db_xref="InterPro:IPR018312"
FT                   /db_xref="InterPro:IPR020591"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83NZ5"
FT                   /protein_id="CAD66693.1"
FT   misc_feature    427..1360
FT                   /note="Bacterial  dnaA  protein Score = 573.7 E-value =
FT                   8.2e-170"
FT   misc_feature    502..525
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    535..576
FT                   /note="PS00675 Sigma-54 interaction domain ATP-binding
FT                   region A signature."
FT   misc_feature    547..570
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    1306..1362
FT                   /note="PS01008 DnaA protein signature."
FT   CDS_pept        1767..2900
FT                   /transl_table=11
FT                   /gene="dnaN"
FT                   /locus_tag="TW002"
FT                   /product="DNA polymerase III, beta chain"
FT                   /EC_number=""
FT                   /note="Similar to Streptomyces coelicolor DNA polymerase
FT                   III, beta chain DnaN or SCO3878 or SCH18.15c
FT                   SWALL:DP3B_STRCO (SWALL:P27903) (376 aa) fasta scores: E():
FT                   7.5e-42, 35.46% id in 375 aa"
FT                   /protein_id="CAD66694.1"
FT   misc_feature    1767..2118
FT                   /note="DNA polymerase III beta subunit, N-terminal domain
FT                   Score = 115.6 E-value = 6.6e-32"
FT   misc_feature    2145..2502
FT                   /note="DNA polymerase III beta subunit, central domain
FT                   Score = 60.4 E-value = 2.7e-15"
FT   misc_feature    2508..2886
FT                   /note="DNA polymerase III beta subunit, C-terminal domain
FT                   Score = 1.7 E-value = 0.00015"
FT   CDS_pept        2890..3981
FT                   /transl_table=11
FT                   /gene="recF"
FT                   /locus_tag="TW003"
FT                   /product="DNA replication and repair protein recF"
FT                   /note="Similar to Streptomyces coelicolor DNA replication
FT                   and repair protein RecF or SCO3876 or SCH18.13c
FT                   SWALL:RECF_STRCO (SWALL:P36176) (373 aa) fasta scores: E():
FT                   3.9e-24, 37.16% id in 374 aa"
FT                   /db_xref="GOA:Q83NZ4"
FT                   /db_xref="InterPro:IPR001238"
FT                   /db_xref="InterPro:IPR003395"
FT                   /db_xref="InterPro:IPR018078"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR042174"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83NZ4"
FT                   /protein_id="CAD66695.1"
FT   misc_feature    2899..3316
FT                   /note="RecF/RecN/SMC N terminal domain Score = -8.3 E-value
FT                   = 6e-07"
FT   misc_feature    2986..3009
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    3802..3855
FT                   /note="PS00618 RecF protein signature 2."
FT   CDS_pept        4011..4445
FT                   /transl_table=11
FT                   /locus_tag="TW004"
FT                   /product="hypothetical protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein SCO3875 or SCH18.12c SWALL:Y2H5_STRCO
FT                   (SWALL:P35925) (190 aa) fasta scores: E(): 5.9, 24.32% id
FT                   in 111 aa"
FT                   /protein_id="CAD66696.1"
FT   CDS_pept        4485..6434
FT                   /transl_table=11
FT                   /gene="gyrB1"
FT                   /locus_tag="TW005"
FT                   /product="DNA gyrase subunit B"
FT                   /EC_number=""
FT                   /note="Similar to Bacillus halodurans DNA gyrase subunit B
FT                   GtrB or BH0006 SWALL:GYRB_BACHD (SWALL:O50627) (637 aa)
FT                   fasta scores: E(): 1.1e-136, 56.74% id in 645 aa"
FT                   /protein_id="CAD66697.1"
FT                   FIQHNARDVRFLDI"
FT   misc_feature    4584..5013
FT                   /note="Histidine kinase-, DNA gyrase B-, and HSP90-like
FT                   ATPase Score = 94.1 E-value = 2e-25"
FT   misc_feature    5160..5682
FT                   /note="DNA gyrase B Score = 261.5 E-value = 7.7e-76"
FT   misc_feature    5775..5801
FT                   /note="PS00177 DNA topoisomerase II signature."
FT   misc_feature    5853..6096
FT                   /note="Toprim domain Score = 47.8 E-value = 1.7e-11"
FT   misc_feature    6204..6396
FT                   /note="DNA gyrase B subunit, carboxyl terminus Score =
FT                   135.1 E-value = 8.7e-38"
FT   CDS_pept        6438..8897
FT                   /transl_table=11
FT                   /gene="gyrA1"
FT                   /locus_tag="TW006"
FT                   /product="DNA gyrase subunit A"
FT                   /EC_number=""
FT                   /note="Similar to Streptomyces coelicolor DNA gyrase
FT                   subunit A GyrA or SCO3873 or SCH18.10c SWALL:GYRA_STRCO
FT                   (SWALL:P35885) (857 aa) fasta scores: E(): 1.8e-189, 61.26%
FT                   id in 808 aa"
FT                   /protein_id="CAD66698.1"
FT                   DDLEGQG"
FT   misc_feature    6525..7878
FT                   /note="DNA gyrase/topoisomerase IV, subunit A Score = 899.7
FT                   E-value = 6.1e-268"
FT   misc_feature    7950..8097
FT                   /note="DNA gyrase C-terminal domain, beta-propeller Score =
FT                   52.8 E-value = 5.4e-13"
FT   misc_feature    8100..8256
FT                   /note="DNA gyrase C-terminal domain, beta-propeller Score =
FT                   50.6 E-value = 2.5e-12"
FT   misc_feature    8271..8412
FT                   /note="DNA gyrase C-terminal domain, beta-propeller Score =
FT                   48.9 E-value = 7.8e-12"
FT   misc_feature    8415..8562
FT                   /note="DNA gyrase C-terminal domain, beta-propeller Score =
FT                   43.8 E-value = 2.7e-10"
FT   misc_feature    8568..8718
FT                   /note="DNA gyrase C-terminal domain, beta-propeller Score =
FT                   46.4 E-value = 4.4e-11"
FT   misc_feature    8721..8868
FT                   /note="DNA gyrase C-terminal domain, beta-propeller Score =
FT                   31.1 E-value = 1.8e-06"
FT   CDS_pept        8894..9274
FT                   /transl_table=11
FT                   /locus_tag="TW007"
FT                   /product="putative integral membrane protein"
FT                   /note="Similar to Streptomyces coelicolor putative integral
FT                   membrane protein SCO3872 or SCH18.09c SWALL:Q9KXX6
FT                   (EMBL:AL357152) (185 aa) fasta scores: E(): 0.0026, 30.5%
FT                   id in 118 aa"
FT                   /protein_id="CAD66699.1"
FT   misc_feature    8894..9085
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.950) with cleavage
FT                   site probability 0.633 between residues 64 and 65"
FT   misc_feature    order(8978..9046,9137..9232)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 29-51 and 82-113"
FT   tRNA            9278..9351
FT                   /note="tRNA Ile anticodon GAT, Cove score 79.47"
FT   tRNA            9365..9441
FT                   /note="tRNA Ala anticodon TGC, Cove score 94.27"
FT   CDS_pept        complement(9640..10332)
FT                   /transl_table=11
FT                   /locus_tag="TW008"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Thermoanaerobacter tengcongensis thiamine
FT                   pyrophosphokinase Thi80 or Tte1497 SWALL:Q8R9T9
FT                   (EMBL:AE013107) (211 aa) fasta scores: E(): 2.5e-09, 29.68%
FT                   id in 192 aa, and to Bacillus subtilis YloS protein
FT                   SWALL:O34664 (EMBL:Z99112) (214 aa) fasta scores: E():
FT                   5.7e-08, 30% id in 210 aa"
FT                   /protein_id="CAD66700.1"
FT                   NQIQKPSG"
FT   misc_feature    complement(9957..10299)
FT                   /note="Thiamin pyrophosphokinase, catalytic domain Score =
FT                   80.0 E-value = 3.5e-21"
FT   CDS_pept        10472..11095
FT                   /transl_table=11
FT                   /locus_tag="TW009"
FT                   /product="putative integral membrane protein"
FT                   /note="Similar to Streptomyces coelicolor putative membrane
FT                   protein SCO3855 or SCH69.25c SWALL:Q9XA09 (EMBL:AL079308)
FT                   (297 aa) fasta scores: E(): 9.4e-13, 40% id in 155 aa"
FT                   /protein_id="CAD66701.1"
FT   misc_feature    10472..10591
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.992) with cleavage
FT                   site probability 0.460 between residues 40 and 41"
FT   misc_feature    order(10538..10606,10649..10717,10736..10804,10814..10882,
FT                   10901..10969,11027..11086)
FT                   /note="6 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 23-45, 60-82, 89-111,
FT                   115-137, 144-166 and 186-205"
FT   misc_feature    10610..11021
FT                   /note="Rhomboid family Score = 144.6 E-value = 1.3e-40"
FT   CDS_pept        complement(11133..11342)
FT                   /transl_table=11
FT                   /locus_tag="TW010"
FT                   /product="putative membrane protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein SCO3854 or SCH69.24 SWALL:Q9XA10 (EMBL:AL079308)
FT                   (84 aa) fasta scores: E(): 1.4e-08, 40% id in 55 aa, and to
FT                   Corynebacterium glutamicum hypothetical membrane protein
FT                   Cgl0040 cgl0040 SWALL:BAB97433 (EMBL:AP005274) (90 aa)
FT                   fasta scores: E(): 6.5e-06, 33.33% id in 63 aa"
FT                   /db_xref="GOA:P67379"
FT                   /db_xref="InterPro:IPR009619"
FT                   /db_xref="UniProtKB/Swiss-Prot:P67379"
FT                   /protein_id="CAD66702.1"
FT   misc_feature    complement(order(11151..11210,11238..11306))
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-35 and 45-64"
FT   CDS_pept        11399..12037
FT                   /transl_table=11
FT                   /locus_tag="TW011"
FT                   /product="putative glutamine amidotransferase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   glutamine amidotransferase SCO3851 or SCH69.21c
FT                   SWALL:Q9XA13 (EMBL:AL079308) (212 aa) fasta scores: E():
FT                   1.8e-29, 43.68% id in 206 aa, and to Escherichia coli
FT                   para-aminobenzoate synthase glutamine amidotransferase
FT                   component II PabA or b3360 SWALL:PABA_ECOLI (SWALL:P00903)
FT                   (187 aa) fasta scores: E(): 5e-24, 41.48% id in 188 aa"
FT                   /protein_id="CAD66703.1"
FT   misc_feature    11411..11966
FT                   /note="Glutamine amidotransferase class-I Score = 180.3
FT                   E-value = 2.2e-51"
FT   misc_feature    11630..11665
FT                   /note="PS00442 Glutamine amidotransferases class-I active
FT                   site."
FT   CDS_pept        12143..12715
FT                   /transl_table=11
FT                   /locus_tag="TW012"
FT                   /product="conserved hypothetical membrane protein"
FT                   /note="Similar to Rhizobium meliloti hypothetical
FT                   transmembrane protein SMC00853 or R00853 SWALL:Q92RL3
FT                   (EMBL:AL591785) (182 aa) fasta scores: E(): 6.7e-26, 49.18%
FT                   id in 183 aa"
FT                   /protein_id="CAD66704.1"
FT   misc_feature    12143..12217
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.916) with cleavage
FT                   site probability 0.503 between residues 25 and 26"
FT   misc_feature    12152..12220
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 4-26"
FT   misc_feature    12164..12710
FT                   /note="LemA family Score = 254.7 E-value = 9e-74"
FT   CDS_pept        12752..13627
FT                   /transl_table=11
FT                   /locus_tag="TW013"
FT                   /product="putative integral membrane heat shock protease"
FT                   /note="Similar to Streptococcus gordonii Challis probable
FT                   protease HtpX homolog SWALL:HTPX_STRGC (SWALL:O30795) (297
FT                   aa) fasta scores: E(): 1.5e-41, 42.52% id in 301 aa, and to
FT                   Escherichia coli probable protease HtpX or b1829
FT                   SWALL:HTPX_ECOLI (SWALL:P23894) (293 aa) fasta scores: E():
FT                   4.9e-17, 32.05% id in 287 aa"
FT                   /db_xref="GOA:Q83IG0"
FT                   /db_xref="InterPro:IPR001915"
FT                   /db_xref="InterPro:IPR022919"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IG0"
FT                   /protein_id="CAD66705.1"
FT                   RRLKEMGNQF"
FT   misc_feature    12752..12895
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.984) with cleavage
FT                   site probability 0.241 between residues 48 and 49"
FT   misc_feature    order(12788..12856,12866..12934,13211..13279,13307..13375)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-35, 39-61, 154-176 and
FT                   186-208"
FT   misc_feature    12995..13601
FT                   /note="Peptidase family M48 Score = 115.6 E-value =
FT                   6.5e-32"
FT   CDS_pept        13628..13999
FT                   /transl_table=11
FT                   /locus_tag="TW014"
FT                   /product="putative integral membrane protein"
FT                   /note="Similar to Streptomyces coelicolor putative integral
FT                   membrane protein SCO1562 or SCL11.18 SWALL:Q9L1C0
FT                   (EMBL:AL157953) (138 aa) fasta scores: E(): 1.2e-12, 41.02%
FT                   id in 117 aa"
FT                   /protein_id="CAD66706.1"
FT   misc_feature    13628..13696
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.767) with cleavage
FT                   site probability 0.217 between residues 23 and 24"
FT   misc_feature    order(13640..13699,13727..13795,13814..13882,13910..13978)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 5-24, 34-56, 63-85 and
FT                   95-117"
FT   CDS_pept        14121..15404
FT                   /transl_table=11
FT                   /locus_tag="TW015"
FT                   /product="WiSP family protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66707.1"
FT   misc_feature    14181..14240
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 21-40"
FT   CDS_pept        15432..16280
FT                   /transl_table=11
FT                   /gene="dkgA"
FT                   /locus_tag="TW016"
FT                   /product="2,5-diketo-D-gluconic acid reductase A"
FT                   /EC_number="1.1.1.-"
FT                   /note="Similar to Yersinia pestis 2,5-diketo-D-gluconic
FT                   acid reductase A DkgA or YPO0676 or y3501 SWALL:DKGA_YERPE
FT                   (SWALL:Q8ZI40) (277 aa) fasta scores: E(): 5.3e-50, 46.71%
FT                   id in 274 aa, and to Corynebacterium sp.
FT                   2,5-diketo-D-gluconic acid reductase A DkgA
FT                   SWALL:DKGA_CORSP (SWALL:P06632) (277 aa) fasta scores: E():
FT                   1.1e-55, 51.5% id in 266 aa"
FT                   /protein_id="CAD66708.1"
FT                   D"
FT   misc_feature    15468..16233
FT                   /note="Aldo/keto reductase family Score = 357.0 E-value =
FT                   1.4e-104"
FT   misc_feature    15564..15617
FT                   /note="PS00798 Aldo/keto reductase family signature 1."
FT   misc_feature    15810..15863
FT                   /note="PS00062 Aldo/keto reductase family signature 2."
FT   CDS_pept        complement(16396..18048)
FT                   /transl_table=11
FT                   /locus_tag="TW017"
FT                   /product="putative phosphomannomutase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   phosphomannomutase SCO4916 or SCK13.08c SWALL:Q9AD82
FT                   (EMBL:AL512667) (549 aa) fasta scores: E(): 9.1e-77, 44.21%
FT                   id in 536 aa, and to Streptococcus thermophilus
FT                   phosphoglucomutase PgmA SWALL:Q9K560 (EMBL:AJ243290) (572
FT                   aa) fasta scores: E(): 1.1e-28, 33.27% id in 544 aa"
FT                   /protein_id="CAD66709.1"
FT   misc_feature    complement(16773..17100)
FT                   /note="Phosphoglucomutase/phosphomannomutase,
FT                   alpha/beta/alpha domain III Score = 14.2 E-value = 0.00014"
FT   misc_feature    complement(17106..17433)
FT                   /note="Phosphoglucomutase/phosphomannomutase,
FT                   alpha/beta/alpha domain II Score = 11.1 E-value = 3.8e-05"
FT   misc_feature    complement(17472..17922)
FT                   /note="Phosphoglucomutase/phosphomannomutase,
FT                   alpha/beta/alpha domain I Score = 147.4 E-value = 1.8e-41"
FT   misc_feature    complement(17581..17625)
FT                   /note="PS00710 Phosphoglucomutase and phosphomannomutase
FT                   phosphoserine signature."
FT   CDS_pept        complement(18061..18894)
FT                   /transl_table=11
FT                   /gene="punA"
FT                   /locus_tag="TW018"
FT                   /product="purine nucleoside phosphorylase"
FT                   /EC_number=""
FT                   /note="Similar to Cellulomonas sp purine nucleoside
FT                   phosphorylase PunA SWALL:PUNA_CELSP (SWALL:P81989) (282 aa)
FT                   fasta scores: E(): 6.6e-45, 48.33% id in 271 aa"
FT                   /protein_id="CAD66710.1"
FT   misc_feature    complement(18084..18816)
FT                   /note="Phosphorylase family 2 Score = 185.7 E-value =
FT                   5.4e-53"
FT   CDS_pept        18975..20372
FT                   /transl_table=11
FT                   /locus_tag="TW019"
FT                   /product="putative oxidoreductase"
FT                   /note="Similar to Corynebacterium glutamicum
FT                   dihydrolipoamide dehydrogenase/glutathione oxidoreductase
FT                   and related enzymes cgl0688 SWALL:BAB98081 (EMBL:AP005276)
FT                   (469 aa) fasta scores: E(): 6.5e-76, 48.58% id in 459 aa,
FT                   and to Bacillus subtilis dihydrolipoamide dehydrogenase
FT                   PdhD or AceD or CitL SWALL:DLD1_BACSU (SWALL:P21880) (470
FT                   aa) fasta scores: E(): 1.6e-35, 30.99% id in 442 aa"
FT                   /protein_id="CAD66711.1"
FT                   RTDSASP"
FT   misc_feature    18975..19061
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.772) with cleavage
FT                   site probability 0.272 between residues 29 and 30"
FT   misc_feature    18996..19935
FT                   /note="Pyridine nucleotide-disulphide oxidoreductase Score
FT                   = 221.0 E-value = 1.2e-63"
FT   misc_feature    20010..20331
FT                   /note="Pyridine nucleotide-disulphide oxidoreductase,
FT                   dimerisation domain Score = 91.6 E-value = 1.1e-24"
FT   CDS_pept        complement(20441..22216)
FT                   /transl_table=11
FT                   /locus_tag="TW020"
FT                   /product="putative acyl-CoA carboxylase complex A subunit"
FT                   /note="Similar to Streptomyces coelicolor putative acyl-CoA
FT                   carboxylase complex A subunit AccA1 SWALL:Q9RGQ6
FT                   (EMBL:AF113603) (590 aa) fasta scores: E(): 2.3e-110,
FT                   51.67% id in 596 aa, and to Mus musculus pyruvate
FT                   carboxylase, mitochondrial precursor SWALL:PYC_MOUSE
FT                   (SWALL:Q05920) (1178 aa) fasta scores: E(): 1.6e-71, 42.26%
FT                   id in 504 aa"
FT                   /protein_id="CAD66712.1"
FT                   ETVPSGHELLRLKKV"
FT   misc_feature    complement(20455..20656)
FT                   /note="Biotin-requiring enzyme Score = 73.7 E-value =
FT                   2.7e-19"
FT   misc_feature    complement(20890..21208)
FT                   /note="Biotin carboxylase C-terminal domain Score = 180.6
FT                   E-value = 1.8e-51"
FT   misc_feature    complement(21229..21868)
FT                   /note="Carbamoyl-phosphate synthase L chain, ATP binding
FT                   domain Score = 301.7 E-value = 6.5e-88"
FT   misc_feature    complement(21332..21355)
FT                   /note="PS00867 Carbamoyl-phosphate synthase subdomain
FT                   signature 2."
FT   misc_feature    complement(21874..22210)
FT                   /note="Carbamoyl-phosphate synthase L chain, N-terminal
FT                   domain Score = 149.0 E-value = 6e-42"
FT   CDS_pept        complement(22333..22752)
FT                   /transl_table=11
FT                   /locus_tag="TW021"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66713.1"
FT   CDS_pept        22844..23152
FT                   /transl_table=11
FT                   /locus_tag="TW022"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66714.1"
FT   CDS_pept        23168..23563
FT                   /transl_table=11
FT                   /locus_tag="TW023"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66715.1"
FT   misc_feature    23168..23242
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.996) with cleavage
FT                   site probability 0.972 between residues 25 and 26"
FT   misc_feature    order(23186..23254,23264..23332,23369..23437,23468..23536)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-29, 33-55, 68-90 and
FT                   101-123"
FT   CDS_pept        23661..23798
FT                   /transl_table=11
FT                   /locus_tag="TW024"
FT                   /product="putative integral membrane protein"
FT                   /note="Doubtful CDS. No significant database matches"
FT                   /protein_id="CAD66716.1"
FT                   "
FT   misc_feature    23724..23792
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 22-44"
FT   CDS_pept        complement(24099..25676)
FT                   /transl_table=11
FT                   /gene="pccB"
FT                   /locus_tag="TW025"
FT                   /product="propionyl-CoA carboxylase beta chain"
FT                   /EC_number=""
FT                   /note="Similar to Saccharopolyspora erythraea propionyl-CoA
FT                   carboxylase beta chain PccB SWALL:PCCB_SACER (SWALL:P53003)
FT                   (546 aa) fasta scores: E(): 8.9e-123, 62.5% id in 520 aa"
FT                   /protein_id="CAD66717.1"
FT                   RKHGSIPL"
FT   misc_feature    complement(24110..25625)
FT                   /note="Carboxyl transferase domain Score = 893.4 E-value =
FT                   4.8e-266"
FT   CDS_pept        25738..26484
FT                   /transl_table=11
FT                   /locus_tag="TW026"
FT                   /product="putative protein ligase"
FT                   /note="Similar to Mycobacterium tuberculosis BirA or
FT                   Rv3279c or mtcy71.19c or mt3379 SWALL:P96884 (EMBL:Z92771)
FT                   (266 aa) fasta scores: E(): 2.8e-16, 36.11% id in 252 aa,
FT                   and to Bacillus subtilis BirA bifunctional protein
FT                   [includes: biotin operon repressor;
FT                   biotin--[acetyl-coa-carboxylase] synthetase BirA
FT                   SWALL:BIRA_BACSU (SWALL:P42975) (325 aa) fasta scores: E():
FT                   1.6e-11, 30.4% id in 250 aa"
FT                   /protein_id="CAD66718.1"
FT   misc_feature    25744..26155
FT                   /note="Biotin/lipoate A/B protein ligase family Score =
FT                   84.2 E-value = 1.9e-22"
FT   misc_feature    26326..26461
FT                   /note="Biotin protein ligase C terminal domain Score = 41.4
FT                   E-value = 1.4e-09"
FT   CDS_pept        complement(26537..26869)
FT                   /transl_table=11
FT                   /locus_tag="TW027"
FT                   /product="putative integral membrane protein"
FT                   /note="Similar to Streptomyces coelicolor putative integral
FT                   membrane protein SCO4845 or SC5G8.13 SWALL:Q9KZA1
FT                   (EMBL:AL353872) (157 aa) fasta scores: E(): 2.9e-08, 41.3%
FT                   id in 92 aa"
FT                   /protein_id="CAD66719.1"
FT                   VFSKRK"
FT   misc_feature    complement(26554..26869)
FT                   /note="GtrA-like protein Score = 36.2 E-value = 5.2e-08"
FT   misc_feature    complement(order(26555..26623,26651..26719,26780..26842))
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 10-30, 51-73 and 83-105"
FT   CDS_pept        26979..28232
FT                   /transl_table=11
FT                   /gene="purK"
FT                   /locus_tag="TW028"
FT                   /product="phosphoribosylaminoimidazole carboxylase ATPase
FT                   subunit PurK"
FT                   /EC_number=""
FT                   /note="Similar to Mycobacterium tuberculosis
FT                   phosphoribosylaminoimidazole carboxylase ATPase subunit
FT                   PurK or Rv3276c or mt3376 or mtcy71.16C SWALL:PURK_MYCTU
FT                   (SWALL:P96881) (429 aa) fasta scores: E(): 1.3e-21, 39.43%
FT                   id in 421 aa, and to Schizosaccharomyces pombe
FT                   phosphoribosylaminoimidazole carboxylase Ade6 or Min1 or
FT                   Spcc1322.13 SWALL:PUR6_SCHPO (SWALL:P15567) (552 aa) fasta
FT                   scores: E(): 1.5e-14, 32.15% id in 395 aa"
FT                   /protein_id="CAD66720.1"
FT                   LAIAAEECRQLLRESHAV"
FT   misc_feature    27135..27588
FT                   /note="ATP-grasp domain Score = 56.7 E-value = 3.6e-14"
FT   CDS_pept        28311..28853
FT                   /transl_table=11
FT                   /gene="purE"
FT                   /locus_tag="TW029"
FT                   /product="phosphoribosylaminoimidazole carboxylase
FT                   catalytic subunit PurE"
FT                   /EC_number=""
FT                   /note="Similar to Corynebacterium ammoniagenes
FT                   phosphoribosylaminoimidazole carboxylase catalytic subunit
FT                   PurE SWALL:PUR6_CORAM (SWALL:Q44679) (177 aa) fasta scores:
FT                   E(): 7.7e-28, 55.09% id in 167 aa, and to Streptomyces
FT                   coelicolor phosphoribosylaminoimidazole carboxylase
FT                   catalytic subunit PurE or SCO3059 or SCBAC19G2.14c
FT                   SWALL:Q93J44 (EMBL:AL596138) (180 aa) fasta scores: E():
FT                   3.7e-27, 54.21% id in 166 aa"
FT                   /protein_id="CAD66721.1"
FT                   SLFDQSNEKDRMINEPK"
FT   misc_feature    28353..28824
FT                   /note="AIR carboxylase Score = 236.9 E-value = 2e-68"
FT   CDS_pept        complement(29078..29476)
FT                   /transl_table=11
FT                   /locus_tag="TW030"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66722.1"
FT   misc_feature    complement(order(29111..29179,29207..29275,29312..29365,
FT                   29375..29443))
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-34, 38-55, 68-90 and
FT                   100-122"
FT   CDS_pept        complement(29804..30667)
FT                   /transl_table=11
FT                   /locus_tag="TW032"
FT                   /product="putative polysaccharide biosynthesis protein"
FT                   /note="Similar to Streptomyces rishiriensis
FT                   dTDP-4-keto-6-deoxyhexose reductase CouS SWALL:Q9F8T1
FT                   (EMBL:AF235050) (288 aa) fasta scores: E(): 4.4e-46, 48.52%
FT                   id in 272 aa, and to Saccharopolyspora spinosa
FT                   dTDP-4-dehydrorhamnose reductase Kre SWALL:Q93EJ9
FT                   (EMBL:AF355468) (305 aa) fasta scores: E(): 4.2e-36, 43.34%
FT                   id in 293 aa"
FT                   /protein_id="CAD66723.1"
FT                   ECIAGQ"
FT   misc_feature    complement(29857..30262)
FT                   /note="RmlD substrate binding domain Score = 183.5 E-value
FT                   = 2.3e-52"
FT   CDS_pept        complement(30664..31647)
FT                   /transl_table=11
FT                   /locus_tag="TW033"
FT                   /product="putative dehydratase"
FT                   /note="Similar to Streptomyces tenebrarius AprE
FT                   SWALL:Q9F5R6 (EMBL:AF306787) (332 aa) fasta scores: E():
FT                   8.2e-88, 64.83% id in 327 aa"
FT                   /protein_id="CAD66724.1"
FT   misc_feature    complement(30705..31638)
FT                   /note="NAD dependent epimerase/dehydratase family Score =
FT                   526.7 E-value = 1.1e-155"
FT   misc_feature    complement(31147..31233)
FT                   /note="PS00061 Short-chain dehydrogenases/reductases family
FT                   signature."
FT   CDS_pept        31892..32515
FT                   /transl_table=11
FT                   /locus_tag="TW035"
FT                   /product="putative epimerase"
FT                   /note="Similar to Streptomyces antibioticus
FT                   dTDP-4-keto-6-deoxyglucose 3,5-epimerase SWALL:Q9L6C5
FT                   (EMBL:AF237894) (202 aa) fasta scores: E(): 4e-34, 50% id
FT                   in 192 aa"
FT                   /protein_id="CAD66725.1"
FT   misc_feature    31898..32426
FT                   /note="dTDP-4-dehydrorhamnose 3,5-epimerase Score = 241.2
FT                   E-value = 1e-69"
FT   CDS_pept        32571..33449
FT                   /transl_table=11
FT                   /locus_tag="TW036"
FT                   /product="putative nucleotidyl transferase"
FT                   /note="Similar to Streptomyces sphaeroides NovV
FT                   SWALL:Q9L9E6 (EMBL:AF170880) (297 aa) fasta scores: E():
FT                   6.5e-76, 66.78% id in 286 aa, and to Escherichia coli
FT                   glucose-1-phosphate thymidylyltransferase RffH or b3789
FT                   SWALL:RFFH_ECOLI (SWALL:P27831) (293 aa) fasta scores: E():
FT                   6.6e-69, 59.17% id in 289 aa"
FT                   /protein_id="CAD66726.1"
FT                   HYLLSGKHGFS"
FT   misc_feature    32574..33285
FT                   /note="Nucleotidyl transferase Score = 311.9 E-value =
FT                   5.3e-91"
FT   CDS_pept        complement(33457..34305)
FT                   /transl_table=11
FT                   /locus_tag="TW037"
FT                   /product="putative glycosyl transferase"
FT                   /note="Similar to Mycobacterium smegmatis
FT                   dTDP-rha:a-D-glcnac-diphosphoryl polyprenol,
FT                   a-3-L-rhamnosyl transferase WbbL SWALL:Q9RN50
FT                   (EMBL:AF187550) (296 aa) fasta scores: E(): 2.3e-30, 36.66%
FT                   id in 270 aa"
FT                   /protein_id="CAD66727.1"
FT                   K"
FT   misc_feature    complement(33732..34284)
FT                   /note="Glycosyl transferase Score = 72.8 E-value = 5e-19"
FT   CDS_pept        complement(34302..35108)
FT                   /transl_table=11
FT                   /locus_tag="TW038"
FT                   /product="putative ABC transport ATP-binding subunit"
FT                   /note="Similar to Myxococcus xanthus O-antigen export
FT                   system ATP-binding protein RfbB SWALL:RFBB_MYXXA
FT                   (SWALL:Q50863) (437 aa) fasta scores: E(): 2.3e-30, 48.92%
FT                   id in 233 aa"
FT                   /protein_id="CAD66728.1"
FT   misc_feature    complement(34367..34877)
FT                   /note="ABC transporter Score = 129.9 E-value = 3.3e-36"
FT   misc_feature    complement(34833..34856)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(35160..36041)
FT                   /transl_table=11
FT                   /locus_tag="TW039"
FT                   /product="putative ABC transport integral membrane subunit"
FT                   /note="Similar to Pseudomonas aeruginosa membrane-spanning
FT                   domain Msd Wzm SWALL:P72162 (EMBL:U63722) (265 aa) fasta
FT                   scores: E(): 8.6e-21, 30.68% id in 277 aa, and to
FT                   Myxococcus xanthus O-antigen export system permease protein
FT                   RfbA SWALL:RFBA_MYXXA (SWALL:Q50862) (260 aa) fasta scores:
FT                   E(): 1.2e-15, 26.83% id in 272 aa"
FT                   /protein_id="CAD66729.1"
FT                   FVKMQANLAQEL"
FT   misc_feature    complement(35174..35966)
FT                   /note="ABC-2 type transporter Score = 151.4 E-value =
FT                   1.1e-42"
FT   misc_feature    complement(order(35193..35252,35394..35453,35472..35540,
FT                   35583..35651,35712..35780,35823..35891))
FT                   /note="6 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 51-73, 88-110, 131-153,
FT                   168-190, 197-216 and 264-283"
FT   CDS_pept        36116..37087
FT                   /transl_table=11
FT                   /locus_tag="TW040"
FT                   /product="putative glycosyl transferase"
FT                   /note="Similar to Actinobacillus actinomycetemcomitans DNA
FT                   for glycosyltransferase, lytic transglycosylase,
FT                   dTDP-4-rhamnose reductase SWALL:O05379 (EMBL:AB002668) (289
FT                   aa) fasta scores: E(): 3.2e-17, 30.73% id in 257 aa"
FT                   /protein_id="CAD66730.1"
FT   misc_feature    36125..36602
FT                   /note="Glycosyl transferase Score = 115.3 E-value =
FT                   8.3e-32"
FT   CDS_pept        complement(37195..37551)
FT                   /transl_table=11
FT                   /locus_tag="TW041"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66731.1"
FT                   QDELEDIKSHSSKE"
FT   misc_feature    complement(order(37309..37377,37387..37455,37489..37542))
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 4-21, 33-55 and 59-81"
FT   CDS_pept        complement(37548..38276)
FT                   /transl_table=11
FT                   /locus_tag="TW042"
FT                   /product="putative glycosyl transferase"
FT                   /note="Similar to Actinobacillus actinomycetemcomitans
FT                   putative glycosyltransferase SWALL:Q9AQB2 (EMBL:AF213680)
FT                   (234 aa) fasta scores: E(): 6.3e-16, 28.99% id in 238 aa"
FT                   /protein_id="CAD66732.1"
FT   misc_feature    complement(37772..38261)
FT                   /note="Glycosyl transferase Score = 75.8 E-value = 6.5e-20"
FT   CDS_pept        38634..40475
FT                   /transl_table=11
FT                   /locus_tag="TW043"
FT                   /product="putative large integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66733.1"
FT   misc_feature    38634..38813
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.978) with cleavage
FT                   site probability 0.865 between residues 60 and 61"
FT   misc_feature    order(38742..38810,39135..39203,39222..39275,39288..39347,
FT                   39381..39449,39507..39575,39609..39677,39720..39779,
FT                   39792..39860,39888..39956,39975..40043,40215..40283)
FT                   /note="12 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 37-59, 168-190, 197-214,
FT                   219-238, 250-272, 292-314, 326-348, 363-382, 387-409,
FT                   419-441, 448-470 and 528-550"
FT   repeat_region   40470..40740
FT                   /note="rep11. Degenerate repeat sequence including upstream
FT                   and 5' region of CDS."
FT   CDS_pept        40712..40825
FT                   /transl_table=11
FT                   /locus_tag="TW044"
FT                   /product="hypothetical protein"
FT                   /note="Doubtful CDS. No significant database matches"
FT                   /protein_id="CAD66734.1"
FT   CDS_pept        40845..40934
FT                   /transl_table=11
FT                   /locus_tag="TW045"
FT                   /product="putative small membrane protein"
FT                   /note="Doubtful CDS. No significant database matches"
FT                   /protein_id="CAD66735.1"
FT                   /translation="MALFVVITLLIGAGLFLLRDLLLPGDEQI"
FT   misc_feature    40848..40901
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 2-19"
FT   CDS_pept        41326..41835
FT                   /transl_table=11
FT                   /locus_tag="TW046"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66736.1"
FT                   RKKRDL"
FT   misc_feature    order(41422..41490,41500..41568,41605..41667,41695..41763)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 33-55, 59-81, 94-114 and
FT                   124-146"
FT   repeat_region   42022..42288
FT                   /note="rep11. Degenerate repeat sequence including upstream
FT                   and 5' region of CDS."
FT   CDS_pept        42189..42587
FT                   /transl_table=11
FT                   /locus_tag="TW048"
FT                   /product="putative secreted protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66737.1"
FT   misc_feature    42189..42266
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.996 between residues 26 and 27"
FT   CDS_pept        42584..42982
FT                   /transl_table=11
FT                   /locus_tag="TW049"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66738.1"
FT   misc_feature    42584..42730
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.992) with cleavage
FT                   site probability 0.533 between residues 49 and 50"
FT   misc_feature    order(42626..42682,42695..42763,42806..42874,42893..42961)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 15-33, 38-60, 75-97 and
FT                   104-126"
FT   CDS_pept        43109..43420
FT                   /transl_table=11
FT                   /locus_tag="TW051"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66739.1"
FT   misc_feature    43109..43213
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.706) with cleavage
FT                   site probability 0.437 between residues 35 and 36"
FT   misc_feature    order(43145..43213,43226..43285,43322..43390)
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-35, 40-59 and 72-94"
FT   repeat_region   43618..43884
FT                   /note="rep11. Degenerate repeat sequence including upstream
FT                   and 5' region of CDS."
FT   CDS_pept        43784..44215
FT                   /transl_table=11
FT                   /locus_tag="TW052"
FT                   /product="putative secreted protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66740.1"
FT   misc_feature    43784..43861
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.947 between residues 26 and 27"
FT   misc_feature    43802..43861
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-26"
FT   CDS_pept        44219..44608
FT                   /transl_table=11
FT                   /locus_tag="TW053"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66741.1"
FT   misc_feature    44219..44320
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.997) with cleavage
FT                   site probability 0.402 between residues 34 and 35"
FT   misc_feature    order(44252..44320,44330..44383,44420..44488,44516..44575)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-34, 38-55, 68-90 and
FT                   100-119"
FT   repeat_region   44676..44810
FT                   /note="(tcgaatcgtgctgta)9"
FT   CDS_pept        complement(44860..46251)
FT                   /transl_table=11
FT                   /locus_tag="TW054"
FT                   /product="putative two component system sensor kinase"
FT                   /note="Similar to Mycobacterium tuberculosis hypothetical
FT                   protein Rv0758 or mt0783 or mtcy369.03 SWALL:P71815
FT                   (EMBL:Z80226) (485 aa) fasta scores: E(): 8.9e-37, 31.11%
FT                   id in 466 aa, and to Streptomyces coelicolor putative two
FT                   component system histidine kinase SCO4021 or 2SC10A7.25
FT                   SWALL:Q9ADN6 (EMBL:AL583945) (524 aa) fasta scores: E():
FT                   5.5e-27, 37.73% id in 265 aa"
FT                   /protein_id="CAD66742.1"
FT                   HSLTR"
FT   misc_feature    complement(44910..45243)
FT                   /note="Histidine kinase-, DNA gyrase B-, and HSP90-like
FT                   ATPase Score = 132.6 E-value = 5.2e-37"
FT   misc_feature    complement(45369..45570)
FT                   /note="His Kinase A (phosphoacceptor) domain Score = 68.2
FT                   E-value = 1.2e-17"
FT   misc_feature    complement(45603..45813)
FT                   /note="HAMP domain Score = 46.4 E-value = 4.5e-11"
FT   misc_feature    complement(order(45742..45810,46180..46239))
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 5-24 and 148-170"
FT   misc_feature    complement(46177..46251)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.702) with cleavage
FT                   site probability 0.385 between residues 25 and 26"
FT   CDS_pept        complement(46318..47001)
FT                   /transl_table=11
FT                   /locus_tag="TW055"
FT                   /product="putative two component system response regulator"
FT                   /note="Similar to Streptomyces coelicolor putative two
FT                   component system response regulator SCO4020 or 2SC10A7.24
FT                   SWALL:Q9ADN7 (EMBL:AL583945) (271 aa) fasta scores: E():
FT                   1.2e-40, 50.44% id in 226 aa"
FT                   /protein_id="CAD66743.1"
FT                   IMRTR"
FT   misc_feature    complement(46332..46557)
FT                   /note="Transcriptional regulatory protein, C terminal Score
FT                   = 88.7 E-value = 8.6e-24"
FT   misc_feature    complement(46635..46992)
FT                   /note="Response regulator receiver domain Score = 141.1
FT                   E-value = 1.4e-39"
FT   CDS_pept        47266..47643
FT                   /transl_table=11
FT                   /locus_tag="TW057"
FT                   /product="cold shock protein B"
FT                   /note="Similar to Streptomyces coelicolor cold shock
FT                   protein B CspB or SCO4325 or SCD12A.08 SWALL:Q9KXN2
FT                   (EMBL:AL357524) (127 aa) fasta scores: E(): 8.1e-16, 42.06%
FT                   id in 126 aa, and to Pseudomonas fragi cold shock protein
FT                   CapB SWALL:CAPB_PSEFR (SWALL:P80415) (69 aa) fasta scores:
FT                   E(): 0.0014, 38.09% id in 63 aa"
FT                   /protein_id="CAD66744.1"
FT   misc_feature    47266..47458
FT                   /note="'Cold-shock' DNA-binding domain Score = 23.9 E-value
FT                   = 1.1e-05"
FT   CDS_pept        47741..47968
FT                   /transl_table=11
FT                   /locus_tag="TW058"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66745.1"
FT   CDS_pept        47971..48753
FT                   /transl_table=11
FT                   /locus_tag="TW059"
FT                   /product="putative sporulation/chromosome partition
FT                   protein"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   partitioning or sporulation protein SCO1772 or SCI51.12c
FT                   SWALL:Q9S228 (EMBL:AL109848) (340 aa) fasta scores: E():
FT                   9.9e-52, 57.14% id in 252 aa, and to Bacillus subtilis
FT                   sporulation initiation inhibitor protein Soj
FT                   SWALL:SOJ_BACSU (SWALL:P37522) (253 aa) fasta scores: E():
FT                   2.6e-38, 46.21% id in 251 aa"
FT                   /protein_id="CAD66746.1"
FT   misc_feature    48223..48556
FT                   /note="ParA family ATPase Score = 119.9 E-value = 3.4e-33"
FT   CDS_pept        48827..49963
FT                   /transl_table=11
FT                   /locus_tag="TW060"
FT                   /product="putative oxidoreductase"
FT                   /note="Similar to Staphylococcus aureus prephenate
FT                   dehydrogenase TyrA or Mw1252 SWALL:BAB95117 (EMBL:AP004826)
FT                   (363 aa) fasta scores: E(): 8.9e-10, 27.5% id in 389 aa"
FT                   /protein_id="CAD66747.1"
FT   misc_feature    48839..49721
FT                   /note="Prephenate dehydrogenase Score = 124.4 E-value =
FT                   1.5e-34"
FT   misc_feature    49763..49856
FT                   /note="ACT domain Score = 19.1 E-value = 4.5e-05"
FT   CDS_pept        49945..52005
FT                   /transl_table=11
FT                   /locus_tag="TW061"
FT                   /product="putative GTP-binding protein"
FT                   /note="Similar to many eg. Streptomyces coelicolor putative
FT                   GTP binding protein SCO1758 or 2SCI34.11c SWALL:Q9EWW8
FT                   (EMBL:AL445403) (492 aa) fasta scores: E(): 8.6e-84, 49.49%
FT                   id in 493 aa. N-terminal region contains match to Pfam
FT                   PF02224 Cytidylate kinase."
FT                   /protein_id="CAD66748.1"
FT   misc_feature    49975..49998
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    50152..50617
FT                   /note="Cytidylate kinase Score = 66.2 E-value = 4.8e-17"
FT   misc_feature    50725..50748
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    50911..51682
FT                   /note="GTPase of unknown function Score = 158.0 E-value =
FT                   1.2e-44"
FT   misc_feature    51238..51261
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(52002..53279)
FT                   /transl_table=11
FT                   /locus_tag="TW062"
FT                   /product="putative chorismate binding enzyme"
FT                   /note="Similar to Pseudomonas putida anthranilate synthase
FT                   component I TrpE SWALL:TRPE_PSEPU (SWALL:P20579) (493 aa)
FT                   fasta scores: E(): 5e-16, 29.18% id in 281 aa"
FT                   /protein_id="CAD66749.1"
FT   misc_feature    complement(52010..52829)
FT                   /note="chorismate binding enzyme Score = 42.5 E-value =
FT                   1.2e-18"
FT   CDS_pept        53375..54094
FT                   /transl_table=11
FT                   /locus_tag="TW063"
FT                   /product="putative ubiquinone/menaquinone
FT                   methyltransferase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   ubiquinone/menaquinone methyltransferase SCO4556 or
FT                   SCD16a.27c SWALL:Q9XAP8 (EMBL:AL078618) (231 aa) fasta
FT                   scores: E(): 1.6e-29, 42.17% id in 230 aa, and to
FT                   Escherichia coli, and Escherichia coli O157:H7
FT                   ubiquinone/menaquinone biosynthesis methyltransferase UbiE
FT                   or b3833 or z5355 or ecs4763 SWALL:UBIE_ECOLI
FT                   (SWALL:P27851) (251 aa) fasta scores: E(): 6.5e-23, 36.32%
FT                   id in 245 aa"
FT                   /db_xref="GOA:P67065"
FT                   /db_xref="InterPro:IPR004033"
FT                   /db_xref="InterPro:IPR023576"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/Swiss-Prot:P67065"
FT                   /protein_id="CAD66750.1"
FT                   RLSFGAVALHRALRGPE"
FT   misc_feature    53396..54080
FT                   /note="ubiE/COQ5 methyltransferase family Score = 136.3
FT                   E-value = 3.8e-38"
FT   CDS_pept        54106..55122
FT                   /transl_table=11
FT                   /locus_tag="TW064"
FT                   /product="putative polyprenyl diphosphate synthase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   transferase SCO4583 or SCD20.01 SWALL:Q9F2X8
FT                   (EMBL:AL392148) (336 aa) fasta scores: E(): 3.3e-37, 38.19%
FT                   id in 343 aa, and to Gluconobacter oxydans decaprenyl
FT                   diphosphate synthase DdsA SWALL:O82832 (EMBL:AB006850) (315
FT                   aa) fasta scores: E(): 2.4e-23, 32.55% id in 301 aa"
FT                   /protein_id="CAD66751.1"
FT   misc_feature    54223..54985
FT                   /note="Polyprenyl synthetase Score = 137.2 E-value =
FT                   2.2e-38"
FT   misc_feature    54424..54447
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    54733..54771
FT                   /note="PS00444 Polyprenyl synthetases signature 2."
FT   CDS_pept        55141..56484
FT                   /transl_table=11
FT                   /locus_tag="TW065"
FT                   /product="putative ferredoxin/ferredoxin-NADP reductase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   ferredoxin/ferredoxin-NADP reductase SCO0681 or SCF15.02
FT                   SWALL:Q9RK35 (EMBL:AL132856) (454 aa) fasta scores: E():
FT                   1.3e-71, 43.55% id in 450 aa, and to Rattus norvegicus
FT                   NADPH:adrenodoxin oxidoreductase, mitochondrial precursor
FT                   FdxR SWALL:ADRO_RAT (SWALL:P56522) (494 aa) fasta scores:
FT                   E(): 7.4e-33, 35.16% id in 455 aa"
FT                   /protein_id="CAD66752.1"
FT   CDS_pept        complement(56824..57795)
FT                   /transl_table=11
FT                   /locus_tag="TW066"
FT                   /product="putative iron-siderophore binding lipoprotein"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   iron-siderophore binding lipoprotein SCO0494 or SCF34.13c
FT                   SWALL:Q9RK12 (EMBL:AL109974) (350 aa) fasta scores: E():
FT                   7.7e-19, 30.97% id in 339 aa, and to Corynebacterium
FT                   diphtheriae DtxR/iron regulated lipoprotein precursor Irp1
FT                   SWALL:Q46023 (EMBL:U02617) (355 aa) fasta scores: E():
FT                   1e-12, 31.02% id in 303 aa"
FT                   /protein_id="CAD66753.1"
FT   misc_feature    complement(56928..57651)
FT                   /note="Periplasmic binding protein Score = 83.8 E-value =
FT                   2.5e-22"
FT   misc_feature    complement(57718..57795)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.630 between residues 26 and 27"
FT   misc_feature    complement(57739..57771)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(57921..58916)
FT                   /transl_table=11
FT                   /locus_tag="TW067"
FT                   /product="putative iron-siderophore binding lipoprotein"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   iron-siderophore binding lipoprotein SCO0494 or SCF34.13c
FT                   SWALL:Q9RK12 (EMBL:AL109974) (350 aa) fasta scores: E():
FT                   4.2e-19, 29.82% id in 342 aa, and to Mycobacterium
FT                   smegmatis FxtD SWALL:O87315 (EMBL:AF027770) (420 aa) fasta
FT                   scores: E(): 2.7e-12, 31.09% id in 238 aa"
FT                   /protein_id="CAD66754.1"
FT   misc_feature    complement(58025..58772)
FT                   /note="Periplasmic binding protein Score = 81.2 E-value =
FT                   1.5e-21"
FT   misc_feature    complement(58839..58916)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.630 between residues 26 and 27"
FT   misc_feature    complement(58860..58892)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(59134..59919)
FT                   /transl_table=11
FT                   /locus_tag="TW068"
FT                   /product="putative iron-siderophore uptake system
FT                   ATP-binding component"
FT                   /note="Similar to Escherichia coli ferric enterobactin
FT                   transport ATP-binding protein FepC or b0588
FT                   SWALL:FEPC_ECOLI (SWALL:P23878) (271 aa) fasta scores: E():
FT                   8.6e-42, 50% id in 250 aa"
FT                   /protein_id="CAD66755.1"
FT   misc_feature    complement(59286..59841)
FT                   /note="ABC transporter Score = 172.0 E-value = 6.8e-49"
FT   misc_feature    complement(59467..59511)
FT                   /note="PS00211 ABC transporters family signature."
FT   misc_feature    complement(59797..59820)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(59903..60937)
FT                   /transl_table=11
FT                   /locus_tag="TW069"
FT                   /product="putative iron-siderophore uptake system integral
FT                   membrane component"
FT                   /note="Similar to Escherichia coli ferric enterobactin
FT                   transport system permease protein FepG or b0589
FT                   SWALL:FEPG_ECOLI (SWALL:P23877) (330 aa) fasta scores: E():
FT                   1.2e-43, 39.93% id in 323 aa"
FT                   /protein_id="CAD66756.1"
FT                   DYRR"
FT   misc_feature    complement(59929..60814)
FT                   /note="FecCD transport family Score = 267.8 E-value =
FT                   9.9e-78"
FT   misc_feature    complement(order(59936..60004,60032..60100,60119..60187,
FT                   60269..60322,60488..60556,60566..60625,60662..60730,
FT                   60809..60877))
FT                   /note="8 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 21-43, 70-92, 105-124,
FT                   128-150, 206-223, 251-273, 280-302 and 312-334"
FT   misc_feature    complement(60806..60937)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.829) with cleavage
FT                   site probability 0.374 between residues 44 and 45"
FT   CDS_pept        complement(60943..61908)
FT                   /transl_table=11
FT                   /locus_tag="TW070"
FT                   /product="putative iron-siderophore uptake system integral
FT                   membrane component"
FT                   /note="Similar to Escherichia coli ferric enterobactin
FT                   transport system permease protein FepD or b0590
FT                   SWALL:FEPD_ECOLI (SWALL:P23876) (334 aa) fasta scores: E():
FT                   5.2e-33, 40% id in 305 aa"
FT                   /protein_id="CAD66757.1"
FT   misc_feature    complement(60960..61824)
FT                   /note="FecCD transport family Score = 223.4 E-value =
FT                   2.3e-64"
FT   misc_feature    complement(order(60967..61026,61054..61113,61150..61218,
FT                   61276..61344,61417..61485,61498..61566,61579..61647,
FT                   61675..61743,61828..61896))
FT                   /note="9 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 5-27, 56-78, 88-110, 115-137,
FT                   142-164, 189-211, 231-253, 266-285 and 295-314"
FT   misc_feature    complement(61786..61908)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.836) with cleavage
FT                   site probability 0.222 between residues 41 and 42"
FT   tRNA            complement(62075..62151)
FT                   /note="tRNA Met anticodon CAT, Cove score 95.55"
FT   tRNA            complement(62170..62241)
FT                   /note="tRNA Thr anticodon GGT, Cove score 73.84"
FT   CDS_pept        62354..62647
FT                   /transl_table=11
FT                   /locus_tag="TW071"
FT                   /product="putative regulator"
FT                   /note="Similar to Staphylococcus aureus cadmium efflux
FT                   system accessory protein homolog cadC SWALL:CADF_STAAU
FT                   (SWALL:P37374) (121 aa) fasta scores: E(): 3e-07, 37.89% id
FT                   in 95 aa"
FT                   /protein_id="CAD66758.1"
FT   misc_feature    62396..62627
FT                   /note="Bacterial regulatory protein, arsR family Score =
FT                   84.2 E-value = 1.9e-22"
FT   tRNA            complement(62810..62892)
FT                   /note="tRNA Tyr anticodon GTA, Cove score 64.70"
FT   CDS_pept        complement(62943..64580)
FT                   /transl_table=11
FT                   /gene="lysS"
FT                   /locus_tag="TW072"
FT                   /product="lysyl-tRNA synthetase"
FT                   /EC_number=""
FT                   /note="Similar to Pyrococcus horikoshii lysyl-tRNA
FT                   synthetase LysS or ph0224 SWALL:SYK_PYRHO (SWALL:O57963)
FT                   (523 aa) fasta scores: E(): 2e-56, 33.2% id in 530 aa"
FT                   /protein_id="CAD66759.1"
FT   misc_feature    complement(62966..64532)
FT                   /note="tRNA synthetases class I (K) Score = 364.7 E-value =
FT                   7e-107"
FT   misc_feature    complement(64419..64448)
FT                   /note="PS00178 Aminoacyl-transfer RNA synthetases class-I
FT                   signature."
FT   CDS_pept        64669..65535
FT                   /transl_table=11
FT                   /gene="panC"
FT                   /locus_tag="TW073"
FT                   /product="pantoate--beta-alanine ligase"
FT                   /EC_number=""
FT                   /note="Similar to Corynebacterium glutamicum
FT                   pantoate--beta-alanine ligase PanC or cgl0113
FT                   SWALL:PANC_CORGL (SWALL:Q9X713) (279 aa) fasta scores: E():
FT                   1.5e-27, 39.59% id in 293 aa"
FT                   /db_xref="GOA:Q83ID9"
FT                   /db_xref="InterPro:IPR003721"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR042176"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83ID9"
FT                   /protein_id="CAD66760.1"
FT                   NVDLVVV"
FT   misc_feature    64675..65521
FT                   /note="Pantoate-beta-alanine ligase Score = 171.0 E-value =
FT                   1.4e-48"
FT   CDS_pept        65832..67328
FT                   /transl_table=11
FT                   /locus_tag="TW074"
FT                   /product="putative phospholipase"
FT                   /note="Similar to Escherichia coli cardiolipin synthetase
FT                   Cls or Nov or b1249 SWALL:CLS_ECOLI (SWALL:P31071) (486 aa)
FT                   fasta scores: E(): 4.9e-21, 30.64% id in 496 aa"
FT                   /protein_id="CAD66761.1"
FT   misc_feature    order(65844..65912,65931..65999)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 5-27 and 34-56"
FT   misc_feature    66471..66552
FT                   /note="Phospholipase D. Active site motif Score = 27.9
FT                   E-value = 1.7e-05"
FT   misc_feature    67062..67143
FT                   /note="Phospholipase D. Active site motif Score = 28.7
FT                   E-value = 9.3e-06"
FT   CDS_pept        67380..69902
FT                   /transl_table=11
FT                   /locus_tag="TW075"
FT                   /product="putative Clp-family ATP-binding
FT                   protease/regulator"
FT                   /note="Similar to Bacillus subtilis negative regulator of
FT                   genetic competence ClpC/MecB SWALL:CLPC_BACSU
FT                   (SWALL:P37571) (810 aa) fasta scores: E(): 3e-152, 56.66%
FT                   id in 810 aa, and to Streptomyces coelicolor putative
FT                   Vlp-family ATP-binding protease SCO3373 or SCE94.24c
FT                   SWALL:Q9S6T8 (EMBL:AL049628) (841 aa) fasta scores: E():
FT                   7.6e-189, 65.87% id in 838 aa"
FT                   /protein_id="CAD66762.1"
FT   misc_feature    67437..67593
FT                   /note="Clp amino terminal domain Score = 69.5 E-value =
FT                   5e-18"
FT   misc_feature    67662..67818
FT                   /note="Clp amino terminal domain Score = 74.2 E-value =
FT                   1.9e-19"
FT   misc_feature    68010..68589
FT                   /note="ATPase family associated with various cellular
FT                   activities (AAA) Score = 44.1 E-value = 2.3e-10"
FT   misc_feature    68025..68048
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    69021..69681
FT                   /note="ATPase family associated with various cellular
FT                   activities (AAA) Score = 15.1 E-value = 5.8e-06"
FT   misc_feature    69036..69059
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        70637..72220
FT                   /transl_table=11
FT                   /gene="menD"
FT                   /locus_tag="TW078"
FT                   /product="putative menaquinone biosynthesis protein MenD"
FT                   /EC_number="4.1.3.-"
FT                   /note="Similar to Bacillus subtilis menaquinone
FT                   biosynthesis protein MenD [includes: 2-succinyl-6-hydroxy-
FT                   2,4-cyclohexadiene-1-carboxylate synthase MenD
FT                   SWALL:MEND_BACSU (SWALL:P23970) (580 aa) fasta scores: E():
FT                   3.6e-17, 28.57% id in 525 aa, and to Mycobacterium leprae
FT                   putative
FT                   2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate
FT                   synthase / 2-oxoglutarate decarboxylase MenD or ML2270
FT                   SWALL:Q9CBB0 (EMBL:AL583925) (556 aa) fasta scores: E():
FT                   1.4e-25, 32.95% id in 531 aa"
FT                   /protein_id="CAD66763.1"
FT                   PHLLEVHLAV"
FT   misc_feature    70640..71186
FT                   /note="Thiamine pyrophosphate enzyme, N-terminal TPP
FT                   binding domain Score = -42.9 E-value = 5.4e-05"
FT   CDS_pept        72230..72775
FT                   /transl_table=11
FT                   /locus_tag="TW079"
FT                   /product="putative secreted protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66764.1"
FT                   VEFSIDGFSSSKYNFVLQ"
FT   misc_feature    72230..72367
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.820 between residues 46 and 47"
FT   misc_feature    72263..72316
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-29"
FT   CDS_pept        72796..73707
FT                   /transl_table=11
FT                   /gene="menA"
FT                   /locus_tag="TW080"
FT                   /product="1,4-dihydroxy-2-naphthoate octaprenyltransferase"
FT                   /EC_number="2.5.1.-"
FT                   /note="Similar to Escherichia coli
FT                   1,4-dihydroxy-2-naphthoate octaprenyltransferase MenA or
FT                   b3930 SWALL:MENA_ECOLI (SWALL:P32166) (308 aa) fasta
FT                   scores: E(): 8.9e-17, 33.45% id in 275 aa, and to
FT                   Mycobacterium tuberculosis probable
FT                   1,4-dihydroxy-2-naphthoate octaprenyltransferase MenA or
FT                   Rv0534c or mt0558 or mtcy25d10.13C SWALL:MENA_MYCTU
FT                   (SWALL:O06400) (292 aa) fasta scores: E(): 2.8e-24, 40.63%
FT                   id in 251 aa"
FT                   /protein_id="CAD66765.1"
FT   misc_feature    72796..72942
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.999) with cleavage
FT                   site probability 0.204 between residues 49 and 50"
FT   misc_feature    order(72832..72900,72943..73011,73072..73140,73183..73251,
FT                   73270..73338,73351..73410,73468..73536,73546..73614,
FT                   73633..73701)
FT                   /note="9 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-35, 50-72, 93-115,
FT                   130-152, 159-181, 186-205, 225-247, 251-273 and 280-302"
FT   misc_feature    72880..73696
FT                   /note="UbiA prenyltransferase family Score = 64.0 E-value =
FT                   2.3e-16"
FT   CDS_pept        73945..77412
FT                   /transl_table=11
FT                   /gene="rpoB"
FT                   /locus_tag="TW081"
FT                   /product="DNA-directed RNA polymerase beta chain"
FT                   /EC_number=""
FT                   /note="Previously sequenced as Tropheryma whipplei
FT                   DNA-directed RNA polymerase beta chain RpoB
FT                   SWALL:RPOB_TROWH (SWALL:Q93GF2) (1216 aa) fasta scores:
FT                   E(): 0, 99.56% id in 1155 aa. Similar to Mycobacterium
FT                   tuberculosis DNA-directed RNA polymerase beta chain RpoB or
FT                   Rv0667 or mt0695 or mtci376.08C SWALL:RPOB_MYCTU
FT                   (SWALL:P47766) (1178 aa) fasta scores: E(): 0, 65.56% id in
FT                   1150 aa"
FT                   /db_xref="GOA:P59642"
FT                   /db_xref="InterPro:IPR007120"
FT                   /db_xref="InterPro:IPR007121"
FT                   /db_xref="InterPro:IPR007641"
FT                   /db_xref="InterPro:IPR007642"
FT                   /db_xref="InterPro:IPR007644"
FT                   /db_xref="InterPro:IPR007645"
FT                   /db_xref="InterPro:IPR010243"
FT                   /db_xref="InterPro:IPR014724"
FT                   /db_xref="InterPro:IPR015712"
FT                   /db_xref="InterPro:IPR019462"
FT                   /db_xref="InterPro:IPR037033"
FT                   /db_xref="InterPro:IPR037034"
FT                   /db_xref="InterPro:IPR042107"
FT                   /db_xref="UniProtKB/Swiss-Prot:P59642"
FT                   /protein_id="CAD66766.1"
FT   misc_feature    74044..75205
FT                   /note="RNA polymerase beta subunit Score = 78.2 E-value =
FT                   1.2e-20"
FT   misc_feature    74449..75001
FT                   /note="RNA polymerase Rpb2, domain 2 Score = 48.6 E-value =
FT                   1e-11"
FT   misc_feature    75208..75424
FT                   /note="RNA polymerase Rpb2, domain 3 Score = 145.8 E-value
FT                   = 5.4e-41"
FT   misc_feature    75826..77077
FT                   /note="RNA polymerase Rpb2, domain 6 Score = 688.8 E-value
FT                   = 1.9e-204"
FT   misc_feature    76552..76590
FT                   /note="PS01166 RNA polymerases beta chain signature."
FT   misc_feature    77083..77311
FT                   /note="RNA polymerase Rpb2, domain 7 Score = 170.3 E-value
FT                   = 2.2e-48"
FT   CDS_pept        77472..81299
FT                   /transl_table=11
FT                   /gene="rpoC"
FT                   /locus_tag="TW082"
FT                   /product="DNA-directed RNA polymerase beta' chain"
FT                   /EC_number=""
FT                   /note="Similar to Aquifex pyrophilus DNA-directed RNA
FT                   polymerase beta' chain RpoC SWALL:RPOC_AQUPY (SWALL:Q9X6Y2)
FT                   (1576 aa) fasta scores: E(): 3.4e-124, 40.11% id in 1573
FT                   aa"
FT                   /db_xref="GOA:Q820D9"
FT                   /db_xref="InterPro:IPR000722"
FT                   /db_xref="InterPro:IPR006592"
FT                   /db_xref="InterPro:IPR007066"
FT                   /db_xref="InterPro:IPR007080"
FT                   /db_xref="InterPro:IPR007081"
FT                   /db_xref="InterPro:IPR007083"
FT                   /db_xref="InterPro:IPR012754"
FT                   /db_xref="InterPro:IPR038120"
FT                   /db_xref="InterPro:IPR042102"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q820D9"
FT                   /protein_id="CAD66767.1"
FT   misc_feature    78687..79113
FT                   /note="RNA polymerase Rpb1, domain 2 Score = 282.9 E-value
FT                   = 2.9e-82"
FT   CDS_pept        complement(81523..82884)
FT                   /transl_table=11
FT                   /locus_tag="TW083"
FT                   /product="putative hydrolase"
FT                   /note="Similar to Synechocystis sp. serine esterase sll1284
FT                   SWALL:P73192 (EMBL:D90904) (204 aa) fasta scores: E():
FT                   0.0001, 29.01% id in 193 aa"
FT                   /protein_id="CAD66768.1"
FT   misc_feature    complement(81528..82152)
FT                   /note="Phospholipase/Carboxylesterase Score = 19.9 E-value
FT                   = 6.7e-10"
FT   misc_feature    complement(82173..82329)
FT                   /note="Phospholipase/Carboxylesterase Score = 26.2 E-value
FT                   = 2.4e-07"
FT   CDS_pept        82958..83341
FT                   /transl_table=11
FT                   /gene="groS"
FT                   /locus_tag="TW084"
FT                   /product="10 kDa chaperonin"
FT                   /note="Similar to Streptomyces coelicolor and Streptomyces
FT                   lividans 10 kDa chaperonin GroS or SCO4761 or SC6G4.39
FT                   SWALL:CH10_STRCO (SWALL:P40172) (102 aa) fasta scores: E():
FT                   3.9e-21, 68.42% id in 95 aa"
FT                   /protein_id="CAD66769.1"
FT   misc_feature    83051..83333
FT                   /note="Chaperonin 10 Kd subunit Score = 189.8 E-value =
FT                   3e-54"
FT   misc_feature    83057..83131
FT                   /note="PS00681 Chaperonins cpn10 signature."
FT   CDS_pept        83392..84867
FT                   /transl_table=11
FT                   /gene="guaB1"
FT                   /locus_tag="TW085"
FT                   /product="inosine-5'-monophosphate dehydrogenase"
FT                   /EC_number=""
FT                   /note="Similar to Bacillus subtilis
FT                   inosine-5'-monophosphate dehydrogenase GuaB or GnaB
FT                   SWALL:IMDH_BACSU (SWALL:P21879) (513 aa) fasta scores: E():
FT                   2.1e-87, 50.92% id in 489 aa"
FT                   /protein_id="CAD66770.1"
FT   misc_feature    83392..84856
FT                   /note="IMP dehydrogenase / GMP reductase Score = 647.7
FT                   E-value = 4.4e-192"
FT   misc_feature    83668..83827
FT                   /note="CBS domain Score = 55.5 E-value = 8.2e-14"
FT   misc_feature    83860..84019
FT                   /note="CBS domain Score = 45.7 E-value = 7.6e-11"
FT   misc_feature    84292..84330
FT                   /note="PS00487 IMP dehydrogenase / GMP reductase
FT                   signature."
FT   CDS_pept        84872..85993
FT                   /transl_table=11
FT                   /gene="guaB2"
FT                   /locus_tag="TW086"
FT                   /product="putative inosine-5'-monophosphate dehydrogenase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   inosine-5'-monophosphate dehydrogenase SCO4771 or SCD63.03
FT                   SWALL:Q9L0I6 (EMBL:AL161755) (374 aa) fasta scores: E():
FT                   7.1e-82, 58.64% id in 370 aa, and to Escherichia coli and
FT                   Escherichia coli O157:H7 inosine-5'-monophosphate
FT                   dehydrogenase GuaB or b2508 or z3772 or ecs3370
FT                   SWALL:IMDH_ECOLI (SWALL:P06981) (488 aa) fasta scores: E():
FT                   7.5e-05, 32.94% id in 170 aa"
FT                   /protein_id="CAD66771.1"
FT   misc_feature    85421..85748
FT                   /note="IMP dehydrogenase / GMP reductase Score = 39.4
FT                   E-value = 1.7e-11"
FT   CDS_pept        85986..86699
FT                   /transl_table=11
FT                   /locus_tag="TW087"
FT                   /product="putative membrane protein"
FT                   /note="Similar to Streptomyces coelicolor putative membrane
FT                   protein SCO1829 or SCI8.14 SWALL:Q9RJ39 (EMBL:AL132644)
FT                   (290 aa) fasta scores: E(): 0.37, 25.79% id in 252 aa"
FT                   /protein_id="CAD66772.1"
FT                   YLVRTPEIESCAKRD"
FT   misc_feature    85986..86096
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.976) with cleavage
FT                   site probability 0.587 between residues 37 and 38"
FT   misc_feature    order(86013..86072,86586..86654)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 10-29 and 201-223"
FT   CDS_pept        86765..87202
FT                   /transl_table=11
FT                   /locus_tag="TW088"
FT                   /product="putative membrane protein"
FT                   /note="Similar to Corynebacterium glutamicum hypothetical
FT                   membrane protein Cgl2499 SWALL:BAB99892 (EMBL:AP005281)
FT                   (118 aa) fasta scores: E(): 0.0015, 31.53% id in 130 aa"
FT                   /protein_id="CAD66773.1"
FT   misc_feature    order(86861..86929,86990..87058,87086..87154)
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 33-55, 76-98 and 108-130"
FT   CDS_pept        87199..88710
FT                   /transl_table=11
FT                   /gene="guaA"
FT                   /locus_tag="TW089"
FT                   /product="GMP synthase [glutamine-hydrolyzing]"
FT                   /EC_number=""
FT                   /note="Similar to Bacillus subtilis GMP synthase
FT                   [glutamine-hydrolyzing] GuaA SWALL:GUAA_BACSU
FT                   (SWALL:P29727) (513 aa) fasta scores: E(): 2.2e-94, 50.49%
FT                   id in 509 aa"
FT                   /db_xref="GOA:Q83ID3"
FT                   /db_xref="InterPro:IPR001674"
FT                   /db_xref="InterPro:IPR004739"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR017926"
FT                   /db_xref="InterPro:IPR022310"
FT                   /db_xref="InterPro:IPR022955"
FT                   /db_xref="InterPro:IPR025777"
FT                   /db_xref="InterPro:IPR029062"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83ID3"
FT                   /protein_id="CAD66774.1"
FT   misc_feature    87211..87748
FT                   /note="Glutamine amidotransferase class-I Score = 137.2
FT                   E-value = 2.1e-38"
FT   misc_feature    87421..87456
FT                   /note="PS00442 Glutamine amidotransferases class-I active
FT                   site."
FT   misc_feature    88351..88702
FT                   /note="GMP synthase C terminal domain Score = 195.4 E-value
FT                   = 6.1e-56"
FT   CDS_pept        88815..91046
FT                   /transl_table=11
FT                   /locus_tag="TW090"
FT                   /product="ATP-dependent DNA helicase"
FT                   /note="Similar to Bacillus subtilis ATP-dependent DNA
FT                   helicase PcrA SWALL:PCRA_BACSU (SWALL:O34580) (739 aa)
FT                   fasta scores: E(): 1.1e-72, 41.42% id in 758 aa"
FT                   /protein_id="CAD66775.1"
FT   misc_feature    88845..90321
FT                   /note="UvrD/REP helicase Score = 607.9 E-value = 4.2e-180"
FT   misc_feature    88902..88925
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        91313..92797
FT                   /transl_table=11
FT                   /locus_tag="TW092"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66776.1"
FT   misc_feature    order(91349..91417,91514..91582,91616..91684,91712..91771,
FT                   91868..91936,91964..92032,92036..92104,92162..92230,
FT                   92267..92335,92378..92446)
FT                   /note="10 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-35, 68-90, 102-124,
FT                   134-153, 186-208, 218-240, 242-264, 284-306, 319-341 and
FT                   356-378"
FT   CDS_pept        92799..93437
FT                   /transl_table=11
FT                   /gene="purN"
FT                   /locus_tag="TW093"
FT                   /product="phosphoribosylglycinamide formyltransferase"
FT                   /EC_number=""
FT                   /note="Similar to Mycobacterium paratuberculosis PurN
FT                   SWALL:Q9RAJ6 (EMBL:AF191543) (209 aa) fasta scores: E():
FT                   1.5e-21, 42.39% id in 184 aa and to Escherichia coli
FT                   phosphoribosylglycinamide formyltransferase PurN or b2500
FT                   SWALL:PUR3_ECOLI (SWALL:P08179) (212 aa) fasta scores: E():
FT                   2.1e-17, 36.2% id in 174 aa"
FT                   /protein_id="CAD66777.1"
FT   misc_feature    92811..93348
FT                   /note="Formyl transferase Score = 147.5 E-value = 1.7e-41"
FT   CDS_pept        93477..95105
FT                   /transl_table=11
FT                   /gene="purH"
FT                   /locus_tag="TW094"
FT                   /product="bifunctional purine biosynthesis protein PurH"
FT                   /EC_number=""
FT                   /note="Similar to Mycobacterium paratuberculosis PurH
FT                   SWALL:Q9RAJ5 (EMBL:AF191543) (527 aa) fasta scores: E():
FT                   8.2e-59, 50.46% id in 543 aa, and to Escherichia coli
FT                   bifunctional purine biosynthesis protein PurH [includes:
FT                   phosphoribosylaminoimidazolecarboxamide formyltransferase
FT                   purh or b4006 SWALL:PUR9_ECOLI (SWALL:P15639) (529 aa)
FT                   fasta scores: E(): 2.6e-27, 39.48% id in 547 aa"
FT                   /protein_id="CAD66778.1"
FT   misc_feature    93504..93876
FT                   /note="MGS-like domain Score = 106.3 E-value = 4.1e-29"
FT   misc_feature    93891..94905
FT                   /note="AICARFT/IMPCHase bienzyme Score = 360.0 E-value =
FT                   1.8e-105"
FT   CDS_pept        complement(95180..95521)
FT                   /transl_table=11
FT                   /locus_tag="TW095"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66779.1"
FT                   IGFVLVLLD"
FT   misc_feature    complement(order(95189..95248,95261..95329,95348..95416,
FT                   95429..95497))
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 9-31, 36-58, 65-87 and
FT                   92-111"
FT   misc_feature    complement(95393..95521)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.620) with cleavage
FT                   site probability 0.196 between residues 43 and 44"
FT   CDS_pept        95602..96681
FT                   /transl_table=11
FT                   /locus_tag="TW096"
FT                   /product="putative integral membrane protein"
FT                   /note="Weakly similar to Streptomyces coelicolor putative
FT                   integral membrane transport protein SCO0079 or SCJ11.08c
FT                   SWALL:Q9RI96 (EMBL:AL109949) (407 aa) fasta scores: E():
FT                   2.3e-19, 26.37% id in 364 aa"
FT                   /protein_id="CAD66780.1"
FT   misc_feature    order(95659..95727,95764..95817,95827..95895,95932..96000,
FT                   96010..96078,96139..96198,96241..96309,96328..96381,
FT                   96391..96459,96493..96561,96571..96639)
FT                   /note="11 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 20-42, 55-72, 76-98, 111-133,
FT                   137-159, 180-199, 214-236, 243-260, 264-286, 298-320 and
FT                   324-346"
FT   CDS_pept        complement(96582..97733)
FT                   /transl_table=11
FT                   /gene="truB"
FT                   /locus_tag="TW097"
FT                   /product="tRNA pseudouridine synthase B"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli and Escherichia coli
FT                   O157:H7 tRNA pseudouridine synthase B TruB or p35 or b3166
FT                   or z4527 or ecs4047 SWALL:TRUB_ECOLI (SWALL:P09171) (314
FT                   aa) fasta scores: E(): 2.2e-23, 35.24% id in 227 aa"
FT                   /db_xref="GOA:Q820Z5"
FT                   /db_xref="InterPro:IPR002501"
FT                   /db_xref="InterPro:IPR014780"
FT                   /db_xref="InterPro:IPR020103"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q820Z5"
FT                   /protein_id="CAD66781.1"
FT   misc_feature    complement(97169..97631)
FT                   /note="TruB family pseudouridylate synthase (N terminal
FT                   domain) Score = 155.3 E-value = 7.4e-44"
FT   CDS_pept        97781..98905
FT                   /transl_table=11
FT                   /locus_tag="TW098"
FT                   /product="putative metalloprotease"
FT                   /note="Similar to Mycobacterium tuberculosis hypothetical
FT                   zinc metalloprotease Rv2869c or mt2937 or mtv003.15C
FT                   SWALL:YS69_MYCTU (SWALL:O33351) (404 aa) fasta scores: E():
FT                   8.7e-11, 34.51% id in 423 aa"
FT                   /protein_id="CAD66782.1"
FT   misc_feature    order(97784..97852,98099..98167,98642..98710,98807..98875)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 2-24, 107-129, 288-310 and
FT                   343-365"
FT   misc_feature    97802..98876
FT                   /note="Peptidase family M50 Score = 122.5 E-value =
FT                   5.6e-34"
FT   misc_feature    97829..97858
FT                   /note="PS00142 Neutral zinc metallopeptidases, zinc-binding
FT                   region signature."
FT   misc_feature    98096..98354
FT                   /note="PDZ domain (Also known as DHR or GLGF) Score = 11.3
FT                   E-value = 0.0056"
FT   CDS_pept        complement(98907..100013)
FT                   /transl_table=11
FT                   /gene="dxr"
FT                   /locus_tag="TW099"
FT                   /product="1-deoxy-D-xylulose 5-phosphate reductoisomerase"
FT                   /EC_number=""
FT                   /note="Similar to Pseudomonas aeruginosa 1-deoxy-D-xylulose
FT                   5-phosphate reductoisomerase Dxr or pa3650 SWALL:DXR_PSEAE
FT                   (SWALL:Q9KGU6) (396 aa) fasta scores: E(): 6.2e-42, 40.92%
FT                   id in 391 aa"
FT                   /db_xref="GOA:Q83IC8"
FT                   /db_xref="InterPro:IPR003821"
FT                   /db_xref="InterPro:IPR013512"
FT                   /db_xref="InterPro:IPR013644"
FT                   /db_xref="InterPro:IPR026877"
FT                   /db_xref="InterPro:IPR036169"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IC8"
FT                   /protein_id="CAD66783.1"
FT   misc_feature    complement(98942..100004)
FT                   /note="1-deoxy-D-xylulose 5-phosphate reductoisomerase
FT                   Score = 517.2 E-value = 8.4e-153"
FT   CDS_pept        100065..100817
FT                   /transl_table=11
FT                   /locus_tag="TW100"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein SCO3845 or SCH69.15 SWALL:Q9XA19 (EMBL:AL079308)
FT                   (515 aa) fasta scores: E(): 5.4e-22, 35.98% id in 239 aa,
FT                   and to Rhizobium loti probable phosphoprotein phosphatase
FT                   mlr2361 SWALL:Q98IK3 (EMBL:AP002999) (280 aa) fasta scores:
FT                   E(): 1.4e-20, 36.08% id in 230 aa"
FT                   /protein_id="CAD66784.1"
FT   misc_feature    100122..100782
FT                   /note="Protein phosphatase 2C Score = -16.8 E-value =
FT                   2.9e-06"
FT   CDS_pept        complement(100840..102411)
FT                   /transl_table=11
FT                   /locus_tag="TW101"
FT                   /product="conserved hypothetical protein (putative
FT                   ATP-binding)"
FT                   /note="Weakly similar to Methanosarcina acetivorans
FT                   hypothetical protein Ma1866 SWALL:Q8TPP0 (EMBL:AE010868)
FT                   (613 aa) fasta scores: E(): 0.0012, 22.1% id in 579 aa"
FT                   /protein_id="CAD66785.1"
FT                   AIELPR"
FT   misc_feature    complement(102304..102327)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        102673..102936
FT                   /transl_table=11
FT                   /locus_tag="TW103"
FT                   /product="putative membrane protein"
FT                   /note="Doubtful CDS. No significant database matches"
FT                   /protein_id="CAD66786.1"
FT   misc_feature    order(102685..102738,102766..102834)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 5-22 and 32-54"
FT   CDS_pept        102921..103964
FT                   /transl_table=11
FT                   /locus_tag="TW104"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66787.1"
FT                   IRTATWI"
FT   misc_feature    order(103011..103079,103122..103190,103251..103310,
FT                   103353..103421,103458..103526,103644..103712,
FT                   103749..103817,103860..103928)
FT                   /note="8 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 31-53, 68-90, 111-130,
FT                   145-167, 180-202, 242-264, 277-299 and 314-336"
FT   CDS_pept        103993..104355
FT                   /transl_table=11
FT                   /locus_tag="TW105"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66788.1"
FT                   LTILAVQAVRKSERYA"
FT   misc_feature    order(104095..104163,104182..104250,104260..104328)
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 22-44, 51-73 and 77-99"
FT   CDS_pept        104352..105071
FT                   /transl_table=11
FT                   /locus_tag="TW106"
FT                   /product="putative ABC transport ATP-binding subunit"
FT                   /note="Similar to Myxococcus xanthus PilH SWALL:O30385
FT                   (EMBL:AF003632) (326 aa) fasta scores: E(): 1.1e-12, 33.49%
FT                   id in 206 aa, and to Streptomyces coelicolor putative ABC
FT                   transporter ATP-binding protein SCO3633 or SCH10.11
FT                   SWALL:Q9X8Q0 (EMBL:AL049754) (311 aa) fasta scores: E():
FT                   2.3e-11, 29.61% id in 233 aa"
FT                   /protein_id="CAD66789.1"
FT                   DRVAEILGVDLHDRGAL"
FT   misc_feature    104439..104970
FT                   /note="ABC transporter Score = 87.8 E-value = 1.5e-23"
FT   misc_feature    104460..104483
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    104745..104789
FT                   /note="PS00211 ABC transporters family signature."
FT   CDS_pept        105068..105424
FT                   /transl_table=11
FT                   /locus_tag="TW107"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66790.1"
FT                   KNKKTTKSKKLPLK"
FT   misc_feature    105068..105211
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.999) with cleavage
FT                   site probability 0.305 between residues 48 and 49"
FT   misc_feature    order(105125..105193,105296..105364)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 20-42 and 77-99"
FT   repeat_region   complement(105691..107456)
FT                   /note="Non-coding degenerately repetitive sequence related
FT                   to non-coding repeats at complement(108625..110025),
FT                   complement(110760..111635), complement(113459..115135) and
FT                   coding repeats at 117585..118355"
FT   tRNA            complement(106618..106694)
FT                   /note="tRNA Pro anticodon GGG, Cove score 78.34"
FT   CDS_pept        complement(107600..108649)
FT                   /transl_table=11
FT                   /locus_tag="TW108"
FT                   /product="putative DNA recombinase"
FT                   /note="Similar to Corynebacterium glutamicum integrase
FT                   Cgl1419 SWALL:BAB98812 (EMBL:AP005278) (304 aa) fasta
FT                   scores: E(): 6.6e-16, 38.73% id in 333 aa, and to
FT                   Pseudomonas aeruginosa integrase Inti1 SWALL:Q9AIL0
FT                   (EMBL:AF263519) (337 aa) fasta scores: E(): 4.4e-12, 28.75%
FT                   id in 306 aa"
FT                   /protein_id="CAD66791.1"
FT                   YTTSHPRAL"
FT   misc_feature    complement(107635..108271)
FT                   /note="Phage integrase family Score = 163.2 E-value =
FT                   3e-46"
FT   misc_feature    complement(108337..108592)
FT                   /note="Phage integrase, N-terminal SAM-like domain Score =
FT                   23.4 E-value = 0.00024"
FT   repeat_region   complement(108625..110025)
FT                   /note="Non-coding degenerately repetitive sequence related
FT                   to non-coding repeats at complement(105691..107456),
FT                   complement(110760..111635), complement(113459..115135) and
FT                   coding repeats at 117585..118355"
FT   CDS_pept        complement(110016..110624)
FT                   /transl_table=11
FT                   /locus_tag="TW109"
FT                   /product="putative NUDIX hydrolase"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein sco1775 sco1775 or sci51.15C SWALL:Q9S225
FT                   (EMBL:AL109848) (211 aa) fasta scores: E(): 6e-27, 46.74%
FT                   id in 169 aa, and to Bacillus subtilis adp-ribose
FT                   pyrophosphatase nudF SWALL:ADPP_BACSU (SWALL:P54570) (185
FT                   aa) fasta scores: E(): 1.1e-13, 33.15% id in 184 aa"
FT                   /protein_id="CAD66792.1"
FT   misc_feature    complement(110114..110513)
FT                   /note="NUDIX domain Score = 83.9 E-value = 2.3e-22"
FT   repeat_region   complement(110760..111635)
FT                   /note="Non-coding degenerately repetitive sequence related
FT                   to non-coding repeats at complement(108625..110025),
FT                   complement(105691..107456), complement(113459..115135) and
FT                   coding repeats at 117585..118355"
FT   repeat_region   111536..111619
FT                   /note="(taaccaaaataaacagttggg)4"
FT   CDS_pept        complement(111707..113344)
FT                   /transl_table=11
FT                   /gene="pyrG"
FT                   /locus_tag="TW110"
FT                   /product="CTP synthetase"
FT                   /EC_number=""
FT                   /note="Similar to Chlamydia trachomatis CTP synthetase PyrG
FT                   or Ct183 SWALL:PYRG_CHLTR (SWALL:Q59321) (539 aa) fasta
FT                   scores: E(): 4.8e-90, 48.3% id in 532 aa, and to
FT                   Streptomyces coelicolor putative CTP synthetase PyrG or
FT                   SCO1776 or SCI51.16c SWALL:Q9S224 (EMBL:AL109848) (549 aa)
FT                   fasta scores: E(): 1.2e-104, 58.92% id in 538 aa"
FT                   /db_xref="GOA:Q83IC4"
FT                   /db_xref="InterPro:IPR004468"
FT                   /db_xref="InterPro:IPR017456"
FT                   /db_xref="InterPro:IPR017926"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR029062"
FT                   /db_xref="InterPro:IPR033828"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IC4"
FT                   /protein_id="CAD66793.1"
FT   misc_feature    complement(111719..111742)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(111766..112450)
FT                   /note="Glutamine amidotransferase class-I Score = 193.3
FT                   E-value = 2.7e-55"
FT   misc_feature    complement(112199..112234)
FT                   /note="PS00442 Glutamine amidotransferases class-I active
FT                   site."
FT   misc_feature    complement(113258..113326)
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-29"
FT   repeat_region   complement(113459..115135)
FT                   /note="Non-coding degenerately repetitive sequence related
FT                   to non-coding repeats at complement(108625..110025),
FT                   complement(110760..111635), complement(105691..107456) and
FT                   coding repeats at 117585..118355"
FT   repeat_region   115120..115176
FT                   /note="(acgtgcggccctgcatttc)3"
FT   CDS_pept        complement(115156..116793)
FT                   /transl_table=11
FT                   /gene="recN"
FT                   /locus_tag="TW111"
FT                   /product="DNA repair protein RecN"
FT                   /note="Similar to Escherichia coli DNA repair protein RecN
FT                   or RadB or b2616 SWALL:RECN_ECOLI (SWALL:P05824) (553 aa)
FT                   fasta scores: E(): 2.9e-30, 30.23% id in 559 aa"
FT                   /protein_id="CAD66794.1"
FT   CDS_pept        complement(116812..117729)
FT                   /transl_table=11
FT                   /locus_tag="TW112"
FT                   /product="putative ATP-NAD kinase"
FT                   /note="Similar to Streptomyces coelicolor probable
FT                   inorganic polyphosphate/ATP-NAD kinase PpnK or SCO1781 or
FT                   SCI51.21c SWALL:PPNK_STRCO (SWALL:Q9S219) (301 aa) fasta
FT                   scores: E(): 1.2e-29, 39.09% id in 220 aa"
FT                   /db_xref="GOA:Q83IC3"
FT                   /db_xref="InterPro:IPR002504"
FT                   /db_xref="InterPro:IPR016064"
FT                   /db_xref="InterPro:IPR017437"
FT                   /db_xref="InterPro:IPR017438"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IC3"
FT                   /protein_id="CAD66795.1"
FT   misc_feature    complement(116847..117597)
FT                   /note="ATP-NAD kinase Score = 192.6 E-value = 4.5e-55"
FT   repeat_region   117585..118355
FT                   /note="Coding degenerately repetitive sequence inversely
FT                   related to non-coding repeats at
FT                   complement(105691..107456), complement(108625..110025),
FT                   complement(110760..111635), complement(113459..115135)"
FT   CDS_pept        complement(117757..124683)
FT                   /transl_table=11
FT                   /locus_tag="TW113"
FT                   /product="WiSP family protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66796.1"
FT   repeat_region   121274..121738
FT                   /note="rep11 inverted/repeated at 874563..875027"
FT   misc_feature    complement(124573..124683)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.994) with cleavage
FT                   site probability 0.943 between residues 43 and 44"
FT   misc_feature    complement(124597..124665)
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-35"
FT   CDS_pept        complement(124733..125194)
FT                   /transl_table=11
FT                   /gene="rplI"
FT                   /locus_tag="TW114"
FT                   /product="50s ribosomal protein L9"
FT                   /note="Similar to Streptomyces coelicolor 50s ribosomal
FT                   protein L9 RplI or SCO3909 or SCH24.31 SWALL:RL9_STRCO
FT                   (SWALL:Q9X8U5) (148 aa) fasta scores: E(): 3.6e-21, 44.66%
FT                   id in 150 aa, and to Escherichia coli and Escherichia coli
FT                   O157:H7 50s ribosomal protein l9 RplI or b4203 or z5812 or
FT                   ecs5179 SWALL:RL9_ECOLI (SWALL:P02418) (149 aa) fasta
FT                   scores: E(): 1.6e-11, 39.73% id in 151 aa"
FT                   /db_xref="GOA:Q83IC2"
FT                   /db_xref="InterPro:IPR000244"
FT                   /db_xref="InterPro:IPR009027"
FT                   /db_xref="InterPro:IPR020069"
FT                   /db_xref="InterPro:IPR020070"
FT                   /db_xref="InterPro:IPR020594"
FT                   /db_xref="InterPro:IPR036791"
FT                   /db_xref="InterPro:IPR036935"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IC2"
FT                   /protein_id="CAD66797.1"
FT   misc_feature    complement(124738..125008)
FT                   /note="Ribosomal protein L9, C-terminal domain Score = 72.5
FT                   E-value = 6.2e-19"
FT   misc_feature    complement(125026..125191)
FT                   /note="Ribosomal protein L9, N-terminal domain Score = 74.5
FT                   E-value = 1.5e-19"
FT   misc_feature    complement(125072..125155)
FT                   /note="PS00651 Ribosomal protein L9 signature."
FT   CDS_pept        complement(125191..125442)
FT                   /transl_table=11
FT                   /gene="rpsR"
FT                   /locus_tag="TW115"
FT                   /product="30s ribosomal protein S18"
FT                   /note="Similar to Streptomyces coelicolor 30s ribosomal
FT                   protein S18-2 RpsR2 or SCO3425 or SCE9.32c SWALL:R18B_STRCO
FT                   (SWALL:Q9X8K4) (79 aa) fasta scores: E(): 2.5e-09, 52.77%
FT                   id in 72 aa, and to Escherichia coli, Escherichia coli
FT                   O157:H7 and Salmonella typhi 30s ribosomal protein S18 RpsR
FT                   or b4202 or z5811 or ecs5178 or sty4749 SWALL:RS18_ECOLI
FT                   (SWALL:P02374) (74 aa) fasta scores: E(): 2.1e-05, 43.39%
FT                   id in 53 aa"
FT                   /db_xref="GOA:Q83IC1"
FT                   /db_xref="InterPro:IPR001648"
FT                   /db_xref="InterPro:IPR018275"
FT                   /db_xref="InterPro:IPR036870"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IC1"
FT                   /protein_id="CAD66798.1"
FT   misc_feature    complement(125220..125379)
FT                   /note="Ribosomal protein S18 Score = 79.2 E-value =
FT                   5.8e-21"
FT   CDS_pept        complement(125457..126017)
FT                   /transl_table=11
FT                   /gene="ssb1"
FT                   /locus_tag="TW116"
FT                   /product="single-strand binding protein"
FT                   /note="Similar to Escherichia coli and Escherichia coli
FT                   O157:H7 single-strand binding protein Ssb or ExrB or LexC
FT                   or b4059 or z5658 or ecs5041 SWALL:SSB_ECOLI (SWALL:P02339)
FT                   (177 aa) fasta scores: E(): 8.8e-08, 27.95% id in 186 aa,
FT                   and to Mycobacterium smegmatis single-stranded DNA-binding
FT                   protein SWALL:Q9AFI5 (EMBL:AF349434) (165 aa) fasta scores:
FT                   E(): 6.6e-32, 68.29% id in 123 aa"
FT                   /db_xref="GOA:Q83NU2"
FT                   /db_xref="InterPro:IPR000424"
FT                   /db_xref="InterPro:IPR011344"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83NU2"
FT                   /protein_id="CAD66799.1"
FT   misc_feature    complement(125696..126014)
FT                   /note="Single-strand binding protein family Score = 117.9
FT                   E-value = 1.3e-32"
FT   CDS_pept        complement(126021..126323)
FT                   /transl_table=11
FT                   /gene="rpsF"
FT                   /locus_tag="TW117"
FT                   /product="30s ribosomal protein S6"
FT                   /note="Similar to Streptomyces coelicolor 30s ribosomal
FT                   protein S6 RpsF or SCO3906 or SCH24.28 SWALL:RS6_STRCO
FT                   (SWALL:Q9X8U2) (96 aa) fasta scores: E(): 9.4e-07, 35.86%
FT                   id in 92 aa"
FT                   /db_xref="GOA:Q83IC0"
FT                   /db_xref="InterPro:IPR000529"
FT                   /db_xref="InterPro:IPR014717"
FT                   /db_xref="InterPro:IPR020814"
FT                   /db_xref="InterPro:IPR035980"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IC0"
FT                   /protein_id="CAD66800.1"
FT   misc_feature    complement(126035..126194)
FT                   /note="Ribosomal protein S6 Score = 26.7 E-value = 7.9e-08"
FT   CDS_pept        complement(126672..127589)
FT                   /transl_table=11
FT                   /gene="purC"
FT                   /locus_tag="TW119"
FT                   /product="phosphoribosylaminoimidazole-succinocarboxamide
FT                   synthase"
FT                   /EC_number=""
FT                   /note="Similar to Streptomyces coelicolor
FT                   phosphoribosylaminoimidazole-succinocarboxamide synthase
FT                   PurC or SCO4071 or SCD25.07 SWALL:Q9RKL1 (EMBL:AL118514)
FT                   (299 aa) fasta scores: E(): 1e-38, 40.64% id in 310 aa, and
FT                   to Mycobacterium tuberculosis
FT                   phosphoribosylaminoimidazole-succinocarboxamide synthase
FT                   PurC or Rv0780 or mt0804 or mtcy369.24 SWALL:PUR7_MYCTU
FT                   (SWALL:Q59566) (297 aa) fasta scores: E(): 1.6e-28, 38.19%
FT                   id in 288 aa"
FT                   /db_xref="GOA:Q83IB9"
FT                   /db_xref="InterPro:IPR018236"
FT                   /db_xref="InterPro:IPR028923"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IB9"
FT                   /protein_id="CAD66801.1"
FT   misc_feature    complement(126728..127547)
FT                   /note="SAICAR synthetase Score = 194.1 E-value = 1.5e-55"
FT   misc_feature    complement(126939..126965)
FT                   /note="PS01058 SAICAR synthetase signature 2."
FT   CDS_pept        128106..129023
FT                   /transl_table=11
FT                   /gene="menB"
FT                   /locus_tag="TW120"
FT                   /product="naphthoate synthase"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli naphthoate synthase MenB
FT                   or b2262 SWALL:MENB_ECOLI (SWALL:P27290) (285 aa) fasta
FT                   scores: E(): 1.3e-46, 48.76% id in 283 aa, and to
FT                   Mycobacterium tuberculosis MenB or Rv0548c or mtcy25d10.27c
FT                   or mt0573 SWALL:O06414 (EMBL:Z95558) (314 aa) fasta scores:
FT                   E(): 4.5e-71, 63.39% id in 295 aa"
FT                   /protein_id="CAD66802.1"
FT   misc_feature    128244..128781
FT                   /note="Enoyl-CoA hydratase/isomerase family Score = 125.3
FT                   E-value = 7.9e-35"
FT   misc_feature    128529..128591
FT                   /note="PS00166 Enoyl-CoA hydratase/isomerase signature."
FT   CDS_pept        129025..130161
FT                   /transl_table=11
FT                   /gene="menE"
FT                   /locus_tag="TW121"
FT                   /product="O-succinylbenzoic acid--CoA ligase"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli O-succinylbenzoic
FT                   acid--CoA ligase MenE or b2260 SWALL:MENE_ECOLI
FT                   (SWALL:P37353) (451 aa) fasta scores: E(): 2.5e-10, 28.11%
FT                   id in 345 aa, and to Mycobacterium tuberculosis MenE or
FT                   Rv0542c or mtcy25d10.21c or mt0567 SWALL:O06408
FT                   (EMBL:Z95558) (362 aa) fasta scores: E(): 2.5e-29, 32.84%
FT                   id in 338 aa"
FT                   /protein_id="CAD66803.1"
FT   misc_feature    129151..129649
FT                   /note="AMP-binding enzyme Score = 30.4 E-value = 1.5e-08"
FT   misc_feature    129688..129928
FT                   /note="AMP-binding enzyme Score = 44.7 E-value = 1.7e-12"
FT   tRNA            130466..130552
FT                   /note="tRNA Ser anticodon CGA, Cove score 52.75"
FT   CDS_pept        130688..131341
FT                   /transl_table=11
FT                   /gene="ideR"
FT                   /locus_tag="TW124"
FT                   /product="iron-dependent repressor"
FT                   /note="Similar to Mycobacterium tuberculosis iron-dependent
FT                   repressor IdeR or DtxR or Rv2711 or mt2784 or mtcy05a6.32
FT                   SWALL:IDER_MYCTU (SWALL:Q50495) (230 aa) fasta scores: E():
FT                   6.4e-29, 42.98% id in 221 aa, and to Streptomyces lividans
FT                   and Streptomyces coelicolor iron repressor DesR or DmdR1 or
FT                   SCO4394 or SCD10.26 SWALL:Q54343 (EMBL:Z50049) (230 aa)
FT                   fasta scores: E(): 3.8e-32, 47.23% id in 199 aa"
FT                   /protein_id="CAD66804.1"
FT   misc_feature    130688..130850
FT                   /note="Iron dependent repressor, N-terminal DNA binding
FT                   domain Score = 32.7 E-value = 5.9e-07"
FT   misc_feature    130856..131066
FT                   /note="Iron dependent repressor, metal binding and
FT                   dimerisation domain Score = 104.2 E-value = 1.8e-28"
FT   CDS_pept        131520..131756
FT                   /transl_table=11
FT                   /gene="rpmB"
FT                   /locus_tag="TW125"
FT                   /product="50s ribosomal protein L28"
FT                   /note="Similar to Escherichia coli 50s ribosomal protein
FT                   l28 RpmB or b3637 or z5061 or ecs4512 SWALL:RL28_ECOLI
FT                   (SWALL:P02428) (77 aa) fasta scores: E(): 2.9e-10, 51.31%
FT                   id in 76 aa"
FT                   /db_xref="GOA:Q83IB6"
FT                   /db_xref="InterPro:IPR001383"
FT                   /db_xref="InterPro:IPR026569"
FT                   /db_xref="InterPro:IPR034704"
FT                   /db_xref="InterPro:IPR037147"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IB6"
FT                   /protein_id="CAD66805.1"
FT   misc_feature    131526..131706
FT                   /note="Ribosomal L28 family Score = 75.1 E-value = 1e-19"
FT   CDS_pept        131756..131926
FT                   /transl_table=11
FT                   /gene="rpmG"
FT                   /locus_tag="TW126"
FT                   /product="50s ribosomal protein L33"
FT                   /note="Similar to Escherichia coli 50s ribosomal protein
FT                   l33 RpmG or b3636 SWALL:RL33_ECOLI (SWALL:P02436) (54 aa)
FT                   fasta scores: E(): 3.6e-07, 43.13% id in 51 aa, and to
FT                   Mycobacterium tuberculosis 50s ribosomal protein l33 type 1
FT                   RpmG or Rv2057c or mt2117.1 or mtcy63a.03 SWALL:R331_MYCTU
FT                   (SWALL:O86356) (54 aa) fasta scores: E(): 3.1e-17, 78.84%
FT                   id in 52 aa"
FT                   /db_xref="GOA:Q83IB5"
FT                   /db_xref="InterPro:IPR001705"
FT                   /db_xref="InterPro:IPR011332"
FT                   /db_xref="InterPro:IPR018264"
FT                   /db_xref="InterPro:IPR038584"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IB5"
FT                   /protein_id="CAD66806.1"
FT                   IRRHTEFREER"
FT   misc_feature    131780..131921
FT                   /note="Ribosomal protein L33 Score = 42.9 E-value =
FT                   5.2e-10"
FT   CDS_pept        131927..132232
FT                   /transl_table=11
FT                   /gene="rpsN"
FT                   /locus_tag="TW127"
FT                   /product="30s ribosomal protein S14"
FT                   /note="Similar to Escherichia coli 30s ribosomal protein
FT                   S14 RpsN or b3307 or z4677 or ecs4172 SWALL:RS14_ECOLI
FT                   (SWALL:P02370) (100 aa) fasta scores: E(): 5.8e-12, 47% id
FT                   in 100 aa, and to Mycobacterium tuberculosis 30s ribosomal
FT                   protein S14-2 RpsN2 or Rv2056c or mt2117 or mtcy63a.04
FT                   SWALL:R14B_MYCTU (SWALL:O86355) (101 aa) fasta scores: E():
FT                   1.2e-21, 61.38% id in 101 aa"
FT                   /db_xref="GOA:Q83IB4"
FT                   /db_xref="InterPro:IPR001209"
FT                   /db_xref="InterPro:IPR023036"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IB4"
FT                   /protein_id="CAD66807.1"
FT   misc_feature    131927..132227
FT                   /note="Ribosomal protein S14p/S29e Score = 114.0 E-value =
FT                   2e-31"
FT   CDS_pept        132298..132579
FT                   /transl_table=11
FT                   /gene="hup"
FT                   /locus_tag="TW128"
FT                   /product="DNA-binding protein HU-alpha"
FT                   /note="Similar to Escherichia coli DNA-binding protein
FT                   HU-alpha HupA or b4000 or z5576 or ecs4923 SWALL:DBHA_ECOLI
FT                   (SWALL:P02342) (90 aa) fasta scores: E(): 7.7e-08, 37.77%
FT                   id in 90 aa, and to Streptomyces coelicolor, and
FT                   Streptomyces lividans DNA-binding protein HU 1 Hup1 or Hup
FT                   or SCO2950 or SCE59.09 SWALL:DBH1_STRCO (SWALL:O06447) (93
FT                   aa) fasta scores: E(): 5.1e-13, 50.54% id in 91 aa"
FT                   /protein_id="CAD66808.1"
FT   misc_feature    132307..132574
FT                   /note="Bacterial DNA-binding protein Score = 97.6 E-value =
FT                   1.8e-26"
FT   misc_feature    132319..132384
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1013.000, SD 2.64 at aa 8-29, sequence
FT   CDS_pept        132629..134734
FT                   /transl_table=11
FT                   /locus_tag="TW129"
FT                   /product="putative integral membrane protein"
FT                   /note="Similar to Mycobacterium tuberculosis hypothetical
FT                   protein Rv0102 or mt0111 or mtcy251.21 SWALL:Y102_MYCTU
FT                   (SWALL:Q10897) (661 aa) fasta scores: E(): 8.5e-38, 31.79%
FT                   id in 478 aa, and to Streptomyces coelicolor putative
FT                   integral membrane protein SCO1215 or 2SCG58.15 SWALL:Q9FC98
FT                   (EMBL:AL391017) (316 aa) fasta scores: E(): 3.3e-37, 40.13%
FT                   id in 304 aa"
FT                   /protein_id="CAD66809.1"
FT                   YLARLQG"
FT   misc_feature    132629..132730
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.974) with cleavage
FT                   site probability 0.443 between residues 34 and 35"
FT   misc_feature    order(132647..132715,132758..132826,132863..132931,
FT                   132974..133042,133061..133114,133340..133408,
FT                   133487..133555,133598..133657,133676..133744,
FT                   133847..133915,133973..134041,134069..134137,
FT                   134198..134266,134309..134377,134414..134482,
FT                   134561..134629)
FT                   /note="16 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-29, 44-66, 79-101, 116-138,
FT                   145-162, 238-260, 287-309, 324-343, 350-372, 407-429,
FT                   449-471, 481-503, 524-546, 561-583, 596-618 and 645-667"
FT   CDS_pept        134760..136832
FT                   /transl_table=11
FT                   /locus_tag="TW130"
FT                   /product="putative helicase regulator"
FT                   /note="Similar to Anabaena sp. hypothetical protein Alr4398
FT                   SWALL:Q8YP09 (EMBL:AP003596) (1075 aa) fasta scores: E():
FT                   9.6e-17, 26.54% id in 584 aa, and to Drosophila
FT                   melanogaster IswI protein or cg8625 SWALL:ISWI_DROME
FT                   (SWALL:Q24368) (1027 aa) fasta scores: E(): 2.3e-15, 26.16%
FT                   id in 474 aa"
FT                   /protein_id="CAD66810.1"
FT   misc_feature    135399..136293
FT                   /note="SNF2 family N-terminal domain Score = -26.6 E-value
FT                   = 2.3e-08"
FT   misc_feature    136401..136620
FT                   /note="Helicase conserved C-terminal domain Score = 52.2
FT                   E-value = 8.2e-13"
FT   CDS_pept        136972..138165
FT                   /transl_table=11
FT                   /gene="tufA"
FT                   /locus_tag="TW131"
FT                   /product="elongation factor TU-1"
FT                   /note="Similar to Escherichia coli elongation factor TU
FT                   (TufA or b3339) and (TufB or b3980) SWALL:EFTU_ECOLI
FT                   (SWALL:P02990) (393 aa) fasta scores: E(): 1.1e-103, 70.38%
FT                   id in 395 aa, and to Micrococcus luteus elongation factor
FT                   TU Tuf or TufA SWALL:EFTU_MICLU (SWALL:P09953) (396 aa)
FT                   fasta scores: E(): 6.3e-119, 82.02% id in 395 aa"
FT                   /db_xref="GOA:Q83NT9"
FT                   /db_xref="InterPro:IPR000795"
FT                   /db_xref="InterPro:IPR004160"
FT                   /db_xref="InterPro:IPR004161"
FT                   /db_xref="InterPro:IPR004541"
FT                   /db_xref="InterPro:IPR005225"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR009001"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR031157"
FT                   /db_xref="InterPro:IPR033720"
FT                   /db_xref="InterPro:IPR041709"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83NT9"
FT                   /protein_id="CAD66811.1"
FT   misc_feature    136999..137590
FT                   /note="Elongation factor Tu GTP binding domain Score =
FT                   317.3 E-value = 1.2e-92"
FT   misc_feature    137026..137049
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    137131..137178
FT                   /note="PS00301 GTP-binding elongation factors signature."
FT   misc_feature    137626..137860
FT                   /note="Elongation factor Tu domain 2 Score = 105.9 E-value
FT                   = 5.4e-29"
FT   misc_feature    137872..138157
FT                   /note="Elongation factor Tu C-terminal domain Score = 190.4
FT                   E-value = 2e-54"
FT   CDS_pept        complement(138453..140111)
FT                   /transl_table=11
FT                   /locus_tag="TW132"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66812.1"
FT   misc_feature    complement(order(138507..138575,138777..138845,
FT                   138855..138914,138933..138992,139257..139325,
FT                   139386..139454,139593..139652,139665..139724,
FT                   139737..139805,140043..140102))
FT                   /note="10 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 4-23, 103-125, 130-149,
FT                   154-173, 220-242, 263-285, 374-393, 400-419, 423-445 and
FT                   513-535"
FT   misc_feature    complement(139244..140093)
FT                   /note="Dolichyl-phosphate-mannose-protein
FT                   mannosyltransferase Score = 3.2 E-value = 0.00012"
FT   CDS_pept        140623..141990
FT                   /transl_table=11
FT                   /gene="manA"
FT                   /locus_tag="TW133"
FT                   /product="mannose-6-phosphate isomerase"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli mannose-6-phosphate
FT                   isomerase ManA or Pmi or b1613 SWALL:MANA_ECOLI
FT                   (SWALL:P00946) (391 aa) fasta scores: E(): 2.9e-15, 30.23%
FT                   id in 387 aa, and to Streptomyces coelicolor
FT                   mannose-6-phosphate isomerase ManA or SCO3025 or SCE34.06c
FT                   SWALL:Q9KZL9 (EMBL:AL353862) (383 aa) fasta scores: E():
FT                   1.5e-22, 34.36% id in 323 aa"
FT                   /protein_id="CAD66813.1"
FT   misc_feature    140638..141607
FT                   /note="Phosphomannose isomerase type I Score = 64.2 E-value
FT                   = 2e-16"
FT   CDS_pept        142042..142350
FT                   /transl_table=11
FT                   /locus_tag="TW134"
FT                   /product="WhiB-like regulatory protein"
FT                   /note="Similar to Streptomyces griseocarneus WhiB-STV
FT                   protein SWALL:Q06387 (EMBL:X68708) (87 aa) fasta scores:
FT                   E(): 1.6e-20, 80% id in 70 aa, and to Streptomyces
FT                   coelicolor regulatory protein WhiB or SCO3034 or SCE34.15C
FT                   SWALL:Q53963 (EMBL:X62287) (87 aa) fasta scores: E():
FT                   1.6e-20, 80% id in 70 aa"
FT                   /protein_id="CAD66814.1"
FT   misc_feature    142126..142315
FT                   /note="Transcription factor WhiB Score = 125.1 E-value =
FT                   8.9e-35"
FT   CDS_pept        142512..144908
FT                   /transl_table=11
FT                   /locus_tag="TW135"
FT                   /product="putative integral membrane protein"
FT                   /note="Similar to Streptomyces aureofaciens transmembrane
FT                   protein WhiB2 SWALL:Q53785 (EMBL:L22864) (1219 aa) fasta
FT                   scores: E(): 1.5e-06, 21.76% id in 896 aa, and to
FT                   Streptomyces coelicolor putative integral membrane protein
FT                   SCO3033 or SCE34.14c SWALL:Q9KZL1 (EMBL:AL353862) (1268 aa)
FT                   fasta scores: E(): 2e-06, 24.06% id in 939 aa"
FT                   /protein_id="CAD66815.1"
FT   misc_feature    order(143049..143117,143304..143372,143457..143525,
FT                   143544..143603,143631..143690,143709..143762,
FT                   143805..143873,143892..143951,144027..144095,
FT                   144108..144176,144189..144245,144264..144332,
FT                   144759..144827)
FT                   /note="13 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 235-257, 320-342, 371-393,
FT                   400-419, 429-448, 455-472, 487-509, 516-535, 561-583,
FT                   588-610, 615-633, 640-662 and 805-827"
FT   CDS_pept        144961..146340
FT                   /transl_table=11
FT                   /locus_tag="TW136"
FT                   /product="putative secreted protein"
FT                   /note="Similar to Streptomyces coelicolor putative secreted
FT                   protein SCO3032 or SCE34.13c SWALL:Q9KZL2 (EMBL:AL353862)
FT                   (506 aa) fasta scores: E(): 0.01, 24.83% id in 294 aa"
FT                   /protein_id="CAD66816.1"
FT                   Q"
FT   misc_feature    144961..145062
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.998) with cleavage
FT                   site probability 0.606 between residues 34 and 35"
FT   misc_feature    144979..145047
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-29"
FT   CDS_pept        146782..148212
FT                   /transl_table=11
FT                   /gene="manB"
FT                   /locus_tag="TW137"
FT                   /product="phosphomannomutase"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli phosphomannomutase ManB
FT                   or RfbK or RfbK2 SWALL:RFK9_ECOLI (SWALL:P37755) (456 aa)
FT                   fasta scores: E(): 4.3e-48, 34.44% id in 450 aa, and to
FT                   Streptomyces coelicolor phosphomannomutase ManB or SCO3028
FT                   or SCE34.09c SWALL:Q9KZL6 (EMBL:AL353862) (454 aa) fasta
FT                   scores: E(): 6.8e-88, 51.96% id in 458 aa"
FT                   /protein_id="CAD66817.1"
FT                   EDLMRLVRDKAVKIITGG"
FT   misc_feature    146827..147244
FT                   /note="Phosphoglucomutase/phosphomannomutase,
FT                   alpha/beta/alpha domain I Score = 132.2 E-value = 6.9e-37"
FT   misc_feature    147292..147592
FT                   /note="Phosphoglucomutase/phosphomannomutase,
FT                   alpha/beta/alpha domain II Score = 101.0 E-value = 1.7e-27"
FT   misc_feature    147598..147940
FT                   /note="Phosphoglucomutase/phosphomannomutase,
FT                   alpha/beta/alpha domain III Score = 67.0 E-value = 2.8e-17"
FT   misc_feature    147985..148207
FT                   /note="Phosphoglucomutase/phosphomannomutase, C-terminal
FT                   domain Score = 15.5 E-value = 0.0008"
FT   CDS_pept        148563..149258
FT                   /transl_table=11
FT                   /locus_tag="TW138"
FT                   /product="conserved hypothetical protein (possible
FT                   ATP-binding)"
FT                   /note="Similar to Corynebacterium glutamicum predicted
FT                   amidophosphoribosyltransferases Cgl0757 SWALL:BAB98150
FT                   (EMBL:AP005276) (196 aa) fasta scores: E(): 4.4e-06, 23.98%
FT                   id in 196 aa, and to Deinococcus radiodurans competence
FT                   protein ComF, putative dr1389 SWALL:Q9RUJ7 (EMBL:AE001984)
FT                   (219 aa) fasta scores: E(): 2.2e-05, 27.17% id in 195 aa"
FT                   /protein_id="CAD66818.1"
FT                   FIPTFSITR"
FT   misc_feature    149100..149123
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        149502..152045
FT                   /transl_table=11
FT                   /gene="secA"
FT                   /locus_tag="TW139"
FT                   /product="preprotein translocase SecA subunit"
FT                   /note="Similar to Streptomyces griseus preprotein
FT                   translocase SecA subunit secA SWALL:SECA_STRGR
FT                   (SWALL:P95759) (940 aa) fasta scores: E(): 5.6e-138, 60.32%
FT                   id in 862 aa"
FT                   /db_xref="GOA:Q83NT4"
FT                   /db_xref="InterPro:IPR000185"
FT                   /db_xref="InterPro:IPR011115"
FT                   /db_xref="InterPro:IPR011116"
FT                   /db_xref="InterPro:IPR011130"
FT                   /db_xref="InterPro:IPR014018"
FT                   /db_xref="InterPro:IPR020937"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR036266"
FT                   /db_xref="InterPro:IPR036670"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83NT4"
FT                   /protein_id="CAD66819.1"
FT   misc_feature    149517..150762
FT                   /note="SecA protein, amino terminal region Score = 855.6
FT                   E-value = 1.1e-254"
FT   misc_feature    150948..150995
FT                   /note="PS01312 Protein secA signatures."
FT   CDS_pept        152632..152805
FT                   /transl_table=11
FT                   /locus_tag="TW140"
FT                   /product="hypothetical protein"
FT                   /note="Doubtful CDS. No significant database matches"
FT                   /protein_id="CAD66820.1"
FT                   FPICNLIAIELL"
FT   CDS_pept        152950..153696
FT                   /transl_table=11
FT                   /locus_tag="TW141"
FT                   /product="putative membrane/secreted protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66821.1"
FT   misc_feature    152950..153063
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.996) with cleavage
FT                   site probability 0.480 between residues 38 and 39"
FT   misc_feature    152986..153042
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-31"
FT   CDS_pept        153705..154487
FT                   /transl_table=11
FT                   /locus_tag="TW142"
FT                   /product="putative regulator"
FT                   /note="Similar to Bacillus subtilis sporulation initiation
FT                   inhibitor protein SoJ SWALL:SOJ_BACSU (SWALL:P37522) (253
FT                   aa) fasta scores: E(): 0.00051, 30.88% id in 136 aa"
FT                   /protein_id="CAD66822.1"
FT   misc_feature    154395..154418
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        join(154524..154733,154735..155181)
FT                   /transl_table=11
FT                   /locus_tag="TW143"
FT                   /product="hypothetical phase-variable integral membrane
FT                   protein"
FT                   /note="No significant database matches. Frameshift at
FT                   potentially variable G(11) tract after aa 70"
FT                   /protein_id="CAD66823.1"
FT   misc_feature    order(154611..154679,155098..155166)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 30-52 and aa 131-153"
FT   repeat_region   154731..154741
FT                   /note="(g)11"
FT   misc_feature    155098..155166
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 131-153"
FT   CDS_pept        155275..158181
FT                   /transl_table=11
FT                   /gene="gcvP"
FT                   /locus_tag="TW144"
FT                   /product="glycine dehydrogenase [decarboxylating]"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli glycine dehydrogenase
FT                   [decarboxylating] GcvP or b2903 SWALL:GCSP_ECOLI
FT                   (SWALL:P33195) (956 aa) fasta scores: E(): 4.4e-106, 48.71%
FT                   id in 973 aa, and to Mycobacterium tuberculosis probable
FT                   glycine dehydrogenase [decarboxylating] GcvP or GcvB or
FT                   Rv1832 or mt1880 or mtcy1a11.11C SWALL:GCSP_MYCTU
FT                   (SWALL:Q50601) (941 aa) fasta scores: E(): 2e-114, 51.27%
FT                   id in 981 aa"
FT                   /db_xref="GOA:Q83IA7"
FT                   /db_xref="InterPro:IPR000192"
FT                   /db_xref="InterPro:IPR003437"
FT                   /db_xref="InterPro:IPR015421"
FT                   /db_xref="InterPro:IPR015422"
FT                   /db_xref="InterPro:IPR015424"
FT                   /db_xref="InterPro:IPR020581"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IA7"
FT                   /protein_id="CAD66824.1"
FT   misc_feature    155281..156550
FT                   /note="Glycine cleavage system P-protein Score = 572.6
FT                   E-value = 1.8e-169"
FT   CDS_pept        158391..159971
FT                   /transl_table=11
FT                   /locus_tag="TW145"
FT                   /product="putative ABC transporter substrate-binding
FT                   protein"
FT                   /note="Similar to Streptomyces coelicolor putative peptide
FT                   transport system secreted peptide-binding protein SCO5117
FT                   or SC9E12.02 SWALL:Q9F353 (EMBL:AL391751) (544 aa) fasta
FT                   scores: E(): 1.2e-51, 33.57% id in 551 aa"
FT                   /protein_id="CAD66825.1"
FT                   PVYYLITKG"
FT   misc_feature    158391..158489
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.577 between residues 33 and 34"
FT   misc_feature    158409..159963
FT                   /note="Bacterial extracellular solute-binding proteins,
FT                   family 5 Score = 96.8 E-value = 3e-26"
FT   misc_feature    158427..158459
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        159968..161569
FT                   /transl_table=11
FT                   /locus_tag="TW146"
FT                   /product="putative ABC transporter substrate-binding
FT                   protein"
FT                   /note="Similar to Streptomyces coelicolor putative peptide
FT                   transport system secreted peptide-binding protein SCO5117
FT                   or SC9E12.02 SWALL:Q9F353 (EMBL:AL391751) (544 aa) fasta
FT                   scores: E(): 3.3e-48, 33.39% id in 512 aa"
FT                   /protein_id="CAD66826.1"
FT                   KLNKRGIVDTSDMIRE"
FT   misc_feature    159968..160066
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.787 between residues 33 and 34"
FT   misc_feature    159986..160054
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-29"
FT   misc_feature    160004..161561
FT                   /note="Bacterial extracellular solute-binding proteins,
FT                   family 5 Score = 94.3 E-value = 1.7e-25"
FT   misc_feature    160007..160039
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(161570..162175)
FT                   /transl_table=11
FT                   /locus_tag="TW147"
FT                   /product="putative ABC transporter integral membrane
FT                   subunit"
FT                   /note="Similar to Rhizobium meliloti hypothetical
FT                   transmembrane protein smc00963 r00889 or smc00963
FT                   SWALL:Q92RI2 (EMBL:AL591785) (201 aa) fasta scores: E():
FT                   2.3e-12, 34.23% id in 184 aa"
FT                   /protein_id="CAD66827.1"
FT   misc_feature    complement(order(161777..161836,161897..161965,
FT                   161993..162061))
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 39-61, 71-93 and 114-133"
FT   CDS_pept        complement(162302..162985)
FT                   /transl_table=11
FT                   /locus_tag="TW148"
FT                   /product="putative ABC transporter ATP-binding subunit"
FT                   /note="Similar to Deinococcus radiodurans ABC transporter,
FT                   ATP-binding protein dr2469 SWALL:Q9RRL9 (EMBL:AE002076)
FT                   (226 aa) fasta scores: E(): 3.2e-27, 42.98% id in 221 aa"
FT                   /protein_id="CAD66828.1"
FT                   LCKSA"
FT   misc_feature    complement(162373..162904)
FT                   /note="ABC transporter Score = 169.5 E-value = 3.9e-48"
FT   misc_feature    complement(162542..162586)
FT                   /note="PS00211 ABC transporters family signature."
FT   misc_feature    complement(162860..162883)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        163138..164073
FT                   /transl_table=11
FT                   /locus_tag="TW149"
FT                   /product="putative ABC transporter integral membrane
FT                   subunit"
FT                   /note="Similar to Streptomyces coelicolor putative peptide
FT                   transport system integral membrane protein SCO5118 or
FT                   SC9E12.03 SWALL:Q9F352 (EMBL:AL391751) (307 aa) fasta
FT                   scores: E(): 6.3e-45, 42.15% id in 306 aa, and to Bacillus
FT                   subtilis oligopeptide transport system permease protein
FT                   OppB SWALL:OPPB_BACSU (SWALL:P24138) (311 aa) fasta scores:
FT                   E(): 2.4e-28, 34.07% id in 314 aa"
FT                   /protein_id="CAD66829.1"
FT   misc_feature    163138..163251
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.824) with cleavage
FT                   site probability 0.215 between residues 38 and 39"
FT   misc_feature    order(163165..163233,163324..163392,163435..163503,
FT                   163540..163608,163651..163719,163822..163890,
FT                   163972..164040)
FT                   /note="7 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 10-32, 63-85, 100-122,
FT                   135-157, 172-194, 229-251 and 279-301"
FT   misc_feature    163729..163942
FT                   /note="Binding-protein-dependent transport systems inner
FT                   membrane component Score = 40.2 E-value = 3.3e-09"
FT   CDS_pept        164075..165040
FT                   /transl_table=11
FT                   /locus_tag="TW150"
FT                   /product="putative ABC transporter system integral membrane
FT                   subunit"
FT                   /note="Similar to Corynebacterium glutamicum ABC-type
FT                   transporter, permease components cgl1992 SWALL:BAB99385
FT                   (EMBL:AP005280) (333 aa) fasta scores: E(): 2.3e-50, 45.77%
FT                   id in 308 aa, and to Bacillus subtilis oligopeptide
FT                   transport system permease protein OppC or Spo0KC
FT                   SWALL:OPPC_BACSU (SWALL:P24139) (305 aa) fasta scores: E():
FT                   6.1e-29, 31.77% id in 299 aa"
FT                   /protein_id="CAD66830.1"
FT   misc_feature    order(164228..164296,164435..164503,164522..164590,
FT                   164603..164671,164762..164830,164933..165001)
FT                   /note="6 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 52-74, 121-143, 150-172,
FT                   177-199, 230-252 and 287-309"
FT   misc_feature    164681..164909
FT                   /note="Binding-protein-dependent transport systems inner
FT                   membrane component Score = 20.6 E-value = 0.00061"
FT   CDS_pept        165037..166665
FT                   /transl_table=11
FT                   /locus_tag="TW151"
FT                   /product="putative ABC transporter ATP-binding subunit"
FT                   /note="Similar to Mycobacterium tuberculosis putative
FT                   peptide ABC transporter ATP-binding protein Rv3663c or
FT                   mtv025.011c or mt3764 SWALL:O69631 (EMBL:AL022121) (548 aa)
FT                   fasta scores: E(): 2e-88, 52.67% id in 543 aa"
FT                   /protein_id="CAD66831.1"
FT   misc_feature    165148..165742
FT                   /note="ABC transporter Score = 178.0 E-value = 1.1e-50"
FT   misc_feature    165169..165192
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    165514..165558
FT                   /note="PS00211 ABC transporters family signature."
FT   misc_feature    165985..166555
FT                   /note="ABC transporter Score = 191.4 E-value = 1e-54"
FT   misc_feature    166006..166029
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    166327..166371
FT                   /note="PS00211 ABC transporters family signature."
FT   repeat_region   166803..171844
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   CDS_pept        complement(171897..172667)
FT                   /transl_table=11
FT                   /locus_tag="TW152"
FT                   /product="putative membrane protein"
FT                   /note="Doubtful CDS. No significant database matches"
FT                   /protein_id="CAD66832.1"
FT   misc_feature    complement(order(171903..171971,172485..172553,
FT                   172563..172631))
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 13-35, 39-61 and 233-255"
FT   misc_feature    complement(172560..172667)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.707 between residues 36 and 37"
FT   repeat_region   172696..178092
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   repeat_region   173678..173741
FT                   /note="(ggcgagaaatatgtat)4"
FT   CDS_pept        178288..178713
FT                   /transl_table=11
FT                   /gene="rplM"
FT                   /locus_tag="TW153"
FT                   /product="50S ribosomal protein L13"
FT                   /note="Similar to Escherichia coli 50s ribosomal protein
FT                   L13 RplM or b3231 or z4589 or ecs4104 or stm3345 or sty3525
FT                   SWALL:RL13_ECOLI (SWALL:P02410) (142 aa) fasta scores: E():
FT                   3.8e-25, 54.33% id in 127 aa, and to Streptomyces
FT                   coelicolor 50s ribosomal protein L13 RplM or SCO4734 or
FT                   SC6G4.12 SWALL:RL13_STRCO (SWALL:Q53874) (147 aa) fasta
FT                   scores: E(): 3e-29, 52.94% id in 136 aa. N-terminus
FT                   truncated relative to homologues."
FT                   /protein_id="CAD66833.1"
FT   misc_feature    178303..178684
FT                   /note="Ribosomal protein L13 Score = 225.7 E-value =
FT                   4.9e-65"
FT   misc_feature    178573..178641
FT                   /note="PS00783 Ribosomal protein L13 signature."
FT   CDS_pept        178713..179177
FT                   /transl_table=11
FT                   /gene="rpsI"
FT                   /locus_tag="TW154"
FT                   /product="30s ribosomal protein S9"
FT                   /note="Similar to Escherichia coli 30s ribosomal protein S9
FT                   RpsI or b3230 or z4588 or ecs4103 SWALL:RS9_ECOLI
FT                   (SWALL:P02363) (129 aa) fasta scores: E(): 2.6e-20, 51.61%
FT                   id in 124 aa, and to Streptomyces coelicolor 30s ribosomal
FT                   protein S9 RpsI or SCO4735 or SC6G4.13 SWALL:RS9_STRCO
FT                   (SWALL:Q53875) (170 aa) fasta scores: E(): 2.4e-25, 61.6%
FT                   id in 125 aa"
FT                   /db_xref="GOA:Q83IA3"
FT                   /db_xref="InterPro:IPR000754"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR020574"
FT                   /db_xref="InterPro:IPR023035"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IA3"
FT                   /protein_id="CAD66834.1"
FT   misc_feature    178809..179172
FT                   /note="Ribosomal protein S9/S16 Score = 192.8 E-value =
FT                   3.7e-55"
FT   misc_feature    178986..179042
FT                   /note="PS00360 Ribosomal protein S9 signature."
FT   CDS_pept        179181..180542
FT                   /transl_table=11
FT                   /locus_tag="TW155"
FT                   /product="putative phospho-sugar mutase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   phospho-sugar mutase SCO4736 or sc6g4.14 SWALL:Q53876
FT                   (EMBL:AL031317) (452 aa) fasta scores: E(): 3.6e-76, 50% id
FT                   in 458 aa"
FT                   /db_xref="GOA:Q83NS5"
FT                   /db_xref="InterPro:IPR005841"
FT                   /db_xref="InterPro:IPR005843"
FT                   /db_xref="InterPro:IPR005844"
FT                   /db_xref="InterPro:IPR005845"
FT                   /db_xref="InterPro:IPR005846"
FT                   /db_xref="InterPro:IPR006352"
FT                   /db_xref="InterPro:IPR016055"
FT                   /db_xref="InterPro:IPR016066"
FT                   /db_xref="InterPro:IPR036900"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83NS5"
FT                   /protein_id="CAD66835.1"
FT   misc_feature    179181..179634
FT                   /note="Phosphoglucomutase/phosphomannomutase,
FT                   alpha/beta/alpha domain I Score = 155.2 E-value = 7.9e-44"
FT   misc_feature    179670..179964
FT                   /note="Phosphoglucomutase/phosphomannomutase,
FT                   alpha/beta/alpha domain II Score = 80.7 E-value = 2.2e-21"
FT   misc_feature    179970..180306
FT                   /note="Phosphoglucomutase/phosphomannomutase,
FT                   alpha/beta/alpha domain III Score = 86.9 E-value = 3e-23"
FT   misc_feature    180330..180522
FT                   /note="Phosphoglucomutase/phosphomannomutase, C-terminal
FT                   domain Score = 17.6 E-value = 0.00048"
FT   CDS_pept        complement(180517..181272)
FT                   /transl_table=11
FT                   /gene="coaA"
FT                   /locus_tag="TW156"
FT                   /product="pantothenate kinase"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli pantothenate kinase CoaA
FT                   or Rts or PanK or b3974 or z5545 or ecs4901
FT                   SWALL:COAA_ECOLI (SWALL:P15044) (316 aa) fasta scores: E():
FT                   4.5e-12, 39.66% id in 242 aa"
FT                   /protein_id="CAD66836.1"
FT   misc_feature    complement(181129..181152)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    181825..181959
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.891 between residues 45 and 46"
FT   CDS_pept        181855..183954
FT                   /transl_table=11
FT                   /locus_tag="TW157"
FT                   /product="WiSP family protein"
FT                   /note="No significant database matches. Has possible
FT                   N-terminal secretion signal sequence and 3 possible
FT                   membrane spanning regions in the C-terminal portion.
FT                   Similar to CDS TW161 - TW157 residues 8-275 identical to
FT                   TW161 residues 7-274, though not similar at sequence level
FT                   TW161 C-terminal portion also contains 3 possible membrane
FT                   spanning regions. Region following identity with TW161 is
FT                   an array of small repeats."
FT                   /protein_id="CAD66837.1"
FT                   LTLWF"
FT   repeat_region   181874..182680
FT                   /note="Repeated directly at 193785..194591. Codes for the
FT                   sub-N-terminus of a possible surface protein"
FT   misc_feature    order(181885..181953,183334..183402,183508..183576,
FT                   183727..183795)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 21-43, 504-526, 562-584 and
FT                   635-657"
FT   repeat_region   182423..183559
FT                   /note="Coding degenerate repeat region in Repeat Cluster 1
FT                   (RC1). Related to local non-coding repeat regions."
FT   variation       182819
FT                   /note="polymorphic base C or A"
FT   variation       182821
FT                   /note="polymorphic base: A or G"
FT   variation       182823
FT                   /note="polymorphic base: T or C"
FT   CDS_pept        184178..186028
FT                   /transl_table=11
FT                   /gene="glmS"
FT                   /locus_tag="TW158"
FT                   /product="glucosamine--fructose-6-phosphate
FT                   aminotransferase [isomerizing]"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli
FT                   glucosamine--fructose-6-phosphate aminotransferase
FT                   [isomerizing] GlmS or b3729 SWALL:GLMS_ECOLI (SWALL:P17169)
FT                   (608 aa) fasta scores: E(): 9.8e-90, 42.23% id in 618 aa,
FT                   and to Streptomyces coelicolor
FT                   glucosamine--fructose-6-phosphate aminotransferase
FT                   [isomerizing] GlmS or SCO4740 or SC6G4.18 SWALL:GLMS_STRCO
FT                   (SWALL:O86781) (614 aa) fasta scores: E(): 1.5e-125, 53.73%
FT                   id in 616 aa"
FT                   /db_xref="GOA:Q83IA1"
FT                   /db_xref="InterPro:IPR001347"
FT                   /db_xref="InterPro:IPR005855"
FT                   /db_xref="InterPro:IPR017932"
FT                   /db_xref="InterPro:IPR029055"
FT                   /db_xref="InterPro:IPR035466"
FT                   /db_xref="InterPro:IPR035490"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IA1"
FT                   /protein_id="CAD66838.1"
FT   misc_feature    184178..184195
FT                   /note="PS00443 Glutamine amidotransferases class-II active
FT                   site."
FT   misc_feature    184181..184733
FT                   /note="Glutamine amidotransferases class-II Score = 221.0
FT                   E-value = 1.2e-63"
FT   misc_feature    185045..185447
FT                   /note="SIS domain Score = 136.8 E-value = 2.7e-38"
FT   misc_feature    185054..185083
FT                   /note="PS00339 Aminoacyl-transfer RNA synthetases class-II
FT                   signature 2."
FT   misc_feature    185561..185981
FT                   /note="SIS domain Score = 119.4 E-value = 4.6e-33"
FT   repeat_region   185973..187677
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   tRNA            complement(187804..187874)
FT                   /note="tRNA Gln anticodon TTG, Cove score 59.16"
FT   CDS_pept        complement(187878..189107)
FT                   /transl_table=11
FT                   /gene="ispE"
FT                   /locus_tag="TW159"
FT                   /product="4-diphosphocytidyl-2-c-methyl-D-erythritol
FT                   kinase"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli
FT                   4-diphosphocytidyl-2-c-methyl-D-erythritol kinase IspE or
FT                   Ipk or b1208 or z1979 or ecs1713 SWALL:ISPE_ECOLI
FT                   (SWALL:P24209) (283 aa) fasta scores: E(): 7.7e-07, 28.95%
FT                   id in 221 aa, and to Streptomyces coelicolor
FT                   4-diphosphocytidyl-2-c-methyl-D-erythritol kinase IspE or
FT                   SCO3148 or SCE66.27c SWALL:ISPE_STRCO (SWALL:Q9K3R6) (299
FT                   aa) fasta scores: E(): 5.9e-21, 39.07% id in 238 aa. Note
FT                   possible alternative translational start sites."
FT                   /db_xref="GOA:Q83IA0"
FT                   /db_xref="InterPro:IPR004424"
FT                   /db_xref="InterPro:IPR006204"
FT                   /db_xref="InterPro:IPR013750"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="InterPro:IPR036554"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83IA0"
FT                   /protein_id="CAD66839.1"
FT                   PAYSSIYWQT"
FT   misc_feature    complement(187898..189266)
FT                   /note="GHMP kinases putative ATP-binding protein Score =
FT                   49.3 E-value = 6e-12"
FT   repeat_region   189310..191014
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   CDS_pept        191188..192282
FT                   /transl_table=11
FT                   /locus_tag="TW160"
FT                   /product="putative membrane protein"
FT                   /note="Similar to Corynebacterium glutamicum
FT                   uncharacterized membrane proteins cgl2282 SWALL:BAB99675
FT                   (EMBL:AP005281) (264 aa) fasta scores: E(): 2.1e-24, 43.16%
FT                   id in 278 aa"
FT                   /protein_id="CAD66840.1"
FT   misc_feature    order(191584..191652,191665..191733,192031..192099,
FT                   192112..192180,192217..192276)
FT                   /note="5 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 133-155, 160-182, 282-304,
FT                   309-331 and 344-363"
FT   repeat_region   192292..192718
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   tRNA            complement(193050..193125)
FT                   /note="tRNA Phe anticodon GAA, Cove score 74.74"
FT   tRNA            complement(193131..193204)
FT                   /note="tRNA Asp anticodon GTC, Cove score 87.26"
FT   tRNA            complement(193214..193289)
FT                   /note="tRNA Glu anticodon TTC, Cove score 54.89"
FT   repeat_region   193286..193640
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   misc_feature    193745..193870
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.999) with cleavage
FT                   site probability 0.819 between residues 42 and 43"
FT   CDS_pept        193769..196159
FT                   /transl_table=11
FT                   /locus_tag="TW161"
FT                   /product="WiSP family protein"
FT                   /note="No significant database matches. Has possible
FT                   N-terminal secretion signal sequence and 3 possible
FT                   membrane spanning regions in the C-terminal portion.
FT                   Similar to CDS TW157 - TW161 residues 7-274 identical to
FT                   TW157 residues 8-275, though not similar at sequence level
FT                   TW157 C-terminal portion also contains 3 possible membrane
FT                   spanning regions."
FT                   /protein_id="CAD66841.1"
FT   repeat_region   193785..194591
FT                   /note="Repeated directly at 181874..182680. Codes for the
FT                   sub-N-terminus of a possible surface protein"
FT   misc_feature    order(195506..195574,195629..195697,195791..195859)
FT                   /note="3 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 588-610, 629-651 and 683-705"
FT   repeat_region   196197..197688
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   CDS_pept        complement(197697..199415)
FT                   /transl_table=11
FT                   /locus_tag="TW162"
FT                   /product="putative ABC transporter (ATP-binding and
FT                   integral membrane)"
FT                   /note="Similar to Escherichia coli transport ATP-binding
FT                   protein CydC or MdrA or MdrH or SurB or b0886
FT                   SWALL:CYDC_ECOLI (SWALL:P23886) (573 aa) fasta scores: E():
FT                   4.8e-32, 27.92% id in 573 aa"
FT                   /protein_id="CAD66842.1"
FT   misc_feature    complement(197783..198332)
FT                   /note="ABC transporter Score = 201.4 E-value = 9.6e-58"
FT   misc_feature    complement(197958..198002)
FT                   /note="PS00211 ABC transporters family signature."
FT   misc_feature    complement(198288..198311)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(order(198537..198602,198630..198698,
FT                   198879..198938,198951..199019,199176..199244,
FT                   199287..199355))
FT                   /note="6 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 21-43, 58-80, 133-155,
FT                   160-179, 240-262 and 272-293"
FT   misc_feature    complement(198551..199361)
FT                   /note="ABC transporter transmembrane region Score = -19.6
FT                   E-value = 0.0025"
FT   misc_feature    complement(199269..199415)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.981) with cleavage
FT                   site probability 0.595 between residues 49 and 50"
FT   CDS_pept        complement(199447..201318)
FT                   /transl_table=11
FT                   /locus_tag="TW163"
FT                   /product="putative ABC transporter (ATP-binding and
FT                   integral membrane)"
FT                   /note="Similar to Clostridium perfringens probable ABC
FT                   transporter cpe0226 SWALL:Q8XNV6 (EMBL:AP003185) (576 aa)
FT                   fasta scores: E(): 2.7e-35, 26.56% id in 576 aa"
FT                   /protein_id="CAD66843.1"
FT   misc_feature    complement(199560..200115)
FT                   /note="ABC transporter Score = 156.8 E-value = 2.6e-44"
FT   misc_feature    complement(199735..199779)
FT                   /note="PS00211 ABC transporters family signature."
FT   misc_feature    complement(200071..200094)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(order(200275..200343,200401..200469,
FT                   200668..200736,200746..200814,200959..201027,
FT                   201085..201153))
FT                   /note="6 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 56-78, 98-120, 169-191,
FT                   195-217, 284-306 and 326-348"
FT   misc_feature    complement(200331..201147)
FT                   /note="ABC transporter transmembrane region Score = 37.9
FT                   E-value = 1.7e-08"
FT   repeat_region   201593..202308
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   CDS_pept        complement(202542..203240)
FT                   /transl_table=11
FT                   /locus_tag="TW164"
FT                   /product="putative integral membrane protein"
FT                   /note="Similar to Streptomyces coelicolor putative integral
FT                   membrane protein SCO2196 or SC5F7.05 or SC3H12.04
FT                   SWALL:Q9S2P0 (EMBL:AL096872) (234 aa) fasta scores: E():
FT                   5.7e-15, 31.89% id in 232 aa"
FT                   /protein_id="CAD66844.1"
FT                   KKPVKRPSRG"
FT   misc_feature    complement(order(203007..203075,203088..203156))
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 29-51 and 56-78"
FT   misc_feature    complement(203085..203240)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.866) with cleavage
FT                   site probability 0.502 between residues 52 and 53"
FT   CDS_pept        203335..204531
FT                   /transl_table=11
FT                   /locus_tag="TW165"
FT                   /product="putative serine/threonine protein kinase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   serine/threonine protein kinase SCO1724 or SCI11.13
FT                   SWALL:Q9S2A6 (EMBL:AL096849) (550 aa) fasta scores: E():
FT                   0.0015, 30.3% id in 165 aa, and to Amycolatopsis
FT                   mediterranei serine/threonine kinase PkmA SWALL:Q9KK90
FT                   (EMBL:AF135382) (589 aa) fasta scores: E(): 0.0043, 25.59%
FT                   id in 168 aa"
FT                   /protein_id="CAD66845.1"
FT   misc_feature    204247..204315
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 305-327"
FT   repeat_region   204575..205214
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   CDS_pept        205328..207172
FT                   /transl_table=11
FT                   /locus_tag="TW166"
FT                   /product="putative transcription factor"
FT                   /note="Similar to Caulobacter crescentus elongation factor
FT                   TU family protein cc0741 SWALL:Q9AA65 (EMBL:AE005749) (610
FT                   aa) fasta scores: E(): 4e-83, 43.18% id in 616 aa, and to
FT                   Streptomyces coelicolor putative GTP-binding protein
FT                   SCO5111 or SCBAC31E11.07 SWALL:Q93IU4 (EMBL:AL596043) (635
FT                   aa) fasta scores: E(): 8.9e-80, 56.85% id in 635 aa"
FT                   /protein_id="CAD66846.1"
FT   misc_feature    205337..205958
FT                   /note="Elongation factor Tu GTP binding domain Score =
FT                   223.5 E-value = 2.2e-64"
FT   misc_feature    205364..205387
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    205451..205498
FT                   /note="PS00301 GTP-binding elongation factors signature."
FT   misc_feature    205985..206234
FT                   /note="Elongation factor Tu domain 2 Score = 48.2 E-value =
FT                   1.3e-11"
FT   misc_feature    206555..206816
FT                   /note="Elongation factor G C-terminus Score = 75.4 E-value
FT                   = 8.5e-20"
FT   CDS_pept        207488..208330
FT                   /transl_table=11
FT                   /locus_tag="TW167"
FT                   /product="conserved hypothetical protein"
FT                   /note="Has C-terminal similarity to proteins of undefined
FT                   function. Similar to Streptococcus pyogenes hypothetical
FT                   protein Spym18_1743 SWALL:AAL98271 (EMBL:AE010084) (153 aa)
FT                   fasta scores: E(): 1.6e-10, 40% id in 140 aa"
FT                   /protein_id="CAD66847.1"
FT   misc_feature    207491..207815
FT                   /note="4'-phosphopantetheinyl transferase superfamily Score
FT                   = 48.8 E-value = 8.6e-12"
FT   misc_feature    207887..208241
FT                   /note="Uncharacterised P-loop hydrolase UPF0079 Score =
FT                   111.1 E-value = 1.5e-30"
FT   misc_feature    207950..207973
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        208351..209856
FT                   /transl_table=11
FT                   /locus_tag="TW169"
FT                   /product="conserved hypothetical protein"
FT                   /note="Localised similarity to proteins of unknown
FT                   function. C-terminal similar to Thermoanaerobacter
FT                   tengcongensis acetyltransferases RimI3 or tte0537
FT                   SWALL:Q8RC99 (EMBL:AE013024) (149 aa) fasta scores: E():
FT                   5e-10, 37.24% id in 145 aa. N-termional similar to
FT                   Corynebacterium glutamicum inactive homologs of
FT                   metal-dependent proteases, putative molecular chaperones
FT                   cgl0592 SWALL:BAB97985 (EMBL:AP005275) (225 aa) fasta
FT                   scores: E(): 0.00017, 39.62% id in 106 aa"
FT                   /protein_id="CAD66848.1"
FT   misc_feature    208456..208624
FT                   /note="Glycoprotease family Score = 18.0 E-value = 1.9e-05"
FT   misc_feature    209551..209788
FT                   /note="Acetyltransferase (GNAT) family Score = 86.8 E-value
FT                   = 3.2e-23"
FT   CDS_pept        209856..211061
FT                   /transl_table=11
FT                   /gene="gcp"
FT                   /locus_tag="TW170"
FT                   /product="O-sialoglycoprotein endopeptidase"
FT                   /EC_number=""
FT                   /note="Similar to Pasteurella haemolytica
FT                   O-sialoglycoprotein endopeptidase Gcp SWALL:GCP_PASHA
FT                   (SWALL:P36175) (325 aa) fasta scores: E(): 1.5e-13, 36.97%
FT                   id in 384 aa, and to Streptomyces coelicolor probable
FT                   O-sialoglycoprotein endopeptidase Gcp or SCO4752 or
FT                   SC6G4.30 SWALL:GCP_STRCO (SWALL:O86793) (374 aa) fasta
FT                   scores: E(): 4.3e-20, 43.71% id in 398 aa"
FT                   /db_xref="GOA:Q83I95"
FT                   /db_xref="InterPro:IPR000905"
FT                   /db_xref="InterPro:IPR017861"
FT                   /db_xref="InterPro:IPR022450"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I95"
FT                   /protein_id="CAD66849.1"
FT                   VV"
FT   misc_feature    209859..210987
FT                   /note="Glycoprotease family Score = 376.6 E-value =
FT                   1.7e-110"
FT   repeat_region   211107..212101
FT                   /note="Non-coding degenerate repeat region in Repeat
FT                   Cluster 1 (RC1)."
FT   CDS_pept        212254..213477
FT                   /transl_table=11
FT                   /locus_tag="TW171"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein SCO3406 or SCE9.13c SWALL:Q9X8I6 (EMBL:AL049841)
FT                   (352 aa) fasta scores: E(): 2.6e-11, 32.66% id in 401 aa"
FT                   /db_xref="GOA:Q83I94"
FT                   /db_xref="InterPro:IPR011063"
FT                   /db_xref="InterPro:IPR012094"
FT                   /db_xref="InterPro:IPR012795"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I94"
FT                   /protein_id="CAD66850.1"
FT                   MHTLRGKL"
FT   CDS_pept        213482..213985
FT                   /transl_table=11
FT                   /gene="hpt"
FT                   /locus_tag="TW172"
FT                   /product="hypoxanthine phosphoribosyltransferase"
FT                   /EC_number=""
FT                   /note="Similar to Salmonella typhimurium hypoxanthine
FT                   phosphoribosyltransferase Hpt or Stm0170 SWALL:HPRT_SALTY
FT                   (SWALL:O33799) (178 aa) fasta scores: E(): 7.7e-25, 46.01%
FT                   id in 163 aa, and to Streptomyces coelicolor putative
FT                   hypoxanthine phosphoribosyltransferase HprT or SCO3405 or
FT                   SCE9.12c SWALL:Q9X8I5 (EMBL:AL049841) (187 aa) fasta
FT                   scores: E(): 7.9e-35, 54.81% id in 166 aa"
FT                   /protein_id="CAD66851.1"
FT                   VLEQ"
FT   misc_feature    213482..213920
FT                   /note="Phosphoribosyl transferase domain Score = 63.3
FT                   E-value = 3.6e-16"
FT   misc_feature    213746..213784
FT                   /note="PS00103 Purine/pyrimidine phosphoribosyl
FT                   transferases signature."
FT   CDS_pept        213988..215988
FT                   /transl_table=11
FT                   /gene="ftsH"
FT                   /locus_tag="TW173"
FT                   /product="FtsH-like putative cell division protein"
FT                   /EC_number="3.4.24.-"
FT                   /note="Similar to Streptococcus pneumoniae cell division
FT                   protein FtsH or sp0013 SWALL:FTSH_STRPN (SWALL:O69076) (652
FT                   aa) fasta scores: E(): 2.5e-86, 54.38% id in 502 aa, and to
FT                   Streptomyces coelicolor cell division protein FtsH homolog
FT                   FtsH2 or SCO3404 or SCE9.11c SWALL:Q9X8I4 (EMBL:AL049841)
FT                   (668 aa) fasta scores: E(): 4.5e-119, 55.12% id in 664 aa"
FT                   /protein_id="CAD66852.1"
FT   misc_feature    213988..214083
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.907) with cleavage
FT                   site probability 0.640 between residues 32 and 33"
FT   misc_feature    order(214015..214068,214312..214380)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 10-27 and 109-131"
FT   misc_feature    214576..215137
FT                   /note="ATPase family associated with various cellular
FT                   activities (AAA) Score = 328.5 E-value = 5.6e-96"
FT   misc_feature    214591..214614
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    214888..214944
FT                   /note="PS00674 AAA-protein family signature."
FT   misc_feature    215155..215785
FT                   /note="Peptidase family M41 Score = 336.5 E-value =
FT                   2.1e-98"
FT   CDS_pept        216002..216547
FT                   /transl_table=11
FT                   /gene="folE"
FT                   /gene_synonym="mtrA"
FT                   /locus_tag="TW174"
FT                   /product="GTP cyclohydrolase I"
FT                   /EC_number=""
FT                   /note="Similar to Bacillus subtilis GTP cyclohydrolase I
FT                   FolE or MtrA SWALL:GCH1_BACSU (SWALL:P19465) (190 aa) fasta
FT                   scores: E(): 1.9e-12, 33.53% id in 167 aa, and to Bacillus
FT                   halodurans GTP cyclohydrolase I FolE or MtrA or bh1646
FT                   SWALL:GCH1_BACHD (SWALL:Q9KCC7) (188 aa) fasta scores: E():
FT                   2.6e-14, 32.25% id in 186 aa"
FT                   /protein_id="CAD66853.1"
FT                   AHRGIGDADIISFMTIIR"
FT   misc_feature    216197..216482
FT                   /note="GTP cyclohydrolase I Score = 46.7 E-value = 3.8e-11"
FT   CDS_pept        216584..218881
FT                   /transl_table=11
FT                   /gene="folP"
FT                   /gene_synonym="sul"
FT                   /locus_tag="TW175"
FT                   /product="dihydropteroate synthase"
FT                   /EC_number=""
FT                   /note="Similar to Bacillus subtilis dihydropteroate
FT                   synthase Sul SWALL:DHPS_BACSU (SWALL:P28822) (285 aa) fasta
FT                   scores: E(): 8.7e-28, 40.61% id in 261 aa, and to
FT                   Streptomyces coelicolor putative dihydropteroate synthase
FT                   FolP or SCO3398 or SCE9.05 SWALL:Q9X8H8 (EMBL:AL049841)
FT                   (288 aa) fasta scores: E(): 1.7e-38, 46.26% id in 268 aa"
FT                   /protein_id="CAD66854.1"
FT                   ESRGKTEPHGKI"
FT   misc_feature    216629..216676
FT                   /note="PS00792 Dihydropteroate synthase signature 1."
FT   misc_feature    216638..217412
FT                   /note="Pterin binding enzyme Score = 325.9 E-value =
FT                   3.3e-95"
FT   misc_feature    216731..216772
FT                   /note="PS00793 Dihydropteroate synthase signature 2."
FT   misc_feature    217631..217958
FT                   /note="Dihydroneopterin aldolase Score = 59.2 E-value =
FT                   6.1e-15"
FT   misc_feature    218066..218612
FT                   /note="7,8-dihydro-6-hydroxymethylpterin-pyrophosphokinase
FT                   (HPPK) Score = 100.9 E-value = 1.7e-27"
FT   CDS_pept        218878..219327
FT                   /transl_table=11
FT                   /locus_tag="TW176"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66855.1"
FT   misc_feature    218878..218958
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.468 between residues 27 and 28"
FT   misc_feature    order(218890..218949,218977..219045,219106..219174,
FT                   219217..219285)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 5-24, 34-56, 77-99 and
FT                   114-136"
FT   CDS_pept        219552..220313
FT                   /transl_table=11
FT                   /locus_tag="TW177"
FT                   /product="putative ABC transporter ATP-binding subunit"
FT                   /note="Similar to Lactococcus lactis NisF protein NisF
FT                   SWALL:Q48635 (EMBL:Z29363) (225 aa) fasta scores: E():
FT                   2.3e-15, 32.57% id in 221 aa"
FT                   /protein_id="CAD66856.1"
FT   misc_feature    219684..220209
FT                   /note="ABC transporter Score = 108.4 E-value = 9.9e-30"
FT   misc_feature    219705..219728
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    219984..220028
FT                   /note="PS00211 ABC transporters family signature."
FT   CDS_pept        220402..221079
FT                   /transl_table=11
FT                   /locus_tag="TW178"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66857.1"
FT                   GIL"
FT   misc_feature    order(220468..220536,220624..220692,220735..220803,
FT                   220837..220905,220981..221049)
FT                   /note="5 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 23-45, 75-97, 112-134,
FT                   146-168 and 194-216"
FT   CDS_pept        221086..221778
FT                   /transl_table=11
FT                   /gene="ung"
FT                   /locus_tag="TW179"
FT                   /product="uracil DNA glycosylase"
FT                   /note="Similar to Streptomyces coelicolor uracil DNA
FT                   glycosylase Ung or SCO1114 or 2SCG38.07 SWALL:Q9EX12
FT                   (EMBL:AL445503) (225 aa) fasta scores: E(): 2.6e-52, 59.17%
FT                   id in 218 aa, and to Homo sapiens uracil-DNA glycosylase,
FT                   mitochondrial precursor Ung or Dgu or Ung15 SWALL:UNG_HUMAN
FT                   (SWALL:P13051) (304 aa) fasta scores: E(): 6.1e-26, 42.18%
FT                   id in 192 aa"
FT                   /db_xref="GOA:P67079"
FT                   /db_xref="InterPro:IPR002043"
FT                   /db_xref="InterPro:IPR005122"
FT                   /db_xref="InterPro:IPR018085"
FT                   /db_xref="InterPro:IPR036895"
FT                   /db_xref="UniProtKB/Swiss-Prot:P67079"
FT                   /protein_id="CAD66858.1"
FT                   APIDWRLT"
FT   misc_feature    221251..221737
FT                   /note="Uracil DNA glycosylase superfamily Score = 170.1
FT                   E-value = 2.7e-48"
FT   misc_feature    221275..221304
FT                   /note="PS00130 Uracil-DNA glycosylase signature."
FT   CDS_pept        221811..222749
FT                   /transl_table=11
FT                   /gene="ribF"
FT                   /locus_tag="TW180"
FT                   /product="riboflavin biosynthesis protein RibF [includes:
FT                   riboflavin kinase]"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli riboflavin biosynthesis
FT                   protein RibF [includes: riboflavin kinase] or b0025 or
FT                   z0029 or ecs0028 SWALL:RIBF_ECOLI (SWALL:P08391) (313 aa)
FT                   fasta scores: E(): 8.3e-30, 35.33% id in 317 aa"
FT                   /protein_id="CAD66859.1"
FT   misc_feature    222351..222732
FT                   /note="Riboflavin kinase / FAD synthetase Score = 125.2
FT                   E-value = 8.4e-35"
FT   CDS_pept        223106..223651
FT                   /transl_table=11
FT                   /locus_tag="TW181"
FT                   /product="putative secreted protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66860.1"
FT                   PPFQPRYIRFDPFRTKCN"
FT   misc_feature    223106..223195
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.992 between residues 30 and 31"
FT   misc_feature    223133..223201
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 10-32"
FT   CDS_pept        223721..224497
FT                   /transl_table=11
FT                   /locus_tag="TW182"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66861.1"
FT   misc_feature    order(223730..223783,223949..224017,224174..224242,
FT                   224255..224323)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 4-21, 77-99, 152-174 and
FT                   179-201"
FT   CDS_pept        224723..225307
FT                   /transl_table=11
FT                   /locus_tag="TW184"
FT                   /product="putative peptidase"
FT                   /note="Similar to Aeromonas hydrophila type 4 prepilin-like
FT                   proteins leader peptide processing enzyme [includes: leader
FT                   peptidase tapD] SWALL:LEP4_AERHY (SWALL:P45794) (290 aa)
FT                   fasta scores: E(): 1.5e-05, 29.44% id in 197 aa, and to
FT                   Escherichia coli leader peptidase HopD SWALL:HOPD_ECOLI
FT                   (SWALL:O68932) (155 aa) fasta scores: E(): 0.0017, 32.7% id
FT                   in 159 aa"
FT                   /protein_id="CAD66862.1"
FT   misc_feature    224723..224857
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.981) with cleavage
FT                   site probability 0.862 between residues 45 and 46"
FT   misc_feature    order(224741..224836,224879..224932,224969..225037,
FT                   225095..225163,225197..225265)
FT                   /note="5 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-38, 53-70, 83-105, 125-147
FT                   and 159-181"
FT   CDS_pept        225473..226039
FT                   /transl_table=11
FT                   /locus_tag="TW186"
FT                   /product="putative integral membrane protein"
FT                   /protein_id="CAD66863.1"
FT   misc_feature    order(225680..225748,225761..225829,225848..225907,
FT                   225935..226003)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 70-92, 97-119, 126-145 and
FT                   155-177"
FT   CDS_pept        226082..226408
FT                   /transl_table=11
FT                   /locus_tag="TW187"
FT                   /product="ferredoxin"
FT                   /note="Similar to Streptomyces griseus ferredoxin
FT                   SWALL:FER_STRGR (SWALL:P13279) (105 aa) fasta scores: E():
FT                   1.8e-33, 79.2% id in 101 aa"
FT                   /protein_id="CAD66864.1"
FT                   SDSV"
FT   misc_feature    226178..226247
FT                   /note="4Fe-4S binding domain Score = 38.9 E-value = 8e-09"
FT   misc_feature    226199..226234
FT                   /note="PS00198 4Fe-4S ferredoxins, iron-sulfur binding
FT                   region signature."
FT   CDS_pept        226431..227699
FT                   /transl_table=11
FT                   /locus_tag="TW188"
FT                   /product="putative integral membrane protein"
FT                   /note="Weakly similar to Streptomyces coelicolor putative
FT                   integral membrane protein SCO1752 or 2SCI34.05 SWALL:Q9EWX4
FT                   (EMBL:AL445403) (396 aa) fasta scores: E(): 4.1e-05, 24.72%
FT                   id in 364 aa"
FT                   /protein_id="CAD66865.1"
FT   misc_feature    order(226536..226604,226758..226826,226839..226907,
FT                   226926..227030,227073..227132,227190..227258,
FT                   227391..227459,227478..227546,227604..227672)
FT                   /note="9 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 36-58, 110-132, 137-159,
FT                   166-200, 215-234, 254-276, 321-343, 350-372 and 392-414"
FT   repeat_region   227946..227956
FT                   /note="(g)11"
FT   CDS_pept        228065..228706
FT                   /transl_table=11
FT                   /locus_tag="TW189"
FT                   /product="putative membrane protein"
FT                   /note="No significant database matches. Possible
FT                   coiled-coil region at residues 42-80."
FT                   /protein_id="CAD66866.1"
FT   misc_feature    228065..228133
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.998) with cleavage
FT                   site probability 0.405 between residues 23 and 24"
FT   misc_feature    order(228077..228145,228626..228694)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-34 and 195-217"
FT   CDS_pept        complement(228948..229565)
FT                   /transl_table=11
FT                   /gene="mdmC"
FT                   /locus_tag="TW190"
FT                   /product="putative O-methyltransferase"
FT                   /EC_number="2.1.1.-"
FT                   /note="Similar to Streptomyces mycarofaciens
FT                   O-methyltransferase MdmC SWALL:MDMC_STRMY (SWALL:Q00719)
FT                   (221 aa) fasta scores: E(): 8e-05, 28.57% id in 175 aa"
FT                   /protein_id="CAD66867.1"
FT   misc_feature    complement(228956..229538)
FT                   /note="O-methyltransferase Score = -50.0 E-value = 1.3e-08"
FT   CDS_pept        229601..229825
FT                   /transl_table=11
FT                   /locus_tag="TW191"
FT                   /product="putative secreted protein"
FT                   /note="N-terminus similar to that of Caulobacter crescentus
FT                   hypothetical protein Cc2002 SWALL:Q9A6T1 (EMBL:AE005873)
FT                   (200 aa) fasta scores: E(): 5.2, 31.91% id in 47 aa"
FT                   /protein_id="CAD66868.1"
FT   misc_feature    229601..229693
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.889) with cleavage
FT                   site probability 0.511 between residues 31 and 32"
FT   misc_feature    229631..229690
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 11-30"
FT   CDS_pept        229953..230495
FT                   /transl_table=11
FT                   /locus_tag="TW192"
FT                   /product="possible integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66869.1"
FT                   PFQPRYIRFDPFRTKCG"
FT   misc_feature    229953..230036
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.780 between residues 28 and 29"
FT   misc_feature    order(229971..230039,230283..230351)
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-29 and 111-133"
FT   CDS_pept        230519..231298
FT                   /transl_table=11
FT                   /locus_tag="TW193"
FT                   /product="possible integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66870.1"
FT   misc_feature    order(230561..230608,230708..230776,230819..230887,
FT                   231023..231091,231119..231187)
FT                   /note="5 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 15-30, 64-86, 101-123,
FT                   169-191 and 201-223"
FT   CDS_pept        complement(231435..232766)
FT                   /transl_table=11
FT                   /gene="aroA"
FT                   /locus_tag="TW194"
FT                   /product="3-phosphoshikimate 1-carboxyvinyltransferase"
FT                   /EC_number=""
FT                   /note="Similar to Mycobacterium tuberculosis
FT                   3-phosphoshikimate 1-carboxyvinyltransferase AroA or Rv3227
FT                   or mt3324 or mtcy20b11.02 SWALL:AROA_MYCTU (SWALL:P22487)
FT                   (450 aa) fasta scores: E(): 1.6e-52, 42.4% id in 441 aa"
FT                   /db_xref="GOA:Q83I86"
FT                   /db_xref="InterPro:IPR001986"
FT                   /db_xref="InterPro:IPR006264"
FT                   /db_xref="InterPro:IPR013792"
FT                   /db_xref="InterPro:IPR023193"
FT                   /db_xref="InterPro:IPR036968"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I86"
FT                   /protein_id="CAD66871.1"
FT   misc_feature    complement(231458..232721)
FT                   /note="EPSP synthase (3-phosphoshikimate
FT                   1-carboxyvinyltransferase) Score = 326.9 E-value = 1.7e-95"
FT   CDS_pept        232840..234861
FT                   /transl_table=11
FT                   /gene="recG"
FT                   /locus_tag="TW195"
FT                   /product="ATP-dependent DNA helicase RecG"
FT                   /EC_number="3.6.1.-"
FT                   /note="Similar to Staphylococcus aureus ATP-dependent DNA
FT                   helicase RecG SWALL:RECG_STAAU (SWALL:O50581) (686 aa)
FT                   fasta scores: E(): 3.9e-62, 32.43% id in 666 aa"
FT                   /protein_id="CAD66872.1"
FT   misc_feature    232966..233191
FT                   /note="OB-fold nucleic acid binding domain Score = 47.9
FT                   E-value = 1.6e-11"
FT   misc_feature    233545..234124
FT                   /note="DEAD/DEAH box helicase Score = 98.8 E-value =
FT                   7.8e-27"
FT   misc_feature    233656..233679
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    234310..234526
FT                   /note="Helicase conserved C-terminal domain Score = 76.5
FT                   E-value = 3.9e-20"
FT   CDS_pept        234982..235512
FT                   /transl_table=11
FT                   /gene="coaD"
FT                   /locus_tag="TW196"
FT                   /product="phosphopantetheine adenylyltransferase"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli phosphopantetheine
FT                   adenylyltransferase CoaD or KdtB or b3634 or z5058 or
FT                   ecs4509 SWALL:COAD_ECOLI (SWALL:P23875) (159 aa) fasta
FT                   scores: E(): 3.8e-06, 33.13% id in 169 aa"
FT                   /db_xref="GOA:Q83I84"
FT                   /db_xref="InterPro:IPR001980"
FT                   /db_xref="InterPro:IPR004821"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I84"
FT                   /protein_id="CAD66873.1"
FT                   PACVTRFFGTHSG"
FT   misc_feature    235000..235498
FT                   /note="Cytidylyltransferase Score = 56.8 E-value = 3.4e-14"
FT   CDS_pept        complement(235965..236714)
FT                   /transl_table=11
FT                   /locus_tag="TW197"
FT                   /product="putative membrane protein"
FT                   /note="Similar to Streptomyces coelicolor putative integral
FT                   membrane protein SCO3849 or SCH69.19c SWALL:Q9XA15
FT                   (EMBL:AL079308) (253 aa) fasta scores: E(): 9.6e-09, 25.6%
FT                   id in 250 aa"
FT                   /protein_id="CAD66874.1"
FT   misc_feature    complement(235997..236423)
FT                   /note="Sortase family Score = 54.3 E-value = 1.9e-13"
FT   misc_feature    complement(236568..236636)
FT                   /note="1 probable transmembrane helix predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 27-49"
FT   CDS_pept        236982..237179
FT                   /transl_table=11
FT                   /gene="rpmF"
FT                   /locus_tag="TW198"
FT                   /product="50s ribosomal protein L32"
FT                   /note="Similar to Bacillus stearothermophilus 50s ribosomal
FT                   protein L32 RpmF SWALL:RL32_BACST (SWALL:P07840) (56 aa)
FT                   fasta scores: E(): 4.3, 34.92% id in 63 aa, and to
FT                   Mycobacterium tuberculosis 50s ribosomal protein L32 RpmF
FT                   or Rv0979.1c or mt1007 or mtv044.07c.1 SWALL:RL32_MYCTU
FT                   (SWALL:P58287) (57 aa) fasta scores: E(): 0.00062, 55.1% id
FT                   in 49 aa"
FT                   /db_xref="GOA:Q83I83"
FT                   /db_xref="InterPro:IPR002677"
FT                   /db_xref="InterPro:IPR011332"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I83"
FT                   /protein_id="CAD66875.1"
FT   misc_feature    236985..237099
FT                   /note="Ribosomal L32p protein family Score = 17.6 E-value =
FT                   0.00057"
FT   CDS_pept        237204..237851
FT                   /transl_table=11
FT                   /gene="rnc"
FT                   /locus_tag="TW199"
FT                   /product="ribonuclease III"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli ribonuclease III Rnc or
FT                   b2567 or z3848 or ecs3433 SWALL:RNC_ECOLI (SWALL:P05797)
FT                   (226 aa) fasta scores: E(): 3e-18, 35% id in 220 aa, and to
FT                   Streptomyces coelicolor ribonuclease III Rnc or SCO5572 or
FT                   SC7A1.16 SWALL:RNC_STRCO (SWALL:Q9ZBQ7) (272 aa) fasta
FT                   scores: E(): 3.9e-26, 42.05% id in 214 aa"
FT                   /db_xref="GOA:Q83I82"
FT                   /db_xref="InterPro:IPR000999"
FT                   /db_xref="InterPro:IPR011907"
FT                   /db_xref="InterPro:IPR014720"
FT                   /db_xref="InterPro:IPR036389"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I82"
FT                   /protein_id="CAD66876.1"
FT   misc_feature    237300..237326
FT                   /note="PS00517 Ribonuclease III family signature."
FT   misc_feature    237300..237570
FT                   /note="RNase3 domain Score = 160.6 E-value = 1.8e-45"
FT   misc_feature    237651..237831
FT                   /note="Double-stranded RNA binding motif Score = 71.7
FT                   E-value = 1.1e-18"
FT   CDS_pept        237969..239126
FT                   /transl_table=11
FT                   /locus_tag="TW200"
FT                   /product="putative ABC transporter branched chain amino
FT                   acid binding protein"
FT                   /note="Similar to Pseudomonas aeruginosa leucine-,
FT                   isoleucine-, valine-, threonine-, and alanine-binding
FT                   protein precursor BraC or pa1074 SWALL:BRAC_PSEAE
FT                   (SWALL:P21175) (373 aa) fasta scores: E(): 3.2e-22, 28.78%
FT                   id in 337 aa"
FT                   /protein_id="CAD66877.1"
FT   misc_feature    238092..239115
FT                   /note="Receptor family ligand binding region Score = -7.8
FT                   E-value = 4.8e-05"
FT   CDS_pept        239174..240178
FT                   /transl_table=11
FT                   /locus_tag="TW201"
FT                   /product="putative ABC transporter branched chain amino
FT                   acid transport permease"
FT                   /note="Similar to Escherichia coli high-affinity
FT                   branched-chain amino acid transport system permease protein
FT                   LivH or b3457 or z4827 or ecs4304 SWALL:LIVH_ECOLI
FT                   (SWALL:P08340) (308 aa) fasta scores: E(): 1.1e-30, 42.05%
FT                   id in 302 aa"
FT                   /protein_id="CAD66878.1"
FT   misc_feature    239246..240152
FT                   /note="Branched-chain amino acid transport system /
FT                   permease component Score = 127.1 E-value = 2.3e-35"
FT   misc_feature    order(239270..239338,239351..239419,239447..239515,
FT                   239552..239620,239678..239746,239843..239911,
FT                   239924..239992,240011..240064,240092..240160)
FT                   /note="9 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 33-55, 60-82, 92-114,
FT                   127-149, 169-191, 224-246, 251-273, 280-297 and 307-329"
FT   CDS_pept        240175..241269
FT                   /transl_table=11
FT                   /locus_tag="TW202"
FT                   /product="putative ABC transporter branched chain amino
FT                   acid transport permease"
FT                   /note="Similar to Escherichia coli high-affinity
FT                   branched-chain amino acid transport system permease protein
FT                   LivM or b3456 SWALL:LIVM_ECOLI (SWALL:P22729) (425 aa)
FT                   fasta scores: E(): 2.9e-14, 36.19% id in 326 aa"
FT                   /protein_id="CAD66879.1"
FT   misc_feature    order(240235..240303,240331..240390,240409..240465,
FT                   240493..240561,240580..240648,240736..240795,
FT                   240886..240954,240997..241065,241102..241155)
FT                   /note="9 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 21-43, 53-72, 79-97, 107-129,
FT                   136-158, 188-207, 238-260, 275-297 and 310-327"
FT   misc_feature    240310..241177
FT                   /note="Branched-chain amino acid transport system /
FT                   permease component Score = 94.8 E-value = 1.2e-25"
FT   CDS_pept        241271..242053
FT                   /transl_table=11
FT                   /locus_tag="TW203"
FT                   /product="putative branched chain amino acid ABC
FT                   transporter ATP-binding subunit"
FT                   /note="Similar to Escherichia coli high-affinity
FT                   branched-chain amino acid transport ATP-binding protein
FT                   LivG or b3455 or z4825 or ecs4302 SWALL:LIVG_ECOLI
FT                   (SWALL:P22730) (255 aa) fasta scores: E(): 4.7e-36, 47.43%
FT                   id in 253 aa"
FT                   /protein_id="CAD66880.1"
FT   misc_feature    241379..241973
FT                   /note="ABC transporter Score = 197.7 E-value = 1.3e-56"
FT   misc_feature    241400..241423
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        242078..242761
FT                   /transl_table=11
FT                   /locus_tag="TW204"
FT                   /product="putative branched chain amino acid ABC
FT                   transporter ATP-binding subunit"
FT                   /note="Similar to Escherichia coli high-affinity
FT                   branched-chain amino acid transport ATP-binding protein
FT                   LivF or b3454 SWALL:LIVF_ECOLI (SWALL:P22731) (237 aa)
FT                   fasta scores: E(): 1.4e-33, 52.42% id in 227 aa"
FT                   /protein_id="CAD66881.1"
FT                   AYLGV"
FT   misc_feature    242138..242684
FT                   /note="ABC transporter Score = 187.2 E-value = 1.9e-53"
FT   misc_feature    242159..242182
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    242459..242503
FT                   /note="PS00211 ABC transporters family signature."
FT   CDS_pept        242928..243596
FT                   /transl_table=11
FT                   /gene="ftsY"
FT                   /locus_tag="TW205"
FT                   /product="putative SRP54-type protein"
FT                   /note="Similar to Escherichia coli cell division protein
FT                   FtsY or b3464 SWALL:FTSY_ECOLI (SWALL:P10121) (497 aa)
FT                   fasta scores: E(): 4.8e-30, 47.32% id in 224 aa"
FT                   /protein_id="CAD66882.1"
FT                   "
FT   misc_feature    242985..243591
FT                   /note="SRP54-type protein, GTPase domain Score = 329.8
FT                   E-value = 2.2e-96"
FT   misc_feature    243012..243035
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    243510..243551
FT                   /note="PS00300 SRP54-type proteins GTP-binding domain
FT                   signature."
FT   CDS_pept        243756..244064
FT                   /transl_table=11
FT                   /gene="rpsJ"
FT                   /locus_tag="TW206"
FT                   /product="30S ribosomal protein S10"
FT                   /note="Similar to Mycobacterium tuberculosis 30s ribosomal
FT                   protein S10 RpsJ or RpsX or Rv0700 or mt0727 or mtcy210.19
FT                   SWALL:RS10_MYCTU (SWALL:P95048) (101 aa) fasta scores: E():
FT                   7.7e-28, 70.29% id in 101 aa"
FT                   /db_xref="GOA:Q83I79"
FT                   /db_xref="InterPro:IPR001848"
FT                   /db_xref="InterPro:IPR018268"
FT                   /db_xref="InterPro:IPR027486"
FT                   /db_xref="InterPro:IPR036838"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I79"
FT                   /protein_id="CAD66883.1"
FT   misc_feature    243768..244053
FT                   /note="Ribosomal protein S10p/S20e Score = 176.1 E-value =
FT                   4e-50"
FT   misc_feature    243840..243887
FT                   /note="PS00361 Ribosomal protein S10 signature."
FT   CDS_pept        244074..244706
FT                   /transl_table=11
FT                   /gene="rplC"
FT                   /locus_tag="TW207"
FT                   /product="50S ribosomal protein L3"
FT                   /note="Similar to Escherichia coli 50s ribosomal protein L3
FT                   RplC or b3320 or z4691 or ecs4185 SWALL:RL3_ECOLI
FT                   (SWALL:P02386) (209 aa) fasta scores: E(): 2.1e-32, 49.26%
FT                   id in 205 aa"
FT                   /db_xref="GOA:Q83I78"
FT                   /db_xref="InterPro:IPR000597"
FT                   /db_xref="InterPro:IPR009000"
FT                   /db_xref="InterPro:IPR019926"
FT                   /db_xref="InterPro:IPR019927"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I78"
FT                   /protein_id="CAD66884.1"
FT   misc_feature    244098..244671
FT                   /note="Ribosomal protein L3 Score = 213.6 E-value =
FT                   2.2e-61"
FT   misc_feature    244362..244433
FT                   /note="PS00474 Ribosomal protein L3 signature."
FT   CDS_pept        244696..245442
FT                   /transl_table=11
FT                   /gene="rplD"
FT                   /locus_tag="TW208"
FT                   /product="50s ribosomal protein L4"
FT                   /note="Similar to Bacillus stearothermophilus 50s ribosomal
FT                   protein L4 RplD SWALL:RL4_BACST (SWALL:P28601) (207 aa)
FT                   fasta scores: E(): 6.1e-28, 41.62% id in 197 aa"
FT                   /db_xref="GOA:Q83I77"
FT                   /db_xref="InterPro:IPR002136"
FT                   /db_xref="InterPro:IPR013005"
FT                   /db_xref="InterPro:IPR023574"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I77"
FT                   /protein_id="CAD66885.1"
FT   misc_feature    244741..245308
FT                   /note="Ribosomal protein L4/L1 family Score = 159.9 E-value
FT                   = 3e-45"
FT   CDS_pept        245439..245750
FT                   /transl_table=11
FT                   /gene="rplW"
FT                   /locus_tag="TW209"
FT                   /product="50s ribosomal protein L23"
FT                   /note="Similar to Mycobacterium bovis 50s ribosomal protein
FT                   L23 RplW SWALL:RL23_MYCBO (SWALL:O06046) (100 aa) fasta
FT                   scores: E(): 8.8e-19, 69.31% id in 88 aa, and to Thermus
FT                   thermophilus ribosomal protein L23 SWALL:Q9RA57
FT                   (EMBL:AF094532) (96 aa) fasta scores: E(): 1.4e-11, 51.76%
FT                   id in 85 aa"
FT                   /protein_id="CAD66886.1"
FT   misc_feature    245484..245745
FT                   /note="Ribosomal protein L23 Score = 107.4 E-value =
FT                   1.9e-29"
FT   misc_feature    245700..245744
FT                   /note="This hit extended beyond the end of the feature by 1
FT                   aa and was clipped."
FT                   /note="PS00050 Ribosomal protein L23 signature."
FT   CDS_pept        245758..246591
FT                   /transl_table=11
FT                   /gene="rplB"
FT                   /locus_tag="TW210"
FT                   /product="50s ribosomal protein l2"
FT                   /note="Similar to Escherichia coli 50s ribosomal protein l2
FT                   RplB or b3317 or z4688 or ecs4182 SWALL:RL2_ECOLI
FT                   (SWALL:P02387) (272 aa) fasta scores: E(): 6e-60, 56.93% id
FT                   in 274 aa"
FT                   /db_xref="GOA:Q83I75"
FT                   /db_xref="InterPro:IPR002171"
FT                   /db_xref="InterPro:IPR005880"
FT                   /db_xref="InterPro:IPR008991"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR014722"
FT                   /db_xref="InterPro:IPR014726"
FT                   /db_xref="InterPro:IPR022666"
FT                   /db_xref="InterPro:IPR022669"
FT                   /db_xref="InterPro:IPR022671"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I75"
FT                   /protein_id="CAD66887.1"
FT   misc_feature    245881..246112
FT                   /note="Ribosomal Proteins L2, RNA binding domain Score =
FT                   162.1 E-value = 6.5e-46"
FT   misc_feature    246130..246514
FT                   /note="Ribosomal Proteins L2, C-terminal domain Score =
FT                   286.9 E-value = 1.8e-83"
FT   misc_feature    246412..246447
FT                   /note="PS00467 Ribosomal protein L2 signature."
FT   CDS_pept        246596..246877
FT                   /transl_table=11
FT                   /gene="rpsS"
FT                   /locus_tag="TW211"
FT                   /product="30s ribosomal protein s19"
FT                   /note="Similar to Escherichia coli 30s ribosomal protein
FT                   S19 RpsS or b3316 or z4687 or ecs4181 SWALL:RS19_ECOLI
FT                   (SWALL:P02375) (91 aa) fasta scores: E(): 6.9e-26, 67.39%
FT                   id in 92 aa"
FT                   /db_xref="GOA:Q83I74"
FT                   /db_xref="InterPro:IPR002222"
FT                   /db_xref="InterPro:IPR005732"
FT                   /db_xref="InterPro:IPR020934"
FT                   /db_xref="InterPro:IPR023575"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I74"
FT                   /protein_id="CAD66888.1"
FT   misc_feature    246602..246842
FT                   /note="Ribosomal protein S19 Score = 176.2 E-value =
FT                   3.8e-50"
FT   misc_feature    246752..246826
FT                   /note="PS00323 Ribosomal protein S19 signature."
FT   CDS_pept        246877..247236
FT                   /transl_table=11
FT                   /gene="rplV"
FT                   /locus_tag="TW212"
FT                   /product="50s ribosomal protein l22"
FT                   /note="Similar to Escherichia coli 50s ribosomal protein
FT                   L22 RplV or EryB or b3315 or z4686 or ecs4180 or stm3435 or
FT                   sty4363 SWALL:RL22_ECOLI (SWALL:P02423) (110 aa) fasta
FT                   scores: E(): 2.2e-13, 45.37% id in 108 aa"
FT                   /db_xref="GOA:Q83I73"
FT                   /db_xref="InterPro:IPR001063"
FT                   /db_xref="InterPro:IPR005727"
FT                   /db_xref="InterPro:IPR018260"
FT                   /db_xref="InterPro:IPR036394"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I73"
FT                   /protein_id="CAD66889.1"
FT                   KRGSHVTVTLSKEVR"
FT   misc_feature    246913..247222
FT                   /note="Ribosomal protein L22p/L17e Score = 127.3 E-value =
FT                   1.9e-35"
FT   misc_feature    247144..247218
FT                   /note="PS00464 Ribosomal protein L22 signature."
FT   CDS_pept        247239..247901
FT                   /transl_table=11
FT                   /gene="rpsC"
FT                   /locus_tag="TW213"
FT                   /product="30s ribosomal protein S3"
FT                   /note="Similar to Escherichia coli 30s ribosomal protein S3
FT                   RpsC or b3314 or z4685 or ecs4179 or stm3434 or sty4364
FT                   SWALL:RS3_ECOLI (SWALL:P02352) (232 aa) fasta scores: E():
FT                   7.2e-36, 50.72% id in 207 aa"
FT                   /db_xref="GOA:Q83I72"
FT                   /db_xref="InterPro:IPR001351"
FT                   /db_xref="InterPro:IPR004044"
FT                   /db_xref="InterPro:IPR004087"
FT                   /db_xref="InterPro:IPR005704"
FT                   /db_xref="InterPro:IPR009019"
FT                   /db_xref="InterPro:IPR015946"
FT                   /db_xref="InterPro:IPR018280"
FT                   /db_xref="InterPro:IPR036419"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I72"
FT                   /protein_id="CAD66890.1"
FT   misc_feature    247239..247434
FT                   /note="Ribosomal protein S3, N-terminal domain Score = 98.0
FT                   E-value = 1.3e-26"
FT   misc_feature    247443..247584
FT                   /note="KH domain Score = 20.6 E-value = 0.00091"
FT   misc_feature    247605..247854
FT                   /note="Ribosomal protein S3, C-terminal domain Score =
FT                   147.0 E-value = 2.3e-41"
FT   misc_feature    247737..247841
FT                   /note="PS00548 Ribosomal protein S3 signature."
FT   CDS_pept        247898..248329
FT                   /transl_table=11
FT                   /gene="rplP"
FT                   /locus_tag="TW214"
FT                   /product="50s ribosomal protein L16"
FT                   /note="Similar to Bacillus subtilis 50s ribosomal protein
FT                   L16 RplP SWALL:RL16_BACSU (SWALL:P14577) (144 aa) fasta
FT                   scores: E(): 2.4e-32, 56.61% id in 136 aa"
FT                   /db_xref="GOA:Q83I71"
FT                   /db_xref="InterPro:IPR000114"
FT                   /db_xref="InterPro:IPR016180"
FT                   /db_xref="InterPro:IPR020798"
FT                   /db_xref="InterPro:IPR036920"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I71"
FT                   /protein_id="CAD66891.1"
FT   misc_feature    247901..248294
FT                   /note="Ribosomal protein L16 Score = 246.8 E-value =
FT                   2.1e-71"
FT   misc_feature    248144..248179
FT                   /note="PS00701 Ribosomal protein L16 signature 2."
FT   CDS_pept        248316..248555
FT                   /transl_table=11
FT                   /gene="rpmC"
FT                   /locus_tag="TW215"
FT                   /product="50s ribosomal protein L29"
FT                   /note="Similar to Escherichia coli 50s ribosomal protein
FT                   L29 RpmC or b3312 or z4683 or ecs4177 SWALL:RL29_ECOLI
FT                   (SWALL:P02429) (63 aa) fasta scores: E(): 0.0011, 40% id in
FT                   60 aa, and to Streptomyces coelicolor 50s ribosomal protein
FT                   L29 RpmC or SCO4710 or SCD31.35 SWALL:RL29_STRCO
FT                   (SWALL:Q9L0D2) (74 aa) fasta scores: E(): 9.1e-12, 54.93%
FT                   id in 71 aa"
FT                   /db_xref="GOA:Q83I70"
FT                   /db_xref="InterPro:IPR001854"
FT                   /db_xref="InterPro:IPR036049"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I70"
FT                   /protein_id="CAD66892.1"
FT   misc_feature    248340..248526
FT                   /note="Ribosomal L29 protein Score = 75.4 E-value =
FT                   8.4e-20"
FT   CDS_pept        248552..248812
FT                   /transl_table=11
FT                   /gene="rpsQ"
FT                   /locus_tag="TW216"
FT                   /product="30S ribosomal protein S17"
FT                   /note="Similar to Escherichia coli 30s ribosomal protein
FT                   S17 RpsQ or NeaA or b3311 or z4681 or ecs4176
FT                   SWALL:RS17_ECOLI (SWALL:P02373) (83 aa) fasta scores: E():
FT                   2.3e-12, 49.35% id in 77 aa"
FT                   /db_xref="GOA:Q83I69"
FT                   /db_xref="InterPro:IPR000266"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR019979"
FT                   /db_xref="InterPro:IPR019984"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I69"
FT                   /protein_id="CAD66893.1"
FT   misc_feature    248588..248792
FT                   /note="Ribosomal protein S17 Score = 113.0 E-value = 4e-31"
FT   misc_feature    248726..248764
FT                   /note="PS00056 Ribosomal protein S17 signature."
FT   CDS_pept        248910..249281
FT                   /transl_table=11
FT                   /gene="rplN"
FT                   /locus_tag="TW217"
FT                   /product="50s ribosomal protein L14"
FT                   /note="Similar to Bacillus stearothermophilus 50s ribosomal
FT                   protein L14 RplN SWALL:RL14_BACST (SWALL:P04450) (122 aa)
FT                   fasta scores: E(): 1e-30, 72.35% id in 123 aa"
FT                   /db_xref="GOA:Q83I68"
FT                   /db_xref="InterPro:IPR000218"
FT                   /db_xref="InterPro:IPR005745"
FT                   /db_xref="InterPro:IPR019972"
FT                   /db_xref="InterPro:IPR036853"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I68"
FT                   /protein_id="CAD66894.1"
FT   misc_feature    248910..249276
FT                   /note="Ribosomal protein L14p/L23e Score = 260.6 E-value =
FT                   1.4e-75"
FT   misc_feature    249090..249170
FT                   /note="PS00049 Ribosomal protein L14 signature."
FT   CDS_pept        249284..249625
FT                   /transl_table=11
FT                   /gene="rplX"
FT                   /locus_tag="TW218"
FT                   /product="50S ribosomal protein L24"
FT                   /note="Similar to Bacillus stearothermophilus 50s ribosomal
FT                   protein L24 RplX SWALL:RL24_BACST (SWALL:P04455) (103 aa)
FT                   fasta scores: E(): 1.9e-11, 42.85% id in 112 aa"
FT                   /db_xref="GOA:Q83I67"
FT                   /db_xref="InterPro:IPR003256"
FT                   /db_xref="InterPro:IPR008991"
FT                   /db_xref="InterPro:IPR014722"
FT                   /db_xref="InterPro:IPR041988"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I67"
FT                   /protein_id="CAD66895.1"
FT                   AKKSGKELT"
FT   misc_feature    249302..249382
FT                   /note="PS00052 Ribosomal protein S7 signature."
FT   CDS_pept        249622..250173
FT                   /transl_table=11
FT                   /gene="rplE"
FT                   /locus_tag="TW219"
FT                   /product="50S ribosomal protein L5"
FT                   /note="Similar to Escherichia coli 50s ribosomal protein L5
FT                   RplE or b3308 or z4678 or ecs4173 SWALL:RL5_ECOLI
FT                   (SWALL:P02389) (178 aa) fasta scores: E(): 1.3e-37, 54.23%
FT                   id in 177 aa"
FT                   /db_xref="GOA:Q83I66"
FT                   /db_xref="InterPro:IPR002132"
FT                   /db_xref="InterPro:IPR020930"
FT                   /db_xref="InterPro:IPR022803"
FT                   /db_xref="InterPro:IPR031309"
FT                   /db_xref="InterPro:IPR031310"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I66"
FT                   /protein_id="CAD66896.1"
FT   misc_feature    249703..249871
FT                   /note="Ribosomal protein L5 Score = 98.0 E-value = 1.3e-26"
FT   misc_feature    249883..250165
FT                   /note="ribosomal L5P family C-terminus Score = 177.5
FT                   E-value = 1.5e-50"
FT   CDS_pept        250203..250601
FT                   /transl_table=11
FT                   /gene="rpsH"
FT                   /locus_tag="TW220"
FT                   /product="30S ribosomal protein S8"
FT                   /note="Similar to Bacillus stearothermophilus 30s ribosomal
FT                   protein S8 RpsH SWALL:RS8_BACST (SWALL:P56209) (130 aa)
FT                   fasta scores: E(): 2.1e-25, 57.81% id in 128 aa"
FT                   /db_xref="GOA:Q83I65"
FT                   /db_xref="InterPro:IPR000630"
FT                   /db_xref="InterPro:IPR035987"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I65"
FT                   /protein_id="CAD66897.1"
FT   misc_feature    250215..250596
FT                   /note="Ribosomal protein S8 Score = 214.2 E-value =
FT                   1.4e-61"
FT   misc_feature    250506..250559
FT                   /note="PS00053 Ribosomal protein S8 signature."
FT   CDS_pept        250595..251140
FT                   /transl_table=11
FT                   /gene="rplF"
FT                   /locus_tag="TW221"
FT                   /product="50S ribosomal protein L6"
FT                   /note="Similar to Bacillus stearothermophilus 50s ribosomal
FT                   protein L6 RplF SWALL:RL6_BACST (SWALL:P02391) (177 aa)
FT                   fasta scores: E(): 1.3e-31, 54.8% id in 177 aa"
FT                   /db_xref="GOA:Q83I64"
FT                   /db_xref="InterPro:IPR000702"
FT                   /db_xref="InterPro:IPR002358"
FT                   /db_xref="InterPro:IPR019906"
FT                   /db_xref="InterPro:IPR020040"
FT                   /db_xref="InterPro:IPR036789"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I64"
FT                   /protein_id="CAD66898.1"
FT                   GIRYSDEIVRRKVGKAGK"
FT   misc_feature    250634..250847
FT                   /note="Ribosomal protein L6 Score = 63.0 E-value = 4.5e-16"
FT   misc_feature    250871..251096
FT                   /note="Ribosomal protein L6 Score = 85.9 E-value = 5.6e-23"
FT   misc_feature    251063..251089
FT                   /note="PS00525 Ribosomal protein L6 signature 1."
FT   CDS_pept        251137..251496
FT                   /transl_table=11
FT                   /gene="rplR"
FT                   /locus_tag="TW222"
FT                   /product="50S ribosomal protein L18"
FT                   /note="Similar to Bacillus stearothermophilus 50s ribosomal
FT                   protein L18 RplR SWALL:RL18_BACST (SWALL:P09415) (120 aa)
FT                   fasta scores: E(): 8.7e-20, 52.54% id in 118 aa"
FT                   /db_xref="GOA:Q83I63"
FT                   /db_xref="InterPro:IPR004389"
FT                   /db_xref="InterPro:IPR005484"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I63"
FT                   /protein_id="CAD66899.1"
FT                   VAAVAEGAREAGLQT"
FT   misc_feature    251149..251491
FT                   /note="Ribosomal L18p/L5e family Score = 162.3 E-value =
FT                   5.9e-46"
FT   CDS_pept        251493..252353
FT                   /transl_table=11
FT                   /gene="rpsE"
FT                   /locus_tag="TW223"
FT                   /product="30s ribosomal protein S5"
FT                   /note="Similar to Bacillus stearothermophilus 30s ribosomal
FT                   protein S5 RpsE SWALL:RS5_BACST (SWALL:P02357) (166 aa)
FT                   fasta scores: E(): 5.9e-26, 62.32% id in 146 aa. Has an
FT                   unusually long N-terminal extension relative to homologues
FT                   so may use a downstream alternative translational start
FT                   site."
FT                   /db_xref="GOA:Q83I62"
FT                   /db_xref="InterPro:IPR000851"
FT                   /db_xref="InterPro:IPR005324"
FT                   /db_xref="InterPro:IPR005712"
FT                   /db_xref="InterPro:IPR013810"
FT                   /db_xref="InterPro:IPR014721"
FT                   /db_xref="InterPro:IPR018192"
FT                   /db_xref="InterPro:IPR020568"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I62"
FT                   /protein_id="CAD66900.1"
FT                   SSDTA"
FT   misc_feature    251829..252027
FT                   /note="Ribosomal protein S5, N-terminal domain Score =
FT                   136.6 E-value = 3.2e-38"
FT   misc_feature    251883..251981
FT                   /note="PS00585 Ribosomal protein S5 signature."
FT   misc_feature    252054..252273
FT                   /note="Ribosomal protein S5, C-terminal domain Score =
FT                   126.0 E-value = 4.8e-35"
FT   CDS_pept        252558..253001
FT                   /transl_table=11
FT                   /gene="rplO"
FT                   /locus_tag="TW224"
FT                   /product="50s ribosomal protein L15"
FT                   /note="Similar to Bacillus stearothermophilus 50s ribosomal
FT                   protein L15 RplO SWALL:RL15_BACST (SWALL:P04452) (146 aa)
FT                   fasta scores: E(): 3.1e-15, 44.75% id in 143 aa"
FT                   /db_xref="GOA:Q83I61"
FT                   /db_xref="InterPro:IPR005749"
FT                   /db_xref="InterPro:IPR021131"
FT                   /db_xref="InterPro:IPR030878"
FT                   /db_xref="InterPro:IPR036227"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I61"
FT                   /protein_id="CAD66901.1"
FT   misc_feature    252567..252861
FT                   /note="Ribosomal protein L15 amino terminal region Score =
FT                   123.2 E-value = 3.4e-34"
FT   misc_feature    252630..252653
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    252885..252978
FT                   /note="Ribosomal protein L15 Score = 29.2 E-value = 7e-06"
FT   CDS_pept        253023..254348
FT                   /transl_table=11
FT                   /gene="secY"
FT                   /locus_tag="TW225"
FT                   /product="preprotein translocase SecY subunit"
FT                   /note="Similar to Streptomyces griseus preprotein
FT                   translocase SecY subunit SWALL:SECY_STRGR (SWALL:Q59916)
FT                   (437 aa) fasta scores: E(): 2.9e-97, 57.52% id in 445 aa"
FT                   /protein_id="CAD66902.1"
FT   misc_feature    253023..253166
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.891) with cleavage
FT                   site probability 0.399 between residues 48 and 49"
FT   misc_feature    order(253077..253145,253242..253310,253368..253436,
FT                   253494..253562,253581..253649,253662..253730,
FT                   253791..253859,253980..254048,254163..254231)
FT                   /note="9 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 19-41, 74-96, 116-138,
FT                   158-180, 187-209, 214-236, 257-279, 320-342 and 381-403"
FT   misc_feature    253239..253298
FT                   /note="PS00755 Protein secY signature 1."
FT   misc_feature    253239..254295
FT                   /note="eubacterial secY protein Score = 548.2 E-value =
FT                   3.8e-162"
FT   misc_feature    253554..253610
FT                   /note="PS00756 Protein secY signature 2."
FT   CDS_pept        254348..254908
FT                   /transl_table=11
FT                   /gene="adk"
FT                   /locus_tag="TW226"
FT                   /product="adenylate kinase"
FT                   /note="Similar to Xanthomonas campestris adenylate kinase
FT                   Adk or Xcc3291 SWALL:AAM42561 (EMBL:AE012446) (187 aa)
FT                   fasta scores: E(): 3.3e-21, 37.96% id in 187 aa, and to
FT                   Homo sapiens adenylate kinase isoenzyme 1 Ak1
FT                   SWALL:KAD1_HUMAN (SWALL:P00568) (194 aa) fasta scores: E():
FT                   3.7e-14, 32.78% id in 183 aa"
FT                   /db_xref="GOA:Q83I60"
FT                   /db_xref="InterPro:IPR000850"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR033690"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I60"
FT                   /protein_id="CAD66903.1"
FT   misc_feature    254360..254825
FT                   /note="Adenylate kinase Score = 139.0 E-value = 5.8e-39"
FT   misc_feature    254576..254611
FT                   /note="PS00113 Adenylate kinase signature."
FT   CDS_pept        254911..255774
FT                   /transl_table=11
FT                   /locus_tag="TW227"
FT                   /product="putative aminotransferase"
FT                   /note="Similar to Bacillus licheniformis D-alanine
FT                   aminotransferase Dat SWALL:DAAA_BACLI (SWALL:P54692) (283
FT                   aa) fasta scores: E(): 5.1e-11, 29.91% id in 244 aa"
FT                   /protein_id="CAD66904.1"
FT                   LARSAV"
FT   misc_feature    254962..255757
FT                   /note="Aminotransferase class IV Score = 23.8 E-value =
FT                   2.5e-12"
FT   CDS_pept        255844..256065
FT                   /transl_table=11
FT                   /gene="infA"
FT                   /locus_tag="TW228"
FT                   /product="translation initiation factor IF-1"
FT                   /note="Similar to Escherichia coli translation initiation
FT                   factor IF-1 InfA or b0884 or z1228 or ecs0969 or stm0953 or
FT                   sty0951 SWALL:IF1_ECOLI (SWALL:P02998) (71 aa) fasta
FT                   scores: E(): 3.7e-16, 65.27% id in 72 aa"
FT                   /db_xref="GOA:Q83I58"
FT                   /db_xref="InterPro:IPR004368"
FT                   /db_xref="InterPro:IPR006196"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I58"
FT                   /protein_id="CAD66905.1"
FT   misc_feature    255850..256060
FT                   /note="S1 RNA binding domain Score = 34.6 E-value =
FT                   1.6e-07"
FT   misc_feature    256021..256050
FT                   /note="PS00215 Mitochondrial energy transfer proteins
FT                   signature."
FT   CDS_pept        256068..256187
FT                   /transl_table=11
FT                   /gene="rpmJ"
FT                   /locus_tag="TW229"
FT                   /product="50S ribosomal protein L36"
FT                   /note="Similar to Thermus thermophilus 50s ribosomal
FT                   protein L36 RpmJ or Rpl36 SWALL:RL36_THETH (SWALL:P80256)
FT                   (37 aa) fasta scores: E(): 3.8e-10, 70.27% id in 37 aa"
FT                   /db_xref="GOA:Q83I57"
FT                   /db_xref="InterPro:IPR000473"
FT                   /db_xref="InterPro:IPR035977"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I57"
FT                   /protein_id="CAD66906.1"
FT   misc_feature    256074..256182
FT                   /note="Ribosomal protein L36 Score = 62.1 E-value =
FT                   8.6e-16"
FT   misc_feature    256104..256181
FT                   /note="PS00828 Ribosomal protein L36 signature."
FT   CDS_pept        256222..256596
FT                   /transl_table=11
FT                   /gene="rpsM"
FT                   /locus_tag="TW230"
FT                   /product="30S ribosomal protein S13"
FT                   /note="Similar to Synechococcus sp. 30s ribosomal protein
FT                   S13 RpsM or Rps13 SWALL:RS13_SYNP6 (SWALL:O24708) (125 aa)
FT                   fasta scores: E(): 6.5e-27, 61.78% id in 123 aa"
FT                   /db_xref="GOA:P66398"
FT                   /db_xref="InterPro:IPR001892"
FT                   /db_xref="InterPro:IPR010979"
FT                   /db_xref="InterPro:IPR018269"
FT                   /db_xref="InterPro:IPR019980"
FT                   /db_xref="InterPro:IPR027437"
FT                   /db_xref="UniProtKB/Swiss-Prot:P66398"
FT                   /protein_id="CAD66907.1"
FT   misc_feature    256228..256546
FT                   /note="Ribosomal protein S13/S18 Score = 166.5 E-value =
FT                   3.1e-47"
FT   misc_feature    256309..256341
FT                   /note="PS00639 Eukaryotic thiol (cysteine) proteases
FT                   histidine active site."
FT   CDS_pept        256600..256992
FT                   /transl_table=11
FT                   /gene="rpsK"
FT                   /locus_tag="TW231"
FT                   /product="30S ribosomal protein S11"
FT                   /note="Similar to Escherichia coli 30s ribosomal protein
FT                   S11 RpsK or b3297 or z4667 or ecs4162 SWALL:RS11_ECOLI
FT                   (SWALL:P02366) (128 aa) fasta scores: E(): 7.1e-26, 56.69%
FT                   id in 127 aa"
FT                   /db_xref="GOA:P66366"
FT                   /db_xref="InterPro:IPR001971"
FT                   /db_xref="InterPro:IPR018102"
FT                   /db_xref="InterPro:IPR019981"
FT                   /db_xref="InterPro:IPR036967"
FT                   /db_xref="UniProtKB/Swiss-Prot:P66366"
FT                   /protein_id="CAD66908.1"
FT   misc_feature    256657..256984
FT                   /note="Ribosomal protein S11 Score = 226.0 E-value =
FT                   3.8e-65"
FT   CDS_pept        257011..257994
FT                   /transl_table=11
FT                   /gene="rpoA"
FT                   /locus_tag="TW232"
FT                   /product="DNA-directed RNA polymerase alpha chain"
FT                   /EC_number=""
FT                   /note="Similar to Streptomyces coelicolor DNA-directed RNA
FT                   polymerase alpha chain RpoA or SCO4729 or SC6G4.07
FT                   SWALL:RPOA_STRCO (SWALL:P72404) (340 aa) fasta scores: E():
FT                   9.7e-75, 63.91% id in 327 aa"
FT                   /db_xref="GOA:Q820D8"
FT                   /db_xref="InterPro:IPR011260"
FT                   /db_xref="InterPro:IPR011262"
FT                   /db_xref="InterPro:IPR011263"
FT                   /db_xref="InterPro:IPR011773"
FT                   /db_xref="InterPro:IPR036603"
FT                   /db_xref="InterPro:IPR036643"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q820D8"
FT                   /protein_id="CAD66909.1"
FT   misc_feature    257062..257668
FT                   /note="Bacterial RNA polymerase, alpha chain, N terminal
FT                   domain Score = 367.9 E-value = 7.6e-108"
FT   misc_feature    257632..257655
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    257719..257920
FT                   /note="Bacterial RNA polymerase, alpha chain C terminal
FT                   domain Score = 115.3 E-value = 8.3e-32"
FT   CDS_pept        258010..258549
FT                   /transl_table=11
FT                   /gene="rplQ"
FT                   /locus_tag="TW233"
FT                   /product="50S ribosomal protein L17"
FT                   /note="Similar to Bacillus stearothermophilus 50s ribosomal
FT                   protein L17 RplQ SWALL:RL17_BACST (SWALL:P07843) (119 aa)
FT                   fasta scores: E(): 3.8e-13, 47.7% id in 109 aa"
FT                   /db_xref="GOA:Q83I55"
FT                   /db_xref="InterPro:IPR000456"
FT                   /db_xref="InterPro:IPR036373"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I55"
FT                   /protein_id="CAD66910.1"
FT                   APADPGESSSNQRVIR"
FT   misc_feature    258067..258355
FT                   /note="Ribosomal protein L17 Score = 130.0 E-value = 3e-36"
FT   CDS_pept        258575..259378
FT                   /transl_table=11
FT                   /gene="truA"
FT                   /locus_tag="TW234"
FT                   /product="tRNA pseudouridine synthase A"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli tRNA pseudouridine
FT                   synthase A TruA or HisT or AsuC or LeuK or b2318
FT                   SWALL:TRUA_ECOLI (SWALL:P07649) (270 aa) fasta scores: E():
FT                   5.1e-18, 32.27% id in 251 aa, and to Streptomyces
FT                   coelicolor tRNA pseudouridine synthase A TruA or SCO4731 or
FT                   SC6G4.09 SWALL:TRUA_STRCO (SWALL:O86776) (284 aa) fasta
FT                   scores: E(): 4.5e-34, 40.59% id in 271 aa"
FT                   /db_xref="GOA:Q820Z2"
FT                   /db_xref="InterPro:IPR001406"
FT                   /db_xref="InterPro:IPR020095"
FT                   /db_xref="InterPro:IPR020097"
FT                   /db_xref="InterPro:IPR020103"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q820Z2"
FT                   /protein_id="CAD66911.1"
FT   misc_feature    258596..258896
FT                   /note="tRNA pseudouridine synthase Score = 83.2 E-value =
FT                   3.9e-22"
FT   misc_feature    259016..259322
FT                   /note="tRNA pseudouridine synthase Score = 42.0 E-value =
FT                   9.3e-10"
FT   CDS_pept        complement(259491..260606)
FT                   /transl_table=11
FT                   /locus_tag="TW235"
FT                   /product="putative MRP-family ATP-binding protein"
FT                   /note="Similar to Mycobacterium tuberculosis Mrp protein
FT                   homolog or rv1229c or mt1267 or mtci61.12c or mtv006.01C
FT                   SWALL:MRP_MYCTU (SWALL:O33225) (381 aa) fasta scores: E():
FT                   1.2e-45, 43.83% id in 365 aa"
FT                   /protein_id="CAD66912.1"
FT   misc_feature    complement(260207..260291)
FT                   /note="4Fe-4S iron sulfur cluster binding proteins,
FT                   NifH/frxC family Score = 24.8 E-value = 3.1e-07"
FT   misc_feature    complement(260247..260270)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(260381..260603)
FT                   /note="Domain of unknown function DUF59 Score = 54.4
FT                   E-value = 1.8e-13"
FT   CDS_pept        complement(260614..261108)
FT                   /transl_table=11
FT                   /locus_tag="TW236"
FT                   /product="conserved hypothetical membrane protein"
FT                   /note="Similar to Mycobacterium tuberculosis hypothetical
FT                   protein Rv1231c or mtv006.03c or mt1269 SWALL:O86314
FT                   (EMBL:Z98260) (180 aa) fasta scores: E(): 1.4e-09, 39.25%
FT                   id in 135 aa"
FT                   /protein_id="CAD66913.1"
FT                   S"
FT   misc_feature    complement(order(260833..260901,260944..261012))
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 33-55 and 70-92"
FT   CDS_pept        complement(261095..262342)
FT                   /transl_table=11
FT                   /locus_tag="TW237"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein SCO5154 or SCP8.17c SWALL:Q9FBK4 (EMBL:AL390975)
FT                   (433 aa) fasta scores: E(): 6.5e-37, 38.06% id in 423 aa"
FT                   /protein_id="CAD66914.1"
FT                   IDSTNNKENMVHNEKE"
FT   misc_feature    complement(261172..261331)
FT                   /note="CBS domain Score = 37.5 E-value = 2.2e-08"
FT   misc_feature    complement(261349..261538)
FT                   /note="CBS domain Score = 22.5 E-value = 0.00068"
FT   misc_feature    complement(261544..261925)
FT                   /note="MgtE intracellular domain Score = 58.7 E-value =
FT                   8.8e-15"
FT   CDS_pept        complement(262339..263508)
FT                   /transl_table=11
FT                   /locus_tag="TW238"
FT                   /product="Xaa-Pro aminopeptidase"
FT                   /note="Similar to Streptomyces coelicolor Xaa-Pro
FT                   aminopeptidase I PepP1 or SCO3970 or SCBAC25e3.07c
FT                   SWALL:AMP1_STRCO (SWALL:Q05813) (490 aa) fasta scores: E():
FT                   6.8e-55, 43.76% id in 409 aa, and to Escherichia coli
FT                   Xaa-Pro aminopeptidase PepP or b2908 SWALL:AMPP_ECOLI
FT                   (SWALL:P15034) (440 aa) fasta scores: E(): 1.9e-26, 35.63%
FT                   id in 275 aa"
FT                   /protein_id="CAD66915.1"
FT   misc_feature    complement(262365..263142)
FT                   /note="metallopeptidase family M24 Score = 185.4 E-value =
FT                   6.3e-53"
FT   misc_feature    complement(262579..262617)
FT                   /note="PS00491 Aminopeptidase P and proline dipeptidase
FT                   signature."
FT   CDS_pept        263951..264562
FT                   /transl_table=11
FT                   /locus_tag="TW240"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66916.1"
FT   CDS_pept        complement(264653..264874)
FT                   /transl_table=11
FT                   /locus_tag="TW241"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Corynebacterium glutamicum hypothetical
FT                   protein Cgl0772 SWALL:BAB98165 (EMBL:AP005276) (75 aa)
FT                   fasta scores: E(): 0.0016, 34.72% id in 72 aa"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66917.1"
FT   CDS_pept        264900..267881
FT                   /transl_table=11
FT                   /locus_tag="TW242"
FT                   /product="putative ATP-dependent DNA helicase subunit"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   ATP-dependent DNA helicase SCO5183 or 2SC3B6.07
FT                   SWALL:Q9FCK5 (EMBL:AL390968) (1159 aa) fasta scores: E():
FT                   2.7e-07, 24.49% id in 1139 aa"
FT                   /protein_id="CAD66918.1"
FT                   FSVK"
FT   misc_feature    264987..265010
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        267878..270799
FT                   /transl_table=11
FT                   /locus_tag="TW243"
FT                   /product="putative ATP-dependent DNA helicase subunit"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   ATP-dependent DNA helicase SCO5184 or 2SC3B6.08
FT                   SWALL:Q9FCK4 (EMBL:AL390968) (1222 aa) fasta scores: E():
FT                   9.9e-16, 26.61% id in 1161 aa, and to Escherichia coli DNA
FT                   helicase II UvrB or MutU or PdeB or Rad or Recl or b3813
FT                   SWALL:UVRD_ECOLI (SWALL:P03018) (720 aa) fasta scores: E():
FT                   2.8e-09, 24.25% id in 800 aa"
FT                   /protein_id="CAD66919.1"
FT   misc_feature    267935..269465
FT                   /note="UvrD/REP helicase Score = 189.1 E-value = 4.8e-54"
FT   misc_feature    267992..268015
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(270823..271998)
FT                   /transl_table=11
FT                   /locus_tag="TW244"
FT                   /product="putative transferase"
FT                   /note="Weakly similar to Escherichia coli macrolide
FT                   2'-phosphotransferase I MphA SWALL:Q47396 (EMBL:D16251)
FT                   (301 aa) fasta scores: E(): 1.4e-07, 26.1% id in 226 aa"
FT                   /protein_id="CAD66920.1"
FT   misc_feature    complement(271915..271998)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.931) with cleavage
FT                   site probability 0.359 between residues 28 and 29"
FT   CDS_pept        272079..273836
FT                   /transl_table=11
FT                   /locus_tag="TW245"
FT                   /product="putative ATP-dependent DNA helicase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   ATP-dependent DNA helicase SCO5188 or 2SC3B6.12
FT                   SWALL:Q9FCK0 (EMBL:AL390968) (785 aa) fasta scores: E():
FT                   2.7e-40, 35.14% id in 606 aa, and to Escherichia coli DNA
FT                   helicase II UvrD or MutU or PdeB or Rad or Recl or b3813
FT                   SWALL:UVRD_ECOLI (SWALL:P03018) (720 aa) fasta scores: E():
FT                   1.5e-19, 25.47% id in 636 aa"
FT                   /protein_id="CAD66921.1"
FT                   CLSPISAKE"
FT   misc_feature    272103..273642
FT                   /note="UvrD/REP helicase Score = 125.7 E-value = 5.9e-35"
FT   misc_feature    272160..272183
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(273875..275149)
FT                   /transl_table=11
FT                   /locus_tag="TW246"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein SCO5199 or 2SC3B6.23c SWALL:Q9FCI9 (EMBL:AL390968)
FT                   (487 aa) fasta scores: E(): 1.7e-38, 32.7% id in 425 aa"
FT                   /protein_id="CAD66922.1"
FT   CDS_pept        275690..276775
FT                   /transl_table=11
FT                   /gene="ftsZ"
FT                   /locus_tag="TW247"
FT                   /product="cell division protein FtsZ"
FT                   /note="Similar to Streptomyces coelicolor cell division
FT                   protein FtsZ or SCO2082 or SC4A10.15c SWALL:FTSZ_STRCO
FT                   (SWALL:P45500) (399 aa) fasta scores: E(): 4.9e-88, 77.28%
FT                   id in 339 aa"
FT                   /protein_id="CAD66923.1"
FT   misc_feature    275723..276302
FT                   /note="Tubulin/FtsZ family, GTPase domain Score = 293.0
FT                   E-value = 2.6e-85"
FT   misc_feature    275819..275923
FT                   /note="PS01134 FtsZ protein signature 1."
FT   misc_feature    275978..276043
FT                   /note="PS01135 FtsZ protein signature 2."
FT   misc_feature    276308..276665
FT                   /note="Tubulin/FtsZ family, C-terminal domain Score = 110.2
FT                   E-value = 2.8e-30"
FT   CDS_pept        276892..277263
FT                   /transl_table=11
FT                   /locus_tag="TW248"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein SCO1749 or 2SCI34.02 SWALL:Q9EWX7 (EMBL:AL445403)
FT                   (146 aa) fasta scores: E(): 3.5e-07, 35.33% id in 133 aa"
FT                   /db_xref="GOA:Q83I43"
FT                   /db_xref="InterPro:IPR007561"
FT                   /db_xref="InterPro:IPR023052"
FT                   /db_xref="InterPro:IPR038594"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I43"
FT                   /protein_id="CAD66924.1"
FT   misc_feature    277006..277243
FT                   /note="Protein of unknown function (DUF552) Score = 105.1
FT                   E-value = 9.9e-29"
FT   CDS_pept        277348..277875
FT                   /transl_table=11
FT                   /locus_tag="TW249"
FT                   /product="putative cell division protein"
FT                   /note="Similar to Bacillus subtilis minicell-associated
FT                   protein DivIVA SWALL:P71021 (EMBL:U60901) (164 aa) fasta
FT                   scores: E(): 0.031, 27.32% id in 161 aa"
FT                   /protein_id="CAD66925.1"
FT                   SGLRDLEPKNPS"
FT   CDS_pept        277872..278324
FT                   /transl_table=11
FT                   /gene="lspA"
FT                   /locus_tag="TW250"
FT                   /product="lipoprotein signal peptidase"
FT                   /EC_number=""
FT                   /note="Similar to Staphylococcus aureus lipoprotein signal
FT                   peptidase LspA or Lsp SWALL:LSPA_STAAU (SWALL:P31024) (163
FT                   aa) fasta scores: E(): 1.9e-07, 35.82% id in 134 aa, and to
FT                   Bacillus halodurans lipoprotein signal peptidase LspA or
FT                   Lsp or bh2543 SWALL:LSPA_BACHD (SWALL:Q9K9V2) (156 aa)
FT                   fasta scores: E(): 3.5e-09, 36.48% id in 148 aa"
FT                   /db_xref="GOA:Q83I41"
FT                   /db_xref="InterPro:IPR001872"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I41"
FT                   /protein_id="CAD66926.1"
FT   misc_feature    277887..278319
FT                   /note="Signal peptidase (SPase) II Score = 51.6 E-value =
FT                   1.2e-12"
FT   misc_feature    order(277896..277964,278037..278105,278124..278183,
FT                   278241..278309)
FT                   /note="4 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 9-31, 56-78, 85-104 and
FT                   124-146"
FT   CDS_pept        278405..279316
FT                   /transl_table=11
FT                   /locus_tag="TW251"
FT                   /product="putative pseudouridine synthase"
FT                   /note="Similar to Streptomyces coelicolor putative
FT                   ribosomal large subunit pseudouridine synthase SCO2073 or
FT                   SC4A10.06c SWALL:Q9S2X8 (EMBL:AL109663) (314 aa) fasta
FT                   scores: E(): 2.5e-42, 49.55% id in 224 aa"
FT                   /protein_id="CAD66927.1"
FT   misc_feature    278654..279107
FT                   /note="RNA pseudouridylate synthase Score = 184.6 E-value =
FT                   1.1e-52"
FT   misc_feature    278783..278827
FT                   /note="PS01129 Rlu family of pseudouridine synthase
FT                   signature."
FT   CDS_pept        279326..282820
FT                   /transl_table=11
FT                   /gene="dnaE"
FT                   /locus_tag="TW252"
FT                   /product="DNA polymerase III alpha subunit"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli DNA polymerase III alpha
FT                   subunit DnaE or PolC or b0184 SWALL:DP3A_ECOLI
FT                   (SWALL:P10443) (1160 aa) fasta scores: E(): 2.8e-112,
FT                   36.11% id in 1188 aa"
FT                   /protein_id="CAD66928.1"
FT   misc_feature    279347..279542
FT                   /note="PHP domain N-terminal region Score = 123.8 E-value =
FT                   2.2e-34"
FT   misc_feature    279623..280016
FT                   /note="PHP domain C-terminal region Score = 124.3 E-value =
FT                   1.6e-34"
FT   misc_feature    282332..282566
FT                   /note="OB-fold nucleic acid binding domain Score = 50.6
FT                   E-value = 2.5e-12"
FT   tRNA            282872..282944
FT                   /note="tRNA Glu anticodon CTC, Cove score 56.40"
FT   CDS_pept        283033..283935
FT                   /transl_table=11
FT                   /locus_tag="TW253"
FT                   /product="conserved integral membrane protein."
FT                   /note="Similar to Streptomyces coelicolor putative integral
FT                   membrane protein SCO0892 or SCM1.25c SWALL:Q9RD18
FT                   (EMBL:AL133422) (316 aa) fasta scores: E(): 8.5e-37, 42.12%
FT                   id in 292 aa"
FT                   /protein_id="CAD66929.1"
FT   misc_feature    order(283078..283143,283186..283254,283273..283341,
FT                   283351..283404,283525..283584,283597..283665,
FT                   283723..283782,283825..283893)
FT                   /note="8 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 7-28, 43-65, 72-94, 98-115,
FT                   156-175, 180-202, 222-241 and 256-278"
FT   misc_feature    283153..283891
FT                   /note="Integral membrane protein TerC family Score = 166.4
FT                   E-value = 3.5e-47"
FT   CDS_pept        283980..285305
FT                   /transl_table=11
FT                   /gene="murA"
FT                   /locus_tag="TW254"
FT                   /product="UDP-N-acetylglucosamine
FT                   1-carboxyvinyltransferase"
FT                   /EC_number=""
FT                   /note="Similar to Bacillus subtilis UDP-N-acetylglucosamine
FT                   1-carboxyvinyltransferase 1 MurAa or MurA SWALL:MUA1_BACSU
FT                   (SWALL:P70965) (436 aa) fasta scores: E(): 3.9e-41, 35.94%
FT                   id in 434 aa, and to Streptomyces coelicolor
FT                   UDP-N-acetylglucosamine transferase MurA or SCO2949 or
FT                   SCE59.08 SWALL:Q9L1U5 (EMBL:AL138851) (448 aa) fasta
FT                   scores: E(): 5e-102, 58.73% id in 441 aa"
FT                   /protein_id="CAD66930.1"
FT   misc_feature    284013..285273
FT                   /note="EPSP synthase (3-phosphoshikimate
FT                   1-carboxyvinyltransferase) Score = 229.6 E-value = 3.2e-66"
FT   misc_feature    285195..285218
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        285371..286027
FT                   /transl_table=11
FT                   /locus_tag="TW255"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Mycobacterium tuberculosis hypothetical
FT                   27.0 kDa protein Rv2182c or mtv021.15c or mt2237
FT                   SWALL:O53516 (EMBL:AL021957) (247 aa) fasta scores: E():
FT                   6.9e-07, 26.92% id in 208 aa"
FT                   /protein_id="CAD66931.1"
FT   misc_feature    285389..285968
FT                   /note="Acyltransferase Score = 77.5 E-value = 1.9e-20"
FT   CDS_pept        286002..286979
FT                   /transl_table=11
FT                   /gene="gpsA"
FT                   /locus_tag="TW256"
FT                   /product="glycerol-3-phosphate dehydrogenase"
FT                   /EC_number=""
FT                   /note="Similar to Bacillus subtilis glycerol-3-phosphate
FT                   dehydrogenase GpsA or GlyC SWALL:GPDA_BACSU (SWALL:P46919)
FT                   (345 aa) fasta scores: E(): 1.2e-31, 36.94% id in 314 aa,
FT                   and to Streptomyces coelicolor glycerol-3-phosphate
FT                   dehydrogenase GpsA or SCO5559 or SC7A1.03 SWALL:GPDA_STRCO
FT                   (SWALL:Q9ZBS0) (336 aa) fasta scores: E(): 1.6e-39, 43.59%
FT                   id in 312 aa"
FT                   /db_xref="GOA:Q83I37"
FT                   /db_xref="InterPro:IPR006109"
FT                   /db_xref="InterPro:IPR006168"
FT                   /db_xref="InterPro:IPR008927"
FT                   /db_xref="InterPro:IPR011128"
FT                   /db_xref="InterPro:IPR013328"
FT                   /db_xref="InterPro:IPR036291"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I37"
FT                   /protein_id="CAD66932.1"
FT   misc_feature    286020..286962
FT                   /note="NAD-dependent glycerol-3-phosphate dehydrogenase
FT                   Score = 324.5 E-value = 8.9e-95"
FT   CDS_pept        286979..288022
FT                   /transl_table=11
FT                   /gene="ddlA"
FT                   /locus_tag="TW257"
FT                   /product="D-alanine--D-alanine ligase A"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli, and Escherichia coli
FT                   O157:H7 D-alanine--D-alanine ligase A DdlA or b0381 or
FT                   z0477 or ecs0431 SWALL:DDLA_ECOLI (SWALL:P23844) (364 aa)
FT                   fasta scores: E(): 5.1e-32, 32.86% id in 353 aa"
FT                   /db_xref="GOA:Q83I36"
FT                   /db_xref="InterPro:IPR000291"
FT                   /db_xref="InterPro:IPR005905"
FT                   /db_xref="InterPro:IPR011095"
FT                   /db_xref="InterPro:IPR011127"
FT                   /db_xref="InterPro:IPR011761"
FT                   /db_xref="InterPro:IPR013815"
FT                   /db_xref="InterPro:IPR016185"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I36"
FT                   /protein_id="CAD66933.1"
FT                   AYCQVKR"
FT   misc_feature    286979..287993
FT                   /note="D-ala D-ala ligase Score = 313.1 E-value = 2.4e-91"
FT   misc_feature    287276..287311
FT                   /note="PS00843 D-alanine--D-alanine ligase signature 1."
FT   CDS_pept        complement(288036..288500)
FT                   /transl_table=11
FT                   /locus_tag="TW258"
FT                   /product="conserved hypothetical lipoprotein"
FT                   /note="Weakly similar to Streptomyces coelicolor
FT                   hypothetical protein SCO3628 or SCH10.06c SWALL:Q9X8P5
FT                   (EMBL:AL049754) (163 aa) fasta scores: E(): 3.8e-07, 32.79%
FT                   id in 125 aa"
FT                   /protein_id="CAD66934.1"
FT   misc_feature    complement(288408..288500)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.997) with cleavage
FT                   site probability 0.910 between residues 44 and 45"
FT   misc_feature    complement(288441..288473)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(288527..289912)
FT                   /transl_table=11
FT                   /locus_tag="TW259"
FT                   /product="putative lipoamide acyltransferase"
FT                   /note="Similar to Bacillus subtilis lipoamide
FT                   acyltransferase component of branched-chain alpha-keto acid
FT                   dehydrogenase complex BfmB SWALL:ODB2_BACSU (SWALL:P37942)
FT                   (424 aa) fasta scores: E(): 1.6e-33, 34.64% id in 459 aa,
FT                   and to Streptomyces seoulensis dihydrolipoamide
FT                   acetyltransferase PdhB SWALL:Q9Z6I4 (EMBL:AF047034) (612
FT                   aa) fasta scores: E(): 1.3e-48, 41.3% id in 477 aa"
FT                   /protein_id="CAD66935.1"
FT                   CTV"
FT   misc_feature    complement(288550..289234)
FT                   /note="2-oxo acid dehydrogenases acyltransferase (catalytic
FT                   domain) Score = 345.2 E-value = 4.9e-101"
FT   misc_feature    complement(289333..289447)
FT                   /note="e3 binding domain Score = 55.3 E-value = 9.7e-14"
FT   misc_feature    complement(289687..289906)
FT                   /note="Biotin-requiring enzyme Score = 86.1 E-value =
FT                   5.2e-23"
FT   misc_feature    complement(289745..289834)
FT                   /note="PS00189 2-oxo acid dehydrogenases acyltransferase
FT                   component lipoyl binding site."
FT   CDS_pept        complement(290066..291418)
FT                   /transl_table=11
FT                   /gene="acoL"
FT                   /locus_tag="TW260"
FT                   /product="dihydrolipoamide dehydrogenase"
FT                   /EC_number=""
FT                   /note="Similar to Bacillus subtilis dihydrolipoamide
FT                   dehydrogenase AcoL SWALL:DLD3_BACSU (SWALL:O34324) (458 aa)
FT                   fasta scores: E(): 2.9e-46, 35.07% id in 459 aa"
FT                   /protein_id="CAD66936.1"
FT   misc_feature    complement(290104..290431)
FT                   /note="Pyridine nucleotide-disulphide oxidoreductase,
FT                   dimerisation domain Score = 126.5 E-value = 3.6e-35"
FT   misc_feature    complement(290506..291409)
FT                   /note="Pyridine nucleotide-disulphide oxidoreductase Score
FT                   = 273.2 E-value = 2.3e-79"
FT   misc_feature    complement(291278..291310)
FT                   /note="PS00076 Pyridine nucleotide-disulphide
FT                   oxidoreductases class-I active site."
FT   CDS_pept        complement(291425..292933)
FT                   /transl_table=11
FT                   /locus_tag="TW261"
FT                   /product="putative aminopeptidase"
FT                   /note="Similar to Rickettsia prowazekii cytosol
FT                   aminopeptidase PepA or Rp142 SWALL:AMPA_RICPR
FT                   (SWALL:P27888) (500 aa) fasta scores: E(): 5.4e-43, 35.72%
FT                   id in 459 aa"
FT                   /db_xref="GOA:Q83I32"
FT                   /db_xref="InterPro:IPR000819"
FT                   /db_xref="InterPro:IPR008283"
FT                   /db_xref="InterPro:IPR011356"
FT                   /db_xref="InterPro:IPR023042"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I32"
FT                   /protein_id="CAD66937.1"
FT   misc_feature    complement(291472..292423)
FT                   /note="Cytosol aminopeptidase family, catalytic domain
FT                   Score = 408.1 E-value = 5.7e-120"
FT   misc_feature    complement(291911..291934)
FT                   /note="PS00631 Cytosol aminopeptidase signature."
FT   misc_feature    complement(292528..292864)
FT                   /note="Cytosol aminopeptidase family, N-terminal domain
FT                   Score = 25.8 E-value = 6.8e-05"
FT   CDS_pept        complement(293012..296086)
FT                   /transl_table=11
FT                   /gene="glyQS"
FT                   /locus_tag="TW262"
FT                   /product="glycyl-tRNA synthetase"
FT                   /EC_number=""
FT                   /note="Similar to Chlamydia pneumoniae glycyl-tRNA
FT                   synthetase GlyQS or GlyQ or cpn0946 or cp0913
FT                   SWALL:SYG_CHLPN (SWALL:Q9Z6W0) (1010 aa) fasta scores: E():
FT                   8.9e-78, 30.52% id in 1055 aa, and to Arabidopsis thaliana
FT                   aminoacyl-t-RNA synthetase precursor Edd1 SWALL:O23150
FT                   (EMBL:AJ003069) (1067 aa) fasta scores: E(): 1.1e-100,
FT                   39.47% id in 1021 aa"
FT                   /protein_id="CAD66938.1"
FT   misc_feature    complement(293404..295129)
FT                   /note="Glycyl-tRNA synthetase beta subunit Score = 342.0
FT                   E-value = 4.7e-100"
FT   misc_feature    complement(293786..293809)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(295216..296065)
FT                   /note="Glycyl-tRNA synthetase alpha subunit Score = 579.1
FT                   E-value = 1.9e-171"
FT   CDS_pept        296144..297307
FT                   /transl_table=11
FT                   /gene="hrdB"
FT                   /locus_tag="TW263"
FT                   /product="RNA polymerase principal sigma factor hrdb"
FT                   /note="Similar to Streptomyces coelicolor RNA polymerase
FT                   principal sigma factor HrdB or SCO5820 or SC5B8.10
FT                   SWALL:HRDB_STRCO (SWALL:P18183) (511 aa) fasta scores: E():
FT                   2.2e-90, 68.31% id in 385 aa"
FT                   /protein_id="CAD66939.1"
FT   misc_feature    296405..296513
FT                   /note="Sigma-70 factor, region 1.2 Score = 68.6 E-value =
FT                   9.5e-18"
FT   misc_feature    296603..296813
FT                   /note="Sigma-70 region 2 Score = 103.3 E-value = 3.3e-28"
FT   misc_feature    296675..296716
FT                   /note="PS00715 Sigma-70 factors family signature 1."
FT   misc_feature    296825..297071
FT                   /note="Sigma-70 region 3 Score = 143.0 E-value = 3.8e-40"
FT   misc_feature    297107..297266
FT                   /note="Sigma-70, region 4 Score = 70.7 E-value = 2.2e-18"
FT   CDS_pept        297309..298694
FT                   /transl_table=11
FT                   /locus_tag="TW264"
FT                   /product="conserved hypothetical protein (possible murein
FT                   ligase)"
FT                   /note="Similar to Mycobacterium tuberculosis hypothetical
FT                   43.4 kDa protein Rv3712 or mtv025.060 or mt3815
FT                   SWALL:O69679 (EMBL:AL022121) (413 aa) fasta scores: E():
FT                   1.4e-18, 31.18% id in 388 aa. Weak similarity to murein
FT                   ligases."
FT                   /protein_id="CAD66940.1"
FT                   SCY"
FT   misc_feature    297453..297708
FT                   /note="Mur ligase family, catalytic domain Score = 28.9
FT                   E-value = 1.3e-08"
FT   CDS_pept        298685..299464
FT                   /transl_table=11
FT                   /locus_tag="TW265"
FT                   /product="conserved hypothetical protein"
FT                   /note="Weakly similar to many eg. Staphylococcus aureus
FT                   hypothetical protein sav1891 sav1891 or sa1707 or mw1832
FT                   SWALL:Q99SZ5 (EMBL:AP003363) (243 aa) fasta scores: E():
FT                   9e-10, 25.12% id in 203 aa"
FT                   /protein_id="CAD66941.1"
FT   CDS_pept        complement(299448..300608)
FT                   /transl_table=11
FT                   /gene="alr1"
FT                   /locus_tag="TW266"
FT                   /product="alanine racemase I"
FT                   /EC_number=""
FT                   /note="Provides the d-alanine required for cell wall
FT                   biosynthesis. Similar to Streptomyces coelicolor alanine
FT                   racemase Alr or SCO4745 or SC6G4.23 SWALL:ALR_STRCO
FT                   (SWALL:O86786) (391 aa) fasta scores: E(): 1.2e-19, 29.5%
FT                   id in 400 aa, and to Lactobacillus plantarum alanine
FT                   racemase Alr SWALL:ALR_LACPL (SWALL:O08445) (375 aa) fasta
FT                   scores: E(): 0.0001, 24.13% id in 377 aa"
FT                   /protein_id="CAD66942.1"
FT   misc_feature    complement(299462..300503)
FT                   /note="Alanine racemase Score = -93.7 E-value = 8e-08"
FT   CDS_pept        complement(300658..301320)
FT                   /transl_table=11
FT                   /gene="alr2"
FT                   /locus_tag="TW267"
FT                   /product="alanine racemase II"
FT                   /EC_number=""
FT                   /note="Provides the d-alanine required for cell wall
FT                   biosynthesis. Similar to the C-terminal region of alanine
FT                   racemases eg. Corynebacterium glutamicum alanine racemase
FT                   Alr or cgl0588 SWALL:BAB97981 (EMBL:AY077456) (361 aa)
FT                   fasta scores: E(): 1.8e-07, 34.82% id in 112 aa."
FT                   /protein_id="CAD66943.1"
FT   misc_feature    complement(300666..301317)
FT                   /note="Alanine racemase Score = -136.6 E-value = 8.7e-06"
FT   CDS_pept        301377..303365
FT                   /transl_table=11
FT                   /gene="gyrB2"
FT                   /locus_tag="TW268"
FT                   /product="DNA gyrase subunit B"
FT                   /EC_number=""
FT                   /note="Similar to Streptomyces sphaeroides DNA gyrase
FT                   subunit B, novobiocin-sensitive GyrBS SWALL:GYBS_STRSH
FT                   (SWALL:P50075) (684 aa) fasta scores: E(): 1.7e-98, 43% id
FT                   in 665 aa"
FT                   /protein_id="CAD66944.1"
FT   misc_feature    301470..301902
FT                   /note="Histidine kinase-, DNA gyrase B-, and HSP90-like
FT                   ATPase Score = 81.0 E-value = 1.7e-21"
FT   misc_feature    302040..302616
FT                   /note="DNA gyrase B Score = 116.2 E-value = 4.4e-32"
FT   misc_feature    302709..302735
FT                   /note="PS00177 DNA topoisomerase II signature."
FT   misc_feature    302787..303030
FT                   /note="Toprim domain Score = 29.8 E-value = 4.5e-06"
FT   misc_feature    303138..303327
FT                   /note="DNA gyrase B subunit, carboxyl terminus Score =
FT                   111.5 E-value = 1.1e-30"
FT   CDS_pept        complement(join(303376..305334,305334..305618))
FT                   /pseudo
FT                   /transl_table=11
FT                   /gene="ptrB"
FT                   /locus_tag="TW269"
FT                   /product="protease ii"
FT                   /EC_number=""
FT                   /note="Pseudogene. Similar to Escherichia coli protease II
FT                   PtrB or Tlp or b1845 SWALL:PTRB_ECOLI (SWALL:P24555) (686
FT                   aa) fasta scores: E(): 9.4e-45, 30.41% id in 720 aa, and to
FT                   Moraxella lacunata protease II PtrB SWALL:PTRB_MORLA
FT                   (SWALL:Q59536) (690 aa) fasta scores: E(): 1.2e-52, 33.6%
FT                   id in 729 aa"
FT   misc_feature    complement(303801..304038)
FT                   /note="Prolyl oligopeptidase family Score = 107.4 E-value =
FT                   2e-29"
FT   misc_feature    complement(304497..304881)
FT                   /note="Prolyl oligopeptidase, N-terminal beta-propeller
FT                   domain Score = 59.2 E-value = 3.6e-18"
FT   misc_feature    complement(305348..305534)
FT                   /note="Prolyl oligopeptidase, N-terminal beta-propeller
FT                   domain Score = 26.6 E-value = 2.1e-08"
FT   tRNA            305818..305891
FT                   /note="tRNA Ala anticodon CGC, Cove score 74.59"
FT   CDS_pept        305928..307358
FT                   /transl_table=11
FT                   /gene="gnd"
FT                   /locus_tag="TW272"
FT                   /product="6-phosphogluconate dehydrogenase,
FT                   decarboxylating"
FT                   /EC_number=""
FT                   /note="Similar to Escherichia coli 6-phosphogluconate
FT                   dehydrogenase, decarboxylating Gnd or b2029
FT                   SWALL:6PGD_ECOLI (SWALL:P00350) (468 aa) fasta scores: E():
FT                   1.8e-86, 49.57% id in 468 aa"
FT                   /protein_id="CAD66946.1"
FT                   VPGIFHTLWSSDLSEVPA"
FT   misc_feature    305931..306444
FT                   /note="NAD binding domain of 6-phosphogluconate
FT                   dehydrogenase Score = 261.6 E-value = 7.5e-76"
FT   misc_feature    306450..307329
FT                   /note="6-phosphogluconate dehydrogenase, C-terminal domain
FT                   Score = 442.0 E-value = 3.8e-130"
FT   CDS_pept        complement(307631..310096)
FT                   /transl_table=11
FT                   /gene="gyrA1"
FT                   /locus_tag="TW273"
FT                   /product="DNA gyrase subunit A"
FT                   /EC_number=""
FT                   /note="Similar to Clostridium acetobutylicum DNA gyrase
FT                   subunit A GyrA or cac0007 SWALL:GYRA_CLOAB (SWALL:P94605)
FT                   (830 aa) fasta scores: E(): 7.6e-93, 36.54% id in 799 aa"
FT                   /protein_id="CAD66947.1"
FT                   PFVHGNDTY"
FT   misc_feature    complement(307969..308119)
FT                   /note="DNA gyrase C-terminal domain, beta-propeller Score =
FT                   25.5 E-value = 9.1e-05"
FT   misc_feature    complement(308632..309973)
FT                   /note="DNA gyrase/topoisomerase IV, subunit A Score = 715.1
FT                   E-value = 2.2e-212"
FT   CDS_pept        complement(310102..311025)
FT                   /transl_table=11
FT                   /locus_tag="TW274"
FT                   /product="conserved DNA-binding protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein SCO5855 or SC9B10.22c SWALL:O50529 (EMBL:AL009204)
FT                   (352 aa) fasta scores: E(): 0.00048, 28.57% id in 350 aa"
FT                   /protein_id="CAD66948.1"
FT   misc_feature    complement(310765..310830)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1162.000, SD 3.14 at aa 79-100, sequence
FT   CDS_pept        311166..311444
FT                   /transl_table=11
FT                   /locus_tag="TW275"
FT                   /product="conserved hypothetical protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein SCO5864 or SC2E9.05 SWALL:O54130 (EMBL:AL021530)
FT                   (98 aa) fasta scores: E(): 8.6e-13, 49.48% id in 97 aa"
FT                   /protein_id="CAD66949.1"
FT   CDS_pept        complement(311511..311978)
FT                   /transl_table=11
FT                   /locus_tag="TW276"
FT                   /product="putative membrane protein"
FT                   /note="Similar to Mycobacterium leprae u1764i ml1027
FT                   putative membrane protein SWALL:Q49991 (EMBL:U15181) (157
FT                   aa) fasta scores: E(): 2.4e-10, 33.76% id in 154 aa"
FT                   /protein_id="CAD66950.1"
FT   misc_feature    complement(order(311796..311864,311877..311945))
FT                   /note="2 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 12-34 and 39-61"
FT   misc_feature    complement(311871..311978)
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 0.976) with cleavage
FT                   site probability 0.938 between residues 36 and 37"
FT   CDS_pept        312051..312491
FT                   /transl_table=11
FT                   /gene="dut"
FT                   /locus_tag="TW277"
FT                   /product="deoxyuridine 5'-triphosphate nucleotidohydrolase"
FT                   /EC_number=""
FT                   /note="Similar to Streptomyces coelicolor deoxyuridine
FT                   5'-triphosphate nucleotidohydrolase Dut or SCO5868 or
FT                   SC2E9.09 SWALL:DUT_STRCO (SWALL:O54134) (183 aa) fasta
FT                   scores: E(): 5.6e-21, 50% id in 130 aa"
FT                   /db_xref="GOA:Q83I22"
FT                   /db_xref="InterPro:IPR008181"
FT                   /db_xref="InterPro:IPR029054"
FT                   /db_xref="InterPro:IPR033704"
FT                   /db_xref="InterPro:IPR036157"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I22"
FT                   /protein_id="CAD66951.1"
FT   misc_feature    312072..312468
FT                   /note="dUTPase Score = 139.9 E-value = 3.2e-39"
FT   CDS_pept        312484..313059
FT                   /transl_table=11
FT                   /locus_tag="TW278"
FT                   /product="conserved hypothetical protein"
FT                   /note="Weak and partial similarity to Streptomyces
FT                   coelicolor hypothetical protein SCO5869 or SC2E9.10
FT                   SWALL:O54135 (EMBL:AL021530) (250 aa) fasta scores: E():
FT                   2.5e-19, 40% id in 175 aa"
FT                   /protein_id="CAD66952.1"
FT   CDS_pept        313063..313719
FT                   /transl_table=11
FT                   /locus_tag="TW279"
FT                   /product="putative integral membrane protein"
FT                   /note="Similar to Streptomyces coelicolor hypothetical
FT                   protein sSCO5874 or SC2E9.15 SWALL:O54140 (EMBL:AL021530)
FT                   (272 aa) fasta scores: E(): 7.4e-13, 28.72% id in 188 aa"
FT                   /protein_id="CAD66953.1"
FT   misc_feature    order(313216..313284,313303..313371,313384..313488,
FT                   313525..313593,313636..313692)
FT                   /note="5 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 52-74, 81-103, 108-142,
FT                   155-177 and 192-210"
FT   CDS_pept        313747..315636
FT                   /transl_table=11
FT                   /gene="Dxs"
FT                   /locus_tag="TW280"
FT                   /product="1-deoxy-D-xylulose 5-phosphate synthase"
FT                   /EC_number=""
FT                   /note="Similar to Streptomyces sp. 1-deoxy-D-xylulose
FT                   5-phosphate synthase Dxs SWALL:DXS_STRC1 (SWALL:Q9RBN6)
FT                   (631 aa) fasta scores: E(): 3.4e-117, 49.75% id in 621 aa"
FT                   /db_xref="GOA:Q83I20"
FT                   /db_xref="InterPro:IPR005474"
FT                   /db_xref="InterPro:IPR005475"
FT                   /db_xref="InterPro:IPR005477"
FT                   /db_xref="InterPro:IPR009014"
FT                   /db_xref="InterPro:IPR020826"
FT                   /db_xref="InterPro:IPR029061"
FT                   /db_xref="InterPro:IPR033248"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I20"
FT                   /protein_id="CAD66954.1"
FT   misc_feature    313849..313908
FT                   /note="PS00801 Transketolase signature 1."
FT   misc_feature    314719..315211
FT                   /note="Transketolase, pyridine binding domain Score = 187.2
FT                   E-value = 1.9e-53"
FT   misc_feature    315241..315586
FT                   /note="Transketolase, C-terminal domain Score = 37.5
FT                   E-value = 2.2e-08"
FT   tRNA            complement(315950..316020)
FT                   /note="tRNA Gly anticodon TCC, Cove score 77.64"
FT   tRNA            316230..316303
FT                   /note="tRNA Pro anticodon TGG, Cove score 86.69"
FT   CDS_pept        316355..317668
FT                   /transl_table=11
FT                   /gene="tig"
FT                   /locus_tag="TW281"
FT                   /product="trigger factor"
FT                   /note="Similar to Escherichia coli trigger factor Tig or
FT                   b0436 or z0541 or ecs0490 SWALL:TIG_ECOLI (SWALL:P22257)
FT                   (432 aa) fasta scores: E(): 2.8e-12, 25.55% id in 407 aa,
FT                   and to Streptomyces coelicolor trigger factor Tig or
FT                   SCO2620 or SCC80.05c SWALL:Q9F314 (EMBL:AL442143) (468 aa)
FT                   fasta scores: E(): 6.4e-24, 30.9% id in 453 aa"
FT                   /protein_id="CAD66955.1"
FT   CDS_pept        317665..318867
FT                   /transl_table=11
FT                   /locus_tag="TW282"
FT                   /product="putative integral membrane protein"
FT                   /note="No significant database matches"
FT                   /protein_id="CAD66956.1"
FT                   P"
FT   misc_feature    317665..317850
FT                   /note="Signal peptide predicted for Unknown_CDS by SignalP
FT                   2.0 HMM (Signal peptide probabilty 1.000) with cleavage
FT                   site probability 0.488 between residues 62 and 63"
FT   misc_feature    order(317722..317790,317866..317934,317968..318036,
FT                   318073..318132,318151..318210,318253..318321,
FT                   318340..318408,318451..318519,318580..318648,
FT                   318691..318759)
FT                   /note="10 probable transmembrane helices predicted for
FT                   Unknown_CDS by TMHMM2.0 at aa 20-42, 68-90, 102-124,
FT                   137-156, 163-182, 197-219, 226-248, 263-285, 306-328 and
FT                   343-365"
FT   CDS_pept        318864..319406
FT                   /transl_table=11
FT                   /gene="clpP1"
FT                   /locus_tag="TW283"
FT                   /product="ATP-dependent Clp protease proteolytic subunit 1"
FT                   /EC_number=""
FT                   /note="Similar to Streptomyces coelicolor ATP-dependent Clp
FT                   protease proteolytic subunit 1 ClpP1 or SCO2619 or
FT                   SCC80.04c SWALL:CLP1_STRCO (SWALL:Q9F315) (219 aa) fasta
FT                   scores: E(): 5.1e-39, 58.82% id in 170 aa"
FT                   /db_xref="GOA:Q83I19"
FT                   /db_xref="InterPro:IPR001907"
FT                   /db_xref="InterPro:IPR023562"
FT                   /db_xref="InterPro:IPR029045"
FT                   /db_xref="InterPro:IPR033135"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I19"
FT                   /protein_id="CAD66957.1"
FT                   TAEEALEYGFVDHIRTE"
FT   misc_feature    318867..319401
FT                   /note="Clp protease Score = 282.2 E-value = 4.5e-82"
FT   CDS_pept        319418..320041
FT                   /transl_table=11
FT                   /gene="clpP2"
FT                   /locus_tag="TW284"
FT                   /product="ATP dependent Clp protease proteolytic subunit 2"
FT                   /EC_number=""
FT                   /note="Similar to Streptomyces coelicolor ATP-dependent Clp
FT                   protease proteolytic subunit 2 ClpP2 or SCO2618 or
FT                   SCC80.03c SWALL:CLP2_STRCO (SWALL:Q9ZH58) (218 aa) fasta
FT                   scores: E(): 3e-48, 67% id in 197 aa"
FT                   /db_xref="GOA:Q83I18"
FT                   /db_xref="InterPro:IPR001907"
FT                   /db_xref="InterPro:IPR018215"
FT                   /db_xref="InterPro:IPR023562"
FT                   /db_xref="InterPro:IPR029045"
FT                   /db_xref="InterPro:IPR033135"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I18"
FT                   /protein_id="CAD66958.1"
FT   misc_feature    319466..320015
FT                   /note="Clp protease Score = 283.0 E-value = 2.6e-82"
FT   misc_feature    319700..319735
FT                   /note="PS00381 Endopeptidase Clp serine active site."
FT   CDS_pept        320051..321322
FT                   /transl_table=11
FT                   /gene="clpX"
FT                   /locus_tag="TW285"
FT                   /product="ATP dependent Clp Protease ATP binding subunit"
FT                   /note="Similar to Bacillus subtilis ATP-dependent Clp
FT                   protease ATP-binding subunit ClpX SWALL:CLPX_BACSU
FT                   (SWALL:P50866) (420 aa) fasta scores: E(): 6.7e-66, 56.89%
FT                   id in 406 aa"
FT                   /db_xref="GOA:Q83MI6"
FT                   /db_xref="InterPro:IPR003593"
FT                   /db_xref="InterPro:IPR003959"
FT                   /db_xref="InterPro:IPR004487"
FT                   /db_xref="InterPro:IPR010603"
FT                   /db_xref="InterPro:IPR019489"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR038366"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83MI6"
FT                   /protein_id="CAD66959.1"
FT   misc_feature    320408..321167
FT                   /note="ATPase family associated with various cellular
FT                   activities (AAA) Score = 79.5 E-value = 4.9e-21"
FT   misc_feature    320423..320446
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(321314..323884)
FT                   /transl_table=11
FT                   /locus_tag="TW286"
FT                   /product="class I tRNA synthetase (I, L, M and V)"
FT                   /note="Similar to Rickettsia conorii valyl-tRNA synthetase
FT                   ValS or rc1053 SWALL:Q92GR9 (EMBL:AE008656) (812 aa) fasta
FT                   scores: E(): 3.5e-56, 39.75% id in 825 aa, and to
FT                   Thermotoga maritima isoleucyl-tRNA synthetase IleS or
FT                   tm1361 SWALL:SYI_THEMA (SWALL:P46213) (919 aa) fasta
FT                   scores: E(): 2.7e-24, 24.4% id in 881 aa"
FT                   /db_xref="GOA:Q83I17"
FT                   /db_xref="InterPro:IPR001412"
FT                   /db_xref="InterPro:IPR002300"
FT                   /db_xref="InterPro:IPR002303"
FT                   /db_xref="InterPro:IPR009008"
FT                   /db_xref="InterPro:IPR009080"
FT                   /db_xref="InterPro:IPR013155"
FT                   /db_xref="InterPro:IPR014729"
FT                   /db_xref="InterPro:IPR022874"
FT                   /db_xref="InterPro:IPR033705"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q83I17"
FT                   /protein_id="CAD66960.1"
FT   misc_feature    complement(322036..323842)
FT                   /note="tRNA synthetases class I (I, L, M and V) Score =
FT                   155.0 E-value = 9.4e-44"
FT   misc_feature    complement(323711..323746)
FT                   /note="PS00178 Aminoacyl-transfer RNA synthetases class-I
FT                   signature."
SQ   Sequence 324050 BP; 81690 A; 74775 C; 75784 G; 91801 T; 0 other;
     gtgaacaaaa ccctaaatcc acaggaagtc tggataaagg ctgtccgaaa cttagaaggt        60
     tttttctctt cccctcgtgt aataggttac ctcaagaaag cgtcaccttc gatagagggg       120
     gaaagtctca taataacttt cccaaatagc catcttgcct ctgttatgga tgatattgag       180
     gtatacgatg caacaaaaaa gactattctt gactcttacc caagtataaa agagataaaa       240
     ataacaatct ccccggatgt tcttgaaaag gaaataactg aagaaattaa tgaccttgtc       300
     cagtctatgg aagaggaaga ttttgccctt atagatcaca caaagccggt tatcccaaat       360
     ttcttcgatc aaaacacacg ggtaaacttt ggcggaggtc caaacaacca tcacccaaca       420
     acaggcgtta atccaaggtt tacatttgat aatttcgttg taggaaaatc aaatgaactt       480
     gctcgagcgg catcaatttc tgcggcagaa aggcctggaa aatcgttcaa cccccttttt       540
     atatacggag actctggggt tggaaaaaca cacctcctac actcgatagg taattatgca       600
     aaattcttat ttccgtccct cagaattaaa tacgtttctt cagaagactt tacaaatgac       660
     tttataaatt ccatttcttc tggaacaagc caaaagttcc aggaaaaata tcgtcaaata       720
     gacattctta tggttgacga tatccaattt ttgcaaaaga aacaggaaac tcaggaatcc       780
     tttttccata cattcaactc cctccataat tcgagcaggc agcttgttat ctcaagcgac       840
     ttacctccaa agcaattaat gggctttgaa gacagaatga gatcacgatt cgaatgcggt       900
     ttagtgtgtg atatacaaaa acccgatctc gaaacacgaa tcgccattct tcagaagaaa       960
     tgtcagaacg agaaaaaaga agtatcaatg gaaatactca catatatcgc aagttgcttt      1020
     agcagcagtg ttcgagagct tgaaggtgcc cttttgagaa tatttgcgct tgcaagtttc      1080
     aataaagaag aaattaacat gacacttgcg caaaaagtac tagaggacct tggtgcacaa      1140
     aggggtgaca aaatagaccc aatcgaaata atcgagatta ccgcaaaaca ttacgaccta      1200
     gccgcttcag atctttgcgg gaattcacgc gttgcaaata tatctatcgc gaggcaaatt      1260
     gcaatgtatt tatgcagaga actgacagat gtatctcttc caaaacttgg ttatatcttc      1320
     ggaagagatc acagcacaat aatctatgca acgagaagaa taagtgattt gataggaaaa      1380
     gatagaaaaa catttagtga tatatacaag ctcacgcagt ttattttgag gagataattt      1440
     actgtggaaa actctgttga aaaaaataat ttactgtgga aaacttttat atctggttga      1500
     taattatcta agaattatta cgattttgtg gaaaaactac ccgtttttag ttaattctcc      1560
     tgaggctata aacaaataac actattgttc ttaccttttg gatagagtat tcaacacagt      1620
     tttccacatt ttcaacagca cttattaata tgatttttaa attcttttac gggagaataa      1680
     tgcttaagca gtaactgaaa ccttagtgta aaaaagcaaa taattcatta gatagaatga      1740
     gactcttctg atcagattgg gaaaatatga agctgattgt cgatagaggt ctccttagtt      1800
     cctcggtaaa tttcgtaacc cgtatgattc ctgcaagacc tccatcacca atactgtctg      1860
     ggatgttaat tgaggcaaag aatgagaaag ttactctttc aacttttaat tacgagacat      1920
     cagcaaaagt cgaattcagc gcaaatgtaa tagaaggcgg aaaggtctta gtaccgggaa      1980
     ctcttattag tagtatttcg cagaaattgc ctgatgaacc agtagagata agcaaagaag      2040
     atgaaaaaat ttctcttacc tgcggacctg taaattacat acttaatcta atgccgatag      2100
     cagagtatcc gccactacct aaccttgaga atgcagagca gtataggata ccttctgaag      2160
     attttgttaa atcagtctcg caggttacaa catcggccgc aaaagatgat ataagcgcag      2220
     ttataacagg aataaaccta agactttcta atgaatcaat tgaactaaca ggaacagacc      2280
     gttatagagt cgcggtgaag accttaaata gcgtatctgg acatccatct gattcatctg      2340
     ttattgtgtc gtctaaaacc ctttttgagg tttcaaaaac gctcgggaat ttggaaagtg      2400
     aaatatcagt ttttataaaa aatgacggag aaaataaagt tatcggattt gaatcgggaa      2460
     ataagacagt aacgtcgctc ttaatctcgg ggaattatcc gccagttgca aagctattta      2520
     cagaagaaac aggtcattat gcaatcctga aaacaagtga tttcctggaa tcgacaaaaa      2580
     gggtctctgt cgtagttgag agagatgagc caattgagtt ttcttttgta aaaaatacag      2640
     ttacgataaa aggctcaggg atagcacttg caagtgaaaa agttgagtgt gaactatttg      2700
     gtgacgaaat aagtattatg ttgaggccgc agtttttatg cgacggactt attgcttgtc      2760
     aagaggactt tataaaggtt gcattcacaa agccaagcgt taaaaatagg ccaggacctg      2820
     ttcttataac accaaaatta tccaataaag aaaaaataga ctttaagtac cttttacagc      2880
     caaatttatt tgcaaaataa tttgatttct catataaacc taaggaattt tcgaaattat      2940
     gagtaccaaa gtatttcatt tactgatggt ctcaacctta taaggggtga taatggccag      3000
     ggaaagacca accttgctga ggcaatctat tttctgtcgg gtttcggatc tcacaggaca      3060
     tacaaaaacc agcctcttat aaaatcggga gaacagaaag cagagatatc tgcaaaaatt      3120
     cagtctaaat acggaacccg aaatgtatac attggtatat cttgcaattc gaataacatc      3180
     ctaaaagtag acggtaagcc ttcgaaactc agggaccttg tttctgtctt tagctgtgta      3240
     atattctccc cagaggatat agatctagta aagggagatc ccggacacag aagaaaatat      3300
     ctggatgata ttatctgcag ggctcgcccc atgatgctgg acatttattc tgcatatgac      3360
     agaacattaa agcagagaaa ctctctgtta aagagcttta gaaaatcatc atgcaaaagc      3420
     gacctcctgg atatttggac acagaagttg gtggagcttg gcctggaaat agtaaatgct      3480
     cgaaaaagat tactaaagat tttaaatcca aaaattagcg aattttattc aaaacttgcg      3540
     ggggtgagta gcacagctga attattctgc caatcttcag attgccttat agatacattc      3600
     gatctattga gagacagaga aatagaagaa ggtgtaaccc ttgctggacc acatagagat      3660
     aacgttgata ttctcttaaa ttcttgtccg gcaagaagtc aatcaagcca gggagaatca      3720
     tggacccttg cgctgtctat gaaactttcc cttatagagc ttatgaggga aactaaaaga      3780
     ctttacgacc cagatcctgt tgtgatactc gatgatgtct ttgctcatct tgattcatat      3840
     cgaaaacaaa aactcgcaca ggaagtgttt agctatgaac agacgattgt aacaacaacc      3900
     gataattccg ataattacag aacatctcaa acccttgtgg tagaagaggg aaaagtgttc      3960
     agcgaaaaca aaaaggggta actatcaatt ctagaattat aagaaactgt gtgaatcagt      4020
     accttaaaat ctcaaatacg gcaggttatt gtaggccaat tcaggatttc agcagtaacc      4080
     cgtttgatcc aggccgagac ccggtttggg tgtctaactt agttggcgat tttataaaga      4140
     aatttgattg taacaactgt ttaaaaggga ataacataag caatatttgg ccagaagtgg      4200
     tcggcgattt tggagcgagg aatacagagg ttgttgaaat aacccgtaaa ggtgaactag      4260
     ttatttcgtg tttatctagg gccattgcat taagcttcag ggtttatagt gaggatatta      4320
     taaaaaaact taatgaccgg tacccagatc ttaatcttga gaagttgatt tttgttccac      4380
     ccgaatcaag gaggggttat tttggcccga agcttgtcag aaacgtggat aaacactacg      4440
     aatgatagaa tcttgcgtta aggtccttta ggagttctgc ttgcatggtt gacacacccg      4500
     agcccgcata tggcgctgat cagatacagg ttctcgaggg tttagaagcc gttcggcgaa      4560
     gaccgggtat gtacataggc agtaccgggt cccggggttt acaccatttg gtatatgagc      4620
     ttgttgataa ctcagtagac gaagcccttg ctggctattg cacaaaaata aatgttgcta      4680
     ttctcgcaga cggcggggtt agggtgacgg ataacggcag gggcatccct gttgatattc      4740
     atcctaaaga gggggtttcc acagttcagg ttgttctcac aacccttcac gctggcggaa      4800
     aattcggtag tggaggatac tccgtttccg gcggtttgca tggcgttgga agctctgttg      4860
     tgaatgcgtt gtctaagaga ctgtatgttg aggtctcaag acagggtttt gtttttagac      4920
     aaaattatga gggcggtaac cccactgctg cacttgaaag atgtgaagaa accaatgcta      4980
     ccggaacggc aattaccttt tggcctgatg atgatatttt tgaaaccgtt tgttttgaat      5040
     atgaagtgct gcgctctcgc ctgcaacaga tggccttcct gaatagcggc cttactgtct      5100
     ccataacaga cgagagggtg gacagcccga ctaacaacga gacttactgt tatcaaaacg      5160
     gtctgtttga ctatgttatg tatcaaaacc gcataagaaa acatgaacct cttcatgaag      5220
     aaataattca ctttcaggca gagaacaagg atcgcctgat gtcccttgag gttgcgatgc      5280
     ggtggacctc gtcttcgacc gagaatatat atacatttgc gaacacaatt aacacccatg      5340
     agggcggtac acacgaagag ggcttcaggg cagcactcac atcgctcgta aaccgttatg      5400
     cacgcgagaa aggttttcta aaggaaaagg acgaaagcct tcagggtgag gatattaggg      5460
     aagggcttac agcaattatc tctgttaagc ttggcgaacc acagtttgag ggtcaaacaa      5520
     aaacaaagct tggcaataca gaaatgcgtg gctatgttca ccacgaggtg aactcttatc      5580
     tgtgggattg gtttgacagt caccccgctc aggcaaaggt gattatttca aaagcccttc      5640
     ttgcggctga ggctagattg gcagctaagc gcgccagaga ggcctcgaga aaacggggtt      5700
     tattcgagtc tgtttcaatg ccaggcaagc tgaaggagtg tcaggcaaag gacccggccg      5760
     tttcagaact ttttattgtt gagggggatt ccgcaggtgg gtctgcaata cagggcaggg      5820
     atccgctcac ccaggccgtt ttaccgctca ggggaaaaat acttaatgtt gaaaaggcaa      5880
     ggctcgacaa ggctattgca aattctgaaa tacaggctat gctcacggct ttcggttctg      5940
     gtatagctga ggattttgat gaatcaaagg ctcgctacca caaaataatt cttatgtccg      6000
     atgcagatgt cgatggccag catataacca cacttctgct cacactcctg ttcaggtata      6060
     tgaggccact tatagagagt ggttatgtgt atttggctca cccccccttg tacaggatta      6120
     agtggagtaa ttccgagcac gactatgttt ttagcgacag agaaagagat aagaagctcg      6180
     cagaaggtaa gctctccgga aaaaagatac caaaagaaaa cgcaattcag cgatacaagg      6240
     gccttggaga aatgaattat agagagctgt gggacaccac catgaatccg gcaactcgca      6300
     ccctccgcca gattaccgtt gacgacgtta cgttagctga tgagattttt tctgtgctta      6360
     tgggggagga tgtcgactct cgtcgtaagt tcatccagca caacgccaga gatgttcgct      6420
     ttttggatat atagatattg tctgagcaaa atattaacca agtagatctt cgcgaggaga      6480
     tgcagcggtc gtatctcgac tacgccatga gcgttataat cggtcgtgcc ttacccgacg      6540
     tccgggatgg tcttaagccc gtacatcgca gggttttgta cgcgatgtac aaagggggtt      6600
     atagaccaga aaaggctttt tcaaaatgtg ccagggttgt cggcgatgtt atgggtcaat      6660
     ttcatcctca tggggatgcg gcaatttatg acgcacttgt ccgtcttgtg cagccgtggg      6720
     ccatgcgcta tccgcttgcg cagggccagg ggaactttgg ctctccgggc aatgatggcg      6780
     ctgccgcccc tcgttacaca gaaacgaaaa tggccacact cgcgattgag atggtcaggg      6840
     atattgatga ggatactgtt gatttttccc caaattatga tggcgaaagc gttgaaccca      6900
     cagttatgcc gtgccgcttt cccaatcttt tggttaatgg ctcagtcggt attgcggttg      6960
     gtatggcaac caatatcccg ccgcataacc ttgccgaggt gtcggccggt gctctgtggt      7020
     gcctcgaaaa tccggatgca acagatgagg agttgacaga agctcttctg gaaagaataa      7080
     aaggtcccga ttttcccacc ggtgctacgg tgttggacac cggaggcata aaagacgcct      7140
     atctcacggg ccgcggcagc gtggttatgc gaggcgttgt tgatattgaa gaaatagacg      7200
     gaaggacctg ccttgttgtg cgcgaacttc cttatcaagt caatccggat aatttggctt      7260
     taaagatagc ctctctcgtt aaggaaaata aactttcggg aattgctgat attcgggatg      7320
     aaacaagcgg tagaaccggc cagcggttga taatcgtcct caagcgagat gctgtcgctc      7380
     gggtggttct gaatagccta tacaaacata cacagcttca agagaacttt ggggtcaata      7440
     tgcttgcgat tgttgacggg gcacccagaa ccctttccct ctgttcgttc attcgtttat      7500
     gggttgaaca ccaaatagaa gtcatcgtcc ggcgcactac cttcaggctt gccagggccg      7560
     agcagcgcgc gcatattctc agggcctatc taagggctct ggaccagatc gacgaggtta      7620
     tacagctcat tcgatcttct aagagcgccg aggaggctca gtctaacctt atggcgctcc      7680
     tgaaaataga cgaaacacag gctcgtgcaa tccttgatct tcagttgcgg cgccttgccg      7740
     ccctcgagcg acaaaggatt atctctgagg caagagaaat agaagagcta atatccagct      7800
     tcaggaagat tctttctgac aagaccgccc agtgccaggt tattgcagaa gaattgaggg      7860
     aaataggtca aaaacactca gacgcacgac gcacagaaat aattcggggg tttgatgggt      7920
     cggtgtctat tgaagacctg attccggtgg aacctgtagt tgttgttatg acccgctgtg      7980
     gttatataaa acgaacacgt attgatcagt ataggtctca acataggggt ggtcgcggcg      8040
     taaaaggcgc ccaagttaag gctgatgatg tcgtgctgca gtttatctct acaacaacac      8100
     acaactggct catgtttttt accaatacag ggagggttta tcgcgcaaaa gcctatgaag      8160
     tcccggaggc aagcagggag gctcgtggtc agcatgttgc aaatcttctt ccgctaaaac      8220
     cgaatgaggc ggtgaccagg attttatctg tctctaattt tgatagcgag gatacaagcc      8280
     ttgttttggc cactaaagat ggatatgtga aaaaaacaac ccttaaagag tacgatacat      8340
     cgcttagcac tggtgttata gcaataaagc ttcggcccgg agataagctt gtatctgcag      8400
     tgcttgcaag aagtgatcag gacatcatac tggttacaaa aaatgccaga tcgctcaggt      8460
     ttaaatccgg tacattgcgc cccttatcta ggggatcata cggcgtaaag ggtatatctc      8520
     ttcgcgaaaa cgatctcctt ctttcagctg agctgattct ttcggacgac agctatatat      8580
     ttgttgtcag cgagaggggt tatgcaaagc gctctagggt tggtgattac aaacttcagg      8640
     cccggggcgg gattggcgta cgggttgcaa acataaccga gcaaaagggc gtacttgctg      8700
     acatgctcgt tgtcaatgac gatgatgagg ttcttgtaat tcttgcaagc ggtaaggtta      8760
     ttcgctcatc tgttgccgag gtctccccaa ctcttcgata tactaccggg gtcgtttttg      8820
     tccgcatgtc tgacggggat aaaattctgg ccatgacgat agcagagaaa tgcgatgacc      8880
     tggaagggca ggggtgaata caaagcttgt aaaaagctcc tcctcacagg cggttctccg      8940
     ccttgggtcg attaacgttg tctccgcagc caggactgcc tttgtgttct cgcttgcctt      9000
     ttcggtagtt atgttcttgc ttattttgat gctttatatg tttctaaatt ttgctggggt      9060
     gttcaacatt agcgctgtcg gtggcacgcc tgagggtgcc cctgcagatt tcaccctgag      9120
     taacgctata agcccgtgga ctgtgttaat tttttctttg attttggccg gaaccaatgt      9180
     ctttacattc acaaccggtg caattatttt ttctgtgatc tacaatgtta ttgcccggat      9240
     tacagggggt ttgcgattta ctttctatcg ctgatttggg gttatagctc agacggttag      9300
     agcgcttcac tgataatgaa gaggccccag gttcaagtcc tggtaacccc acttgttctt      9360
     gcttggggat gtagctcagt taggcagagc gcctgctttg caagcaggag gtcgggggtt      9420
     cgattcccct catctccacc agatcccatt ctgttttgct gtgcatttat ggcctgcaac      9480
     atttttgtct ctgcaacatt tgtctcataa cagaaatctt tttggctacc cagatccggt      9540
     aactggctag ccatgcagtc aggtctggca tacagtcggg ccgtgcagtc gggtctgtag      9600
     aactggaatc ggatcgccca taatgttgga tatgacatct caaccgcttg gtttttgtat      9660
     ttgatttcct gccgtcatcg cacacgtcga aatgttcaaa tgcattctgc cgccttggcg      9720
     ctcgtacacc acaagaagca tgccagactc gaccgcaacc ctgctcttca cccctataaa      9780
     ctcattgcta acaccattaa aggtacccgg tatatgtgcg ttgttcaggg catattttag      9840
     cccctcctca taaaccccgc tggcatcgcc ggagtgcggg aagattgaga tattgccggt      9900
     gaaatgcgac ggaaagtaaa tctcattgtt tcggatcgct gtcaccacat catacttccc      9960
     gacaataaac acgctatatc ccatatttgt cagttcggcc agtagctgga tatttccaat     10020
     ggtatggtca agccgcccac cggtaccccc aaatatgcaa aaagttctaa agccccgctc     10080
     ggcaccaatc agggctgcct gcatcatgtc agttttatct ttttctctgg gcaaaatcac     10140
     ccgatcaatg tttattggaa tagactcaat tgaatcaagg tcgccgacat agagatcaat     10200
     gcgcgcacca tgcttcttga gctgcatcaa gccgccatca gccgcgataa ccaagtcgtg     10260
     catccccact tcttcggggg gtgtaaagtg ctcaccggca ccatatatgt agcaaacacc     10320
     cattccaagc acaaccttca atatcggtga cgaccgcgga tataattgtg ttacaagcta     10380
     attgtacggt ccgggtggct tttgtatggc tcgctccttt tgtgccccct tgctttttcg     10440
     tggttaatat cggagggtgt tcgcgaggtt tatgattatc tggcgaaggc ttcgtgctta     10500
     tcctccggcc actgcaacca taattactct gtgcattttt ttgtggctat tgcagatgct     10560
     tctgggttcc ggtgtaacca caagtcttgc cttcgcgggg gcgtatgtgt ttccggacag     10620
     cctgcagccg tggaggattt ttaccagcat gttcttgcat tcaaccttta caccgcttca     10680
     cctcctgttc aacatgtact ctctgtggtg gttgggcagt aacctggagc agcgaatagg     10740
     ctcatggcgc tttttggcgc tctatttcat aagtggcctg ggtgccgctg tgggtattgt     10800
     gtatcttcag ccttataaca ccctgacact gggggcatcg ggtggtatat tcggccttct     10860
     tgcggcattt attgtgttgc gcattgactc gggacagtta tgggggattg tcggcctgaa     10920
     cttgatcatt tcgtttttac ttcccggggt atcctggcaa gcacatatcg ggggtctttt     10980
     atcaggtttt gttgcagcgt gggccataaa gcgcaggaat ccattattgc ttggggcaca     11040
     ggtcattctg ctcattggag taattgcaac gagaccgtac ctgctgtacg cctaaccccg     11100
     aagcggccta tcgcctgggc gcaggggtcg tattacttcc agcgtgacat cattgcaaat     11160
     ccggccatga ttattccgaa cgctatgagg atattccatg ttccgaccgc cggcagaggc     11220
     aaggcgccgt tggaaatgta gaacagaacc atccacacag ccccggtgcc cataagcccg     11280
     aacataattg tcggaaacca cacggggtta ttttcgctgg actcgtgttt ttttctgctc     11340
     atgaactcct aagggcagag actgcgcgcc ttgagatacc cctattatat ataccgttat     11400
     gttcaaagtc ttggttattg acaaccacga cagctttatc tacacgcttg taaattatct     11460
     gcagcaactt ggggtaacaa ccagtgttgt gcggagtgat aacaattgtc attcggttga     11520
     gtctatgctg ggtgtgcatg acgcagctct catctcaccc ggccccggca cccccgagga     11580
     aagcggcatc accctttctg tcattcgagc tgcttactct acctctaccc cacttcttgg     11640
     ggtttgcttg ggccatcagg cccttgccgt cgcgtttggc ggtgacatag ggccttccgg     11700
     aaggattatg cacggaaagt tggttacggt gcgccctcgg cccagcgcca tattcaagga     11760
     cctccccact gcttttaccg caacaaggta caactcactt actgttacaa aggtgccgca     11820
     agcattgagg gtaatagcca gagcagactg tggcgaagtt atggcacttg aacaccggac     11880
     ggcaccaatg tatggtgtgc aatttcaccc agagtctgca gtttccgaat ggggttttcg     11940
     cattttggga aattggttat acatatcagg tttcaacaag gccctgggaa tatcccgtga     12000
     tctgcccatt gttgtttaca atactcgtgt acgctaagag gctcgtgcat gctggggttt     12060
     gttgcccgct tcgtgcctct cagggtattt caaggcttgt ttgattcaat gactaaggtg     12120
     tttgtatttg cggaggtttt aaatggacgg ggtttttcta tgggtcaccc tgggccttgc     12180
     attggccatt gttgttattg cgatttttgc ctgggttgcc tataatcgcc tggttgcgta     12240
     caatgtgcgt gtcgacgagg cgtggagtga tatcacggtt cagctcaagc ggcgtgccga     12300
     tctaattcct tctcttattg agactgtaaa gggctatgca tcccatgaga aatcggtttt     12360
     taaacaggtt acccttgctc gggcagcaag tattggtgct agcggggttg ccgaagcggc     12420
     agcggccgac aatcaacttc aggctgcctt gaagagtatt tttgccgttg ccgaggcgta     12480
     tccacaactg caggcaagtc aaaactttct cgaccttcag gcgcagctga ctgataccga     12540
     gaacaaaata caggcgtcac gcaggttcta taatggcgga gtgcgtgatt tgaataccct     12600
     tattggggtt tttccgtcta atatcgtggc taggattgct aagtttagta ctcgtgagtt     12660
     ttttgatgtt gagcgatcag aggcccttca gtctcccccg aagattgttt tctaggcaaa     12720
     tgaacagagc cgaatgtttt gatgtgagta tttgatgtac agctttattg cgagaaacaa     12780
     aatcaatacc tttttgatat tgtttgtttt catactggcc tgcgggggtt ttggcctgct     12840
     tgccggcaga ttcctcggta tgtcattttt tctttttatc ttgttattag cagcgggcta     12900
     tgcgtgtgtg cagtattttt tctctggacg tttagccgtt ttgatgtcgg gtgcccggaa     12960
     aattagccgg aacgacaacc cgcgcctctg gaatactgtt gagaatttat caataacaac     13020
     cggcttgcca atgccggagg tgtacattgt tgacgacccc gcccctaatg catttgcaac     13080
     aggccgcgac ccaaaacatg ccaaggttgc cgcaacatcc ggtctgcttg agatacttga     13140
     tgattccgag cttgagggtg tcatggccca cgaaatgggc catgtaaaga actacgatat     13200
     aagggttagc actatcgttt ttggcctcgt ttcagccgtt ggccttattt cagatatggt     13260
     ccttcgggct ctaatttggg gggataatcg tcgcgaagga aattctgcct tttcgtttgc     13320
     tattgtctta tttttctccc tccttgcccc cattgcggca atgctggttc agttggcggt     13380
     ttccagggaa agggagtatt tggcggatgc aaccggcgcc ttgacaacaa gatatcctgc     13440
     cgccctggcc tctgcccttg ccaaactgga gggcaatgca agaccgctgc aaagacagag     13500
     cagtagcatg gcccatttgt ggatttcaaa cccaatgccc cgggggttct tcagaaagct     13560
     tttttctacc cacccaccca ccgaggagag gattaggcga ttgaaagaaa tggggaacca     13620
     gttctgattg gctaaggtgt tatttgcctc ctatgcgttg cttgcagtgg cttcgcttgg     13680
     caggagcgct tatcagatct cgactcggtt ttatgaggcc ccccttgcct actccctttc     13740
     gggctttgcg gctattgtct atttagtcgt atttgtgtcc cttgtttact ccctcagatg     13800
     tttggcatat tgcgcgctgt ttattgagct aattggcgtt gttgttattg gcaccttgtc     13860
     catttttgcc ccgggtcttt tcggcactgg aaatcatatt gccgcaactg tctggacgtt     13920
     gtatggggtt ggttattttt ttcttcccgc ggcacttccc gttcttggca taatttggct     13980
     gtctagatcc aagagatgag gtgttcttag cctctgcttt ctgtcattct tgacagtgac     14040
     tgcatattcg actaaaggtt tttgcgaccc tgcttacgca agctcctcac atagagttct     14100
     cagtattttt tgatacagtt ttgcgcgttg gttgtttagg aaaagaggta ggcttggttc     14160
     gtgcacaggc aatatttcgt cttgtagttt tgagcattct ttgtgtttca gtcttacttc     14220
     caaccagatg ggtacttgcg acacctgcct tgaagccaca gtctttttct gtcgctattg     14280
     gggaaagcct caatagacca cccattcctg ccgctgctcg cggttcggtg tataccgtaa     14340
     acaccaagga cttaacggcc cccggcgatg ggttacctcg ggggctggat atcaaccgtg     14400
     ggaccgggac catctccggc tctgtcgggt cagatgtact gccgggtgtt tacaagccga     14460
     gggtatcggt gacctcctct gctggctcaa ctagcgcggt ttataccatc actgtgacca     14520
     ggcagattgt tcttggtgat gttctggccc aaattaaaca gggtgatccg gtgcggattc     14580
     ctgccaagat catcggtggg cattctctct ttaatttccg gcttgcaggc aagcctcgca     14640
     ccacaccggg gattgcctat cccatgggtc tttctgttga ttcaaagacg ggcgtgctat     14700
     tcggaacggt gtcatacgag gttgagtatg gggtatacaa ttttctgctt tgggcggatg     14760
     aggtaattca cggtgagata gtgtcgcatt ttgcgtatta caccctcctc gtgtcaccga     14820
     tgcattttaa tgttgatgac cagaactttg agctgcaggc ctataagccc tttcaatttc     14880
     cactgagtgc gaatggtgct gctatagcct gggttgctac cggtcttcca aaggggattt     14940
     atctttcccc agccggactt ctttatggcg tcccagctgt tccacctggc gagtatagcg     15000
     cccggcttac cgtatacggc cttgaggttc gcagtggagt tttgaagatt gtttctgtaa     15060
     cggcaaatct gaatattctt gttgctggtg agcctattat ttaccctcaa tctataactg     15120
     ttaagaaggg tgagtccgtc tcgttcccag ccaagccccc tcacaagcct ggctgggttt     15180
     attgggcaaa catggtcgac ataaccacac ccggtaatgg gatacccgat ggtttgattt     15240
     tatctcctga caatggtacc ctctatggtg ctgttagccc ctctgttcag ccaggtgtgt     15300
     acacgccgac tgttttcaag gcggttcctg gagaggttga atatgcgcac agtacaactt     15360
     acacgatcac ggttgttgag ggcactgcgc ctggggcaaa ctgagtttgt tgatgtattt     15420
     agttcgtatt ggtggtgttt gtattgactt atgttcctag cgttctcttg ggtgacggtg     15480
     tatcgattcc ccagtttgga ttgggtacct atgagcttcc tcccaacgag acatcttcgg     15540
     tggtgcagtc tgcgatcgag ttgggctatc gccatatcga tacggcttca ctctacgcta     15600
     atgagcgaga ggttggccgc gctattgcta gcagcggaat aaagcgtgag gagttttttg     15660
     tcacaacaaa gctatggaat tctgatcaac ctaagccgag agaggcgttc gagcgcagcc     15720
     ttgacctcct ctcacttgat tatgttgatt tgtatcttat ccattggcct tgcccgccga     15780
     gtgagctgta tataaatgtc tgggaagtgc tattggagct caaggagtcg ggccgtgcca     15840
     agtctgttgg tgtgtcaaat tttttgtccg agcatatcaa taaaataaaa gaagcgggct     15900
     ttccgctgcc ctctgtaaac caaatagaac ttcatccgtg gcttcaacag cgtgaacttg     15960
     tcttgtcttg cagaaattat ggcatacaaa tcgagtcctg gggacctttc gcgcgttttt     16020
     ctaaggatct tgatgcgttc ccggaactga cacgcccagc aaaagaatat ggaaaaaccc     16080
     cggctcaggt cattttgcgt tggcatattc agaaggggta tgttgtcttc ccaaagacag     16140
     tgcatgcgga acggttgcgg cagaatattg atatattcga ttttgacttg actcctgacg     16200
     aaatatctgg gattgatagc cttgatgcgg gctttaggac cggtccggat ccgagcagct     16260
     ttcgagccgg cctcgattga tctaaccacc caatagtccc agtgatcttt tccagcggta     16320
     taagtaattc ccgccgtttg gttttgtcaa aaatatgttt cagggactac tgtcatgtac     16380
     gctgtgcctg gtggcctagt tttctgcgcc accacggcgg cttgtttcgc ataagaggtt     16440
     tttgcaggca taagttagct ccgacagaag ctgctcggcg ccatcgggcg tcttagcaac     16500
     actgtctatg taacacttta gttttaattc cgttccactt ggcctaacta ttagtcgccc     16560
     aaacagatca tcaatatctt gtcccagatt aaactcaagc agatccaccg gcgggctccc     16620
     gaacagtaga tcacgatatt ttgttactct aaatcgacca attttgttca gcgattctgc     16680
     tctaaggttt tgcataacag cctgcacact atcaagtgat gccatgcgaa cggcatactg     16740
     ggtgctccta aaatacccaa gcttgctttg caggtcatct agacaatctc tgaggcttcg     16800
     accttgggcc ttttgagagg cagctatggt ggcaatggcg gcgccggccg ataggccatc     16860
     tttgtccctt acaagctctg gatgaatcat gtaccccaag gcctcttcaa aaccaaaaca     16920
     gatatctggc acacgcgcaa cccatttaaa tccggttggc gtctccacat gttgcattcc     16980
     gtaggtctca gctatacggc gcattatcgg tgaagaaacc atgctgtttg acagtacccc     17040
     gtgaccgcgt tgcatgcgcg caatttcaac accaagtagg gcgcctattt cattaccagt     17100
     aaaaaccttt ccatccggat gtgcaactgc aacccgatcg gcatcggggt cattagcaat     17160
     gattatgtca cactctgcaa gccgtgctgt ttcaaatgct aaatccaatg cacccttttc     17220
     ttctgggttt ggaaacggca aggttggaaa tgccgggtct ggcatttttt gctcttcaac     17280
     gaacaccagg ttgtggaaac ccaatttttc catgaggcgt acaaagatct cgtgaccaac     17340
     accatgcata gctgtgtggc atatctttag atcagccttt ggtgagccaa actgtcgctt     17400
     aattgctttt gctgtacggg acaggtaggc ctcgataatc tcctcatcaa gaattccgta     17460
     actatctttc attggtatat cgctatacgc gacttcatct ctcaaatttt tggcaatttt     17520
     tgccgctgca gtatcaggta tttgtgcacc cttgtcttct cctccgagat acactttgta     17580
     cccgttgtat tcgcggggat tatgggaggc ggttaccata acccccgcag cagcaccaag     17640
     ctgccgcact gcaaatgcca aaaggggtgt tggtagagcc cttggcataa tcagagctgt     17700
     tatatcgtaa ctgctagcaa tccgcgcagt atttcttgcc cagagctgtg aattgtatct     17760
     tccgtcatag ccaataacca gcgttctgcc ccggttttct tctaaaagaa attgagacag     17820
     tgcatttgca gcctgcgccg tcacgacggc attcacgcga ttaaatccag caccctgcgg     17880
     tgcccttagt cctgcagttc cgaactccag cgtcttagac agcctctctt cgagctcacg     17940
     cacgtcacca gttttttcac tttcagccag aagtctgcgc atttccaagc gtgtgatcgc     18000
     caccggatca ttctcaatcc acaagcttgc cttccgcaga atattcatat ggctaccctg     18060
     ttatttcctg cccgatagat cttgcccgat gtcacgaatg agctctacga gaaatgctga     18120
     agttttttgt ctagcctgtt cgcttacagt cagcacttca tcatggctca attgtcctgt     18180
     acctattccc gccgcaaggt ttgtcacaag agacaacccc acaacattca tctttagtga     18240
     ctttgccatt attgcctcaa gggctgtcga cattccgaca agatctgcgc cgatagttct     18300
     caacattttc acctcagccg gtgtttcgta ctgaggaccc ggcatttgcg cgtacacccc     18360
     ttgagggata ttgggggcca tttgcaggat tttttgcctg agtgcggccg tataaatatc     18420
     gctcatatcg caaaaatttg ccccgcttag aggagatttt ccggtcagat tgatatggtc     18480
     ctttattact accacctctc caggacccca atcaggcact gtgcttcccg cgccattggt     18540
     aaggattgcc accctcgccc ccgctgcatg ggcggttttg atgccatgca ccacagcctc     18600
     agggccatgt ccttggtaga gatgagtcct cgcgcctatt acaagaacat atactccgca     18660
     cgtaagtcga atggaggtca gaacaccgct gtggccagcc aaaacgggag ggaaaaaccc     18720
     gtgtatatct tgcgcgggga ttgttgtaat aagctcaccg aggttggata cagcatcaac     18780
     ccagccgcta cccaaagtaa cggcgatgtc atgccgggca atacctgtta tatctgcaat     18840
     ctgttttgca gctaatgtag cagcggtgag ttcagtattg cagatatctt ccatggcggc     18900
     tgatttccag gataatccaa caagaacacc gccgtcaagc agcactatac ttgagtctgg     18960
     taagaaggct gagagtgtct gtcaagaaaa atcataaaat agttgttatt ggcggtggcc     19020
     caggtggtta ttcagcggct ctgagcggtg ccctgcttgg cgctgatgtt gtgctgattg     19080
     agaatcaggc tgtcggcggg tctgcgactt taacagacgt tgttccctca aaaacactta     19140
     ttgcctcggc agagcgggct gtttttgttg cccagggtgc tgattttggt attcgttttc     19200
     agaactgcgt ttcagccgat atagggcaca taaaccggcg aattatggat cttaccagag     19260
     ctcaaagtgc tgatatgttc tcgaccttga ctggtgctgg ggttagggta gtttatggcc     19320
     atgccgcttt ggatggaccg aatcgggttc ttgtatcggt gtcaggtcaa gagaaatatg     19380
     agttctttgc aaatacggtt gttgttgcaa caggttctag tccaagggtt ttaccaaatg     19440
     ccattcctga cgggaagaga atacttacat ggaaacagct ttataccctt gagcaggttc     19500
     ctgagcatat cattgtagtt ggctcgggcg tgactggcgc tgaatttgca tcagctttca     19560
     ggaatttagg aagcgaagtt acactggttt ccagcaggga cagggtgtta cctgggggag     19620
     atgaagatgc tgcagatttg attcaggaag tttttataaa ttcgggaatg aaactgctca     19680
     accgggcacg tgctcaagcc gccgcagcct gcaatggggg tgttgtggta acccttaccg     19740
     acggtacaga ggtgcgcggg acccattgcc taatggctgt tggcagtgtt cctaatactt     19800
     ctgggattgg tttagaaaca gcgaatattg cactgaatcc agcagggcga attacggtaa     19860
     atagagtggc ctgttcaagc gttcccgggg tatatgcggc aggggactgt tcggattttt     19920
     taccccttgc atctgttgcc gagatgcaag gccaggttgc cgtttatcac gcaatggggg     19980
     agaatgctaa tccaattgaa cttaaaaatt tagcctcaac agtttttaca accccggaaa     20040
     ttgccactgt tggtaggtcc gagaaggcta tagacaaagc cagggccacc gccctgaagg     20100
     ttgacttagc aacaaattcc cgtgcaaaaa ttctgggtat aaagacgggc ttcgttaaga     20160
     tgattgtatc tcgtgaaaca ggcaccgtac ttggcggtgt tgttgttgca ccaaatgcaa     20220
     gtgacttaat ttttccaata tcggttgctg ttcaaaatcg ccttagcgct gatcaattat     20280
     cacaaagctt tgccgtctat ccgtccctaa caatatcttt gtggcacgca gcccgcgctt     20340
     cgcacgtgag aaccgacagc gcgtcgccct gatctcttcc gaaatctgac attctgggca     20400
     gcgctctggc agcgccttgc aatggggtgt gtattttttt tcaaaccttc ttcaagcgta     20460
     acaattcgtg accgcttggc actgtctcgc ctgtgtgcgc gttgattttt tcaactaccc     20520
     catctcgtgg ggccactatc ggctgttcca ttttcatggc ctcaagcacg attaacaggt     20580
     cgtctttttt gacggactgg ccttccgtaa catttacttt cacaacaacc gcttgcattg     20640
     gcgaaaaaat agaatcgggg ttcttctcct gtgttttctg tctgaaattg tgccctaccc     20700
     gcctgccggg aggtttttgc ctttctgtgg gatattcccc tatgggggat ggcaggcgca     20760
     ctctaatttg ttttctgttt acctcaacaa ttatttctct taaatttttt gatacagaca     20820
     gagtgtcttg tatatccggc accgtacttg catcagtttg cttgttaact agcttgctat     20880
     attcgttttc cacccaaccc gtatacatcc ctccatttat gaagtcgggt tgattgagaa     20940
     tattcctgtg gaacggaata agcgttgtca caccgtcaat tacaaactca tcaagagccc     21000
     gcctggcacg tgccaaagcg cattccctat tgtttcccgt aacaatgagt ttgcacagca     21060
     gagaatcaaa ggctgcccct attgtatcgc ccgcctttat tccactatca atacgaattc     21120
     ctagaccgcc agggggttcg aattttacaa ccttcccatg tctcggcata aaaccactgt     21180
     ttgcatcctc agcatttatc ctaaactcca gactatgtcc tttgtatacg ggtgtttcaa     21240
     ggtttttgag cagctttccc tcagctatat ttatctgctc cagaacgaga tcaattccgg     21300
     ttatctcttc tgttactggg tgttcaactt gaagccttgc attaacttcc agaaaaaata     21360
     ttttcccatc ttggtcaatg agaaattcgc aggtgcctgc acctgaatat tcagctgctt     21420
     tcataacagc cttgctcgcg gtgataaggg tttcttcttg tttatctgtc agcgtgtagg     21480
     cgggcgcttc ttcaattagt ttttggtgtc tgcgctgcac ggaacagtct cgcgtggaaa     21540
     cgacttgtac attgccaaac agatcagcca gacattgtgt ttctacatgt cgtggtctat     21600
     caatatattt ttctatgaaa cattccttgt ttccgaatgc cgcctgcgct tcacgttgtg     21660
     ctgatgcgaa aagctcatct atattctttt tttgttttac aactttcatg ccaagaccac     21720
     caccgccata cgcagccttt attgcaattg gaagtccata cttgtctgca aaattatgca     21780
     cttcagatgc acaagagacc acatgttcgc cacccggggg gaccggcact ccaacctgtt     21840
     ctgcaatctt tcgtgccgat aatttgtctg ccaggagcgc tatgacccct gcgcgtggac     21900
     cgacccatgt aatacccgca cttgataccg cttcagcaaa ttcggggctt tcggcaagaa     21960
     agccgtatcc cggatgtatt ccatctgccc gactgagttt tgctatatcg agtattttct     22020
     ctatgtttag gtaggtttcg gcagcggttt caccctccag gcagtaagct tcatccgcaa     22080
     gttgagtatg taccgcatcc ctgtcttgat ccgaatatat tgcaatggag gcaattgctt     22140
     tatcgcgaca ggcacgtata acccttaccg ctatttcgcc gcggttcgct atcaatagtc     22200
     gggttatttt tttcatatat ctagtagcca gccttgattg tgtacctaat gcgtgttacc     22260
     gcgctgcttg gcatcccgcc tattccaggc acagacccgg tggggtgtat cccgactcgg     22320
     ggtcgtgaca gattagcgtg cccattgcct acatatcagt ggttcgtact ttcgcggcag     22380
     cagtgtacca cccgatggcc aactgcgcgt ggaccatact cttatattcc agttgttttt     22440
     tgtgtttctt tcattgcaac aatcagtcgt tttatttatt gccttgctat tcacgtcacg     22500
     gcaggattcc gactcaataa acattatcgc cgcaagggct gcggcagtct cttcttctct     22560
     gcttaggtga atcactctca gtagtgtaca cgcccaatgt gtggcatatc tgtattgggc     22620
     gtacatatag gttgtatgcg cccgtgatat actgtctgtg gtgaattctg gtctttgttg     22680
     aggttgatgt gccgggtact gccaaaatgc tgcgtttgcc gccctggcct ctgtctttgt     22740
     catgttgacc attgcccaac ctgctagcgc gcggggtggc ttgggaaata tttctgtcgt     22800
     cgccggcccc ggcggcactt acagtattac ggccactgtt cgtatggatt tcgatccggg     22860
     aaagtgtgta ataggcgcga taaataaagt ttttagcgtt gacagtatta gcactactgt     22920
     tggttttacc ttactggaca agatggtgaa ggtcctgaag gtttctataa agctaactcg     22980
     ccttatcaac ttttccagca ttgtcctgac tgcaattgat gcggttactg gttgtcttga     23040
     ggggggtatt gtctcgactg aaacgcctgt gcatcctgtg cccattgtaa gctcggattg     23100
     cagtgcatat gacatggggc ataaacttgg ctatcgttgt cagaggaggt aggtcatact     23160
     acgttctttg tggcgtaagc tagcctcagt ccctgcacta attatttatc tggcatttgt     23220
     gccggttttg acagtagccg cggagattta tgttctcacg ggttatagcc tgccgtggct     23280
     tggcattccc gcctttgctc tcgttattat cacaattaac tcaggtttat tgcccaatcg     23340
     tgatgtgtct ccaagccgat tggccaggct tgcagtctat ctcgctctag ctgctctaat     23400
     tgtgtttgtc gtcgtttgta tgactatcta ttttaccgtc ggcttatctc gattagcccg     23460
     ttttgatgtc ttagctcctt ttgtgctggg ttatcttctg gcaagtgcgt tgtcagttga     23520
     gctatgttat aagttgaaag cgaagaaatc aggcaaggta taacagtttt tcgttcaatg     23580
     cctgtcatgg gtaatttctc actacatttc caagccttat cccttgcccg cgcaaccggt     23640
     aacccatccc tgcgagacct atggcgtatg agctgcataa cctgttacat tgcgctgtgc     23700
     catatgacct tcttgtgttt agccgttata tcgcttttac cgtggtggcc gtaagtccca     23760
     tattctggct tatacccggc aattatgctt tactatgatg ccacggcgac ggttatgtct     23820
     attctcacag ggcttgcatt cctctgttgt atcttttacg ggccagttgc ttcttgtgtc     23880
     gggagcaaaa gtacatttca ggccaaatga ctgattaaag cattattctc aattcactca     23940
     ctattctcaa ttcactcaca ctgtgtattt cacgctatgt atgcggtaaa tgtacgtagt     24000
     aataaaattt cgcaatacac gcattctgcc cttgcttaac ggcgcaaggg tttgatgggc     24060
     accaaagcgc cccttatgtc caaccgaaca ggcatcaatt acagtggtat gcttccgtgc     24120
     tttctgtcta tttgtttgta acgcttcgtt ctgatggttt gaaaggctgt agcaatcgca     24180
     attcgcgttt gtgctggctc tataatcgca tccagatatc ctctctgggc ggcaataaaa     24240
     ggattggcaa atttatcggt gtactctttg accaatttct ctttcattgg atttgcgtct     24300
     tcaccggctt gcacgagccg ctttatatca tttctataga gaatattcac agcaccctgg     24360
     gcgcccatga cggcaatttc tgctgatggc catgcaaggt ttatatcggc acctaacgct     24420
     tttgagccca ttactatata ggccccgcca tacgctttac gcaggataat tgtcaccatc     24480
     ggtacagttg cctcggaata agcatagaga agcttcgcac cgcgcctgat aatacctgtc     24540
     cattcctgct ctgtcccggg taaatatccc ggcacatcaa ccagtgtcag aataggaatt     24600
     gaaaaagcgt cacaaaagcg aacaaaccgt gcagctttct cacttgcatt tatatccaaa     24660
     gcccctgcca tatgcgcagg ctgattcgca acaataccga tcgaaaagcc tgatattcgc     24720
     gcaaaaccga tgatgacatt ctttgcgtat gcggattgaa tttccagaaa attgccatca     24780
     tcaacaattc gctctatgac aaactgcata tcataaggct tatttggatt ctcgggcaca     24840
     attgaattta gttcaaggtc actctcctcc gtatgaatat cctgtggcca tgtgggaggg     24900
     tctgacatgt tattactggg cagaaaccca atcagctccc gggcgtatgc aattgcgtca     24960
     tcttcgctat gagccatata gtgcgagacg ccagaggtgg cgttatgcat attggcacca     25020
     ccaagatcct caaaagtcac ctcttctcct gtaactgctt ttataacatc aggtcccgtg     25080
     atgaacatat agctgatctg gtccaccata attacaaaat ctgtaagtgc cggtgagtag     25140
     catgccccac ctgccgcagg ccccataact attgagattt gtggaataat tccgctcgcc     25200
     gcaacatttc gcttgaatat ttctccgtat ttagtaagcg ccgcaattcc ctcctgtatc     25260
     ctggctccac cggaatcaag gagacctatt acgggtattc ctgcagacat tgccaggtcc     25320
     atagttttta ctattttcct gccggccact tctccgagtg acccaccgaa aaccgtgaaa     25380
     tcctgagaat ataccgcaac tttcctgccg tctattgagc caaaacctgt gacgacagag     25440
     tcgccataag ggtggttttt ttcgatacca aatccacttg cgctgtgcat ggcaaactgg     25500
     tctatttcag taaacgagtt ttcgtcaagc agtttatcta tacgctcccg ggcggtcatc     25560
     ttcccttttg agtgttgttt ttccttcgca gaatcctcac gcaaagtgac tgctacttcg     25620
     tatgcctgcc tgtacttctc tagcccccta ctggattcgt caaaattatc ggtcatcagg     25680
     gtactctatc ctcgattcat ttttttgttg gcatttgttt tgttctaata ttctttcatg     25740
     ttcccttgtg tatttctaga cactgttgga tcaacaaacc tttaccttct tgaattgcta     25800
     aaagccaagg atctcgatga cttttttgcg gtttttacca cgaatcaaac cgcaggacgt     25860
     ggtcgcatgg caaggtcatg ggaatgcaag aaagggattg cgttgtctgt atttctgaag     25920
     cacaatttgc caggagccta tattaactgg cttccacttg ttattggact tgccgttgta     25980
     aaagcggtta ataaaatgtt agaagatgca acattgccgc acagggccga cataaaatgg     26040
     ccaaatgatg ttctgattaa tggaaaaaaa ctgtctggaa tactaatcga gacaccttct     26100
     gatggtaatg gattaatcgt tggtattggg ctgaatgtgg ctgttgcacc tattgcaact     26160
     tctatttgcc taaggcaagt aggacttcaa gcaagcccca aagaggtggt ttccgcgctt     26220
     ctggccgaaa tgcatacaat ctatcaacag ctcattgccc ttgccgccaa agacatatca     26280
     tttaaagatt cagaatgctt tggtgaaatt atgcggttgt gctcaacgat caacaagact     26340
     gttagggtga cgggcaccaa gacatttgta ggtgttgcgc aagggcttga ttcgcttggc     26400
     agacttgtta ttcgtcacag cggagacact tcgattgttt ctgctgggga tatcgagcac     26460
     ctgcgcgcta ttgacagttt gtaaaattac caaccctatc ttcgtcttta tttatacatg     26520
     cctcatgcgt ttcatctcat ttacgtttgg aaaaaaccca gaaatagtac ccgatgaatc     26580
     gcagaactgt tgctagcggg agcccaacaa gattgcttgc aatattgtcg gccagtattg     26640
     acgtgaaccc catgccgtag tgggacacaa caagacatgc gagttgcaca agcgacccac     26700
     ctatcgatac cagaaaaaat ctcaccgctt cccgtagcac accatcccgt cgtaagcctc     26760
     taaaaactaa atgacgattg ccaatccaat tgaaggatat tgaaacaata accgcaacag     26820
     acgccgcaag cactgagccg tatgcaatat ttctgaaccc aaggagcatt aataggttga     26880
     aaactaatat attgacaaat atcccggcta tcccaacaat gccaaaggtt gcaatttgcc     26940
     tgtatagagc tttattcacc cggcagaatg ccctttgtat gttatctatt gcacgcattg     27000
     cttctcctgc acagtataac cttagattga tgttcgagag attgagttgt tcggttggtg     27060
     tgattggtgg aggtcaactt gccagaatga tgattgcccc tgcgcaggct ctcggggttg     27120
     atttaaaggt ctttgcagat acccctgaca gttcagcagc ccttgccgca acggcttttg     27180
     gcagtcctga aaatggtgcg gcagtcctcg aatttgcaca gacagttgat attgtgactt     27240
     ttgagcacga gcttgtcccg gctgatgttc tgcaactctt ggatgagagg ggtattgaga     27300
     tgctgccttg cccgcgcgcc ttgcggtatg ctcaagataa attggcattg cgacgctatc     27360
     tcgatgagat ttcagtaaat cagcctgcct gggccgaggt acgctcggaa ggggatttag     27420
     aacgttttat ttctgaacat ggtggttgtg ctgttgtaaa aaccggaggg tatgacggac     27480
     ggggtgtcca ggttgtcacg ctgagctctg agattgatac ttgccgcaac ggaggttttc     27540
     ttgccgagga aagaattgat tttgtctgcg aagtatctca attagttgcc cgctcatcca     27600
     tcggcgaaat ctgcgtatgg ccgcttacac aaacaattca ggagaacggc atatgtgttc     27660
     agacgataac gccagcactt ggcctatcgg gcgggaatgc gctaaatcaa ctcaccacct     27720
     ttcacgatgg cagaacacgc accccacacg cgccgttaca ctctgaattg attactaaac     27780
     tccaggattc agcaaaaaca atcgcccttg atattgcgag aggtttaaat gttgttggcg     27840
     ttatggctgt tgaaatgttc attacgcagg acggcaagct ccttgtgaac gaacttgcaa     27900
     tgcggccaca taacagcggg cattggagca tggccgcatc gattacagac cagtttgaac     27960
     aacacctgcg tgccgtactc ggcttgccgt tgggtgcaac tgatatgtct cacaactgcg     28020
     ccataatggt gaatatattc aattcaattt cgcccgctca atatagagag gttatgacgc     28080
     attggccaga cgcgaagctt catatataca agaaacagcc aaggccgggt cgcaaaatcg     28140
     gtcatgttgt ttttgctggt gaagatttac aacagcttgc cattgcagct gaagaatgca     28200
     ggcaattgct gagagagtca catgcggtgt aagcaatgca cgtcatgcgt ctcaatgctg     28260
     tataccaatt gcaatataag tgacggtgat acaaatttgg tggttcaaat atgactggta     28320
     aaaacatcaa cgatgaaggt agcaaatgcc ccgctcttgt ttggctccta atgggttctg     28380
     attcggattg gcccgttatg tcaggcgccg cagatatcct gcagcagatg aatatatctt     28440
     tcagagtaaa tgttgtttct gcccatcgcc agccggaaaa gatgattagc tgcgccaaac     28500
     gcgctcgtga catgggattc aaagttctga tagctgctgc cggtggagcc gcacacttgc     28560
     ccggaatgct tgcaagtgtc acaactctcc ctgttatcgg agttccggtt gggcagaaaa     28620
     atctgtcagg cctcgattct cttttatcga ttgttcaaat gccctctggt gttccggtgg     28680
     cctgtgtcgg catagattct gctaaaaacg ctgcccttct ggccgcaagg attttggggg     28740
     ttcaatcagc cgacatagaa gcatccagaa tagcagatag tttgtctgca tatcagcaaa     28800
     gcctgtttga tcaatcaaat gaaaaggaca gaatgataaa tgagccgaaa tagcaagttt     28860
     ttcgcaaaaa ttttcgggca catctttggc ctgttatttc cggcataaag ttttaccaga     28920
     tcgccttacg atttatgtgt tagagttgcg tatttcttgc agaaatttcc tcagccgcgt     28980
     ggggttcaca atacaaccgt gtaacacaat aaaaccgcgt aacagcacgg cacggtgccc     29040
     caagagaaaa accgtaaccc cacgcgaatg aggacaatca ggcctctaaa tgtttcggga     29100
     agcgcacgca gataaggcca ataagcagga gatttgacat caacgaagtc gctaacagca     29160
     acacgccata gaggaaggaa agagaaaagc tgaccccaaa tcccggggag agaacaaaaa     29220
     atgccaaaaa caaagctgac aagaagaata caaacacagc agaaacactc caaacccgtc     29280
     tgctatgcaa tattcttggt cggcgaaaag acataaaaga tagtacgccg accgataaga     29340
     gcgcaaaacc gcccgcaagg gtcgcgtatg gactgctata gaaataaaga atagaggcaa     29400
     tagcagaaga gtaagcaaca agggcgaggg taacagcctc ccacataccg ggcttacatg     29460
     ttacatttct tgacataaac cgctcctcct tctgaagcac ctacccagct gacaggactt     29520
     cacgacaatc cactgctaag acagccgcca actgcaccaa ttgctgttcc agcgatgaag     29580
     ccaatcgggc cgagatacct ccatgtaaat tcaccatgcc aatgtaacac attcacataa     29640
     tcccagtagg cagtacagta acacaacaca tgttacctaa acagatacat cggtactgat     29700
     gcatcttaag cacaagaata acacaggaat agatcacata tacagaagaa agaaacatac     29760
     ctgttagaga atgtgattgt atgtattact acttattcac tactcactgc ccagctatac     29820
     actccgcaaa cacacccgca gcccatgcat cattcagggc atcttcccaa ggtctcatgg     29880
     gttccaggcc aactgcagtc catgcatcat ggcccagaca agagtatcca ggcctgcgtg     29940
     ctgggcgcac aaattgtgcg gagctaatgg gaataatgcg tttcgggtcg tacccaccta     30000
     aggcagccac tttcccggca aaatcaaacc aggttgtttt accgctgttt gttccatggt     30060
     acacgccaca tggagcgtca ctctcggcaa gaagctttat ctgttttgca aggtccagac     30120
     tccaagttgg ttgcccatat tggtcgttaa caactgtgac gatatcctgt gttctacacg     30180
     ctttcagaat gctttttacg aagttattgc cgtattgtcc atagagccaa gcagtacgga     30240
     tgataaagct tcctttggaa tattcctcca acactgcctt ttctccagca gccttagatt     30300
     ttccgtagac cgaaagggga gaatgcgggt ggtcttctgg gtatggacgt attgccgttc     30360
     ctgaaaaaac ataatcagtt gagatatgca ctactcgaat tgaacgcctt gctgcagctt     30420
     tggcgacagc ccttgcaccc gcttcattta ccgcataggc ttttgcagca ttactttctg     30480
     ccgcatcaac ctgtgtatat gcagcacaat taattaaaag gtctttattt ctggcggcgt     30540
     caagaacagc atattcatcc gttatatcaa gctcgtcatg cgttagggca acgctctctg     30600
     ggaacacaga ccgtatatcc cgccccaaca taccaccgcc accggttata aggcacttta     30660
     aactcaaaga gccgccctag cctttagcgg cttccaccaa gagctattat ccttatacca     30720
     attgattgtc tcagcaagac cttgttcaaa tgaaacctcg ggcctataac cgagcgtaga     30780
     gatcttgttt attgacacac tatacctctt gtcgtgaccg gggcgatctt taaccctctt     30840
     taccatcgac cagcttttct ccatcacctc gagaataatt tgactaagat cggcattgct     30900
     caactcaagc cccccgccga tattgtagat ttcaccagac ctaccctttg tcaacacaat     30960
     gtaaatacca cgacaatggt catcaacatg caaccaatcc cggacattcg taccatcccc     31020
     gtacaggggt acctctttat cttctattaa attcgtgaca aataggggga tgactttttc     31080
     tggaaactgg tacggcccat aattattcga gcacctcgta atgcaaaccg gcaggtcgta     31140
     ggttttgtga tagctcctga ccaagaggtc acttgccgcc tttgatgccg agtacgggga     31200
     gtttggcaga agcggttgat tttcgtccca gcttccactt tcaatcgaac catagacctc     31260
     atcagttgat atatgaatga accggtctat gttatttcgg gcagcagctt ccagaagccg     31320
     ccctgtacca agcacattag tttccacaaa agctgatgcg tttttaattg acctatcaac     31380
     atgtgtttct gcagcgaaat gcacaacgta gttcacattg ggcatgatct cactcaggag     31440
     atcttcatca cgtatatcac catgaataaa tcgaaggcga ctcgacgatc tgacaggaga     31500
     taaattgtta atattgcccg agtaagttag cgcgtcaagc actgtcactg tacaatctct     31560
     aatctccggg tatttgttct caattgccct gcgcacaaag ttagagccaa taaatccagc     31620
     accgccagta acaagaatat gcgtcataac aagcccatct caaccgctat ctagatttgg     31680
     aattttcaag tctatgccat tatttcgcca acagataaac agtcgcacac tgcatgcatc     31740
     ttgagcacca ccgcaaatgg gatgctgatg gaagtagtag cgccaagctg ctaactaaag     31800
     caccgtcaaa caccgggcaa aacagttcat ccgattttat tccgctcact agttgatttt     31860
     atcggcagcg cttctgttat agacttgtcg agtggaatta cgtaatctta aagttaacgg     31920
     ctgcctcgag gttaccccag aggttcatgt ggactccagg ggttcattct ctgaggtgta     31980
     ccgttttgat gttttggaga aagagattgg gtatccgctc cgggttgctc aggtaaatcg     32040
     ttctttttcc aagaaggctg ttctgcgagg gctgcattac tctcttgcgc cgcactctca     32100
     ggcaaagtac gttatgtgtg cgaatggcgc agtgttagat tttgtgtttg accttcgctt     32160
     ggggtcaccg agtttcgggg tgtgggacgc ggtcctgctc gactctgtag gttgtagggc     32220
     tgtttacatc ccagaagggg ttggtcacgc gtttattgcg ttatccaaga ctgccactgt     32280
     gaactacttg tgcagcgcaa cctacgatcc ggagcgagag aagagtatta atccgctcga     32340
     taaaaatctc aatctagaat accctttcac tactcctgaa atagtgttat ccgagaggga     32400
     tgctgctgcc ccgactttac ctgaagcgca aaagggtggt ttcctgccaa aatgggatga     32460
     atgccggtgg gatgaatgcc gggcaacacc cgagacacac ggaaacattc gataaatacc     32520
     ttgggccatt ctagccaagg ccgggccaag tatgttttta aggagatagc ttgaagggta     32580
     ttatcctagc tggtggaacc ggatcaaggc tctggcccat aacaaaatgc atctcgaaac     32640
     aattgatgcc tgtttacgat aagccgatga tctattatcc cctttccact cttatgatgg     32700
     ccgatattcg ggaaatcctg gttataacaa ccacgcagga ttatgaccaa tttcgcagac     32760
     ttttaggtga tggcgggcag tgggggatca agttgtcgta cgcacaacag ttgtcacccg     32820
     gtggattggc ccaggcattt cttattggcg agtcttttat cgccagcgag agtattgcgc     32880
     ttgtacttgg tgacaatata ttccacggaa gcggtcttgg tacatcgctt cgtcagcatc     32940
     gaagcattca gggtgccctc atttttgctt atcacgtcag taatccaaag gattacggag     33000
     ttgttacctt tgatgcagat ggtaaagcgg tatcaattga agaaaagcca gaaagtccaa     33060
     aaagtaattt tgcagttccg ggactttatt tctatgacaa ccaggtagtt gatatagcaa     33120
     aacagattcc tttgagcgct cgcggcgagc tggaaataag ttcagtgaat aacttttatt     33180
     tagagaaaga tcagcttaga gtttatccat tggcccgtgg aacctcttgg ctcgataccg     33240
     gcacatttga ttctcttgta caggcaagcg agtatgtccg cgttatagag caaagacagg     33300
     gatttaaagt tggttgtgtc gaggaaatag cctggagggc tggatggata gatgatgatc     33360
     agctggccaa acttgcaaat gggcttatga aaagtggtta tgggaagtat ttgcactacc     33420
     tcctgagcgg taagcacggg ttttcataaa aactcactac ttcagttttc ttgcctgtag     33480
     acggtacctg agtttcagtc caagtttcag aaggaatgta acgggtttct gccatttttt     33540
     tgagtatttc ttgtcaagaa agcgccccgc agatttgtgg tgaaaaaaaa gcattgtttt     33600
     tgggttttgc cgagttgaat atctacctat atgcttgact ttcgcatttg gctcgtagcg     33660
     aggtcttttc tgtagacgtg aaaacaagtc gacatcctcg aaatacataa aaaacccctc     33720
     atcgaatccg cccacatctt cgaatgcatt tctgcgtatg atgaagaacg ccccactgag     33780
     ccatccgcag gtccgtcttt ttgtcccgag agcgctctgg gtatagctgc gggtccatgg     33840
     attgtccggc catatatttt taaacaatgc atgaccaacc ccgtttgaaa tgcctggaat     33900
     atcacgtgcg gatggatatg gagtaccgtc ctgatttaga atgcatgggc ccgcagcgac     33960
     agcatcttta tcctgttcga aaacactcaa gagagtgcta atagttccct tctccagcgc     34020
     taaatcagga ttacaaatcc cgatgtactc tatattgctt ggcagcctct tggcgcccgc     34080
     attgaccgct gcgccgtatc cggagttttt ctctagtgcg ataaacctag caccaaactg     34140
     tcgggcataa tctttgcaga tacttctatc atgtgagtta ttgtcaacaa cagttacact     34200
     cactcgattg ggttccgaat cttggactga tactaaaaaa tctctcaaga tatcagagca     34260
     gttgtatgtt acggttataa gctcgaatcg agcgatcatt gtcattgata gttttctctt     34320
     agtaaatcca gcccgacttt tgttgtgcca tagtagatca atcttccatt tttcaagacc     34380
     atgaccttat cgcatacagt ctctatctgt tcggctacat ggcttaccat aacaatgctt     34440
     cgcccttcat ttttgaactg ggtaacctta ttgagacact ttttttgaaa tggcgcatcg     34500
     ccgacagcaa gaatctcatc aatcaacaaa aggtctgggt ctgtatgtac agacacagaa     34560
     aacgcaagtc gcatatacat acctgagcta taaaatttga cctgtgtatc aatgaatttt     34620
     tctatccccg aaaagtcaac aattgagtca aaattccgtc ttatttctgc ttttgttagc     34680
     cccaagattg acccgttcag gtatatattc tctcttccgg tgagatcggg gtgaaatccg     34740
     gcacccagtt caatgagggc gcttatccgc ccgcggctca gtatttcacc ttctgttgcc     34800
     cttactatgc cacctattag cttcagaaga gttgacttcc cggagccatt gtgccccaca     34860
     agaccaacgg agctaccaat tggcaactca aaggttatat tttttagagc ccaaaacggc     34920
     tctctgtttg cccgggaaac cctgaaatta agcagtctct ctttgattga cctattatgc     34980
     tgtattacaa attttttcga tacattactg actcgcagta tcgcattgtc atttgtcaca     35040
     ccggtatagt gcttcgactt cgccagtttt accgcattac tatttaccac tgacatctta     35100
     tttttcattg tgagtttatc tgcaataaaa ccgcttggga cttatctctt gcctgacatt     35160
     cacagctctt gcgccaagtt cgcctgcatc ttaacaaaaa tcctgtgggc taaaaacagt     35220
     aacaagagcc cgacaagaaa aacaataata agacgtgcgt caatgtccgc aggccaatgc     35280
     acgctgcttc cagcagtcca aaatgttttt tgcatgccca taactgctat tgccattggg     35340
     tttagaagat acaattgctc cgcaatattt gagtgtaccg ccccattaac tcgttggaat     35400
     gaatacacaa tcggtgttag ccagaacagt atcgagagtg caacatccag aaaatgttgt     35460
     gcatctctca tataaacatt cagaggtgcc aaaacaagcc caagagcggt tgcgtaaaca     35520
     atagcaatgc ctatccccac aaacccctgc cattttgttg gatctatcgg catttggccg     35580
     agcacgggag cagccaccat gagtataagt atgtaaatgg aaaaagtaaa cagtgcatta     35640
     ccaagcgcag ttacaacaaa tagctctctt ggtaaataaa tctttttgat taaaccccca     35700
     ttattagtca tgcaaacaac agcagtagat gctatctctg cgaacagaga ccaggtggca     35760
     aatccaacga aaataaatat tgcaaactga tcgattcccc tttcggcacc gagtattttg     35820
     ccaattgcga aataatagac cagaagctga acaatcggcc ttgccatact ccacaaaacg     35880
     ccaaatgcag ttcctttata gcgaatcttg atttcgcgct ggatgagtaa agacagaagt     35940
     gcacgccttt gccacatccc ctttaaggaa gacatgcccg tctcgccaac tggtttcaaa     36000
     ggttttgata ataacctggc tcttatcaag ttttccggca taggtctcca caaggaacta     36060
     atattacaaa gacagacggt ctatcattac aatgatagat ttataagttg gtaacatggg     36120
     cgtttccgtt gttatggcca cgtataacgg cggcccgttt ctcgccgagc agctgatgag     36180
     tatactttct caaactgttc tgcctgatga gatagttatt gctgatgacg ggtccactga     36240
     tgataccgag agaattattt ttcgcttcag gggcaaattc cccaacctgc tctacatccc     36300
     aagtgagggc acacgcctcg gtccaggaaa aaattttgaa agagccatta aaagatcatc     36360
     gcaggagttt attgttttct ctgatcagga tgacatatgg cagcctgatc gcattgagat     36420
     acaacagtct gctctaaaga gcaaccctgg agctgtcctg cttcatagca atgccagact     36480
     tgtggaccaa gatggcaaca tgcttgggga tttgttttct gctttaggga taacaaaaac     36540
     aatcttgacg aggatcaata acggggaggc gtttaacata ttgctcagac gcaatgttgt     36600
     aaccggcgcg acagtcatga cacgtcggga gtttgccctc tcaacattgc cctttccgga     36660
     tgcatggctg catgatgaat ggctcgctat atgtggaggt aaccgggtaa gggtattgga     36720
     ccactgcctc attcaataca gacaacacga taaaaatcat attggcgcgc ggcggctcag     36780
     cgtaagggaa aaattcctaa aactgttcga agatactgat gtaagaaatg cgcgactcct     36840
     tgcaagaaca gaggcattga caaattttgc agaggaaaaa tcagggaaca tatttttcaa     36900
     tacgcgcgag atcggtttga taagaaaaaa acttacgcac gagagatttc gcagcactct     36960
     cggtaaaagt cgacttttgc gaatttggcc agttttgaaa agggtcagta gatatcgaca     37020
     gttcagtaat ttttcagccg atatcttgcg cgacctgctc tcaagtcggc agcatgataa     37080
     accttagcga atcacaccta tcgcgagaat ctggaagttt tgcagcttcc ggcgcaacag     37140
     ttccagaaaa tacaggtcat tcaaggaatt ctgtttaaag gtaccggaga gagtctactc     37200
     ctttgacgaa tggcttttga tatcttcaag ttcgtcttgt aagaggaggg tatcttctgc     37260
     aagccttcgt gttctcttgt caagttttgc aagctcacaa ctctgctgca agcaaactaa     37320
     aaagagaaga attacggcca tgaacagaac aaggttgatt ggtgtaatta ttccgagtaa     37380
     attgcttatc cacctaagaa ttccggggaa aaccgcaaag aaaaccgcaa taaacccggc     37440
     aagaagccac cacaccgcat gtctttcgcg gagtttttct cttcgtagca tttcgattag     37500
     aatcacgaga agggcaatag aaactaaaat gccaaaaaag tacgatgtca tcgacagcct     37560
     ttcgactttc cagacttcag gggtgccaca agcgctgcca caactactct caacaacaac     37620
     agggtcgctc tgcatggccc atgcgatgga gtaccggcct tcctttcgcg catcgcaaca     37680
     ggaacctgtc tcaccacaag accttcttta agggcaattg ccaccgactc gactgtatca     37740
     ccgaggtatt cggttggata tttctcggca aatagtttaa ttgctcttgt tccagatgcg     37800
     cgaaaaccgc ttgtaacatc agttagatta gtcttggcaa agcgactcat aagtttgctg     37860
     agagcaaata tcgcccaacg tcttggccct cttagtttgt agtttccgca tcccgcaaag     37920
     cgagccccta tcacaatatc gggtttgtca tgtctattgt tcagtctatt tatcagttca     37980
     ctaacgtact ttgggttatg ctgtccgtca gcgtcaacct gaacaacaac gttaaatcct     38040
     tttctgaggg caaatctgaa gccaagacgc attgccccgc ctactccagc attgaacggt     38100
     atcctgatta cttttatcga atgcgcctcc gctgcatcag atgttgcatc tgtcgacccg     38160
     tcgtctatta ccaaaacact aaatcccggt agattctctt ttatctcttg caaggtccca     38220
     gggagggata aggcctcatt atgtgccgga acgacaacca gcaccctatt tgtcactctt     38280
     caatcctata aagcttcttt tatgtcgtaa attctaaata catatatggt ctgtcctgta     38340
     cgagatacat tataagaatt gggccgtctt tgtaggtgca agaatacgac aaaatatgtc     38400
     cgcaaaattc atcaccttaa acggctgagg ctagatcaag gcctgacagg tggcctgtac     38460
     tgagggtaaa ttccgtaatg tcgaatttat aaaactaccg tcggcagact ggtaacacaa     38520
     gcattatagt tgtgccatta cccgagaaaa cggtagagtt gtggctggta aaaagtatta     38580
     ttgaagcggt gctcgagcgt cggcgggctt ttatattgcg atgataacgg caggtgcgga     38640
     tgagtgacag tgatacgaat agcattccgc ttacacgttc ggcgctgcgc aaaatagaaa     38700
     aaagtagcgc cgccggggcg tcgggactgc gacgattgcg cctggcggtg cttgttccgc     38760
     tgttgctgtt tatttctctg gcaggctggg ccctctcttc cccgattgga agcagccccg     38820
     atgatgattt ccatctcgcc agtgcatggt gtgccctcgg tgacaggcct ggcttatgtg     38880
     aatcatctgg cataaaggat gctaaaaagg ttcccactac gattttggac acctggcatg     38940
     gtaaaggtag ccgccatggc aatttgtatt gtttcctaaa tggtgttagc ccagagtgtc     39000
     agaacaaatg gcttggcaat actgatcaca agatgcagga taccggtcgt gttaactttg     39060
     gcaataatgc acagtatacg aatctttatt actcagctat gggtttattg gcctctgatg     39120
     atgtgcgcgc ttccgtatgg ggcatgcggc ttataaacgc ctttatattc accgctctga     39180
     gtttgctact ttatcttgca ttgccgcagc cgcgcagggc ggctttgctg atcacatggt     39240
     cactaagcct tgttccggcc gcaatgtttt tcataccctc gtctaaccca tcatcatggg     39300
     cgtttatcgg ggtaccgtcg acctttttcg caatgctttc cttctttgaa actcggggta     39360
     ggagaaaaat ttgcctcggc attatcgcgg ttttttcagt tttgctatca gcttttgcca     39420
     ggtctgatgc agccatctat gcccttctgg caattgtaat cagcggaatc ttgcaggtgc     39480
     gggattttaa aaacccctgg gctcagtttg cattgccggt tgctcttggc attatgtcca     39540
     ttgctacatt ctttatgtat ccgctaaatg ttgcagcgac tggacttcct gctactggcg     39600
     ctagagacta tggctttata accttcgtta aaaacattat ttttataccg agttcttttt     39660
     taccgagcgt atttaccccg cagttcctgg ggtggcttga tgtgcccctg tatccccctg     39720
     catatgtgtt tgtcgccatt gcagcgctaa ttgtcgttgg atttgccctt ggggttggag     39780
     gggtgcgcaa gctatttgcg gttctgctga ctcttgcggc attgattatc gcgccattgt     39840
     atgtatctca agttgcgggg attaccgctg ataaactgct tcagccgaga tatttagctc     39900
     ctcttgcgat tatcttcatt gctgtggttc tgtataccgg ctttggtgag gtcctccaga     39960
     taaagaaacg atatatggct gttatttttt ttctaattgc ccccgctaac gcattcggta     40020
     ttttttccct gctcaggcat tatgatgccc tgccaagttt tttgggtggc gctttaccgc     40080
     ctacatcaga cgggcccaat gcgggcgcca gccgcgatgc gctcgctggg catcaccccc     40140
     ccggatccat ttctgcgccg gatggggctg gtacttctgg tgaacattcg ggatcatggt     40200
     ggtggcctgg gtttcccgtt tctccgattt tgcttttcag cgtagttgtt gcatctttca     40260
     cgcttgcatt gttaattgcc ttgcgcgatg tgctcaaaat acgcaatgag gtgaatatag     40320
     cgaatgaaac cgagaaggct ttggcacgtg ccaggcgtct gagcgtatct gacacgccag     40380
     cgcttgtcaa tgttggaacc ggaatgataa ccctttccaa gatatctaac gcaacggcct     40440
     ctataacgct cgaggatgca gaagaccaat cgtaacactt atccggtttc tttcttctgt     40500
     atatgtgatc tatgcctgtg ttatgcttct gcctaagatg catcagttga tgttatctgt     40560
     ttagataaca tatgttgagt tgctgtactg cctactggga ttatgtggac cactgagatt     40620
     acacagaggt atcttatgaa gaaacttata tctcttactg ctctctatcg ttatattatt     40680
     catagcccaa cctgcgcagg caagtgacaa tgtgaagggc aatcatgtta tgcacgcgcc     40740
     tggtaacgct gtaaaaacct ttgaccctga aggatgtcta tacggcgcat ccagtggtgc     40800
     agttggcggt tttgacctgg tttaatgaca ccctcttgca gggtatggcg ttattcgtgg     40860
     tgataacact tcttattggt gccggattgt ttcttctgcg tgatttgctg cttcctggtg     40920
     atgagcaaat ctagctatat acaatttgtg ccacttgcac ctcaatcgct ataccctttt     40980
     tagggcgatg tgctctttcc gatgcgctct ttctacagtg aggtcgttgc gcgcgcccga     41040
     gcgatagatt tacttctgca cccataccta cgttcatcgc acagccgcct tgtcttgcca     41100
     ccttgtctta ttgattgtgc ttgctgcgtc ttccagcggg cgcacattat ttgtgggtat     41160
     ggatcaatac ttggttgtag ctacttgatg ttccgatcct tgtttatttt tgatatgaac     41220
     ccatcgtttt ttctgcgaac catgtaaaag gagcatctcg cgatcaacga aatacgtata     41280
     tgtgtcatat gtcattccat atatttaata tgtgcaagta agtacatgca gaagactcac     41340
     ccatacaata tgtatatgtt tggcgaaata ttcaagcagc gcgcactgga ggtaaagcga     41400
     tccattgggc agatgccgag attgcccagg gcatgcttta ttgcaacacc gccccttgtt     41460
     ctagtcaaga tggtgattct tgttacgctg tggtcattct ggtggatgtg gcctattcta     41520
     ttttcgataa ttgccattga ctgggcagtt tccgcggtcg gcgtattttc tgccaggcgc     41580
     tgggcgaaac acaatccaga taaattgctc aacctcaagt gggctgtcta tccgtttgtt     41640
     tttataattg cgctgttcgc ttttattcgc ccctttttac tgatgggagg ctatatcctg     41700
     ctgatgtttt ttgcgcttcc gattggcggc atgatcagaa tgtttgctct gctagcaatt     41760
     atgtcggggg ctaagcctaa gcctatctca atgctgcgac gtgccataaa gggaagaaag     41820
     aagcgtgatc tctaaagctt gatataaggg accagggttt atctgattta cggtaggcgc     41880
     ttcggaagaa cttcacagaa gtatgccctt ggcaaggcta tctgcacaga ggcgattttg     41940
     taccgctagg cccagtcgac taggattaga cgcatcgcag gctgggtgta tgcaaagatg     42000
     aataatgcat gcagacgaat aagtgattgg atccgcccct aacaggtatg tttctttctt     42060
     gtatgtgatc tatgcctatg ttattcttgt gctcaagata catcagttga tgtatctgtt     42120
     tagataatat gtgttgtgtt tacgtgaatg tgttacattg acatggtgaa tttacatgga     42180
     ggtatcttat gaagaaactt accactgtat ctattactgt tctctctatc gttaccctat     42240
     tattcatagc ccaacctgcc caggcaagtg aaggtaatct ggaagctaat caaggcacaa     42300
     aactcaagag agtcaccaga agcgtaaaaa catttgatgt tgataagtgc ctcaatggcg     42360
     ctgttagcgg tgcagttggg gtgggtggcg gttttgccgg cgcgcaggcc gctaaattga     42420
     taatcaaggg cgtcagcgcc gttaatccgg cgacctttgc tgccgtaaca gcagggactg     42480
     ctgttgctga ttgcgttatg cacggtgggc ttgttgatga tgttgtcaat gggtttaatg     42540
     ctggatttaa cgccgttggt gacttcatag gaaagctgtt cggatgaatg cctctacatt     42600
     gggcggtaga ctcaaaaaca gcaggctgtt tattgttgct tgcatgctct tattgattcc     42660
     gttgtttatt tatgtcgtac tgtcaggtta ttccttaggt tacgctttcg gtgctgcact     42720
     cgctcttgcg tttacgtgtc ctggagtcgt gcgttctgtt tttaatggtt cgttctcgct     42780
     tgatctgggt aacccttttc ttgccgcgat tggcctcttg ggcgccggat accttattct     42840
     catgaccctg agtcctgtac tctggctttt attcagtcag acttttatgt tttatttcaa     42900
     tgccgtcatg tttaccatgt tgtttgttgc tttgcagtgt gcacttgcgc ggtgggctgt     42960
     actaagccgc cgggctggct gaagcctgta ttactgtcgt ggtaataaca ttccttggtg     43020
     ctgctggcgt tgccggcagt gcggcgttgg cgtgtctttc tagcggaatt gtcaagccga     43080
     ttccggctag cagcaaagac atagtgatgt ggattcgcaa cagataggct tgaataattt     43140
     tgtgctcagg aacctgctgt taggctttgt tgcaacggta tgcatactgt tccccattgc     43200
     ttttgtgctt gttgctggcc gtgactggca tgcagtccct cttgtttttg tggtgcttat     43260
     ggcaatctgt ccattgttta tattcgatta tcgttttgtc tccggcaaat ttaaggtaat     43320
     tgttggactt tcctgggcgg ctgcaatatt cttttgtgcc ttcactatcc tgacaggtat     43380
     tgcatttttg ttttttggct ttccagacat atcacattaa ttttcatgca catttcatgc     43440
     acatctttta ggtgttctat gcccccgcta tttatccaag tagctgcaat ccttgccaaa     43500
     tttatcaagc tagaacggaa tgaaactgca gtttgtagag attaaaatac ctgcgctacg     43560
     actgtggcat atttggcact gtacatttaa ctgcatttga gactgccctc ttaacactgc     43620
     cacgggttac ccctaacagg tatgtttctt tcttgtatgt gatctatgcc tgtgtgattc     43680
     ttgtgctcaa gatacatcag tactggtgta tctgtttaga taacatatgt tgtgtttacg     43740
     tgaatgtgtt acatgacatg gtgaatttat acggaggtat cttatgaaga aacttaccac     43800
     tgtatctatt actgttctct ctatcgttac cctgttattc atagtccaac ctgcgcaggc     43860
     aagagggggc gcagggcata tttctgttgt tgccaggggc ggcaatacct acattactgc     43920
     cactattcgt gaagggtttg atcttgacga atgcctgaag ggtgccgtta cagaggtttt     43980
     tgatgtcggc accggtagtc atatggggtt tttgggaaga ctggtaaaaa ttgttgtaaa     44040
     aggtgcgcgc ttcgcgggcc ctatcgggac tgcgattggt accagcattg atgtaattac     44100
     cggttgtcta aagcagggta ttgttccgga taaaccgcag ataccccatg taaattcagt     44160
     ctgcactgtt aacatcttct cccacagacc gggtcatagc tgttataaga ggtagcctgt     44220
     ggcgcgcatc acacgtaata cctcagtgcc tgtgctgatc ctgtgttgtt tgctgtcaat     44280
     cccccttctt gctatcgtcg gggtgattct tgttctcgcc ggtagcgaat tgtggtttat     44340
     cccagccttt gttctgttct tgatgtttat atttggacct gagcatcatg ttactgatta     44400
     caacttatgg gaagcacttt ttgccgggct tataatgggc ggatctcttg caatgcttac     44460
     gacctgctct gtcgttaatt ttgtttatcc tgaattatgg ttattacgct cgccaggttt     44520
     ttctattgcc tgcactgtcg catttgccat tgctgccgct tttttcctgg cggtagattt     44580
     gcgtcgcaag ataaaacagg gccagtaaag ataaacacac attggggcaa gacggctaca     44640
     cgccccgtct tgcccatctc ttgctgccaa gcctgtcgaa tcgtgctgta tcgaatcgtg     44700
     ctgtatcgaa tcgtgctgta tcgaatcgtg ctgtatcgaa tcgtgctgta tcgaatcgtg     44760
     ctgtatcgaa tcgtgctgta tcgaatcgtg ctgtatcgaa tcgtgctgta tcgaatcgtg     44820
     ctgtatcgaa tcgtgctgtg cggtgcaaga tttttcttat caccgtgtga gactatgact     44880
     agaggatcca gaacggtgtt tattaacaag cttgggaatc ctggttctaa atgtagcgcc     44940
     accacctcgt gtgcgcaata tctctattgt gcctttatgg acttttacaa tagatgccac     45000
     aatagaaagc ccaagcccca caccaccgct gttccgtgcc cgcgatgcgt cagatcgcca     45060
     aaaccgcttg aacactttat cgtgtagctg tcttggcacg cccggaccat ggtcgcgcac     45120
     atcaatcaca acatctgttt tatcagtgcg taacacaatc tctattggag agcctggcgg     45180
     ggtatagtgc agggcattgt taatcagatt tgcaagtaac cgccgaagca tattttcgtt     45240
     cccgagaatc atacaggatt gccttttcgg aataccggtt gtgatcttac gagttttttc     45300
     caggacattc atgtcaataa ctgactcttg gacaagatat ttcacatcga caggcacaag     45360
     gtctgtagcc ttttcaaggc gcgtcagaga cagcaagtct tcaaccattg tgcccattcg     45420
     tattgcctct ttttcaatcc gctcaatcgc gttgtcaata tcctccttac ccttaagggc     45480
     gccaatccta tagagctcgg cataacccct aagagataca agtggcgttc gcaattcgtg     45540
     acttgcatct gccaagaatt gcttcatctc gccaagtgtt ttatctcgct caccaagggc     45600
     tttttcgaga ctgtccagca tggaattcag agatttgttt agattgagta tttctgcaga     45660
     aacatattca gaccttatcc gccttgaata atcccctctt gcaaacgccc ttgcggtctt     45720
     ctcaagagca tatagtggag atagtgtatg tgcggttatt agataaacta tgtacgcagc     45780
     gattgcaaat accgcaagac taaaccaaat atagcttctt tgataaaaat tggcggtatt     45840
     ttcagtacca gactgcggca ggtaataagc aaggatttct tgcccactgc ccgtttccag     45900
     tggctgcaag agcattctat atttcttttg tctcgatatc gagtgcaaag taaacggcgt     45960
     gttacccttt tcgttgtaaa gtgtaatgtc aattttcctg tcaaactcga tagaagggtt     46020
     ttctccgata ggccaaatca gtgtcccgtc gaatttataa atatgagctt tgtagcttgc     46080
     ccttcccgga ctgaacactt caaaactgct ttcaaacagc ggaaatgtac cgcttatatg     46140
     aattagctgc tcatcaattg tttttatcat ctcgttcttt ataaccagag tggttccaat     46200
     acccacagca gtgaacgaaa atgcaagcac aagcgctaca agcgttacca ccttactctt     46260
     tatcgaagag cgtgcaacga gtctgtacag cttactggga aactttgctg acacgagtca     46320
     gcgcgttctc atgatataac caaaacctcg cttggtatga ataatcgttt cgctactgta     46380
     agctgctaac ttgcgtctta tatacgaaat ataggactcg acaatactcg agtcaccatc     46440
     aaaatcatag tcccaaacgt gccccagtat ttgagacttt gaaagcacgc ggtttggatt     46500
     caacataaag taccgcagaa gtttgaactc agttggactg agatcaatta ggttaccctt     46560
     taggaacacc tcatttgagt tttgatcgat tactaggtca ccaacacgga tagttgcgtc     46620
     tacatcatct atctttgttc gacgcagaat agctgccaca cgcgccagta tctcatcgag     46680
     actaaatggt tttgtaacgt aatcatcacc acctacggtg aggccagtta tcttgtcttc     46740
     tgtgctatct cttgcactca ggaatatcac gggacagcga aaaccagcct cgcgaagtcg     46800
     tttcgttgca gcaaacccgc tcatatctgg gagcataaca tccatgatta tcaggtctgg     46860
     ctcctcagcc aggaccgccg agactgcacc ggcgccattc ccagcggtga ccacaccgta     46920
     ccccgcgaac cgcaagctcg ccgccaggag atcccgtata ttggcttcgt cgtcaacaac     46980
     tagaatcttt gtctgactca tgaacttaga ccctgcgtgt agcgcactat taccgaatat     47040
     cgctggtgca acgattcgga ccaactccaa caagggatac cccgagcaaa ccgccaggaa     47100
     cgaatgcaga gccagtcaca gctagaccga acccgggagg cacggaccct acaccattat     47160
     agggcagtcc tatctatcct gacattttgt acatactgag catgcggaaa acttcaggat     47220
     aggctctttg taagagtaaa atggttacag gtttaagggg taaatatgcc tttggggacg     47280
     gttcgttttt ataacaaaga acgtggcttt gggtttgttg tgtccgacga tggcgagtct     47340
     gtttttttgc cggctaaagc tttaccggat ggcgtctccg acctttcgcc cggcacccgt     47400
     gttgattacg gggcagctct gggaaagaag ggctctcagg tcttatctct aagagttcta     47460
     agaaaaccac cccgccgtgg tgttaggtca actgatgaca tggcagttat aatcgaggat     47520
     ctaatgaaaa ttcttgatga agcgggcgaa agttttaagc gtggccgtta cccaaaagcc     47580
     gaacgcgcta aggttcttgc ggctatgctc cgccaggttg cagacggtct tgatgctaac     47640
     tgactcgcaa agagagcgca taaaggatct cataagtgat tcttgtgggt cagtaggtga     47700
     atttgttgag tgtgttccaa tatctaatgg cgtttatgaa atgcgttatg ttaatttgac     47760
     atgtggatac acgggttggt tttggattgc tgcggttaac aagaccgctg atggtgatct     47820
     gaatgttcta gagctatacc cctccccagg cccgggggcg cttgcattca ccgcacggtc     47880
     ggaccaaatt gccacaggtg gggaatacga tgacgatgaa tccggtgatc ttattactcc     47940
     ggttgatagg gatggcttgg atttctgaat atgactaaaa aatccgctag gacggttgct     48000
     gtctgtaacc aaaagggtgg agttggtaaa acaacaacaa ccataaatct tgctgcatgc     48060
     ttggccgaac gcggaatgag agttttaacg gtcgacctag atccacaggg tgccctaact     48120
     gctggcttcg gaatttccaa ttttgaatac acggtatacg atcttctgct cggccgtaat     48180
     cgcaatgctg tattgataca aacctccctc aaaggcgttg atgtcctgcc agcaaatata     48240
     gacttgtctg cagctgaagt ctatcttgta tcggaagttg ccagagagca aatacttgcc     48300
     aaagagcttg agtcattctc ctccgattat gatgtgatac taatcgactg ccagccctca     48360
     ctcggtcttc ttaccataaa tgcacttact gcaagtcatg gtttacttat tccccttgag     48420
     tgtgagtatt tcgccatgcg aggattggct ctattactcg aaacagttcg caaaatccaa     48480
     gatcgattaa atactgcgct aaaggttgac ggaattattg caactatgtt cgatatgaga     48540
     actttgcatg ccagagaggt cttagagagt gtgaaaaagg cctttcccgg gttactgcta     48600
     acaactgtta taaataggac aataaaattt ccagactcca gtatcgctgg catgccggtt     48660
     accgttttcg ccccaaatca tcaagcatcg aaaaattatc gcgacctcac gcacgaactt     48720
     gtacatcgtg gtgtttttac cttaccaagc taattgtctt ctctgcattg attcgctctt     48780
     attattatct gcatagcgta gctgtgtagg tcgtacactt taatcggtgt acgttcatat     48840
     cattggtgct ggactgattg gtggcagtat cgcgctaggt ctttcccgtg caggactgaa     48900
     ggtcagtgca agtgacattt cgccagctgc tcagcgcctc tcaaaacttg gggatatttc     48960
     gattggcccg ccaaatcaga atccggattt ggtgtttgta tgcacacctc ccgatgtgac     49020
     cgccgccgaa gttgtgagct ctctggatag atttcccgaa acttgcgtag tggatgtatc     49080
     aagcgttaag accagaatat accgtgaggt attgcgtaaa acacaccctg caaagcgagt     49140
     attttacata cagagtcatc caatggctgg aagagagata ggtggcattc agggcgcctc     49200
     tgccgattta ttctcagggt ggccgtggat tgtgtgccat tcgtttgttt gcggtgacgg     49260
     caatgaccag atgaatggtg agaattctgt tcatcaaaag aattacctaa cacggaacac     49320
     cgaagatgaa gcggaatggt ctttggggaa aaatctcttg cattgtataa accttctagg     49380
     agcctttcct gtcttcatgg atagagacag gcatgatcgg tcagttgcgg cagtatcgca     49440
     tgtgccacat atactctcaa gcctcatagc cctgtcactt gcaaatacag atcaaggcac     49500
     agttgcaata tgtggttcgg gtataaagga tatgacacgt cttgctgcaa gcaatccaga     49560
     attgtggacc cagatcattt tctcaaatcg tcgtgaaatc ttacaaagtc taggggtttt     49620
     ttctggactt ttgaagagaa tgctccacac acttgagaag ctcgataatc ctgcgtatcg     49680
     cacggatctg ttctctcagc ttgctgaggc tcaggcccaa caggcccgca ttccaaaaaa     49740
     accgggcaag aatttggatt attcacagct agaagtgctt attccagaca agcccggtga     49800
     gctatcaaag gttttaggcg ctataaacac ccaaggtatt aacttggaag atttgcattt     49860
     tgaacatgca aataacctcg gggttgtaaa gctatcggta tcaaacaagg acaggtgtcg     49920
     attgatggac actttggaag ataagtggac tttactagta tagttgcaat cgatggtcct     49980
     gccggcagcg gaaaaagttc tgttggtcgg gccgttgctc aatatttagg gtatggtttt     50040
     ctgccaaccg gaagctatta ccgtgccttt gcgtttctgc tagatcagac taaagacctt     50100
     gatagtcagt tggatagctt catttcgtcc gtgcgtaatg atcttgatcc gtacaatagc     50160
     gggtttaacg tgcatattga tgatagtccg ttttttgggt catcaggtat atccgcatca     50220
     tcgaggaata ttgcctctga gctaaacaac ccggaaataa cctcaaaaac tgccgctgtg     50280
     gcgcgcaaca aaagtgtacg agtgcgcctc aacgagtatt ttagaaagct atgttctgaa     50340
     agtatttatc cggccattgt ccttgagggg cgcgatgcaa caactgtgat agcaccaaat     50400
     gcaagggtga aaatattctt gacagcctcg ctggttaaac gagcagctcg gcgctccgaa     50460
     cagctgtctt ccgaacctcc aaattccgta ctggaagctt tacgtcaaag agatgaggca     50520
     gacaacgcag tgactgactt tctgtcagat gacagctcca gaattactct ggacacgagc     50580
     gatctgactt tctcggaatc ggttgcccga gtgcttgaag tgattgaaca agctggaatg     50640
     ccgtttgtct cagataaatg ggttggagag aatgccgatg tgcttgcggc ttctggggaa     50700
     cttggagcaa cagttgtgat tgttggccgg ccaaatgttg gaaaatcagc ccttgtaaac     50760
     tgcatcctcg ggcgcagaga ggctgtagtg gagaatcgtc cgggcgttac aagagatcgt     50820
     gttgtttacc cggcattttg ggcaggcaga ccatttactc ttgttgatac cggcggctgg     50880
     gagtgtgatg ccgagggcct tgatgctgag gtcgtggctc aggcagaaat tggcatgagt     50940
     attgcggaca taatcatttt tgtggttgat gttcagcatg gcccggttag cactgatgca     51000
     gttatcgccc ggaatctaca acgacagaat aagccaatct ttcttgttgc aaataaagct     51060
     gataatgcca gcagtgactc agatgtggcg caattttggt ctctcggatt aggtcagccg     51120
     tatgcctgta gcgcgacgca tggccgggga gttgcagatc ttatggatat agtcatgcag     51180
     tctgcccaag tccatacgcc aagtttttgt tcaggtgcac cacgggtagc gctaattggc     51240
     cggccaaatg ttggaaaatc gagcttaata aaccaactga cgaattcaag aagagcaatt     51300
     gttgatgatc tcgctgggac gacacgtgat ccgcttgatg ctttggcggt tataggggat     51360
     aaatcatggc tctttgtcga tactgcaggt cttagaagaa agttcaaatc acaaaaaggc     51420
     gcagatttct atgcttatct ccgtgcaaca accgttttac ggcgtactga aattgcttta     51480
     ttgttgcttg atgcgagtca cgcaattact gaacaggatg tgcgtatagc agaaatggtt     51540
     gttgaaagcg gccgagccct ggtaattgcc ataaataaat gggatttgct ggatgaagag     51600
     cgacgttatt ggcttgaacg tgaaatagat aacacttttt tccgctttgc ctgggcaccc     51660
     cgggtgaata tttccgcaag aacgggccgg ggcgtaaaac agttggccac agcgcttcaa     51720
     accgccttga caaactggaa cacgcgtctg aacactgctc gcgtgaatca ttttttacaa     51780
     cgcattacgc gtgagcagcc ccatccgacc aggggtggca ggaggccaag aatcttattt     51840
     gccagccaga caggggttgc cccaccgact tttacactgt ttacaacagg ttttcttgaa     51900
     ccaacctacc ggcgattctt gcaaaagtcc atacgctcac aacacagctt tacaggatcc     51960
     ccaattattc tgagtgtgaa aattcgagca agtcggaacc gctaggatat tgcgtcaata     52020
     attgttttga actttaatgt gctttcttca agttcttttt gcgggatgct tgacttcact     52080
     attccacacc cggcaaaagc ttttatatgc cccctgttta gctgcgcaca tcgaatgggt     52140
     aatgtgaact cacatgagct atcttgccca atccacccta ttgccccgcc gtatagctcg     52200
     cggtcaaatg gctctatctc tttgattatt tccagcgctc tttctctggg ctctccagca     52260
     attgctcctg ttggatgaat atgactcaat gcgcgcaagg gggagatatt tggcttaaat     52320
     gtgccggata taaagctcgc tacatgggtt atgtgtgtaa atctcctgat tttgtaggaa     52380
     ttcaccgttg gcgctgtgtt catgagtgtg ctaagtcgct ccaaggttgg gttaagcgca     52440
     aaggaatgtt caagccttag cttttcatcg agatatgtct catcgagagc cttgtaaggg     52500
     gggcttgccg cacaattatg tattacatgt ttggggtgat tggcagacat gctgcctgca     52560
     agaatggaga cctcaaaacc agagttacca tctgttctca gcagcacctc gggtgaagcg     52620
     ccgaatagtc catcaaatac aaacaccgtg ccgtttgccg tattcataag tctctgtatc     52680
     gcctcatcaa ggtcgattgc gtgtgcttca gggtcaaaat catcatgtat ttctgcgata     52740
     atgtcccgcg ccaaaactac ctttgatata tctgcattta aaagtttgtt taccacattg     52800
     gtaatggcat gtttataatc ctcttgtcta aaatctccca ttttaaagct aatactcttt     52860
     ggccatttga aaattcgaga gggctccgag aggttatgac aaatcgttgc atctattttc     52920
     caggcaaccc cgtcgctcca aaaaaacatt tgctctggta ttgcaagaaa actcggcctg     52980
     gcagaatatg gcgaaaatgt aaatccgaat agcacgataa ggccaatcgg attgagattt     53040
     tcgctcgtgt actgtatctt tgtatgtatt tcatttatca gcgactcggc tgcctcaaat     53100
     ctagcctcgg cggaatagga atcgagattt atttttagca cgcggccctg tgttctcatc     53160
     atcgtgctgt gtgtacaata tacgaaatcc caagacaata ctttgcgaat atactgtcgc     53220
     ttgaagtcgc tacgatccat atttccaatt cttgttattt caacttcaat tggaagcatg     53280
     gtaaccctcg tcgtaactcg gttcaagtat tttgttattt agaaaataaa ccgatgtgta     53340
     aagtttttgc acctgggact atactttctt cgctttgggg actaacattc acattgatat     53400
     ggtaattcac ggcaaacaca cggcagagat tagaaaaatg ttcaataggg ttgcccaagc     53460
     ctacgataga acaaatcttg tcttgtcatt cttacaggat gcccactggc gtcgggctgc     53520
     ttgtaagatg cttggggtaa ctgccgggga agaggtgctt gatgtcggtg ctggtactgg     53580
     cgcgagcacc cgaacagttg ccaggaccgg tgctgccgtc acaggaattg atatatctcc     53640
     ccgcatgctc caaattgcac gcaatcgatg taaaaggttt caaaacatca cgtggcgtct     53700
     caccaatggc gatctgccgt tccctgataa gagcttcgac gctattctaa tggtattttg     53760
     tctcagaaat gtgtccaata ttcagggatt cttatgcgat gctgcacgcg tcttgaagcc     53820
     cggtgggcgg cttgtagtgt gcgagttcag ccatcccaga aggtttgttg ccccgttcta     53880
     caggttgtat ctcaggtatg tcttgcccag acttgcaaaa cttatctcga gcgatcctgc     53940
     tgcatacgaa tatcttacag aatcaatcga ggattggtac gaggttgacg agcttgcgtt     54000
     tatgcttgaa cagtgtggtt ttcagaatac atcctggaaa aggttaagct ttggggcagt     54060
     tgccttgcat agggcgctgc gtggtccgga gtagcaaacc cgtacatgct tgtgtcaggt     54120
     atttttctgt ccgatattct tgatccatct ggcagtctga gtgatgatat ttctcccgct     54180
     ctcgataggg ttgaagatct tctgctagaa accgttggtg attgtcatga aatagtaagc     54240
     catttgcttg tcagtggcgg caagcgcgcc cgtccgcttt tggttttgct cacatcttgt     54300
     atgggttctg gcattaatga tgctgttata cgtgctgccg cggggattga gttaatacac     54360
     ctgggctctt tgtatcacga tgatgttatg gataatgcgt atattcgtca tggatcgatc     54420
     accgcacatc gtctatgggg taagtctgcg gctattcttg cgggtgattt tttattcgcc     54480
     aaggcaggtg tgctcggtct taaccttgat aagcgtgcaa ttgcggtgca aactgaggca     54540
     tttcagagaa tgatatcggg tcagctcagt gaaactttgg gtatttctga cagtcttgac     54600
     cctcttgagg cttatataga agtttcgaga gggaagacag gttctttaat cgccgcatcc     54660
     gctcaggttg gggcgatttt aggtgatgcc agcctatcaa ctcttgagcc cctgcgggat     54720
     tttggagaga gcataggggt tgctttccag cttgttgacg atgtgatcga tctttcgggt     54780
     aaatccggca agacccctgg gagtgacata cgcgctggtg tcatgagttt gccgattctg     54840
     cttttgagta acgccgcgaa agatgacaga gactctgcgg ttttgcttga ggaaatagag     54900
     cgcgtgcggc ggcatagcgg cgcatgtggg agtgatgatt attcgtcaga gatgaacgcg     54960
     gttttggcgc atttgcgtaa gcatgatgtg accgcacgca ctctggaaat cgcgagaacg     55020
     tggggagata aggccaaaca tgcgttgaaa aaacttcctg aatgtgcccc tcgtgatgca     55080
     cttttggcgt ttgtcgaaac ggttgtttct cgtgagtttt agagaataga ggtaagggtt     55140
     ttggcgagga ttgcggtagt aggtgcaggt ccagcgggga tatattctgc caatcttctt     55200
     cttgccgatg aatccgttga gcgcgttgat gtttttgagg cattaccagc gccttatggc     55260
     cttgtaaggt atggtgttgc acctgatcat ccgaggataa agagtgttgt aagcaccctc     55320
     agtgacatgt tagagacacc ccgtatgcgc cttttttgcg gtgtgcattt cgggcaacat     55380
     ctttctttag aggatataaa acaacggtac aatgcagtta tttttgcaac aggcgccctc     55440
     cgtggggcta gactcgatat tccgggaatt gatgccagga atagcttttc tgcggctgac     55500
     tttgttgcct ggtatgacgg gcatccggat tacccacgga catggccttt gtcagcaaaa     55560
     tcagttggca taatcggtaa cggcaatgtt gcgctggata ttgcgcgaat tctagtaaaa     55620
     cagcctgaag aactagaaac aaccgaaata cccgacaatg tctatgaaga tttgaagagt     55680
     tctgcattgt ctgacgtaca catatttggc cgtcgtgggc cttttgacgt aaagtttacc     55740
     cccctcgaac tcagagagct cggcgaagta aacggtgtgg atattgttct taatgaagat     55800
     gattttcagg taaagcctga tcgcctggtc aagcaaatga tcataatcga tcgtgtcttt     55860
     tcctcatgga gggctcgctc cggtacatcc tcaaccaggc gattgcactt tcacttttac     55920
     tcggttccca agcgggttgt tgttcgggat aattgcgttt ctggacttga gtaccaacag     55980
     ctgcgcccca cgatagatgc ttgcgattgt gttgcgcccc cgcgtgatag tgacacgcgt     56040
     catgaggtgg tagagcttga tgcgctttat acggcaattg gatattatgg ctcacccctt     56100
     tccgacttac cttttgatga tattagtggc attattccaa atgaccgcgg cagggtaatt     56160
     atcgagggta agccacttag gggatgttac gtaacgggct ggataaagcg gggccctgtt     56220
     ggactgattg gtcatacaaa gagtgatgcc atcgagacaa tagtcagtat gcggcaggat     56280
     aaaactgcct ggtggaagcc agatactgac tctgatatat cagacctatt gggtagcagg     56340
     ggtgtgaact tcacgggtgt tagcggttgg cgcaagcttg atgcgcacga aatatatctc     56400
     ggcagtctct caggtaaaac acgtaaaaag gtagttccac gggaagaaat gtattacatt     56460
     tcttcccgtg gaagcccttc gtaaaagagg caatgcccca ggatgatatg atgccctgat     56520
     actgtcttgt gataccgtct tgttccgtac gcctgtctcg tacctctata gagcgctttt     56580
     ctgtgaactt gactgtttga ctatttagca tttgactatg ttttacctga gggccaaaat     56640
     gccgttatat ctgttgcatg tcactcggtc attatgggcg ttaacaatgt gggcattaac     56700
     aatgtgcttt atagcgacac ctctgtttat aaaaacctct taaacatttt gtaccccaga     56760
     agtcgaaccc ctgaagtcgt aatacatgtg cacacaaatc gcacaagtaa ctggattagc     56820
     agttcactta ttacgaagct tcttggcaat ctcgcgcagc ttatcgctaa tgcgcttgat     56880
     ggcctcacga atgctgagtg cgcttgatgc gctcaggaca ttggctaagt ctttgttggc     56940
     gtatataacc cttccctctt ttgccgcttt cagagaactc agtaaagcat ctttggttat     57000
     atcgtcagtt ccgatgctga taacaattag cacatcagta tctacccagc ttagtttgtc     57060
     agttggtatt ttggcataga aacccgcctt tggtaactcg tttatttttg gctcaagtgt     57120
     aaagccgagc tcttgcataa gatcccagcg accatcaccc ggaagataca caccatactc     57180
     cgcgaatttc gctacaaatg ccccttttaa tcccctatag agcggatcct gagcatcttt     57240
     aatggctttc tcagttttct tgatagcctc ttcaccctct tttacgcgcc caagagcctt     57300
     ggcaacctgc ctttgctgat ccctccaatt taacacccat gactttgtcc ccggaggtcc     57360
     atataccgtt ggggcaatct gactcaaccg cttataagtt ttttcatcgt tattgctgcg     57420
     gacattcagg attaaatcag gttttagatt atgtatctgc tcccagttca atccatccgt     57480
     gccgcgggag ataacttctg gcttcacatc accaaacagc ccctcggccc aagggccaac     57540
     acccttattg ccaaagctaa tccagtcata caccgcaaca ggctttattc ccacagcaag     57600
     ggctgcttca gcatcggacc atccgagggc tacaacccta agatcatgac cctttggtct     57660
     tggtatggta acttcaccaa acaccgtctc aacttttgac aaaacagaag acgactcaga     57720
     gtcaccttta ccgccaaaac agcctgtcaa tagagagagc gcaacaagcg caccaagtaa     57780
     cttcctaccg aacacaaccc ctcaattgct ctgtaccaac aatctcagaa caacacgatt     57840
     ctgtctcaca cccaaaggaa taatccaggc cacgcacgaa agcgcagtat tcaaggcacc     57900
     caatgtacct tgaggccagt tcacttatta cgaagcttct tggcaatctc gcgcagctta     57960
     tcgctaagga actttattgc ttcaggaata ctgagtactg aacccgcaat aagagccaga     58020
     ttgaattcat cagacccgta tatgatcctt ccctcttttg aggcctttag agaagcaata     58080
     agaggatcat tgtgattagc tgcttttcta atcccgcgct taactgttac gacaatcaca     58140
     tccgtgtcaa ttaggtttaa cttacccgag ggaatatctt ttccggcgtg acgcccgtca     58200
     aagagctcag tcacccgtgg ctcaagcgta aagcccaatt ctctaataag atcccactgt     58260
     ctcgtagatt ccgcaaacac gccgtagcct gagggtctct gcacaacaag ggcagctttt     58320
     aatcccctat agagcggatc ctgagcatct ttaatggctt tctcagtttt cttgatagcc     58380
     tcttcaccct cttttacgcg cccaagagcc ttggcaacct gcctttgctg atccctccag     58440
     ggaatctggt atggctggta gtccttggag ttttttggtc catataccgt tggggcaatc     58500
     tgactcaacc gcttataagt tttttcatcg tttttgcttc ggacatccaa aataacatcc     58560
     ggcttgaatg cctttatttg ttcccagttc aatccatctg ttgaaaaaga cataaccgtt     58620
     ggcttcacat caccaaacag cccctcggcc caagggccaa cacccttacc gccgatattg     58680
     aatgcatcaa gaaccgcaac aggctttatt cccacagcaa gggctgcttc agcatcagcc     58740
     cgccctaggg ctacaaccct aagatcatga ccctttggtc ttggtatggt aacttcacca     58800
     aacaccgtct caacttttga caaaacagaa gacgactcag agtcaccttt accgccaaaa     58860
     cagcctgtca atagagagag cgcaacaagc gcaccaagta acttcctacc gaacataccc     58920
     ctcctatttg ttatttcaac ttatccttac aaatcaacac atccgcctat tcgccatata     58980
     ccaggctagt agctagacaa aagaaagtaa agggttaatt tttgctaaca gcaagtgaat     59040
     ctttgcgata cggcaaacgc ccccgcgtgc attattcatg atctataact gctggccaga     59100
     cgcgaaacaa tatcggacgg ttttcgcgcc ccgttacaat cgtttcaaat tctcagattt     59160
     gcggggaata atcatgggtg tattagattc aggatcatct attattcttg atttcaagcc     59220
     aaatgcattt tctatcaagt tttctgttat aacttttttt ggttcgcccg aggcaatgat     59280
     ccggccttct cccatcacaa acaggtgaga tgcatatctt gcagcttggt taaggtcgtg     59340
     taatgagcaa atgatagttt tgctttctct gttgagagat gctaaaagtt caagaatctc     59400
     atattgataa gctatatcaa gaaacgtcgt tggttcgtcg agtaagagaa tacgagtctg     59460
     ctgagctaat accattgcta tcaaggccct ctggcgctgt ccgcccgaaa cggcttcaat     59520
     ggctcgttgt gaaatatgtg aggcctgaac cgcttgaagg gactctttta caacttcttc     59580
     atcagttttc gtccatctat gcagaatgct ttgatgggga tatcgccccc tgctcacaag     59640
     atccgctatg gttagccctt ccgggagatt aacctgttga ggtaggaaag cgatatgctt     59700
     ggccaaattc ttaggcttta accttcgaat atgctgcttg tcaaggagaa tatccccttc     59760
     aaatctattt agtccggcaa tagagcgtaa aaaagttgat ttgccacagc cattagcgcc     59820
     aataattgcg ataaaagagc cccgttttat ctctatgctt atgtcgtgca gaaccttgtt     59880
     ttttccgtaa gaaaacgaaa gcttatcgac ggtaatcatt tgctcccctg atagatagat     59940
     aaagcagata cgccccgcca aatacaattg tcacgacccc ggttggtaat tgcgacggtg     60000
     cgataattgt tcttgcaatt agatctgatg cggccaataa gaaccctcca acagctatag     60060
     ttgggaaaat attaattgcc ttactgccaa caagaaactt tgcgatatgc ggagcggtaa     60120
     gggccacaaa actgattggg ccaaccactg tcgttgaaac cgcagtcaat acaaccgcaa     60180
     tgacaatcat cattgtcaat gtacttcttg ctgaaacgcc caggcttgcg gcattgtcat     60240
     cgcccatttc aagaactcgc attttaggaa taacaataac ggccaaactg acgcatgcaa     60300
     tcaaggtcag gtataagagc agtgcgtcac tccacgttat taggctcagg cttccaacac     60360
     cccatatgct tatgttctga ctgatttcaa cattgataat tgacttcatg taggtattga     60420
     acgatgagat tattgcgtta aggctaatgc cgactataac taaacgtaac ccgcgaaatg     60480
     ttcttgtcaa gctcaggaaa tatacaagaa tggcaacaat aaacccaccg gctagcgctg     60540
     aaagtgttga cggtgttctt tctccaccaa aaagctctgc agctattatt accccggcaa     60600
     atgcacccgc attgaatcca ataatatctg gactgcaaag agggtttctc gttagagact     60660
     gaaacagtgc tccggctagg gcaacagagg atccaacgaa aattgctgat aacacccgcg     60720
     gaagtctcca ttcaagaatt gtttgccgta attcgatatc tccgttgcca gttaatgcac     60780
     tccacatatc cgcaaagctg gtttgcgtat agccaacgct gactgataga aacagtaatc     60840
     ccacgcatag agatgcaaaa acagacccga ccaccaaagc acgagtgtcg agattgcaac     60900
     ttgtccaata cgttctcagc gccacccgct gtggcatgat cctcaaaaga cttttacctt     60960
     tcttgacagg aaaatcagaa tgggcgcacc caagaaaggc acaaccactc cagcgtctag     61020
     tccggttggt gttagaaccc gaccaagcgt gtctgcagtc agtaacacaa tcgggccagt     61080
     tatcaaacaa agaggaataa ttctgagcaa attgggtcct gatataaccc gggagatatg     61140
     tgccgctgca agcgccaaga aactaatcgg accgactgcc gcggtagatc ctgcgctaag     61200
     cgctataact gcaatatatg accacagtgc agtttttcca acgccaagcg attttgatat     61260
     gtctttatca attgacaaaa cattcagtga gctcatcatc ataagtgcga ttagtattcc     61320
     ggccaggatg agaggaaatg atatgtacac cgtgtcgatt tttttgtaat cgagtgaccc     61380
     aactgcccag tggcggatca cgtcaaaaat atcctgattt attaacgcca ccgaacgtgc     61440
     cagtccgcta atcagcgcgg ttaatgcaac tccgaccaag atcaattgcc ccggagtgac     61500
     aatattccca ataaaataaa caagcccagc agcaattgag gcacccaaca gaggaacgat     61560
     cagcaaattc cagaaaggcg ttacatagcc aaccaaaaac ccaaggacaa tcgcaagata     61620
     tgccccatga gttattccaa gcagccccgg atcggccaat ggattccggg taaccacttg     61680
     cataattgcg ccagcaactg agagtgctgc cccaacaaga attgccagca agatacgagg     61740
     aactctaaaa tctcgcagga ctacatcttt gaagtcgtct ccacccccga acaccgcgtc     61800
     aatcaattga ccgacgcttg agccatcgag aaaaagggcc aaataacaaa gcccgacaat     61860
     aacgacgctg ccgaatacta aactcaaacg aaaaactggc cctgccacac atttcaggct     61920
     atctgatgtg taatacgaag taaagggtga gttttaatct ttcttgcagc tatggactgc     61980
     cagatgtcat ttggcagtct caccccattg gtatgcaaat gcacgaccat cagacttctt     62040
     accgcccgaa gaaacaccct aaagtcacag ggtctggtag cgggaacggg attcgaaccc     62100
     gtgaccccac gattatgagc cgtgtgctct aaccaactga gctatcccgc catatgagtg     62160
     atcaaaaaga gccccgggtc aggattgaac tgacgacccc ttccttacca tggaagtgct     62220
     ctgccactga gctaccgggg cgcaaacaat cccaacggct agaataaaat atgtaccgca     62280
     agggcaagaa taccaggttt tgttcaacca accggggttg ctctttagga tatttgtttt     62340
     attacggaca tgcatgggct tatctaggaa aaacgcgcag agcgcagaaa aacttttcaa     62400
     atgccttgca tccgcgtcaa gactcaagat actgttcgtt ttgcttgaat ctgagaagtc     62460
     agtgggtgac ataactgtgg attgtgatat gagtcagccc cttgtctctc agcatttgcg     62520
     ccatcttagg gataataact tggtttatac aaaaagacac ggaaagcaag tttattattc     62580
     gatagcagat gagcatataa aacatgttgt tgctgattgc atacagcatg ttcagcacga     62640
     aacataagtc tgtttacagt aactttctga ccacccaagg tgtctcaccc cgggtggatt     62700
     gcatagctgt cttgaataca catcagggca gctggtggta ctagacatta ggcggtgttt     62760
     taggctacaa catagctgtc gtttaaatcg aaaaagcggc tatgcccagt ggcgagtgag     62820
     ggattcgaac ccccgaagtc gaatgacagc tgatttacag tcagatccct ttggccactt     62880
     gggtaactcg ccaaagacat tcggccaggt cctacgacgt ccgaccgaat gactcaaaaa     62940
     tgctagcatg tctcacagct gcaaagcagt gctcgtgtac tctgttttcc tattgccatc     63000
     agtaaggttg gaagcctcgg acccttgtcc tgacctataa ccaactggta tatcgtccta     63060
     aagaactctt tctgtaaatt ttttacctct tgacttacgt cttttgagga ctgatctata     63120
     cccaagacga ctttgggcac tccgtaggcg agtgtcgtaa gcttctcgat agaccaattc     63180
     ttatctaagc catcaatgaa gatgcgcagc atttccctca cattgggcgc tgcggtatgc     63240
     aaaacttgct tgtttggagt ttgcagaaca tgtattgggt ttgagaattt tttactatag     63300
     atccttgcgc agctcaatct tggctcgagt tgcgcaaggg acctaatatc agggcgtaag     63360
     tttttcacca tccttagcag ttgggaatca tcacttgccg atatgtcgat cagcgaaacc     63420
     agtgttctga aagaaatgag aatctccggt gcattgaatc ttttattggt tgttgacatt     63480
     gcgcgggtat aagaggatgc caattcacac cccgtaagat cattcggtag actgtcccat     63540
     tcgtcatata gtctttgtag gctctggtca aacccgaccg tgaatgattg gttgggtttt     63600
     ctgcgggcat acatccaccg cagaagggtt ggctccataa ccgatagcgc atcattgggg     63660
     gttagaacat tacccgttga gctagacatt tttgcgtgcc cctgaactcc aacgaaggag     63720
     tacattacgg tcaaaggagg ggtccaatta aatatttgat ttgcaatatc actactggct     63780
     gatagcgatg ccgatcctgg cgaacagtga tcaacacctc caggttcgaa atcaactgat     63840
     tcgtacatcc accgcatagg ccagtcaact ttccagggaa gttttccgtt gttgaattcc     63900
     cctatgccaa tggtttcaga atgcccgcat ttgcaagaat atgagagctc actccccgca     63960
     aaatcctcta tttgtgtcag atctttttta caacgtgtgc aatatacaac ataggggtaa     64020
     tactctcgag gtgactcggc aggttgggtc ttcttgctct ggtatttgcc aattatgttc     64080
     tgaatctcat gccgcttttc gagcgcgagc agaatattgt gtgtatacgc acccgaacga     64140
     tacatttgac tctggcttat atgccttacc tttattccga gaatttccat tgttttctca     64200
     aaatctcccc gaaaatgctc cgaccagctg ttttttttgc ttcctgccgg aggcgggaca     64260
     tcacacagtg gcatcccgat atattgttcg tagcctttgt cgatatttgc tggtactttt     64320
     ctcagacgat cgaagtcatc ccaagacagt atgtgttcgc aatcaaaacc cctcgagctt     64380
     atttcgtcgg caataaaatg tccggttatc acctccctga ggttacccaa atggatttgc     64440
     cctgatgggc tgattccaga cgctacaaca atttttttat cccctttacg ctcttgtata     64500
     acctgctcgg caagttttga aacccagtct tgctttccat atttttcggg acttgcagcg     64560
     tcaattcttg atgccgtcat gcgtttactc taaaaaataa aaacaaactg tatgctctca     64620
     agttggaata gggctaaatt tagccttcgt aactagactt agcttacaat gaatctcaaa     64680
     ttggcttctt ctccgcatga gctacggaca tgcttggccg gcagggcatt tgtgctggtc     64740
     cccaccatgg gggctttgca tgagggacat atctggcttg tggacatggc aaggcgatgc     64800
     aatctccctg ttgttgtatc gatttttgtg aaccccctac aattcgatga cagtcttgat     64860
     ttggatactt atcccaggac tctggaacag gatttagaaa agttagaggg caaggctttt     64920
     gcagtttatt cgcctagcgt cgaaacaatg tatccaaacg gtctcgactc tatccgtatt     64980
     gacccagggc caataggaag aattctagaa ggcgccattc gtccggggtt ctttgatggg     65040
     attctcacaa ttgttgcaaa attattgcta caaaccgcac ctgaacgagt tttttttagc     65100
     aaaaaagatg cccaacaggc ctttttagtg aggcgcatgg tgcgtgaact cgcctttcct     65160
     gtcagggttg aagttacagg atttctacgt gataaatttt ccctgcctta ttcctcacgt     65220
     aatcgtaagt taggggtaga tgcgagagaa aaggctcaaa gattatccca aggattactc     65280
     tctgttgtaa ataatggtcc gcttactgtg cgggattgta tcgacaaaat aacagatcta     65340
     gcaaattcaa ttggtgtcga tttgggctat gcgcagattc tggatgaaaa tttttgcgaa     65400
     attgcttcgg atagaatggt tacgcgggca ttccactcgg aggcctgtat tgggctcaat     65460
     accccacttt ttctgcttgc tgcccgtgta cacggggttc gggtagtcga caatgttgat     65520
     ctcgtagttg tttagtcgga tgcctgtcgt tgtccattac aggttgctgt tttgggggtt     65580
     tgcatcttgg gttggaacgg ttgggctgcc ttgcttccat ctatctgcct tgcgctgctc     65640
     ttttggcttg ttatgcactt catactcggc ctggatcgta aagaaaggga ggcgcatttc     65700
     aaggctcttg ggcgcaagtc tcctgatatt cccacacctg agacattaag ccctgagaca     65760
     ttaggcaccg actcagccga taagcgatct cgcggagatt cacaacaggg caccttgcca     65820
     cccggtgggt cgtgaagccc tatttgttta ttttggcggc cctgctattg gccgaccttg     65880
     tcatccgtat tggctgcctt tttgttgttc ctcgcaatag acgtcctaat tctgccaacg     65940
     cctggcttct cacaatattc tttctgccgt ttattggatg gtttcttttt ttgataatag     66000
     gcagctacaa gctcccaaaa tcaagaagag aaaaacaggc tcttataaac cagcttgttg     66060
     caaatgcact gtcagatcat gcagtattgg acaatgtaga tctgcaatgg ctaccatctc     66120
     tggtaaaact aaacagaaat cttggatcta tgccgatggt tgcgggaact cgtgtacata     66180
     ttcttactga tacaagtgtg attatggagc agatggtatc tgccattgat tcagctaaaa     66240
     gcagtgtaca cgttgagttc tacatctttt cgctggatga atttacgcag ggctttttca     66300
     caagccttga aaatgcgacc gcccgcgggg taaaggttcg ggttttatat gatcacatcg     66360
     caactttgcg cgtccctgga tatctgaata tgaagtctcg ccttaagcgc aatgggattg     66420
     aattttatcc gatgcttccg attcagccct tcaagttgaa atatcagagg cctgacctgc     66480
     gcaatcatcg aaaattgctt gtaattgatg atgcaattgc atttgttgga tcgctaaaca     66540
     ttattgatcc tttttataac acgaggggtc gcaagaaaat gttttggcaa gatgcgatgc     66600
     tgcgccttga aggacccgtt ataagcggga taagcgcggt ttttgtctct gattggtacg     66660
     cagaaacagg ccagctcctg agagactaca gaattgtaaa aacttcatcc ggcgattcct     66720
     tcacagaaaa ccgcacacaa tcaaacagtg ttgataggag ttgcccgagt acaaataacg     66780
     ttttatgtca agtagttcct tctggtcctg gatttgaggg ggaaaataac ctccaattgt     66840
     ttctaatgct cctttatgca tcgcaaaaac gggttgcaat tacatcaccg tacttcgtgc     66900
     cggacgaggc aatgacttta gcaatcgtgt cggcgactaa aaggggggtt agtgtcgaac     66960
     tgtttttatc tgaaaaccat gaccaaaaaa ttgtttacca cgctcagtgt tcgtactacg     67020
     aacagctatt gagaagcggc gtaaagattt ggctataccg tgcaccaaat ttcttacaca     67080
     gcaaatatgt aactgttgat gatgatgttg ccgtttttgg atcaagcaat tttgatatgc     67140
     gctctttcaa tctgaatatg gaaatgtcac tgttgctcta cagcaaggaa tttgttgcaa     67200
     aactgcaggc ggttgaacag gaaaaccgag caaatagctc cctgctcacc ctcgatgaat     67260
     ggatgcaccg cgggaaaatg gaccgcttga aagataatct agctagactt acatccgccc     67320
     tgcaataggc acttattgaa gaaaaattta ggattcactc tcgctgtttt ctagtatcct     67380
     tgggtgagga tatgtttgaa aggtttacag ataaagcccg ccgggttata gtactggcgc     67440
     aggaggaagc gcgcacgctt agccacaatt acattggcac cgagcatgtt cttcttggcc     67500
     ttattagcga gggtgatggt attgccgccc aggcgcttga gagtcttgat attacccttg     67560
     agcgtgcgcg cgagggcgtg gcggaactaa taggtcgggg tcagaacgca acatccgggc     67620
     atatcccgtt tacgcctcgt gcgaaaaagg ttctagagct ttcgctccgc gaggctcttc     67680
     agcttggtca caattacatt ggcactgagc atatactcct tgggattctt catgagggtg     67740
     agggtatcgc tgcacaggta ctggtgaata tgggggctga actgcctgca attcagcaga     67800
     gggttatgca ccttttagaa gatggaagag aacaagagcc cgtttcggtt ggcccatctg     67860
     agtcaggaaa aatttcaggc agtcagatac ttgatcaatt cgggcgacac ctcacgcgtg     67920
     ccgcgaaaga gggcaagttg gacccagtta ttggccgtga gaaggaaata gagcgcgtga     67980
     tgcaggtgct ctcgcgcaga acgaagaata acccaatcct aatcggtgag cccggtgttg     68040
     gaaaaactgc tgtcgtcgag gctttggctc aagcgatagt caatggtgat gttccggtca     68100
     atttgcgcaa caagcaagtg tactcgcttg atttgggttc tcttatcgct ggtagcaggt     68160
     acaggggtga ttttgaggaa cgcctcaaga aggttacgaa ggaaatacgt tcacgagggg     68220
     acattatcgt ttttatagat gagatccatt cccttgttgg ggccgggtct gctgagggtg     68280
     ctatcgatgc agcaactatc ctgaaacccc ttctggcccg tggtgagctt caaacaattg     68340
     gcgcaacaac ccttgatgag tatcgcaaga atattgaaaa ggattctgct ctggaaaggc     68400
     gcttccagcc cgtcaacgtg tcagagccca gcataccaat gtgtatccag atactgaaag     68460
     ggttgcgtga tcgctatgag gcccatcata aggtgaaaat caccgatgag gcaatttatg     68520
     ctgcagttac cctttcgagt cgttatataa atgataggtt tttaccagac aaagccatag     68580
     acttgattga tgaggccggc gccaggctga gactgtctgt tttgtctaat ccgagccaac     68640
     tgcgcgctgt cgagaaaaaa attctcgctg ttgttgccag gaaagacaag gcggttgaaa     68700
     aacaggattt cgataaagtt ggcgagctaa aacggaaaga aaaggcccta agagctgagt     68760
     tacggaagat aaagcgtgac tatgagaatg gcaatattgc aagtgccggc actgtagatg     68820
     agggcttgat cgctgaagtg cttgcgtcag cgactggggt tcccgttttt cgactaaccg     68880
     aagacgagtc cgtgcgtctg atgatgatgg aaagaagttt gcatcagcgt gtgattggtc     68940
     aggacgaggc gatttcgtct ctgtcaaggg cgatgcgccg aacgcgcgct ggattgaagg     69000
     atccaaaccg accttccgga tcgtttattt ttgccggccc gaccggtgtc ggaaaaaccg     69060
     agctggccaa ggctcttgcc gagtttctgt ttgataatga agacgccctt gtaagtcttg     69120
     acatgtcaga gtacggagag cggcacactg tatccaggct ttttggagcc ccgcccggat     69180
     ttgttggttt cgaagaaggc ggacaactga cagagaaaat acgccgcaag ccctttagcg     69240
     ttgttttatt tgatgaaatt gaaaaagccc atccggatgt ttttaactcg cttttgcaga     69300
     ttttggaaga aggtcgtctg agtgacgccc agggccgtat ggttgatttt agaaatacga     69360
     taattgttat gacaactaac cttggcagtc gcgatatagc atcaggccct gtcgggtttc     69420
     agtcgggtga tggtagtttt ttggcctatg aggctatgaa ggccaaggtt aatgaggaac     69480
     tgaggcgcag tttaaagccg gagtttctca atcgtattga tgaagttata gttttcccgc     69540
     ccctcaatag agacgagctt ctgcaaatac tgaagatttt tatcaaaaag ctcgatgacc     69600
     gtttgcgcga taggaccatg cgtctttctg tgacagatgc tgccctagaa cagttggtgc     69660
     aaattggcta cgaacccacc atgggagcaa ggcccttgcg ccgagcggtt cagcgcgagg     69720
     ttgaggatag gatttctgaa aagattctgc tgggcgagat aaagccaaat caagagatag     69780
     aaatggactt tgtgaatgat aatttcacga ttgtatcaag ggatatggat taccccctat     69840
     ctcctcttgt gccgtcagtg acaacgggtc tcgttactcc ggatcttgca agtcacgtct     69900
     agtttctgac ataatgctcg cgattttttg cgatgatctg tttttcttta gagcgcctcg     69960
     cgtgaaaagc ctcaccgcga tgcttcttgc cgcaatactt tcggcaccca acttgcgcta     70020
     gttttctaga tgctgcctgt ttctagatac ttcccgaatg acttctgcat cagccctatt     70080
     caggaaccgc cctcgccatg ctctggtttt gagaatacct taccccaacc cctcccgatt     70140
     gtcagccaca acaaagcacc aacgaaggga actaacagca ctgttacaag ccaaagtgat     70200
     cttgataaaa cctgtatctt ttcacgttcc cgcagcacac agtcaacaaa ggctagcaaa     70260
     cttatgcaag catcagaaag tataattagg accaggagac ccacgtgtta aatgttagaa     70320
     catcgagcca taagtcgtcg catattcctg tgaagctttc aaaaatgagg gtaattttca     70380
     tttttctcat tctgcgtctt gtggtgtttt ttgccccgct ctttgtgctc ctgtatcttg     70440
     ggatgcatcc gttgtactct ttaattgttg cctctgctgt aggcttgact tcaagctatt     70500
     tgtttctgac aagactgcgt actcgggcta taggtgacta tcttgacttg cgagcggcac     70560
     atttgaaaaa gctgcgcgat gagcgtggca cacagccttg acgcttgtaa tcgatgcgaa     70620
     acaccttgat tagcctatga catgtgcgtc tgggattgct ttttgcttgc taaatctact     70680
     tgccgagcgc ggtgtgcgtg atattgttgt cgctccggga gcaagatccc aggcactcgc     70740
     gcttgccgcg gttgctctag agcgtgcagg gctggtaagg cttactgtcc gcattgatga     70800
     aagagttgct gcttttaccg cctttggaat ggccaaggct cttgattccc ctgctgttgt     70860
     tataacaaca agtgggagtg ctgtggcaaa tttgtaccct gctgttgttg aagcctctca     70920
     ttcatttgtt ccgctgattg ttataacggc tgaccgcccg cgggaattgc acggtaaaag     70980
     gtctaatcaa acaatgaatc aagagaaatt tttttctcac tgggtcagat ttttttgcca     71040
     tattgaacag gatgtacccg gtgaaagagt tatagatagt gccttacagg cagcacttgg     71100
     tgtgtcgagt ttacgaggcg caggtcctgg acccgtgcat ataaatgttg cctttgacaa     71160
     tccactttcg tgcgcacatg cggtgcagcc cggggacaat aaaggcagtg cactaaagca     71220
     caaaaaagtc cttcgcagca agagagaaac actggtcctc agaaaggacg atccaccgac     71280
     ggttattatt gccgggactg gctcgggcag aaggcctgcg gatatagcct gcgcaactgg     71340
     ctggcctctg gttgctgaga taagcagtgg atcacgcttt gggccgttcc tgataaaaaa     71400
     ctatcgtaat tggctcactg agaacagctt agatatcaga cgtgcaatcg tttttggcca     71460
     cccaacgctc agtagcgaaa ttcccacttt tttaacgaag agaaacattg acaccattgt     71520
     ggttgcacct tttgggcgtg agttttataa cccgtcagga actgcccgac ccgtagccaa     71580
     tgttcttgtt gatgaggaca gtttttctgg aatcccgctt ggggcagcta agtttgcctc     71640
     ggcatcagca ggctgcatat cgcaggatgt aatctcctca gacagaccgc gcggacaccg     71700
     tgtcactcga caacaacttg ttagcgagat ttggaatata accaaagaag acgaaatatt     71760
     gttttttgga tcatcacaac tcataagggt cgcagactct atcttgcccg gcaagagagt     71820
     taccgttttt gccaatcgtg ggttgtcagg gatagacggt aatctgtcaa cggcagctgg     71880
     tatcgccatc gccacaaatc gtacaactcg agttctcgtt ggtgacctta ccggtgtgca     71940
     tgatattggc gctctgctca tcccccttat ggaggcgaaa tacaggctgc agattgtcat     72000
     tgggaacgac ttcggtggcg gtatttttga caccctggaa gtgcatgcaa cgccatcgga     72060
     ttacaagagg gttctttatg ttccgtgtag agtcgatttt aggctcgtat ctcatgcatt     72120
     tggttggaag tacacgtttt gtccggatcc gaacagtttg cgcaaagctc tgaaatcgcg     72180
     gatttttccg catttgcttg aggtccatct tgctgtttaa aatgcggata tgaaaagggt     72240
     ttatcttcgt cgacgtatta tgctatcgat gctaattgtt ctgcctttga ttgttgcggt     72300
     cttttttgct acaggatctc cagggcatga gaggccggcg ttgccccaac ccacaccgat     72360
     taaagttgcc gacgatagat gcaccgaaga gcagatcgcg gttttcgtaa catccgatag     72420
     agagtcttat acaaaaaatc gacttccagc atttagggct tcagttcgca atatagggat     72480
     atccccgtgt cgcatcaatg taggtactgc atctcagagc tatcgtatta ttcgtgatgg     72540
     caaattgata tgggatagta agatttgcct tgttgaccca acaaacgccc tagtgatgct     72600
     tttaccaaaa cagactctga catcacaaac tctcacgtgg cacagggaaa tcgcaaatat     72660
     ttctgattgc ggaaaggact tttctgttcg cccaaaggca actcccggtg agtatacggt     72720
     ggagttctct attgacggtt ttagttcatc aaagtataac tttgttctac agtagttaag     72780
     tcgattataa ggattgtggc cttggagaaa cgcagaagaa aaaagaaaag aagcttgata     72840
     ctgccgtggc tacttgcttc ccgcccggcc accctcattg tttccctgtc ggcagtttcg     72900
     cttgggtggg gtgctgcact tctgaccgtc accggaagaa aggcttcact tttattagtt     72960
     gctcttgcgg cattgaccgc tgttttactc cagattggtg cgaattacat caacgactat     73020
     ggggatggaa tacgcggcgc agattccaat aggtcgcacg cctcgcggcg ccttacagcc     73080
     tcaggcgcta atccgttttc ggttctgacg actggtcttt catttttgat tgccgctgca     73140
     ggctctggac tgattgccgt tatcctcacc cagaggtggc agctcatctt agtcggtgtg     73200
     ttttcgattg ctgctgctta cctgtacact gcaggacctt tcccgtacgc ttatttcgga     73260
     cttggggaat tgtctgtttt tatttttttc ggacccgtaa cagttatcgg gactgtcttt     73320
     ctgttgtctg gaattgttac actgtcatct tttctggtag ctgttgttgc aggttcatgg     73380
     tctgccgcca ttctgcttat gaataatttg cgtgatcacg aaagtgatat gcagagcaat     73440
     aaacgtacct tctccgtttt gtttggggtc ttaattgcca ggatagtttg cattgctctg     73500
     attgctgtgc cctacattgt agtcgcgatt ctgttaatcg agttgccttt tattggctat     73560
     gtttttttaa cccttctcct cagcgcgcca attgtgataa ttttggccac tgccgtgact     73620
     tcaaaagagt ttgcaatagc ttttaggctt gggatcattt gtctgattcc atttgcaata     73680
     ttttttactt ggggacttgc tagctagatg aatctggcac tgtaattttt gcattcgagc     73740
     ctgtgtcctt ggtaatgcca atgtggcgtt ataactgccc cagtgttatt cctgtaaacg     73800
     cgcggggtgc tgtaaagtgt cgcagcttgc tatgctgccc cggatttgct acaatcattc     73860
     tcgctgtctc gccacttgcc ttcatattgc ggtcggctct ggctttgtcg gggtttttct     73920
     tcctcttgcc cgttttgggt gtctttgttt ggggtaggtt ttttggcttt tgctaagggt     73980
     aaaagggttt gtgcgatagg tcgctcctct ctcggtaaga tctctgatcc gcttgaggtt     74040
     ccgaaccttc ttgatttgca gctcgatagt tttgactggc tcataggcgg ccctaggtgg     74100
     cgcgccgccc ttgatgctta ccgcaaaaat ccgtcaggcg ccccaattgc cgaaaagagt     74160
     gggctggatg aggtgtttga tgagatatcc cccatagaag attcggctgg caatatgcag     74220
     cttaatttct ccaagccggt tctggaggcc gaagagttga gcgtaaggga atgccgtgtt     74280
     cgaggcagga cctattcggc acccctgtat gttgaggccg agttcatgaa tcatgatacg     74340
     ggcgagataa agactcagac ggtttttatg ggcgatttcc cgcttatgac tgacaagggt     74400
     acattcgtca taaacggcac cgagagagtt gttgtctctc agcttgttcg cagccctggt     74460
     gtttattttg agcgcacgcc ggaaaaaaac agtgaaaagg atcttttttc gggcagaata     74520
     atccccgctc gcggtgcttg gctagaattc gaagttgaca ggcatgacca gcttggcgtt     74580
     agggttgaca ggaagcgcag gcagccggtt attttctttc tgagagcaat tggcatgact     74640
     gatgatgaga tcagggatgc atttggcgag tttgaatcaa taagcgtcca gcacgaaaag     74700
     aatattgggc tgtccagaga tgacgcgctc cgggaaatat accgtcgcgt tcgtccgggg     74760
     gagcaggcat cggctgaggc tgggcgtgca ctcttagaga atttttactt taccagcaga     74820
     cgttttgacc tggcaagggt tggaaggtac aaagtaaatc gcaaactcgg tgttgatgtt     74880
     gatccaactc ggatggttct tacgaggtcg gatattatcg caacaattcg ttatctcgcg     74940
     gccttgcatc tcggtttctc cgaggttgcg gtgctaaaca gcaacaagag tgtaccaatt     75000
     tcaaccgatg atattgacca tcttggtaat aggcgcatta gaccggttgg tgagttggtg     75060
     caaaaccagc tccgggctgg tctggccaga atggagcggg ttgtgagaga gcgcatgaca     75120
     acccaggata tagaggcgat tatcccgcag acactcataa atgtcatgcc aattgttgca     75180
     gcgctgaagg agttttatgg caccagccag ctctcgcagt ttatggatca gaataacccc     75240
     cttgccggcc ttacgcacaa gaggcgcttg tcagctcttg gccccggtgg actgtcccgc     75300
     gaacgtgccg gtgttgaggt tcgagacgta aatcccagtc attacggcag gatgtgtccg     75360
     atcgaaaccc cagaaggtcc aaatattggc cttatagggt ctttagcgtg ctattccagg     75420
     gtgaacagtt tcggctttat agaaacccca tatagacgtg ttgtcaacgg aaaagtcaca     75480
     gacgatattg agtatatgac agcaacacag gaagatgagc atgcgattgc ccaggcaagc     75540
     actccgctgc gaccggacaa ctcgtttgtt gatgagcgtg ttctggttcg ccgaaaaggt     75600
     ggagaggtcg aggttgtacc ggccgatcag gttgattata tggatgtgtc tggacgtcag     75660
     atggtgtctg ttgcaacttc gcttataccc ttccttgaac ataatgacgc taaccgtgct     75720
     ctcatgggat cgaatatgca gagacaggct gtaccacttc tggttacgga gagtcccctg     75780
     gtcggcacag gtatggagcg gtatgtagcg atcgatgcgg gtgatgtttt aattgccgag     75840
     gatccgggca ttgtggggga tgtttccgct gatgttgtca ctgtcaagca ggatgacggg     75900
     aaacatcgcg actaccatgt tggtaaattt gttcgttcaa atcagggcaa ctgttacaac     75960
     cagcgagttg tggtccgatc cggagatcgt gtagaaaaag gtacagttct tgcagatggt     76020
     ccatgtactg acaaaggtga gcttagtctt ggtagaaatc ttctggttgc gttcatgccc     76080
     tgggagggct ataactttga ggatgcgata attatcagcc agaatttggt caaggacgac     76140
     accctttcgt caatccacat agaagaacat gaggttagca cccgggatac gaagctgggc     76200
     agtgaagaaa taacacgaga ccttccgaat gtaagcatgg attacataaa ggacttggac     76260
     gaacggggta ttatccggat tggcgctgag gttggccctg gggacatttt ggttggtaag     76320
     gtgaccccaa agggcgagac cgaactcagc gcggaagagc gtttgctcag ggctatcttt     76380
     aacgagaaga gcatggaggt tcgcgacaca agtttgaagg tcccacacgg gcagcagggg     76440
     accgtaatcg atgttaagtt gtttgatgcg gttgacggtg aagataagct gggtgctggc     76500
     ataaatcagc gggttgttgt gtacatagcg cataagcgca agattacgga gggagataag     76560
     cttgctgggc gccatggcaa caagggtgtt atttcaaaga tccttccggt agaggatatg     76620
     cccttcatgg ctgatgggac ccccgttgat ataatcctta atccgctcgg cgtgcccgcg     76680
     cgtatgaact tcgggcaggt tttggaaacc catttggggt ggatctctaa gcaaggatgg     76740
     aaaatagagg gtgatcctga ttgggcaaaa gatattcggg tgcgcgaggc gcagcctgat     76800
     agtagggttt caagtccggt ttttgatgga atttccgaag gggagataac cgggcttttt     76860
     tcttctgtat ttccaaaccg tgatggtgag cgtgctgtcg gttctgatgg taaggctatt     76920
     ctctatgatg gccgcacggg ggagcccttc ccggaaccta tttccgtcgg ttacatgtat     76980
     gtcctaaagt tgcaccatct ggtagacgac aagattcatg ctcgctcaac aggaccgtat     77040
     tcgatgataa cccagcaacc gctgggcggc aaggcacaat tcggtgggca gcgcttcgga     77100
     gagatggagg tgtgggcgct tgaggcatat ggtgcagcgc acgcactcca agagttgcta     77160
     acaataaagt ctgatgacgt tgttggccgg gtaaaggtat acgatgcgat tgtcaagggt     77220
     tatccaattc ctacccccgg tgtgcctgaa tcatttaagg ttattgtcaa ggaaatgcag     77280
     tctttgtgca taaatattga ggttgtttct gacggtgagg atgatgtttc cgctgatgct     77340
     gaaaccctac agatagaaga aggtctggat acgtctccca aggtagaagt tggttcgctt     77400
     gaagaggtct agtcgggcat tcgcaaaaga ggtttgtttt gtctacatct tttaaagaaa     77460
     tccgggttag tatggccacg actgaagata ttcgtcgttg gtcatatggc gttgtaaaaa     77520
     agccggagac tataaactac agaaccctaa agcccgagaa agatggcttg tttggcgagc     77580
     agattttcgg tccgacgcgg gattgggagt gtggatgcgg taagtacaag cgcagtcgat     77640
     acagaggcgt tgtatgtgaa cgctgtgggg ttgaagttac ccagtcttcc gttagacgcg     77700
     agcgtatggg gcatatagag cttgcggccc ctgtgaccca tatctggtat ttcaaaggcg     77760
     ttccgagtcg gttgggttat ttgttggata ttgcgccaaa agaccttgac aaggttatat     77820
     acttcgctgc ttatatggtt gtttctttgg acgaggaagg tcgcaaggag gatctgcagg     77880
     atctggagaa tgagcttcgc ctggatataa agcaattgcg cgatgcttgt gatgcaagta     77940
     tcgcatccgc tgtttctgaa ctcgagagaa caataactga gctgcaggat gcaaagacct     78000
     ccgcttcccg tattaacaaa gtccgcagtg aggcggagaa caagatggct aatatccgcc     78060
     gtgaatatga cgataaaatc gaacaccttg agagggtttg ggacagtttc aaagctctca     78120
     aagttggcgg cctatatgct gaggatgatg tttttcgtga tgtgcaagat cgctatggtg     78180
     attattttga tgcatgtatg ggcgcagagg cgattaagcg tcgccttgaa gacttcgatc     78240
     tacagaaaac agctcaggaa cttggtgttc agattgttga gtgtcgtggc cagcgtaagg     78300
     tgcgcgccat aaagcgtctt agggttgtca attcgtttat tacctctaag gcaaatccag     78360
     catgcatggt ccttgatgta atacctgtta ttccccctga actgaggcct atggttcagc     78420
     ttgatgctgg ccgatttgcc gcatctgatc tgaatgatct ttatcggcgg gttatcaacc     78480
     gtaacaacag actaaagaga ctcttggatc ttggtgcgcc gcgtattatt gtcaacaatg     78540
     aaaagcgaat gctgcaggag gctgttgatg cgctttttga caatggccgc cgtggtagac     78600
     cagtcagtgg gactaataac aggactttaa aatccctttc tgacatgctc aaaggaaaat     78660
     ccgggcgatt tcgtcagaat ttgcttggaa agcgcgttga ttattcaggt cgttcggtta     78720
     tcgttgttgg tcctaccctt cagctccatc aatgcgggtt gcccaagctt atggcgctgg     78780
     aattgtttaa gccctttatt gtcaagcggc ttttagatct tgccttagct cccaatatac     78840
     ggtctgcgag acggatgatt gagcgtggcg atccggctgt atgggatatg ctggatgctg     78900
     ttataaaggc gaggcctgtt ttactcaaca gggctccgac cttgcacagg ctcggtatcc     78960
     aggcttttga acctcagctc gttgaaggca aagcgattca gttgcatccg cttgtgtgtg     79020
     ctgcttttaa tgctgatttt gatggagacc aaatggcggt gcacttaccg ctctctcttg     79080
     aagcccaggc cgaggcgcgt gttttaatgc tcgcctcgaa taatatcttg aatccttcag     79140
     atggtcgacc cgtaacccta ccgagtcatg acatgatcat tgggttgtat catctgacaa     79200
     ccgtgaaacc ttctgctaag ggtgctggtc gcgcattctc ttcggtcgcc gaggctatta     79260
     tggcaaagga ccggggcgac ctgtcaatca gtgctcctgt aaagattctt ttttccaata     79320
     ttgtattaga cggaaaaacg cttgattcgg cagttgttga aacaactttg ggtcgtgcta     79380
     ttttcaatga agctctgccc gatgggcacc cttacatcaa tgaattagtt gataagcaag     79440
     taatttcgtc gattattaat aacctggccg aggtctattc aaaggtcgag gtggcgaaca     79500
     ctctggacaa aataaagagt gtgggatttc attgggcgac ccgttctggt gttactgttg     79560
     caatttccga tgtcgtgtca ccgcccgaaa agcaggagat aatttctaag tacgagacgc     79620
     aggccagggg tgttcaacag gattttgaga taggccttct aactgaccta gaaaggcgac     79680
     aggccctggt ttccatttgg tctgaggcaa cagatcgtgt cgcggaagcg atgcgtaagt     79740
     gttttccgga cgataatacg atcaatacta tggttacttc aggagctagg ggcaactggc     79800
     ttcaagtacg caacattgcg ggtatgcgtg gcttagttgc aaacccaaaa ggtgagacaa     79860
     ttccgaggcc tattatttct tcttatcgcg aggggctttc tgttaccgag tatttcattt     79920
     ctacgcacgg tgctcgtaaa ggtcttgttg acactgccct aaaaacggcc gattctggtt     79980
     atctgacaag acgcttggtt gacgtggctc aggatgttgt tgttcgcgag cgcgactgcg     80040
     gctttacacg gggtgttcgc atgccagtta cattccgcgg tgatgatggt gaacttcata     80100
     aggtggagaa tgcggaacat tcggtttacg gcagaaccct tgctgaggat gtaaaaactc     80160
     cggatgacaa tcttattgca aaggccggag aagatataag tggcatcatg atcgacagtt     80220
     tcatcgctgc cggtgttgag tctgttgaag tcaggtctgt tctgacatgt cgatccaaag     80280
     ttggggtctg ctccgcctgc tatggtcgct ctcttgcaac gggtgctcgt gtcgatatag     80340
     gtgacgcggt tggaattgtt gccgcccagt ccattggtga gcctggcact cagctcacaa     80400
     tgcgtacatt ccacagtggt ggttcggcat ctgctgttga tatcactcag ggccttccta     80460
     gggttcagga gctttttgaa gcgagaacac ccagggctgc agctcctatt gccgaggcag     80520
     atgggactgt gtccattgaa gatggtgata gagcgcgccg gcttattctt aagtctgata     80580
     acaacgaaga gtttagttac actgttctaa agcgcgcgca gctccgcgtt aaagacggca     80640
     gtcgcgtttc actcggtgat caattggtcg agggttcatt ggatccaaag gaagttttgc     80700
     gagtcaaggg cattcgtgca gttcaggagt acctcgtaaa tggggttcag caggtgtatc     80760
     gctcacaggg tgttcctatt cacaataagc atattgaggt tattgtgcgc cagatgctgc     80820
     gcaaggttac cgtcgttgat cacggcgaca cgtctatgtt acccggtgaa cttattgatc     80880
     agtctcgata tcaggagcta aatcgcgagg cgcaagcgga gggacgtaaa accgcttcag     80940
     cccgtcaaga ggttaccggc attaccaagg ccagcttggc taccgagtct tggttgtccg     81000
     ccgcctcctt ccaggagact actcgtgttt taactcaggc cgttatttct ggaagaagag     81060
     atcctctgat tggcttaaaa gagaatgtta ttataggaaa ccttatcccg gctggcactg     81120
     gcttgtccgt ctatcgtgat gttgagccgg agcctagacc tgaggctatt tcccggatgt     81180
     acccgactcg acgtccagaa atcgaaaacc ttttggaagg tgactctgtt gatccagagt     81240
     ttgatttttc ttctctaaca caaggccttg aattgcccga tgactatccc gtacagtaat     81300
     tctatgattt gaccacatac taatttatag tggctaatga ttatagttgc cttacctcat     81360
     tttgaccgca gtgctaagca tgccttgatc ttgtaacgag aatttctgta tctagaatgc     81420
     ttgacctaaa gtagcctgta gtgccggtaa atacccgtct tagagccccc aagtcgacaa     81480
     gaccgagagg cataacgctc ctttattcac aggtgagctt gttcaaaggt gagctctgag     81540
     atatttactc gcgcgggcaa tcacttctgg ggttatttca tgcgtgagcc cactcaggca     81600
     ttcttcggtg agttctgaag acttctccaa tacgtatttg gttgacagaa cgcgattctc     81660
     atctattaca gagtcagagt caccgcgtat ccagaggact ggtttttttg cggaagaagt     81720
     ggttgaccca acggcaaagc cactcaaaac aacagccaaa tcaaatagtt ccggatgtct     81780
     caatagcaac tcaatgcaaa cagccccgcc ttgactaaaa ccaagaagcc caaccctggc     81840
     tggtttgcca aaagtttgca ccaaatcaca aaaccaatta acaacagaat taactgcatc     81900
     acctacatca gtcgcattcc tgtcaaacca cgcgtatccc attgcctctg gtatgggtcc     81960
     ctgcagtgat atataggtcg tattttcagg aagatactgt tctgtctgtt catccaggct     82020
     cacttgcgcc gccgaggggc cagtccatcg aataagttca ctctctgatg agccatatcc     82080
     gtgcagcaaa agaactacat ttttaccagt taggtcttgc tctttccatc tgcaacgaat     82140
     cgctggagtt atacgaccca cccgattctc aagatgccga aggagaaacg acgatatatc     82200
     acgcacttct tcgtcgcaga tcttgtgggc aagctctggg tatatacgta tttcaggatt     82260
     tgttacgcta agaagccagg cctgggttgc ctcccatacc ttgtatggca gtatcgtgtc     82320
     ttcttttcca agaccccaga aaacctctgt tctacgcctt tctgtcacaa gagaatcgcc     82380
     gtagcgaact cttttttcaa gacctccggc cagaacactg tcatctctcc taggcggacc     82440
     ccagacaaat ccacttatat tgaccgcaaa gtcaaatttc tcgggtgccg ctcgcaagag     82500
     ctccatgcac attgccccgc cttgactaaa accaagaagc ccaataccag ctggtttttt     82560
     tgtatccagc cagctaagaa tctgtttcgc gctctgcgaa agtgttttat atgaattttt     82620
     atatgaacca gattcatcaa acagaaacca ggcaaatcct tcgtcggggc cttcactgac     82680
     gcttgagaga tcaattggcg ccctcaggga gacgatactg attccagcct gaatctcttg     82740
     cggcataaaa cttttgaccg tgtcgtacat aacctgatta ttcccactgt atccatgcat     82800
     cgctaatagt aagaagcggt tctcattcac atgaccgagc actctgcatt catcaatggg     82860
     ggcgcttgcg tcaaagttat tcacacatac attatgtcat tgtttgcatg ctgttatccc     82920
     cctcgcgtat gcggggtgtt ttgcgtttta gcactgcttg ttacgctttg gtagaatatt     82980
     gttctcgcgg ggctttctgc cttcgattga tttggaagtc ttagtacatg gaagaggttc     83040
     agctgtgtca tttgcaatta aaccactcgg cgatcgtgta gttatcagac cggccgatgc     83100
     ggagcaggtt acagcaagcg gtttggttat tcccgatacc gcgcaggagc gccctcagga     83160
     gggtgaagtt gttgccgtcg gtcccggttc tcttaacgac gatgggaatc gtgtcccgct     83220
     tgatgtttct gtcggcgatc gcgttatcta cgcgcgctat ggtggtaccg aggttaaact     83280
     gggcgatgac gagtacacga tcttggcttc aagggatgtg ctcgcggttg ttcatcggta     83340
     accgactctt ttagcccgtt cctcttgcgt accattcggt agcgtgttgt tgtgcacccc     83400
     cataagcttt ccggagttgg gctcacgtat gacgatgtta tgctcgttcc tgggcgctct     83460
     gatgttttgc ccagtcaggt taacttcggt agttttctca cccggcgtat aagactctcg     83520
     gcgccgcttg tgtcggctgc gatggatacc gttacagagt ctggtatggc tgttgcgatg     83580
     gcccgtcttg gtggtgttgg ggttatccat cgcaatatgt cgattgcgga ccaggcagag     83640
     cacgtaactc gtgtaaagct gagtgagtca ggcatgatca cgaggcccgt ttctgtttct     83700
     cccgatctga ccttggagga agtcgagcag cgttgttcgc gttacaagat atccggattc     83760
     cctgtggtcg atgaggacaa cactctgctt gggatagtta caagccgcga tatgtggccc     83820
     tataggcacg agcatcgcgc ttctgtccgt gtttcagagg ttatgacaag gtctccccta     83880
     attaccgctt cgccaaatat atcttcagag gaagcacggg acttgctcta caagcacaga     83940
     ctggagaagc tgccgcttgt ggatgagcat ggtcgactct ttggtcttat tacggtaaag     84000
     gattttgtaa accgccagcg ttatccgttt gcaaccaagg acaagaatgg atgcctgatc     84060
     gttggtgcag caattggctt ctttggtgat gcatatgaca gagcccttgc tttggctgct     84120
     gcaggtgttg atttcattgt cgttgatacg gccaatggtt attctgatgg agccctgaag     84180
     atgataaatc gcctgaaaaa cgattcaacc tttgccgaca ttgacataat tggtggtaat     84240
     gtcgcgaccg gtgatggtgc gaaggcactg attgactctg gcgctgatgc tgttaaggtt     84300
     gggattggcc cgggttcgat ttgtaccacc cgggttatag caggtgttgg ggttccgcag     84360
     ataacggcta tatacgagtg cgcgcaaaca tcatcggttc caataattgc ggatggtgga     84420
     ctgcattatt ctggcgatat cgcaaaagcc ctggttgccg gggccaagtc cgttatgttg     84480
     ggcggacttc tcgccggttg tgatgaaagc ccgggggagt taatatcccg tggtgggaag     84540
     cagtacaaga tctacagagg aatgggttct gcaggcgcca tgcaggccag ggcatcctac     84600
     tctcgtgata gatattttca gcatgatctg gattcgcacc ccattgccga gggtgttgaa     84660
     gggcaagtgc cacataccgg ttctgtcagc acggtttttt accaattact gggagggctc     84720
     aggcagtcta tgttttatgt cggctgcagg gatatcaatg aactgcagga taaaggtcgg     84780
     tttgtaagaa tcacctcagc tggactaaaa gagtcacatc cgcatgatat tgaaatgatt     84840
     gtcgaaaccc caaactacag aacgtagact tatggaagtc ggtttttcca gaaatgccag     84900
     aagagctttt tcgctcgatg aagttgctgt tgttccgagc aggcgtaccc gtcactctag     84960
     tgaggtatca atcgagtgga agatggatgc tttctctttt gacacaccga ttatttcttc     85020
     tccagcggac tctgttgtct caccaagcac gattgttgaa ctgtccgaat ttggctgtct     85080
     tggtattttg gatctcgaag gtgtttggac acgttacgag aatccagaac ctgtcctgcg     85140
     cgagatttct gcactgccgg aggaaaaagc gtgtcttggc cttcagaaaa tatactcgga     85200
     gccaattaaa cggcacctac tggaaaggcg cttgcaggag cttcgcgatg caggggtgat     85260
     tgttgcaggt tgcctttctc cgcaaaccac aaatgcgctt tacaagagtg taatctcagc     85320
     gggcgtagat atttttgtca ttcgtggggg cactgtatcc gctgaacatg tttcaaagag     85380
     tgacaatgtt ctaaacctga agaggtttat atacgagcta gatgttccag ttatggtggg     85440
     cggtgttgca acctatactg cggccttgca catgatgcgc accggcgcgg ccggggtttt     85500
     ggtcggtttt ggcggatgcg caggatcaac gaaccatgct tcacttggaa taaaggtgcc     85560
     tatggcaact gcaatagcag atgttgcagc ggcaagaaaa gattatttgg atgaatctgg     85620
     agggcgatat gttcaagtaa ttgccgacgg gagcatgaac accagcggta tggctgtgaa     85680
     tgcattagct ctcggtgctg atgcggtaat gatgggaact ccacttgtac gctcgacaac     85740
     ctctccggga ttcgggtacc actggggtag agaggcccat cacatgactt taccgagggg     85800
     tcgacgcgcc tacatagggc aaactgcctc tttgcaggag attatccagg gcccgggaca     85860
     ttccccagat ggaacggtaa attttgcagg agcaattcga cgagcggttg cactggctgg     85920
     ctttcaagat ctgaagaatt ttcagcgggt cgagatggtt gttatacagg accaacgacg     85980
     gtgttgtgcc taaggcatat ttcaagctct ccagtctatt actcctggcg ccatttcttg     86040
     tggtttcatt ttgttttgtt taccttgggt tttggcaact ttcgcgctca tattcgcctc     86100
     aagatgatcc gggaacgggt atagtcacag atttttcggt acatacacat atcttgcacg     86160
     gacagcggat tgccttagag ggtcaactta tcccagaaga tacccttatt gtgtccgata     86220
     gatatgaaaa gggtgagtca acctggtggc ttgttgcaag gtacaatacc ccaaatggag     86280
     ctttaccggc ggtgttgggg tatggagacc gtaatgctgt ggccaccgca tgttcacact     86340
     tgaagcagac caaggttgtc gcttcgcaga agatatcggg tcgtttttat tacgatgaac     86400
     cacccgactc tttgaagctg ccggaatcag gcacgttaaa caggatgtct tctgcggcca     86460
     tgataaatat gtggcgcaaa ttttctgatc caagagtttt ttctggtttt gttgttctgg     86520
     acgacccgcc tgggttaggc ttgggaagag tgtcgatttt gcccgggcag cccgctcgaa     86580
     taaattggct gaatattttt tatgctgtag agtggttcct gtttgccggg ttttgcctgt     86640
     atgtgtggtt ttatttagtc aggacccctg agattgagag ttgcgcgaaa agagactgag     86700
     gcctattggc tttcgttggg ctctagcctc ttttggcttt gttatgttta tataggggtg     86760
     cgcattgcct aagggttcct ctgaacaaga gcctgtacgt caacccgtct gtccgggtga     86820
     taattctgtg ctctctgcct ttaggatgta tcgcgccgca tccagcataa ctggggtgct     86880
     tctaatcttg gtctgcgttg aaatgttcct caaatatata ttgggagtgc aggtttttgc     86940
     actgactggt ggtgctttgg tcgagctcta tcatgtagat gcccctgagc catcagggct     87000
     taacttatcc gttatgaccc tgatattcca tggttggttt tatgttttct atttgtggtc     87060
     tgatctctat ctctggagta aggtccgttt tggatttgca ctatttatcg ttatcgctct     87120
     cggcggagtt gtgcctctta tgagttttgt ggtcgagcgg tatgtttaca agaaactttc     87180
     aaaacggttt gtgtcgacat gagacctgtt cttgtcgttg attttggctc tcaatattcg     87240
     cagcttgtag tccgtgcgat aagagagtgc gggtattatg cagagtttgc gtccccgagt     87300
     atttctgctg ctgaatgtct tgccttgtcc ccgattgcca tatttctctc tggagggcct     87360
     gctagtgcat acaaagataa tgcccccaag cttgacgaag agatttttaa ttgtggcatt     87420
     cccatttttg gcatttgcta cggctttcaa ctgcttgcac aggcattcgg tggatctgtc     87480
     aaaaaagcaa atgctccgga atacggccct gcggatataa caattgtcaa caaggcgttt     87540
     ttttctggcc aacccgaccg ccagacagtg tggatgagcc atggtgatag tgttatacgc     87600
     gctcccaaaa atttttgcat tctttcaact tctcaggatg ctgttctttc attttgcaac     87660
     cgtgatagaa caattgctgg cgtgcaatgg cacccggaag taaagcacag ccggtttggt     87720
     aaacacacaa taaaagcctt tttatcaagt tttgccgcgc caaactggga tccagaacag     87780
     acaatttgtg ggacagttga cagtatccgc aaaactgttg gttgtaagag ggttttgtgt     87840
     gctcttagcg gaggagttga ctctgtcgtt gccgcaacac tcacacaccg tgcgataggc     87900
     gataggctgc gatgtgtttt tgttgatcat ggtcttcttc ggttgaatga gagggagcag     87960
     gttgaggagt attgttcatc tcttggtctt aatgtgtcta cttatgatgc ctcagattgt     88020
     tttttgagcg ccctttcagg gatacgtgat tctgagcaaa agcgtaaggt aattggtcgc     88080
     gagtttattg cctgtttttc aaaattgcaa gagcgatttg atataaagcc gcactttctc     88140
     ttacagggca cgctttatcc ggatctcgtt gaatccggag caaccccggg tggcgcgact     88200
     ataaaaagtc atcataatgt tggtggcttg tcggataatc ttggttttga attattagaa     88260
     ccgctgaagt atcttttcaa ggatgaagtg cgaaaaattg gccttcaact cggtatacct     88320
     aagcacatag tgcacagaca gcccttccct ggccctggcc ttgctataag aataattggt     88380
     gaggttacaa acaagaagct gtctattctg cgtgcggccg atgcaattgt caggcatgag     88440
     ttgcgagact ggactgatat ctggcagtgc ccagttatct tactatctga cgtgcaatca     88500
     gtaggcgttc gcggagatag tagatcatgc ggctttccga ttgttatccg gcccgtttcg     88560
     tctgatgatg caatgaccgc ggattggtac cgattaccat acgatgttct tgcacgaatt     88620
     tctggtcgta taacaaacga aattcctgaa atcgtgcgtg ttgttcttga tatcacaccc     88680
     aagcccccag caacgataga gtgggagtag ggtatcttac tgcttggact ttgcgtcgat     88740
     gcactactga gctttgaggc taccgggttt acggggtatt ctagacgctg tgcgctctag     88800
     agagcgcagc acttatgaca attccggccg atttactcaa gggtttgaac ccccagcagg     88860
     tggagggtgt ctgctatagg gggccaaccc ttcttatttc cgctggcgcc ggcagtggta     88920
     agactaaggt gctgacccat aggattgccg gatttctggc aacaggtgaa gcatcctgtg     88980
     accagatatt ggcgattaca ttcacaaata aggctgcatc tgaaatgcgc catcgcaccg     89040
     gggatcttgt tggattatcc gtcagagata tgcagatatc taccttccat tcagtctgtg     89100
     tgagaattct tcgtgaatgt gtcgggcatc taggcaaggc aaagaatttc acgatatatg     89160
     atgctgcaga ccagcgtgcg attatcaaac aaatctgtca gtctacggat acttttggac     89220
     taacggcaag catggttgcc tcgcaaatag gtctgttgaa aaaccaaatg cataccccag     89280
     acacctattc gcgctgtctt gcctcaaatt ccactaatgg caattcggta acttcgatta     89340
     ccttacagag agaacagttt atcctgcacg tttttaggcg ctaccaggag attctgaaag     89400
     aggcaaatgc ctttgacttt gatgatctta tttccgaaac agttttttta ctccagaaat     89460
     ccccggagat ttctgcaatg tatagaaacc gctggaagta tcttttggta gacgaatatc     89520
     aggatacaaa ccatgcccag tataggctta ttcttgagct gacaaaaggt gataaaagcg     89580
     acatgtctct gacagctgtc ggtgattcag atcagagtat atacgctttc cggggtgctg     89640
     atattgccaa tatagtgaat ttcgaaaacg attttccgga ctgtcacaca atcttattgg     89700
     agcagaatta ccgctcttgc cagaatattc ttttagctgc caatgcgctt atttcaaata     89760
     atcagaatcg taaggataaa aacctgtgga gcgaactagg tgccggtgag aaggttgttg     89820
     catactgtgc atcttccgca gaagaagagg ggcgttttgt tgcagatagg gtgcgccatc     89880
     tggtcgatca aggtgagagc ttgtctgata tagcggtttt ttaccgatcc aatactcaga     89940
     gcagagcaat agaagaatca ctcatcaggc aatcaattcc atacagagtt gttggcggga     90000
     caaaatttta tgaacgcgct gaaataaaag atattctggc gtatctgaca gtaattgtca     90060
     atccagacga tacgctggct ctcaggcgta ttctaaatgt tccaaagcgt ggtgtcggaa     90120
     cggtatcaga gaataggctt gttgaatttg ccagtgctag aggcataaca cttatgcagg     90180
     cactttctcg cattgatgaa attaacattc agccatctgc caaatcagct cttcgggatc     90240
     tcttttactt attaaatcgc tttgccggat ctagtatgcc ggccaatgaa ctgctcgacg     90300
     acctgctaaa agctacagac cttctaagtc gattcaacaa cactgatgat cctcaaaatg     90360
     aggctagaaa gatcaatatt ggggactttg tagattcggt tgaggatttc gcaaaagaaa     90420
     accccggagg cactctatct gactttatga caaatattgc acttatgaca tcctacgatc     90480
     agtctgatga cgcaccgggc cagattaccc tcatgacctt acatatggca aagggtcttg     90540
     aatttgattt tgtgtttcta actggtctgg aagagggtat ccttcctcac gaaatgtctc     90600
     ttaaagagaa gaatggcata gaagaagagc gtagacttgc ctatgttggt atgacgcgcg     90660
     caaaaaaagt tcttcacctt tcttttagta gctaccgaaa acgatacaca gatggggtgc     90720
     gcttgccgag tcgtttttgg gatgaaattc ctcagcatct cctgcggtgg cacagtcggt     90780
     ttacacacaa gagatttacc ggtcccctgt acgggtttac agcgcgtccc gcaggggagt     90840
     cacggcaatc agtgcatgtt ttgaaagacc gatacccccg tgagagtttt tctatttcgg     90900
     atagtgtaaa gcattccgtt tttggtgttg gaacggtggt tgatgttctt ggtttgggcc     90960
     caaaacagat aattgttgtt gaatttgctg ataaacgccg cagtttgctc gcgagtattg     91020
     cacccattgt aaaatgcaaa caatagaatc aataattctc cgtacagttg catggtgcga     91080
     atggtccaga tcgaagtgag atttctgcgc tacgcggcag tgttcttgtt aaggattttc     91140
     agcctgaagg ccccgaagag gctatgctaa gaaaccggtt tttgtttgcc cccattgcgc     91200
     cgcagtcagc accgcagtca gttatgtcat cgagataccc tgtgggtttt attgcagacc     91260
     agggcgtaga aagcgggacg ggggttcccc aaaactcgct tgaggcaaag ctgtgaaagt     91320
     attaccgcta ctctttgtaa ctgcacttga tgcatgcttt gctgttgtaa caccgatctt     91380
     aattcccctt gtggttctgt tggtaagttg gatcttttca gataatctct atggtccatt     91440
     ttcatatcgc ttggaaggtg cgcttgcaat atggggtgca ggttttggag ttcccgttag     91500
     agttcttcgc ccccttgagt tttccgtcag cattattccg ttgagcatga cacttgtcac     91560
     gatgctgatt tccttgcgcc tcgcaagacg ctgtgtatta tttgggagaa ggattttact     91620
     ttttgttatt gcatccattg cctatgtcat aaccgcgatg gtgattctaa gctttgttca     91680
     ttgggaactt gtaacacttg acccagtgaa agttattttt tttggactct ttctttatat     91740
     atcttttgcg cttttagcaa gtgagattct cataaacaga aatcattcca gaattgtcac     91800
     cccaatcatc cggttgcatg caccgaaatg gctcagagag ctagcgggcc ttagtatgcg     91860
     ctgcgcaatt atgcttcttc ttttgcagct gtctcttgca agcatggttt ttgccggttt     91920
     gcagtttttg catacttttg atacggtgca gatctataac agtatgcatg cgggaatagt     91980
     tggtctaatc agtattaccc ttttacaact cgccttcttg ccaaactttt tgatatggat     92040
     aatctcttgg caggtgggtg ctgggtttta tattggcggt cttcactttg gtggtttttc     92100
     aattgaccat ggtgattatt ccttgccact ggttccagta tttgcctcgc tgccggcaca     92160
     aaattttcct ttgatgggaa atattatcct aactactgtt tgtgttattc cggttggtat     92220
     ttggcttatg aaaaaccgaa gcatatcttt tagttttggc tggaagctgg ttattggatt     92280
     ttctggcgtt gtattagcaa ctcttagtct ggtttttctg agctatctga gtggggggtc     92340
     aattagccct cgtcaatcag tcgggattga tcttttgcta ctgttccttc tctcatttgc     92400
     agatattttc tgcggtgttc ttgttggtgt tgttatagga ataattttca agccatacac     92460
     agcatatgag aggattaaaa ctccacgggt ttgggaatac cttggccatt taccgtcgag     92520
     ggcttcaagc ctcctgccaa tttttggtcg ccccaatgca aacaaagcgc cagtaaacaa     92580
     agtgtcagta agcaaaacaa ctgaattgaa tacaggtaat acccccgaga cttcagggcg     92640
     gtctgtgttt actgcagtgt atttctggcg aacaatttgc agggtgtgtc atgtgaaaag     92700
     attgtggggc aaacaatcaa aagtagaccc agcgatcaaa ggtaaaagtc gtaataaacc     92760
     cgggcttggc gttccaagaa tgaaagacct tgagtgatat gaaaactgct atgagactta     92820
     ttgttatggt atccgggatt ggctcaggtc tcttgcgtct aattcgagct tgcgaacaaa     92880
     aggagctcaa agctgagatt gttgccgttg gctctgacag gcatgctcca gcactttcgc     92940
     atgcctcaga ttatggaatt ccattttttg tatccccatt caaagaatat tccaatcgtg     93000
     acgcatgggg ggcgaatcta ctaaacaccg tcttggctta caagcctgat ctggtcgtgt     93060
     tgagcggatt tatgcgtatt ctgccatcat gtgttgttga tgctctgtca cctaatttga     93120
     tcaacacaca tccatcgtat ttacctgagt ttcccggaat gaatgccgtc gaggatgcgt     93180
     tgcgggccgg tgtaaaaaca accggtgcaa gtgttatcag ggtggacaat ggaattgaca     93240
     cgggccctgt tatatctcag atgagggtta aagtctattc ctctgacaca tgtcagactt     93300
     tacatagtcg cataaaaaag gttgagcatc tgcttttatg tcgggctatc aaaaatatat     93360
     acaccgagca attcattcta aagaatcttt tgcataacag cgtgaggcgt ccctctggta     93420
     aaacaggaga tcgatgaacg ggtcggtaaa ttttagtgat aagtaatgtt tagaatatga     93480
     cgacaaatat acgtataaaa agagctctta tttcagtgag tgataagtca ggccttgcag     93540
     atctagcaga agccctcgcg gcgcattctg tcaaaatagt gtcaaccggc agcacggcag     93600
     agttcatacg cggggtgtct attcccgtgc gcgatgtatc tgaggtaaca ggggttgggg     93660
     aactcttgga tggccgcgtg aaaaccctgc atcccaaaat acatgccccg attcttgctg     93720
     acacaacttc acagatgcac cgcgcgcagc tacagcagct tggcgttgat gcttttgatc     93780
     ttgtcgtggt caacctgtat ccattttttg aaatttccaa aaactctgaa gcagaattct     93840
     ctgatgtaat tgagcaaatt gacattggtg gctctgccct aataagggct gcggcaaaaa     93900
     atcatacacg agttgttgtt attgttgatc caagtgacta cattcatgtg attaacagcc     93960
     ttgaaagggg tgccccgtcc cgcctgcgcc accaactcgc tataaaggcg tattcacaca     94020
     cttccgaata tgatcttcat atttccagat ggctttccga gcggttttac aaacatactc     94080
     tttattcttc gagtgattct gtaggtgatg tttgtgataa caatctcgat tccaatgatc     94140
     attttgttga actgcgtggc aaaaaactgg gtgatctgcg ctacggcgaa aacagtcatc     94200
     agaaggcttc cctatacctg tcttgcaagg agagcgttcc ccaattgggc ttggcgagtg     94260
     cagctcttct tgggggcaag cagatgtcgt acaacaatta tcttgacgca gatgttgcct     94320
     caagaattgt caacagcttt gatctgccaa cagtatcgtt tgtaaagcac ggtaaccctt     94380
     gtggaattgc ctcaaatatt gaggttgcta ttgcatgcag aaatgctcat gagtgtgacc     94440
     caacttcagc ctttggcggt gttgtcgctg tcaataggga agttaccctt gacgttgcaa     94500
     ctcatctttt gccgattttt atagaggtag ttgtggcgcc cggttatgac ccacaagcac     94560
     tacagctttt gctaaaaaag aagaatctga gggttgtaga gcttcctgag tgcgcttcgt     94620
     atccgcaaga tcagttgcgg caaatctccg gtggatttct ggtgcaggac gcagacaaat     94680
     ttgaccatca cgacacattt tccagctgga ctcaggtgtc tggcccacgt atttttatgg     94740
     atgccggagc tgataacgag acgctaatgg atttggaatt tgcctggaaa tcctgtgcgt     94800
     ttgttaaatc caatgcgatt cttctggcaa aaaacatggc atcggttgga ataggaatgg     94860
     ggcaggtaaa tagactagat gcgtgttacc tggctgtaaa tcgtgcggga tccagatccc     94920
     tgggtgcagt cgccgcatct gatgcatttt ttcccttttc tgatggcctg gatgtgctaa     94980
     taaattccgg agtaaaggct attgtgcagc cgggcgggtc tgttcgtgat aatgctgtta     95040
     tagctgctgc tcaacaggcg ggtgtcacca tgttttttac cggcaagagg cattttgcgc     95100
     attgaatgtt ttgccccaca gtgtttctct ggaccatttc tgaagacaaa aacatgcaac     95160
     gtgcccctta tttagtagct taatcaagca agacaagcac aaaaccgata aacgatgcta     95220
     atacaagatg tgcaacggca agaccaatag accgaaaatc tattagactt agagctgcaa     95280
     gcagtgaaac cacgagatac acgattgagc gaaggtatat acttgctgaa attgctggag     95340
     atgtcgataa gatacacgcc caccccagac ccaggacaat cggcagtaca acaccaaata     95400
     ttgcgttcac gggccaggtg actgaggata aacaccaaac ttcaaggatt gtcgcagaca     95460
     gaacaaaact cagatctcgt gctagcagaa atactgcaag ttttttattc attgacttca     95520
     tactcgctta aacgaggata gacgattttg ctgttgttga ttgttttgtc cgcaggggtt     95580
     tttctgtcgg tagtcggaga aatgatcccc gcttcagcca taaagtatat ggctgaagat     95640
     ctgaatgtta gcctcggaaa aattgggttt ttgataacat tgttttcctt tgctgtaatt     95700
     ctgacagccc ccattcttac tattattact aggggcataa gtcgcagatc tcttatgact     95760
     acagtcatta tttttctggg cctctttcat gcaagcgctg cgctttttac cggatatgag     95820
     atggtggcag tggttcgctt tctgacaggt gctgttcacg gtatgttttg gacacttgtc     95880
     ggaagtatag ttggccagct atacgcgcca cgcagtctcg caagagcaat gtcgattgtt     95940
     cttggaggtg gcactgtttc ttatgttatt ggccttccgt tgtcaaactt ttttgcattt     96000
     cagtttggct ggaagtcagt ggtgattgtc ctgggtatta tgtttgttct attgggcttg     96060
     ttattcaact ttacgctgaa agttccccta cattcggcca gaatgggtcc tgccaaaaat     96120
     aggaatgttt ttaaaagtaa atggatgccg atttgtattt tgagcgcctc agttttactt     96180
     gggcagttta ttttttcaag ttatgttcct gcgtttttgt caaagcgata ttcgccagag     96240
     tttgttagta ttctcctatt tgtatacgga ttttgtggat gtattggcaa tgttctggca     96300
     ggtgttttta aacccactcg taggcgattt atggttatca tcgctacatc attgatttgt     96360
     attttgcttt tctcgtttat ggataacgca attgggctcg ctgcgtatgc tatttggggt     96420
     gccatgtttg gtgcagtccc ggtattgttg actgtctttt tgctgagtaa tacaagcgat     96480
     aataatcgtg atatcgccaa cgcttattac actatgagtt tcaacatcgg gataggttcg     96540
     ggtgcactat tcggcgggct ttttctcgat ggatttgggt tttatgtgct tccacttgcg     96600
     tcttgtgccg cattactgtt gagttttctg ttatcactga gaactgtttc agggcgccat     96660
     aatcctgctg ataccggctg aataaccgca attaaatttt ctttacaaac tgcacacacc     96720
     gggccgtttg agtcgattcc aagagatata tatcgcccgc aacttaggtc atctgcctgt     96780
     ttttgactaa cttctatcgg tttgtaaatt cttgataatg cctggagggc tgtgaggcga     96840
     gtgaatgaca gtgtatcacc ttgtgtatag tgcacttcac gaagcgctgt gcatgtatct     96900
     ttaattccaa gctcagtaca attaattcca ggctcagtac aatcgtgctt atcactctcg     96960
     gagatggcca tgttgtcgga gatggccatg ttgtcagtta atccttgcgt attaccacta     97020
     ggcgttcgct cagacatggt ggcttccttt ttgtttattt cccgatatat ttcatgcaaa     97080
     tgaaatggcc ctatgctgag gcgttttagg tatgataagt gcccgccaac acccaggaat     97140
     tttcccatat cccgggccaa tgccctaacg tatgtaccag atgaacaggt aatctgcaca     97200
     tgaacttggt tattttcaaa atctccgaga aatttccaat gcacccgcac ctctcgtgca     97260
     ttgagctttg ggataatccc ctgacgcgct aggttgtacg ctctatttcc agagaccttt     97320
     attgcgctgt atgcgctcgg gatttgtttg attgttccgc ttaatttctc cgcagccctc     97380
     cctatgctct cgagtgtaat tttgtcaagg gatggctttg gtgcactgta tataatctca     97440
     ccttctgaat catcagttgt tgtttgtgtg cccagcgtta ttgttgcaat ataccgctta     97500
     tcaagattgg acatatatct tataagtctt gttgcagttc cgcatcccat tatcaaaaga     97560
     ccacacgctg ccggatcgag ggttccgcaa tgcccgattt tttttactcc tgtgaggtgc     97620
     cttatttttg caacagctgt gtgacttgta atgccgctta ttttgtctac cagaagaacc     97680
     tgcgtcatag cgaacagtat atacatctca gaacgttcaa ctttacctaa cataggccaa     97740
     atgagtctgg tatcatttcc tcgatcaaga agggggtttg atgttttttc ttggtgtcct     97800
     gatcattctt atttttgtgt atattgcagt tgccctgcat gaacttggac acatgctacc     97860
     ggcaaagtat ttcggtgtgc cggtgcagaa atatgcaatt ggatttggac catctctttt     97920
     cagttttaag aagcgcgaga cttcatattc tttcaatctt ctaccattgg gtgggtatgt     97980
     tcagctggag ggcatgctgc ctccatctga aaaccctcga cgttggttta aaaaacttat     98040
     gaaatttgcc gaatctgata gcccacgggc gttttggcgc ctgcctgctt ggaaaaaaat     98100
     aatagttatg ttttctggtc cgtttgtaaa tcttattctc gcgacattgg ggtatgtatt     98160
     cgttctatct gttctgggcc tcccggttat aaaaccggtg attcacgagg ttattgcgaa     98220
     cactccggct gcttctgccg gaattcttcc gggtgatgaa attattgcaa taaacgacac     98280
     agcaatcagc tcaccgggtc agattagggg tctcatacaa gacaaggatc ttgttacgct     98340
     atcgcttctc aaagatggcg gcacccgtat tgtttcactg cgacctttga atggttcaat     98400
     tggtgtgaag ttttcgacgg tgaatgaaag gcagtcaatt tttgatgctt tgtcaagtat     98460
     ggtaaaagat accgttggcg tggcaaaatc tcttatcgct ctgccatata acctgtttac     98520
     gggccttgcc gatacattac atcagagaaa agatggtgtg gttggcctta ttggtgcggc     98580
     tagaatctcg ggtgatattg tatccgcacc cagcatttca ttgtatgaca agttgcggag     98640
     catgatctgg atttttgcct cattgaatct tgcgttattt gttttcaaca tgattcctct     98700
     tttacctttt gacggtgggt atattgctgc tgctgttttt gagggcgcgc gttcacgcgt     98760
     gcttcttgcg ttcagaaaaa atgactacgc tccagtcaat atctcatatt tgttacctgt     98820
     tacactgctt gtaacagccg cgattattgt gatgagtatt atgctcgcct ggatagatat     98880
     agtaaacccg cttcgtcttg gttagctcag tcagcgctca tattctctat aactgttttg     98940
     gctagctctc tggttcgggc atcctcttct aaaatgacct caattggatt tttcgccgac     99000
     tcgcggttcg tatgttgttt tgtatagagg ttaaaaaccg tttctgttac atggattatc     99060
     cttgcaaagg atattttgcc agccataaat gcctctactg cacattcatt gctggcattc     99120
     aggacagcgg gataaacccc tccggcttca ccggctcgcc gtgcgagatt gatactcctc     99180
     attgagtttt ctgttggtgg caggaagtcc cacctctgcc ttgcacccca ctcaagtggt     99240
     ctaaccgcat ttaaagctcg gttaggccaa ctcagggcat accctattgg cagggtcata     99300
     tctgcaacag aggcctgtgc aataacagat ccgtctttat actcgaccat tgaatgaaca     99360
     attgattgtg ggtgaatcac aacatcgatt tgcgagtacg gaataccaaa tagtagatgc     99420
     gcttcaataa tctcaagacc cttattgaac attgttgcgg aatttatact tatcatgggt     99480
     cccatattcc atgtgggatg gtctagggca tctttaagag ttataccctc caggctttcc     99540
     ctgtcataaa aaggcccacc cgaagctgtc aggatgagct tatttacctc ggagaatttt     99600
     ccggacttca tggcctgcgc tatcgcagaa tgctctgaat caaccggcgt tatttgacct     99660
     ttgaagcttg tcatgtctag gaaatatttc ccgcccataa tcaatgattc tttgttcgcc     99720
     agcgcaagcc gtttgccggt cttgagcgta gcgtatgtag ataataatcc agccgcgccg     99780
     gttatggcgt ttagcacaac atccgcctcg gtagcttcta taagctctgc cgcttcgctc     99840
     gcaccctgtg ctgtgttttt cgtgccaaat acttgcgctt gctctcgaag aagacttgtt     99900
     tgcgtgctcg cagcgagccc tacaaccaga aaactatcgc gattttttaa gataaagtca     99960
     atcgcttgtg ttcctataga tccggttgag ccaacaatta ttaccctctg cacacttgaa    100020
     actctagtac aattttcgta tccgcataag acttgttaag ggctgtgtct aatagatcaa    100080
     ctggttcaga tgattacatc gtctctggca agttctctat atcgtgggcc tcacttagcc    100140
     atgttggcca ccaccgagag tctaatgaag acagctacag tgcaaagccc ccgttatggg    100200
     ttgttgccga tggcatgggt ggtcatgctt gtggtgatat tgccagcgga gttgttacat    100260
     cttttctgtc tgctatatct tcagactttg taagtccgca ggatattact ggggctttgc    100320
     gacaagcact tgcaagtctt gccaaaaaaa ttggctctac cactgcggga acaaccctat    100380
     cgggaattgg actctcaaaa gtggataacc aaccagcctg gcttgttcta aatctcggcg    100440
     atagccgtgt ttattgtatt gaatctgaca agatacgttt actaactgaa gatcattcga    100500
     ttgttcacga gatgatcaaa agcggccaaa taacaccaga agaagctgct attcatcctt    100560
     ataacaacat cataacccgg gcagttagtt tcaacagcga acccattcca gattttagct    100620
     ttcttccgct tcgcagcggc gtacggttta ttatttgttc tgatggactt accaaagaat    100680
     tgaatgatgc gcagatcgag acgcatgcta cccgtggatc tcctcgcgag gctgctgaga    100740
     gtcttttata tgcagcactc tctgctgggg gaagggacaa tattacgatt atccttcttg    100800
     atgttcacga taagtaatat atcccatttc gttagatgcc taccttggta gttcgatcgc    100860
     attcaggagg ctatttacac tttcaatcgc tattgcaagc tgttcattta agagagatga    100920
     gacaacaaga gctgccctga ctttattact tgagttttta cgacaaaacg cagcaactgc    100980
     ctgttcggtt tttccacccc cgcgcagctc ggaatgagca aagagttttg actctcttag    101040
     tgcattccat aaagtatttg caccaatggc ccttgtatac tcgtcctcca aatcacgctt    101100
     cgaaacatat attgagtttt gagtaaactc attttttgga attcccagtc gtactgaagt    101160
     gtgctgaaca gcgtcagaat caatcagcaa ggaaataggg atcctaaaac cttttggtcc    101220
     gaatagttta tagatcggcc acatatcccc agagccattt gcttctatca aagcaatacc    101280
     aagtcggtca agatttcgcc cagttacttc agctgcactc tcaaggatta ttcggtccga    101340
     aatcccctcg acagcaacaa tccgcctagc ggttaggggc tccagtcgcc cgtgaaccca    101400
     ccaccttgca ataatgcgct catcttctcc gagaaagccc cgtgctggct ggacaacctg    101460
     cccattgggc tgaacaaccg caacgtgctc tggcgaaaag gctccaacaa tatcagccga    101520
     gtgggttgca ataatttttt gattagattc ctcttgcaaa acccgcgcca ggcttctctg    101580
     aatcgtcgga tgcagatgtg tctctggctc gtcaatacca acaacactcg catctctact    101640
     gaggacatca taaatggcca ctgcataaag cgatcgcatt ccgtccaaac aatcgatcat    101700
     atgaggtgac ttgttttgtc gttttacctg aaccctgata ttgccaagta cctgtgtgcc    101760
     tatatcgtct tttggtacaa gatggactgc atctttattt agattgccag gcatggtttt    101820
     tatcagtttt tctgcaagtc tttcgcgcag attttccaaa aacggtgatg cctcgatttg    101880
     ctcacgaaac gactgagtta gagatgaaag accgtgctgc ctaagattcg ttgattccat    101940
     aacgccacta agaactgttt tatattgact cgctgtacat ggcacttcac ccgcatcgaa    102000
     taactcccaa ccaatgccgg taagttggct gtcggcaaca ggctttgttg tgttgttata    102060
     aagcacctct cgctttattg ttagcatttg actctcatca agaaacgcgc tcagtgtgag    102120
     ctttatctct gatatccggt tgttgtttat gccaaacgca atttggattt tgtcatcaag    102180
     attgttgatg tcaacgctga taattattgg ttttgttgca tctcgaaaat gccacgcctg    102240
     gaagtgactg tatagcattg gtgttgtggc actcagcagc agatcaaggc aggtcagaat    102300
     tgatgtcttg cccgagtcgt tggcaccaac cagaacgagg tgccgtcgca cctcaagtgt    102360
     tatgtcagat atcggagtgt aattcgttat agtaacttgt tttagctgca ttaacttacc    102420
     cccctgcggc acgtcgcgct tgcccgatct aaatgtcacg ctaaacaccg cacgcattgt    102480
     cgtgccatgt aattagaagt gccatgtaat ctaaggtctg gccctgcgca aacctaactc    102540
     attctatatc agctctgcca agcttgcgac gtgaatgtac ggttacactc tgcacatctt    102600
     gacaagatat ctttagcaaa tcataaattg tacacttgta tttacttgcg tgtttgatcg    102660
     ctgtgctgta taatggctgc atgtttgttc ctggcagttt tgcttacgct tcggcctatc    102720
     ttgcatcccg gattcctgct cgttccttcc gatacgattt ttggtggctt gtggcttctc    102780
     acctttgtcg tggggcttat tggggttatc tatttcatgc atatgctcat ctttacgccg    102840
     ttgtgcgaca aagttgatca tatggaatac actgctaact ttggcgtact tgatctcgcc    102900
     acaagtcatg tcaaatacca atgtgggaga agatagctga tctgcgccga tcgcttactc    102960
     tctctggcgt ctttttcgtt tacttcactc gcaaggtttt ctcgtatcgc cttggcctgt    103020
     catcgcgtat gttcattctt ggcatatgcg tcctgctcta tgggacggtc ctaatttaca    103080
     ggttgtcttt attggcccct gtgttttatg actttgtcac tcttatcggt gcagcggagt    103140
     caatcatcaa cctttttatg gctttcttgt ttgcaaagat actgttcctg aggtctggcg    103200
     gacttatgaa tttcaccatg caacttccct tgaaaaataa agaaaggact atggccctga    103260
     caatctgcga aatactgatt gtctttatgg gattcacgat actgtattca cctgaagcaa    103320
     tagtctctac ctggaaaaca ggtcagcccg cgtacctgct ggtaaatggg cttatgcctg    103380
     gcttcatcgc ctatatcctt tgttctctta tatataatct ctcggttcgt atatttatcc    103440
     tcttcaatct ttcccgcttg tcgcatattg gcggtatcat tgtcacaata tttgcctttc    103500
     ttggcttatt gatttttgtt ggccaatctg tccagagcct actccccgcg ccgggccagt    103560
     caattaagca agcctatgac catttacaga cagatgtgtt cttaattttt aacgtcttct    103620
     tctggctttt tcaacactat ggcctgttga catcaatact tgcctttctt atttccctta    103680
     ttatcctttt tccagccctg attatctcta tcccctcaaa gtatccagat gtacaccgtt    103740
     ttataaaatt ccctgtgcca ttcattaact cgaccctatg gccgtttatt gctgttttta    103800
     tccgtcgaat tgaatggtgg gtggctgttg ttgtttctat cctgtcaata cctctgggtg    103860
     gttttgttct tatcttgcta aatttacatt tgcttgccct cttttctgcc ggtatctata    103920
     tgttctccat gtctcgcgcc ataaggactg ctacctggat atagactttc tgcaacacgg    103980
     gaaactctgt atatgtttgc agcccaagca ctatgtatat gcccgtttct tatgctggtt    104040
     cagcttgcac tatatattgc ctcttttgct tcgggcacta tcgtcccgca tgacccaata    104100
     aacctatctg ttatcttgat gtttggcgta atacttccga catttatcgg catcctattt    104160
     gttcataacg aagataatcc cgttcaggcc tttgccggct actttgtcgt cagtattatt    104220
     gccatggtta cgtatcttgc aatatccgtc actggccaaa tattcctttt gattctcttt    104280
     acagaggcta ttgttgccat tcccctgact atccttgctg ttcaggcggt tagaaaaagc    104340
     gagcgttacg catgaatatt ctttccgtcc aagatgtttc gttttcatat gataaatcca    104400
     caccagctat ctatggcgtt gatcttcaga ttgatcccgg cgaggtggtt ggcctggttg    104460
     gccctaacgg gtcaggtaag tcaacattta taaaacttgt ttttgacctc cttgaattgc    104520
     aaaaagggca gatacagatc ctgggcaata atcaccgtct cacgactgcc cgtcttgcat    104580
     ctatatacct gccgagcgat gatgaccttc cagaatttct aaccggcgat gaatacctgc    104640
     gaacactctt taggctctat aaacgacctt ttgataaaaa cagtgtattg cgtgaatttg    104700
     accgcttcgg catgcgaggt cgtgagcgta atttaataga ggattattcc cacggcatgc    104760
     gcaaaaagct acagctgatt agtgcatttc tgctgcaact tcccctgact gttatagatg    104820
     agacaataaa tggaattgat cttgatgccg tgtatgagtg tcgtaaatcc attacggaac    104880
     taaagtctcg cggacactct gttttactct gcacccatga cttttatttt ttgcaaaaag    104940
     tggccgataa agtcatcgta ttccatcagg ccaaacaaat tgccagcttt gccacaccgt    105000
     cacacgaaca cctggaggat cgcgtggcag aaatactggg agtagatctg catgataggg    105060
     gagcgctgtg actcaggcat ttagcagaag gtcaccgttt cgcaaaataa aacttgtcac    105120
     ggcaatactc tcatccagtt ttgctctatc aatgattacc gtttttgttt cttttatgta    105180
     cctcgttgca attactgacc cgtctagcgg tgttgagcaa tatcactcac ttatttttaa    105240
     caccatctat attcgtaccg aacccagcag taaaggtgtt catatcgata tatctgttgg    105300
     ccttcttgcg gttatcctgc cattcctatt cttcacgatc ataatctctc tgtgtgtatt    105360
     tttttacaag aagtttataa aaaacaaaaa gacaactaaa tcaaaaaaat tacctttgaa    105420
     ataacactgt tcaggatttc tgttaagcct tgtggaaaca tgaccagggg tcaggcaatt    105480
     cttgttgcat tgtcaggtcc cgggatctgt ttcttatgtg gtgttggcct gtgtttcata    105540
     taccgtgatt tatcgtggtg gtacctgatt cacattatgt cccttttgcc actcttcggc    105600
     gatgggcgcg ctattattac tgccctgttt gctcaaatga cccgacaggg caatacaaga    105660
     caggtgcaat cactaacgat gcggtatcaa tcaagcatgt atactcaagt gattgtgttt    105720
     ttataggtta ggtcgaatag aaaattctct aacctctcta aagaacttct tcacctacct    105780
     aacaggaaca gctcacctca gtttcctaag ctcaaccaaa acaggactaa ccacaataaa    105840
     cggttgggta actggtataa ccgggcccgt caacaaatat atagacaaga taagagactg    105900
     gggtctatta gataaggatc ataaaacaac aggaacaacc ctcaaagtcc tagacaaagt    105960
     agtaaacccc cttacatcct ggttaccaag ccccctaaag gtcctaacca gtaatgttct    106020
     agaatcaaaa ggtctagtca catggacaaa aggtacagct acaaaactga tctgcaggat    106080
     ccccgggata aaagacctgt gtgctgactc tgatagctct actaaatcca ccaaataacc    106140
     acacttggtt taacagcaat gctcacaagc gcgtcaaacg aggtgcgtca gaatcacaag    106200
     aacaccctct caagcctgtc aatgagcaga taaaaacagc caagataaac actgaccagg    106260
     taaaaacagc cacaaaactg atctgtctga tccctgggat aacagacctg tgtaactctg    106320
     gtaactctac taaatcctcc aaataaccac acttggttta acagcaatgc tcacaagcgc    106380
     gtcaaacgag gtgcgtcaaa accaccagaa cccgcacacc ctcaggcaca tatctatatg    106440
     ccgtatttct aaacactcac aggcatgtgt cggtaggcat gtgtcggtaa tgtaacttct    106500
     acctgtgaca tacgcaggtt acaggtagat acctgttcag tggcacaaca agatggtctt    106560
     tcgataaaac agcactgtga caaatcaaca tatactaaag agaaacaaca caagtgattg    106620
     tcgggctggc gggatttgaa cccacgaccc cttgaccccc agtcaagtgc gctaccaagc    106680
     tgcgccacag cccgttgtct ctattaacca ctatattttg tatcgccaca aaatacgtta    106740
     ttcacctacc taacagacaa agccaacctc agtttcctaa aatcaaccaa agatggacta    106800
     accaaaataa acggttgggt aactggtata accaagcctg tcaacaaata tatagacaag    106860
     ctaagagact ggggtcttaa aacactcggg ttaaaacaca ccggagccac acccgtgacc    106920
     acatctgtct gatcccgtgg ataaaaaccc tacccctgtg tcctgctgac tctggtaact    106980
     ctgataaatc ctccagataa ccactcttgg tacgttaaca ccaagggaac catgctcacg    107040
     cagccggtgg caccagcggc aaaacgcgcg tcaaacgagg tgcgccaaca acaccacccg    107100
     accaccctct caagtctgtc aatgacaaga taaaaactga gaaggtcaac actgaccagc    107160
     cacatccctg atctgcaaga tcccgtggat atcaggcctg tgttctggta actctgctaa    107220
     actctccaaa taaccacact tgcgtttaaa aaacatacca aaagggtata taccagcaca    107280
     atatacgcac aacaaccctc aaagtcctag aggcagtagt aaatcccctt acagcctggt    107340
     taccaggctc cctaccggtc ctagccagta gtgttttaga gtcacgggat tctaacatca    107400
     cagtgttctg gaatcagtgt tttagaatca cagcatggct taaatactct agatacagca    107460
     tcaacagcat tctagaatta cagggcctac cctagccgtc cggggctaac aaatcaaccc    107520
     cgcttgatcc atactgcaaa cgcacgaaac accgtatgaa cggcacacaa tattacgcga    107580
     tgatttatct cgtgctcatt tataaagccc gtggatgcga cgtggtgtac acctcccgta    107640
     ggctgtcgat cgtgaccttt gtgtatacac tggtcgtatt tatcgagctg tgcccgagca    107700
     attcctgaac ggttcttata tctgccccag cctgtagcat gtgggttgcg aaagaatgcc    107760
     gcagtgaatg tggtgatatg tatctgccaa tctcagcagc ttcgccgagc ttgcggatta    107820
     tatttccagc ctgttgcctg gttagacgtt ttccgcggtt gctgagaaat agccatggca    107880
     cgccagccgc ggttgctgtc agcactccgt cctcagcatc cccaattgtc gaacttgtgg    107940
     gcctatattt caatgtacta gcatccgtta tattacgata aacatgggac ctcgctaaca    108000
     gctttggcct agaatgttgc aggtaattat ccacggcatt ccgtgcatac gacccaaata    108060
     ggaccatgcg ctgtttgtta ccttttcctg taagtcgtag gagattttga tcactttcgg    108120
     caaaggcatt aacatttagg ctaaccgctt cgctgatcct tgcacctgtt ccgtacaata    108180
     cctcgatcag tgccctgtca cgcaatgata tttcccgcgc ttgatttgca tctgctgcct    108240
     tgagaaggtt tattatctca tcaaggctca aaggatgcgg gagggccttc ggcacttttg    108300
     gctgttgtaa tttctctgtg ggatttagag cttgtcggcc ttctaacact aaatgcctgt    108360
     gaaaagtgcg taacgcagca acggtatttg cgagggtgct ttttcgcgta tggcgctgtc    108420
     tatactctaa aaatctttcg attgcatttg aattgacttc actcaagcgt tgggtgccct    108480
     gctcgccaag ccaggataga tagattccca gtgaattgcg atatgtttgg agggttgcat    108540
     ccgatagtcc tagctccagt tttgcaaagg gaaaaaacca atcaaaatcg ggttttatat    108600
     ccgggggtat tgctatgtct gcgaccttgg tcacagtatt tttagacaca gctcacctca    108660
     aattcctaaa ctcaaccaaa acagggctaa ccacaataaa caattgggta accaaagtaa    108720
     ccgggcccgt caacaaatat ataggtaatc taagagactg gggtctagga gtgcgccaaa    108780
     accaccagag cccgaacacc ctctcaagtc tgtcacagcc aagataaaaa ctgagaaggt    108840
     caacactgat caggtaaacc ctgatctgtc tgatccccgg gataaaagac ctgtgtaact    108900
     ctgataaatc taataaatcc accaaataac cacttggtac cttaacacca atggaaccat    108960
     gctcacacca gcggtaacgc aaccggcaac actcacacca atagcaacca ccaatgctca    109020
     caagcgcgtc aaacgaggtg cgccagaatc acaagaacac cctctcaagc ctgtcacagc    109080
     cagtaaacac tgaccagata aaccctgaga agataaaaac agccacaaaa ctgatctgca    109140
     agatcccgtt gatagcaacc ctgtgtcctg ctgactctga tagctctact aaatccacca    109200
     aataaccaca cttgtgttta gaaaacatac cctagagaaa agggtatata agagaaaagg    109260
     gtatatacca gcacaatata cgcacaacaa ccctcgcagt tctagacaaa gtagtaaaac    109320
     cccttacatc ctggttacca gactccctaa aggtcctaac cagtaatgtt ctagaatcac    109380
     ggggttctag tctagtcacg cagatcgagc ccacgctaca catacattcc catgtgaaat    109440
     tcccaggcgc aacagacaaa gccaacctca ctttcctaga ctcaaccaaa acaggactaa    109500
     ccacaataaa cggttgggta accaacataa ctaagcctgt caacaaatat atagacaaga    109560
     taagagactg ggggtctagg agtgcgccaa aatcaccaga tcaccctctc aagtctgtca    109620
     atgacaagat aaaaactgta accggtgctg taaataactt tcaaaaatct gttctaacct    109680
     ctctaaagaa cttctttacc tacctaacag acaaagccca cctcaaattc ctagactcaa    109740
     ccaaaaatgg actagacaca ataaacggtt gggtaaccaa aacacctaaa cctgtcacag    109800
     ccaagataaa caacgaccag ataaaaacag ccacaaccct gatctgcaag atccctggga    109860
     taaaagacct gtgtaactct gacagttctg gtaactctgc taaatcctcc aaataaccac    109920
     acttggtaag agacagtgtg taaatgagag tgtaaatagg acagtgtgta tgcgagaaga    109980
     gtgtattcaa tacagcaaaa cctactgcac cctctctaac ttatgaggcc ctttaatctt    110040
     tcatagaccg gccagggctc atctgcatct ctcagatatt tccattgcac ctgcaagccc    110100
     tcatgcgcag caagggctgc cagcataaga actggattct gtactctcct tgtgagaaca    110160
     gaaaataaca aatcctccat cggaatccat gcaatttcca tatcagcttc ttctgatttt    110220
     ctattgaact tagcctgaga tgctctcagc tcacgcgcga gatatactct catcacctca    110280
     ttgcttccac cgggagttaa ggtgaaatca atcagggtgt gccaggtttg tgcacacata    110340
     tccacttctt ctgatagctc acgcttggca gcatcaaggg gggattcgcc cgatagatcg    110400
     agcatgcctg caggaatttc ccattctctc gtgcgaattg ggtgtcgata ctgtcttatc    110460
     aggagagcct cattcttatc gttcagcgca agcacaccaa ctgcgccggg atgagatacg    110520
     aactcccgac taattgtttc gccgcgataa tcgagctttt cctgcacaac gtcccacacc    110580
     gcacccttgt gtaaaagggt agactcaagc actctgtagt gcaccggctt atcttccggt    110640
     ggtttgcgcc tctcgattga aatacacctc gcaaagtact gatcattcga tcatagtatc    110700
     tctcctacaa gcatagtatc tcttttaccc ttcgatccat atatgtaata ccggccgcat    110760
     ataacgtgag ttctatataa cgtgagtgcc aatacatgtg tatttatacc tagcagccaa    110820
     cctcagtttc ctagactcaa ccaaaacagg actaaccaca ataacaggtt gggtaaccag    110880
     cataactaag cccgtcaaca catatataga caagctaaga gactggggtc ttaaaatact    110940
     cgggttaaaa cacaccagat ccacacctga aacaacatcg cctgcgggat ccctgggata    111000
     tcaggcctgt gttctggtaa ctctgatagc cctgctaaat ccaccaaata accacacttg    111060
     gtttaaccca agggaaccat gctcacgcag ccggtggcac aaccaccaat gcaaccggca    111120
     acaccaatgg caaaaagcgc gtcaaacgag atacgcaaaa accacaagaa caagaacacc    111180
     ctctcaagtc tgtcaatgag cagataaaca ctgtaaccgg tgctgtaaat aactttcaaa    111240
     aatctgttct gacctctcta aaggacttat tcacctacct aacagacaca gccaaactca    111300
     gtttcctaag cccaaccctc aaagtcctag acaaagtagt aaatcccctt acatcctggt    111360
     taccaagccc cctaccggtc ctagccagta atgttctaga atcacggggt tctagtctag    111420
     tcacgcagat cgagcccacg ctacacatac attcccatgt gaaattccca ggtgcaatta    111480
     ccaggtgcaa cagacaaagc caacctcagt ttcctaaaat caaccaaaac aggactaacc    111540
     aaaataaaca gttgggtaac caaaataaac agttgggtaa ccaaaataaa cagttgggta    111600
     accaaaataa acagttgggt agctggtata acctaagctt gtcaacaatg aaataagtga    111660
     tatagggaaa taggtgatat aggaacaaat gatgcacgga cggttactat tgaagcaccg    111720
     tcttgccgga attgaattcc gctatttctt tcctagctaa agccgctgcc acaaggccct    111780
     tgaacagcgg gtgtggcctc tttggtcgcg acttacattc cggatgcgcc tgtgtgccaa    111840
     tgtagaacgg gtgatccttg cggtcgagct caataaattc aatcaggtct tgctctgtat    111900
     tccgcccaga gactataagc ccacgctcaa ccagtcgctg tgcatagcca ttatttacct    111960
     catagcggtg cctatgccgc tcgtgtatat cagttgtgcc atataaactg gcagctagac    112020
     tcccgacact cagaacggca cggtagcttc ccaggcgcat tgtcccgcca aactgatcgt    112080
     caataagaat atctctttgt tcaagcattg ttgttacaac tggccactga gtatcatcgg    112140
     taaactccgt tgacgatgcg ccatgcatcc caacaacatg tctggcatac tctatcacca    112200
     tgcactgcat cccgagacat ataccgagag taggaatttc tctttcgcgg caaatccgta    112260
     tggcttttat aagtccttct atgccccgta ttccaaaacc gccggggata caagcgccgt    112320
     tgatgttttc cagctgatcc tcaaggttct catcatctga gtcaacccac tttatattaa    112380
     cctttgtctt actctcgaat ccgccagccc taagcgcctc aataacagaa atgtatgcgt    112440
     cgggcagtcc cgtatacttt ccaataatgg ctatctctat ttcacttcta ttgttctcta    112500
     tcgcatcaag cacatcgtcc caataggacc agtcaatttc acccgcctca aggtcgaggt    112560
     gcttgattac aaacttgtct aacccgtgtt gatttagaac acaaggtatt tcatagatgt    112620
     ttggaacagt gaccgcgttt acaacagcac tgacatcaca cataagtgct atctttttct    112680
     gattggcact tgaaatgggc ttatcgctcc gcaagacaag ggcatcgggt tgaattcccg    112740
     cggctctcaa tatagcaacc gaatgctgag tgggttttgt tttctgctca cccgcactct    112800
     cgagaaaggg gacaagtgat acatgtataa aacagcagtt ttctctgcca acttcgcgcc    112860
     ttatctgcct ggccgcctcg ataaatggct gggactcaat atccccaacc gtgcccccta    112920
     tttcggttat tatgacatca atatcatcag gtgcgagtcg tatcctgcgc tttatctcat    112980
     cagttatatg aggtataacc tgtacagttt cgccaagata tctgccggtt ctttcaagag    113040
     tgattacctt ggagtacact tgccccgttg taacattcgc tgttctatcg agatccacat    113100
     ccaagaaccg ttcgtagtgc ccaacatcaa gatcggtttc tgcgccatcc tcggttataa    113160
     acacttcacc atgctgcagc ggattcatcg tgccaggatc aacattcaga tacggatcca    113220
     gcttttttat aaacaccttt agcccacgca ttgtgagcag actgcccaag ctggctgctg    113280
     ttagcccctt acctattgag gaaacaaccc cacctgttat gaatatatgt tttatgccgt    113340
     tcactacagg gtttcattgt attgcatttt attgtctact aataacgcat gctgaaaaat    113400
     agtcagattg gacctgtgtt ctgctttgtg catatccagt ctattgggca atctcgcatc    113460
     ctgattaggc tttaacagcc cggttaccag aacccctacc ggtcctagcc agtagtgttc    113520
     tagaatcacg ggattctagt ccggtcatgc agatcgagcc cacgccacac atacattcca    113580
     acgcacaatt accaggagca gcccacctca ctttcctaga cccaatcaaa acaggactaa    113640
     ccaaaatagt agaccccctt acatcctggt taccaagccc cctacaggtc ctaaccagta    113700
     atgttctagg aacaaaatag ctcaagatgg actaaccaaa ataaacggtt gggtaactgg    113760
     tataaccggg cccgtcaaca aatatatagg cacgataaga gactggggtc ttaaaacact    113820
     cgggttaaaa cacaccagat ccacacctga aacaacatcg cctgcaggac cctcgggata    113880
     acagacctgt gttctactga ctctgataaa tctaataact cctccagata accacacttg    113940
     gtaccttaac accaagggaa ccattctcat gtagccggta acacaaccgg caagaccaat    114000
     ggcaagactc acaccaatag caaccaccaa gaccagcggc aaaaagcgcg tcaaacgagg    114060
     tgcgtcaaca tcaccagatc accctctcaa gtctgtcaat gagcagataa acactgacca    114120
     ggtaacaaca gccacaaaac tgatctgtct gatcccgtgg ataacaaccc tgtgtaactc    114180
     tgataaatct ggtaaaccct ccaaataacc actcttggta agagacagtg tgtaaatgag    114240
     agtgtaaata ggacagtgtg tatgcgagaa gagtgtattc aataagaacc agtacagtac    114300
     cccaagaata aggtatgcat agaaattcat gcatagaagt taaggtgtgc agataaggtg    114360
     tgcagggccc ccagaaggaa caaccctcaa agtcctagac aaagtagtaa aaccccttac    114420
     agcccggtta ccagaacccc taaaggtcct agccagtagt gttctagaat cacggggttc    114480
     tagtctagtc acgcagatcg agcccacgct acacatacat tcccatgtga aattcccagg    114540
     tgcaacagac aaagccaacc tcagtttcct aaaatcaacc aaaacaggac taaccacaat    114600
     aaacggttgg gtaaccagca taactaagcc tgtcaacaaa tatatagaca agataagaga    114660
     ctgggggtct aggagtgcgc caaaaccacc agaacccgaa caccctctca agtctgtcaa    114720
     tgacaagata aacactgaga aggtcaacac tgaccaggta aaccctgatc tgtctgatcc    114780
     ccgggataaa agacctgtgt gctggctctg ataaatctaa taaatccacc aaataaccac    114840
     tcttggtacc ttaacaccaa gggaaccatg ctcacgcaac cggtaacacc aatggcaaaa    114900
     cgcgcgtcaa acgaggtgcg ccaaaatcac cagaacccga acaccctctc aagtctgtca    114960
     atgacaagat gaacactgta accgatgctg taaataactt tcaaaaatct gctctaacct    115020
     ctctaaagaa cttctttacc tacctaacag acaaagccca cctcagtttc ctaagcccaa    115080
     ccaaagatgg actaaataac agattgggat cgacataata cgtgcggccc tgcatttcac    115140
     gtgcggccct gcatttcacg tgcggccctg catttcacgt gcggccatag ctagcaactc    115200
     ccgcgaatgt tccaatccgc tctcgctatc atgcaatcca gacaataacc tagccatctc    115260
     accaacacga ttttctcccg acagggaaca cacatcagac aggttgccag tttttgtaac    115320
     cagaaggtga gtcgtggcaa atgccgcaac ctgggctgag tgcgttataa caatcacctg    115380
     cagccgccgc gccaaggccg ccaaacgtct gccaatctca atagccgccg cgccgccgac    115440
     cccagaatcg atttcatcaa aaataactgt aggaacagtt tttacactgg caagcgctat    115500
     ttcaatcgca agcataacac gcgatatttc ccccccactt gcccctgttc caattggctg    115560
     tgcggcaccc gcataacttg ttcgtaaaaa catagccact tggtccatac cgtaactgtc    115620
     atgggatttt tgcagaacct ggacctcaaa tctagcctcg ggcatagcaa gacatggaag    115680
     atttaaagac accgaatcgc ccaatagccg cgctgccgac acacgccttt ctgataattt    115740
     tttggcaaga tattcaacat ttttctgtaa ttcttctttt ttcgcctcca attcctgtac    115800
     cctcacgtcg tcattttcga ttgtgctgct ccgcgctaac gcgttttttg caaagtcaat    115860
     tacatcttcg attgtcggac catatttttt ctgtaatttt ctcagtgcac ccagcctatt    115920
     gtgcatctca tccaatatct ctgtgctgtc ctcgggtaag gtgtcaatct gttttgttat    115980
     ctcgtttgat aattcctgca tagtcacaag tgctgtatca attgccgtgc catatgcatg    116040
     ttgaagtttt attccctcca tttcacataa aatctgctgc agttcggtga ttttgtcgat    116100
     tatgccatta tcgatcagta attgttttgc tgcacgtaaa ttcccgagaa gctgttcgtg    116160
     gttctctaga atgtttatct gtttttttat attttcgtct tcaccaattt gtggattgat    116220
     ctcgttaatt tcctctacag cctgtataag acctatcgct tccgcgcgac gacccgccaa    116280
     attatcccga atattacgaa gttcaagatt tgtttttgag agttcgctcc aggccaattg    116340
     atattccttt agcagatcgg tattaccagc gtatccatca agaatttgtc tttgcagggc    116400
     cggatttttc agcctcacct gtgcaaattg cccatgcact acaaggagct tatttcgtaa    116460
     tttgcccaaa taactgttat tggcagtttt cccattaacg tttgcaacag atttgccgga    116520
     taggcttatt tcacgtgaca ccgttagttt gccctcaata caaggtaaaa cattctcaaa    116580
     atgtcgtggt acgcgccata ttccaatcac ctgcgcactc tggttatgcg gatacttcga    116640
     atttccaggc tttcccaaaa gtgtttctaa tgcgcccagc aacatagtct tgccggcacc    116700
     ggtctcgccg gttatcacgg taaaatcgga accaaaatct atatctgctt ttgctatatt    116760
     tccaaaattg cgtatagaga tttgttcaat cattctgcac agcgccgacc ctcaagcggt    116820
     ctggaggtta aatttcttta cgagatgctc tgcaaaacac ccctttttca cacggccaaa    116880
     cacaacaggc acctttccca cgtggcacgc aatttcatcg ccggattgca ggcataatct    116940
     cacttgcccg tcactgcaca gcactacttt attatctcta gatgtaacct tgagcagaat    117000
     tgatcgatta tctggcaaca cgattggttt agcaaacagc tcatgcgggc taaccggaac    117060
     aaccagagtc accttcatct ctggccaaac aattggtcca cccgaagaaa acgaataagc    117120
     agttgagcct gttgcggttg caataataat gccattacag ctaatgtcca tcaccctgca    117180
     tccgtcaaca aatacctcta tatcaacaac ttttccttca acctttcttt caattgtaat    117240
     ttcgtttacc gcccactcgt cgtggatctt tttaccccct ctttgaacgc ttgctgttat    117300
     cggtagtcgt ttttcttctg tatattcacc ttttacgata ttttcaacga gattcactat    117360
     atcttctggt tcgatatcga ccagaaatcc cattcgcccc atatttactc cgaataacgg    117420
     ggttcctgtg tttttcaagt ctctcgccat tcgcagaaag gtgccatctc caccaatgga    117480
     tattccggca caaaacggca cattaataga ccgtgatgtt gcaggcgatg ttgtttcttg    117540
     atccagatat ttattgcgcc cggcttgatt gagagaaact actccactgt cagtattacg    117600
     agcgctttca ttattacgag catggggatc tgtaatgacc gacatttttc tctgcgccac    117660
     gagctcgcag atagtcccat aaataggctc agcttcaaga caaccattgt gcgcaatata    117720
     cactctcatt tacacactgt ctcttaccaa gtgtggttat ttggaggatt tatcagagtt    117780
     accagagtca gcaggacaca ggggtagggt ttttatccac gggatcagac agatcagttt    117840
     tgtagctgta ccttttgtcc atgtgactag accttttgat tctagaacat tactggctag    117900
     gacctgtagg gggcttggta accaggatgt aaggggattt actactgcct ctaggacttt    117960
     gagggttgtt cctgttgttt tatgatcctt atctaataga ccccagtctc ttatcttgtc    118020
     tatatatttg ttgacgggcc cggttatacc agttacccaa ccgtttattt tggttagtcc    118080
     tgttttggtt gagtttagga atttgaggtg agctgtgtct gttaggtagg tgaagaagtc    118140
     ctttagagag gttagaacag atttttgaaa gttatttaca gcaccggtta cagtttttat    118200
     ctgctcattg acagacttga gagggtgttc gggtggtttt tgcgtatctc gtttgacgcg    118260
     cgttttgcca ttggtgttac cggttgcgtt ggtggttgaa gaaggggctt cagagcgact    118320
     accgaataat tttctgaatg gccatgttat gccatgccat atccatttaa atggcgcagc    118380
     tataccacta cctacttttg accagaatcc ccctccttta ctctctgtag gtgttttttc    118440
     ttctttaggt ttttctgtgg gtttggcaga ttgggtgtgt gatggtggtg gtgttgtgtc    118500
     ttttagggtt agtcggtaga gctgttgtcc ataggtgctc tctaccagga atgtgtagac    118560
     acctggagag gagccataga ccgaacctgt tagtgatcca tctgcacgtc ccaggagtag    118620
     gccgagtggg actctgttgg gtcctggtgt tgcactatag gtagctgttg atgacaggct    118680
     gtaggttccc tcttgtgttg gtggaaagaa gattacgggg gaggttgact ggtatatacc    118740
     agctatcttt accagattca ctgtggcatc tattccaggg gcacctattg ttattgtgta    118800
     tagccttgat cccaggtatt tgcctgactg agttgagata tcaactgtaa atgtgtagac    118860
     accattttgt atgccagtct tgaagaatcc agccacacgt cctgttggtc ctgctatacc    118920
     taggcctgcg gggactctgt tgggtcctgg tgttgttgat gatgatgttc cacgggcaaa    118980
     ggcaaaggtt agagtttcct ttagggattc ttctggggtt ttgtcaaaca gggcattgac    119040
     gtcatttaca tctgccgata gtggggaaac agatgagact gttagggttg cggtagatgg    119100
     tgcagaggtg tataggggtt gaccgtaata cctggttgtg tatggcaggc tgtagatgcc    119160
     tgggggttgt gttattgcct ttgaggtaac agacccatct gcaccaacga ctatgccata    119220
     ctccttcggc aggccactta gtgtgattcc tgaaggaata gctatttcat ctgttatctg    119280
     atcaccctgt agggcagaga gggtaacagg tggtaggaca gcaagggtgt atagatagga    119340
     ggaccttcta ccacgtgggc caaaggaaag agtgaatgta tagatcccgg gttgaacacc    119400
     tgagagtggg ttcagggtct taagggaacc tgttgatgga tccaggaaga caccacgtgg    119460
     gactctgttg ggtcctggtg ttgttgacca ggcagcattc acaaaggaaa agtctgatcc    119520
     tccatcatcc tgacctgatg ggaggctgac ctgtgttcct agggtaacag cagcagagaa    119580
     tggttttgtt ccaaatacat ctgttacaga gacagagtac ataacagttg tgatacgtga    119640
     tcctcttgct gagaagacat caacaccaaa ggtgtataga ccagctgcta ctgttctgcc    119700
     tactgtgcca gttatgttac cagttgtcct gtcaagggta attccgcgtg ggattcttcc    119760
     ctgtccggct actacagagg aataggaaga agatgataat gcataggtgt atccggttgt    119820
     atttgtatct ttatttacag gaacggggcg cccggctact acagagtagt ttctgctctc    119880
     aatagctgag acaaggagag taacctgcaa ggtgacaggt gaggtgcctt gggagcctgt    119940
     tgctgtaata ccaaaggtgt atctccccgc ctctacgtct gtgccaaggg tgccttggac    120000
     aagacctgta tcagggttta tacctaggcc tgcggggact ctgttgggtc ctggtgttat    120060
     ggatgatgat gttccattgg caaaggcaaa ggtttgacct cctgctatat gtgggaagaa    120120
     cgagacagat gcaccctgct ttgtcacaac aagctgtgtt ggggaaagca gggttgcctg    120180
     cccttcaaca cgtatcttta ccagaacagt tcttctggca ccaacaggta tctgctctcc    120240
     tgttgcctgg aagacatcga tatgtgctgt gtattcgccg gcttcaacac ggggatcaac    120300
     tacgccctgt attgcaccga ggccatcgga tgttttagat gaggatgtca gggatggctt    120360
     tgtaatggta aggccaaggg ggagtctccc gtcacccggt tttagagatg gaacagcgcc    120420
     tgagcctgcg gtaatcgtta gcttgcgtgc ctgatcaaga tcagttggga ccttgggagt    120480
     tatggagacc tgttgtccgg gctttacaag ggtgttttca ggatactcta ctgcatctaa    120540
     ttcaaagaca gttatctcaa ctcttagaga tgagacatat tgtccattgt ctagagcaac    120600
     cagatcgaat gaataaaggc ctggcttaac agacttatca acattaccga taagagcacc    120660
     ttcagagctg tataggacaa ggcctagagg aacagtattt tcacccggag ttgtgccctg    120720
     gactgtatct ctaccaaagg tccatgtata ggaagggtat ttcctggaga gatccagata    120780
     aacagagaac ctgtccttta gaggctctct cccggttgta tggggtgtgt aaccggcaac    120840
     aacagagtat gttgtggttg gaaatggcgg tggggtcttt accgttagat gatatagggc    120900
     ctcagttgag acaccatctg ttgtggcaag aactctgaat gtataggaac cgggattagc    120960
     agatgagaca gagcctgtta gggtgcctgt tgattgatct atagaaagac cctgtggata    121020
     tctattgaca cccggatcga tactggatga tcctgatagg gagaaggttg tgccagtccc    121080
     cgcattgagc aggttagccg ggatggtaac gtgatgagac ttatacacgg gtccatctac    121140
     tgactcaaga acaggacgtg ttgtaactgt cagtgcataa taaatggtct ctgatgagcc    121200
     ggggaagcga cctgtatcca ggctgtcagc agataccttc acaccaaaga catatgtccc    121260
     ggggagaacg gtttttccga cagtgccact cacatatcct gtttcaggat tcaggcttag    121320
     gcctgttggt aacccaaact gaacgggtcc gtcactcttc tttactgtct ctgcctggtc    121380
     acgggcatct acgagagtgt atttgaatcc accctttcca tccaactgag gtatgctgac    121440
     acgcccacca ggtgctgcat atacaggatt agtaacagga ctgattggtg tggtgtgtgg    121500
     ctttgttaca tatatcagtg atatatctgc tacaccatag ccacctgttg cattggttgc    121560
     ccttagccta aaggtgtatg ttccatactc aacagaagaa tctatagttc ctgttatctt    121620
     acctgtgctt ttatccagac taagacccct gggcagagta ttatctgcag gaatgatacc    121680
     tgtgccctca gtgctaccag agtcatagag agaccatgta tatgtattag tgtctgttgc    121740
     ggttggggtt ataggtaggc ctgaaaagtc ctgaccgtct agggtcttga ccttgacagg    121800
     attagtatca cctttgtaat agacaagatt cttgggtgtg ataataggat caccctgtgt    121860
     tacatatatc tctactacag cagaaacaga tttcttattc ttatcatccc cataggtgag    121920
     tgttaggggg aagctataca cgcctgtttt gacagtctta tctattacgc cgtatatggt    121980
     tcctgtctca tgactcagat gtaaaccctt gggcagttta tcgtgtgtgt caggtgatgt    122040
     tgcaccttct tcgggtttct ttttcttact cttggggtct ggttcaccta tggaataagt    122100
     gccggcagtg gtaagaccgg taactgatgg aggtagaaca attgttccgc cctgggatgt    122160
     tgtaacggtc tgtttaccga gagatacggg caggtgggtt atcttatagg ttaggtcgat    122220
     agagctcttg ctgtgtctgg tgcttatggt aactgtgaac tgtgagacac ctgtggcacc    122280
     taagagtctg cctgtcagcc ttccctcatg gcctagactg agacctgcgg gaagtgtact    122340
     gccactcttt agggtgtata taacagtttc accatctaca cctgttaggg caggagggga    122400
     cacatagata gggtcagagg gttggccctc ttggtgataa acagagatat tctgtgtctc    122460
     aagttctgca cgagccttat ccttgagagc aagttttgtt actactacga caagaacaac    122520
     agtttttgtt acacccccgc ttgttactga tagacgggtt agatatcttc ccggtgcaac    122580
     agacccatca ggcttacctg ttagatgtac tgatctggca gatgctgtag aggattcacc    122640
     tgtgcctgag acagaaagac ttagcccttt gggaagacta ttagatcctg gtgttgttgc    122700
     attctgattt gttccctgtg gaagagagac tgtaacatct gtgccaccga ctatacctgt    122760
     tagaacacct gttgtcttat ccagggtctg gtctgtgctg acatatacgg tagagttacc    122820
     tgctacaaag ggttgctcta ctcggagagt atatgtaacc tctgtttttt ctccgccgag    122880
     agaaactgca ataactctga atgagtatgt gccagaagcg ggtatctcat cacctgttga    122940
     agcaacagtg ccagatatgg tacctgtatt gggattaaga cttagccctt tgggaagact    123000
     atcagatcct ggtgttgttg cattctgatt tgttccgtct gccaggcgat agtaagagac    123060
     actggttggt tgagagaggg ggttatcttg attaccagac gcaggggata ggctataggc    123120
     aacacctgcc acaacatgtg ttctgttctt atccagtggg tcagatggaa tcggacgacc    123180
     aacgaagctt acatgctcac caacagttac gggtgcatca aaataggcag actggcccag    123240
     ctgattctta gcctctacaa ccaccctgta tacaccctct ggtggaacag gatatagacg    123300
     attaccggaa tcaatattgc cacgcagagc acctgtaaag gtatcgatgg aaagggcatc    123360
     aaggccatat ggcttagtcc tgatggagaa tttgagggcc tgggaatcca ggttagttgg    123420
     tatagcagag gttattgtgc ctgtgcttga gtctatggtt gttgttccat aggtaacacg    123480
     tggtggtgtt actacagaga taactatggt ggctacagcc tgagagggtt tgagatcaaa    123540
     tagtttggca agttctccat agttctgatg ggtgcgtact gttagggggt atgtgtgggc    123600
     ctgctgggtc tttgagacag tacctgagat tctccctgtt gtggagttaa aggaaagtcc    123660
     actgggtaga gtgtatttac cttcttctat ctcttggccg ggctttttat caggcttttg    123720
     gtcggttagg gtgtatgtaa catctggacc acccagggtt ctgccgggaa aggggcgctg    123780
     gtcatatgag acctgtgagc cggggccaac agatatatca gcagagtcaa gggtgggatg    123840
     ttcctggact atcatctcca ctactgcaac aatgtcattt attgttgcgg ttgatctctt    123900
     tgtggagtcc actagaccaa aggtgtaata tccgggtgcg gctgtaacag tgccacctag    123960
     aataccctgt acggggttga cgagttgtag accctgagga atgctcagtt gattgttatg    124020
     cacgcagtcc acaccacgac atgcaggtgg tctttgggaa acggtaccaa agagagataa    124080
     accgcctgag tattgggtct ttagagcaga tgttagggat gcttcaccgc gtgtaacaag    124140
     ggttaccgca tactcatcat atacatggaa ggtatatgat gcagagagca ctgtggatga    124200
     atcagctgac ttatattcgg cagtggctgt atatgtccca gatacgtcac tggttaggct    124260
     tcccggactg acctttagcc atcctttgtg atcacctgag ttcagaaagc taacagctga    124320
     tggatattta ccggtggctg gtgtcgtaga tgaggaggag gtaaaggata tggttcctgt    124380
     tatcttgtct ggtcctgcat atgtttttac gtatacatct gtgccagata catgtgtggg    124440
     taggtgggtt ttctctgtga agtatgctgc aaaggccttt gcctgttcag tggttgatat    124500
     gtgcttgggg agccatatat cacgtcccgg taggtctaca ggttgctggc ttgcctcttt    124560
     agtttgctca gcagcgtgtg tgtatgtctg tgggtttatg tataagccgg acgttataag    124620
     agttacagca gtgagcgatg caacaaccgg cagaacagaa taggtttttt tcgtatcaac    124680
     cataactttc ctcataatca aagcttagca ggagggggcg gaagaaaata gactactcgg    124740
     cataaacaac aacatttata tcaaccttaa cattcgggtg aagcttcacc ttgacggtgt    124800
     gttcacccag agtttttatg ggtgaatcaa tttcaatctt ccccctgtca attttatgac    124860
     cacttgcact agacaaaact ttcgctatat tcgccgcagt aacagaccca aacaaccggc    124920
     catcctctcc ggcatttgcg gcaagcctta actctcttgt tacagcctct tttgtcaggg    124980
     tatttgcaat atcgcgtgcc tcttgtagag cagcggcctc gcgcgctctt cttgcagcag    125040
     agatgtctcc aatatgtttc tgcgcgccct ccgtccacct aacggccatt ccctttggca    125100
     caagatagtt tctgctgtaa ccagccttta cctcaacaac atcaccaacg gacccaagac    125160
     cgttgacatc ctgcacgaga atcactctcg tcatctgctt acaccgctct taaaaggtat    125220
     aacgcccatc tccctggcat tctttatggc cttagctatc tgcctctgtt gttggattga    125280
     ggcccctgta accctgcgcg cccttatctt acctctgtcg gacaaaaacc ttttgagaga    125340
     tgcaagatcc ttgtaatcaa gacctttgat actcacgcgt ttcggcggcg caacaacact    125400
     gtcagcctta ggctgtcgac gaccttttgc tctatatccc atggatcaac caacaactag    125460
     aaaggaactt catcactgtc aaaatcctca taagatacat tatctcccac cagaactttt    125520
     ttatttaact cgtttttccc ggcaccctcg ccattcttcg cgttttcagt aatttcctca    125580
     ctacgtgtgg tgtgagagtc aataccctga ccagtctgag agtcagccca aggatcagga    125640
     gacacaccat gcccagcctg cgtggccctc gagcatttcg ctgttgcgta ccgcaaagtc    125700
     gggccaatct catcaatttc aagctcaacc gaagttctgc gatcaccctc tctcgtttca    125760
     tagtttcgct gctttagctt accgacagct acaactcgca ttcccttcgc aagggaggcc    125820
     gcggcattaa tggcatactc tctccacaga atgccacgaa gaaaaagagg ttccccatcc    125880
     ttccactcgc cggactgtct gtcgtacatg cgaggggtgc ttgctatggt catgttgacg    125940
     acagccgccc cagttgcggt gtacctcaat tccggatcgg ctgttagatt gcccaccacg    126000
     gtaacggttg catccaccct ttatttccgt ccgactcgca aaagtttagt acgtataaca    126060
     tcctctgtca gacgcatctg cctgccaatc tccgcgatcg acccggcatt tgctagaagc    126120
     ctgacaacaa cacaaacccc atcgttgcgc ccctttatct cgtaagcaaa tttccgtacc    126180
     cccagaacat caagatgctt tactgtaacc ccttcgggtt cgactggagt aaagaggctt    126240
     ctaacacgag actcggcctc aggctcaaat tcagacccaa ggctgaccag cagttcgtat    126300
     tcacgcaaag gggatcccaa caaacaaaaa ccgaagaaga agcaactccg cgaccgcacg    126360
     gagtgaggcc attttagcgc acaccttact gtatgcaaaa tggtgctttc gatacaccat    126420
     atttgggtat cttgtatggc gcctttgcag tgtgtgcagc gtacaccatg aatatctctt    126480
     agatgcaccc ttcttgcaat gagcatttct tgcaatgagc attgtctcct aacgcgcctt    126540
     ctttcgttga cgcaggcttt tgttgacgca ggcgcagtga ggagttatca gaagacagtt    126600
     cttcagggat caggcagatt agggttttta ttggtgacca gacctttgcc ccttcttcat    126660
     cagccccttt ttcatcccgt tagcttagct agtaatgttt tgtacttttt ataaacagtt    126720
     tgaataagtt cctgtggaag tctcagtggg gttatgtttt gtggggttat gtttttgcca    126780
     gaattgcact ttacccaatc gcgcacagct tgcttgtcaa agctatccaa tctgcgttct    126840
     atgggcaaat caaactgccc ccatgaattg atatcccaat atcttgccga atcagctgtt    126900
     agcagctcgt cagcaagata cgctttccct tcagctatgc caaactcaaa ctttgcgtct    126960
     gcaataataa gacccttgtt gcgtgctatc tgttcagcgg ttgtgtaata gtccgtgcac    127020
     atctctctaa gttgctgcgc atggctcaaa ccgattgcat ttacaagatc ttcatagcga    127080
     acgggcgtat cctttgttct actttttgtc gttggggtaa aaattggccc ggggagccta    127140
     tcaccctggc gaaattttcc ctttagcttg atcccgtaaa ccgtgttgtt ttcgagataa    127200
     tctgcccatg ctgagccagt taagtaaccc cttataacga attcaaatgg gatgatatcc    127260
     attttcctgc atattgttga cctttctaga atgtggcttg gaatgtggct tgcaaggtct    127320
     ctatataatt cttggtcgta attttccaga agatgatttt cggcaggcag tttacggaac    127380
     caccaattgc tcatttgtgt cagcatgcgc cccttttcgg gaatttcggg ctctaagaca    127440
     aagtcaaatg cgcttacccg gtttgatgca aacattagga ggatgttctt gtattgtcta    127500
     tggacataaa gctcacggac ctttcctccg cctatatgag accaatctgg caggtcgcgc    127560
     gattctggta tttcaagttt tcttgtcatt tgtaatccgt ctaatggtgg gattcgctaa    127620
     catattacga ttcatgctaa ctctcgatac gatttatgac cactggggtc atcttatgat    127680
     atgcacgagt catgatatgc acgagtgccc acagaaacag gggctctcat aaactatagg    127740
     atgctcatac acacagggct ctcataaaca tagtacagcg ataacaacgt actctgacaa    127800
     aggaacgtgc cctgacaacg gagtaccttg gccgtgacaa ttttcatcat gcgcggtgta    127860
     acaatgcgca ttgttacaaa tggtgtaaca aacacatgtt gcacacagta caggggatag    127920
     agcaaaatat ttcgatacag cctattaccg tatgcggtga caccgcatga aggcacccga    127980
     tgattgactc aatgcgctaa acaccacgca cagattttgc cttgtatgag ataaccccat    128040
     agtgaatcac tgacgtaatt gaatcacagt tatttatcgg gtttgttatt catcgggttt    128100
     aatgtgtggg tgaatctaaa ggtgctccca cctttgatac actccaacat gtgttgctta    128160
     gtgagctgtt tgacccggac ctttgggtgg cgcatgaggg cttcgaagct tgtgatgtaa    128220
     cgtatcacac agctcctggg gttgcacgta ttgcatttaa cagaccagag attagaaatg    128280
     cgtttcgacc cgaaactgtt gatcagcttt atgctgcgct agatcatgca cgggtcagcg    128340
     ataaaatcgg tgctgtttta ctgacaggca atggcccatc cccgcgcgac ggtatccgtg    128400
     ctttttgtgc agggggcgat cagaaaacac gccggaggga tggatacgca tacagcgatt    128460
     cccaccgttc ttcgaggatg catattcttg aagtccaaag actgattcgc tttatgccaa    128520
     agcctgttat tgcattggta aacgggtggg ctgcgggtgg tggacattcc ttgcacgttg    128580
     tgtgcgatct cagtattgca agccttgagc atgccaaatt caagcaaaca gacgcaactg    128640
     tagcaagttt tgactcaggt tttggaagcg cctatttcgc ccgacaggtc gggcagaagt    128700
     ttgcacgcga ggtctgtttt cttgcggcag aatatgacgc taaaaccgct ctcgaaaaag    128760
     gtgcggttaa tgctgtggtt gcgcatgagt atcttgagca gaccggatac gaatgggccc    128820
     ggaggattct tgagcagtca ccgacttcga tacgtatgtt taaatacgcg ctaaatgccg    128880
     ttgatgatgg cctggtcgga cagcagattt ttgcaggcga ggccacacgc cttgcgtatg    128940
     caacagatga gtcaaaagaa gggcgtgacg cattcctcga aaaacgtcgg ccagactggt    129000
     caagctttcc ctggagcttc tagtatgacc aaggctctca tgcgggggca aattacactt    129060
     gactctgtaa aaagagtcct tgaggacgag cgatttgcta tttgtgcgtc agaagagcct    129120
     ctctcatgcg ggggcaaaat aatggtcgac gatgcggttt gtctcgtaat aaatacatct    129180
     ggatcaaccg cctcgcccaa gagagttgcg ttttcatcat catctcttat gaactctgct    129240
     cgtgcgtgct gctccgttct tggctatgga cagtgggttt tgtgcttacc aaagcaatat    129300
     actgccgggg tgcgtgtgct tgtacgatcc attctgtctg gcacgaaacc aatagatatt    129360
     tctgaggata gattttcccc tgaaaatttc atacatgcat gccggaggtt atcttgctcg    129420
     aataccttta ctgcacttgt cccaacccag ctcagtgccc ttgttagggt ggcagaggat    129480
     gacaaaaacg ttgcaaaagt tttgagtggc tttacgggcg ttattgtcgg agggcagcat    129540
     attgcgcgat cactgcttga aagaagcagg ttgctcggga tcaatttatt tacttcatac    129600
     gggttgaccg aaacttttgg tggatgcgtt tacaatggcc ttcctcttcc tggagtgcag    129660
     atacagatta ttgacggaag ggccgcaatc gcctccccca gtctggcgct tgggtatcta    129720
     aaagaaaacg ggcaaatcga tgaaacagga tttttttttg accgaggtga gcggtggttt    129780
     cacacaaatg atcttgccgt tatgaatcgg ggaaaattga taatccacgg ccggatcgac    129840
     agagttataa acagtggagg gatgaagctt gacctaaacg ctatcgaaac agctcttaga    129900
     tctcttgact gcgttgagga tgctgttttg ctgggtgtta agtcgaaaaa atggggtcag    129960
     cacttctgtg cgtttatcga tattggtgat gtcacaaagg ccgataggac tgattgcctg    130020
     caaaaaataa acaccctcct ttcaaccttt ggccgcgcgt gccgatctgg acagataaag    130080
     cttattcatc caataccccg cacttttagc ggtaaaccag atcgaattgc cctacaaaga    130140
     ggattacaga acaatatttg agcagaacaa tatttgcaag gcccaaatac ccgatcatct    130200
     cagtgtggga tgttaggcca tatccataat gcaactactg ctagtacttt ttatggggaa    130260
     gccaaacaag tgtataaacc atttctcgac acttttgatc attcgggtgt acattacgtg    130320
     cgttattgca ttctgcatgc catcgctcaa gattcatggc atatcaaata gatgttatag    130380
     ctgttaagtg cgtatcattc cgggcggtat cagatatgca tgtttcatac ggatgcatga    130440
     atatttcccg tacactggga tacacggtag cgtgtctgag tggccgaaag agcgcgcctc    130500
     gaaagcgcgt gagcgcacct gtgctccgtg ggttcaaatc ccaccgctac cgtggtggtt    130560
     atcaaataac tgatgcaatc tctagacagc agctctctaa atgtcgaacc gaataaacag    130620
     ccgattacgc ggagctcttt gcgggaagta gtctttacgg gtgaatgatc tagttgatac    130680
     aactgaaatg tacttgagga caattgtcaa tctcgaagaa gaaggtatta gtccgataat    130740
     aaaggccagg atttctgagc gtatcggaca cacggcgcca actgtttttc agacgattgc    130800
     gagaatgcag cgcgatgggt tacttgttgt ttcgtcgaac aaaagcctga tccttacatc    130860
     aaagggaagg aaaatcgcgc tttccgttgt acgcaaacat cgcctggcgg aggttcttct    130920
     acatgacgtg gtaggccttg aatgggagca tattcatttg gaagcttgtc gccttgaaca    130980
     cgttatgagt gatcacctcg aagagcacct gcgaagaata ttaaataatc catcttttac    131040
     cacatacgga acaccaattc ctccagctga tagtgatttt gtagaaccat ttcgtgatgt    131100
     gatttctctt tcacgggccg ttattcgaca aaaagcacga aaactgtcag tgcggtgttt    131160
     aggtgaaatt gcgcagcagg acactattct gctatctcag ctttcaaagg ccggattgcg    131220
     cccgggggga ttgggaagtt ttatggattc tcagaacggc attttgtcat ggacaaattc    131280
     ggggaataag ttcattatct cgcattacat cgcggagtgc atatttgtaa atcaaaactg    131340
     acgcatgtgc aggcccaacg aataaaggga cctggacata aagagaccta gggttgcagt    131400
     gtaactgtaa taatgtatgt aattgtaata atgtaactgc aattctgtgt atctcgcgat    131460
     atatcacctg ctgagcaact gcgaattgtg actatactgc gtctggtata ctcggacggg    131520
     tgtcctcggt atgtcaggta acaggggctt cgcctggttt tgggtacgcc gtgtcgcact    131580
     cccaccgccg cactaaacgg cggtttgatc cgaatgtgcg tcgacgcaca ttttatgtgg    131640
     caacccttgg taggcgtgtt accctcaatg tatccgtcaa gggcctcagg ttaattgaca    131700
     agcgcggtat cgacgcggtt gtgcgtgatc ttatcaaaaa gggcgttaag ctctaatggc    131760
     aagaaaacgg caggacgttc gtccgattgt gaaactcaaa tcgactgccg gtaccggttt    131820
     tacatatgtc actcgcaaga atcgtcgcaa tgatcctgat aggatcgttc tgaagaagta    131880
     tgatcctatt attcgtcgcc acacggaatt tcgcgaggag cgttgaatgt caaagcttag    131940
     caagattgta aagaacgaga agcgcaaggt tattgtcgcg cggtatgctg ctcgcaggca    132000
     ggaattgaag aggattatcg ccgctccggg gacagccccc gaacggcgcg atgaggctca    132060
     ggctgctttg cagaagctgc ctagagatgc gtcaccggtt agggtgcgct ctcgtgatgt    132120
     tgttgatggc cgaccccggg gcatcctcag taggtttggc gtctccagga ttcgtttccg    132180
     cgagatggcg catcgcggag aattacccgg tataaccaaa tcaagctggt aagtttttga    132240
     ttttgctgct aagatcgcag tcggcgtcgc ttctggaccc agatattagg aggtaatgtg    132300
     gtttctctga atcgcactga attggttgct aaggttgctg agacgtctgg tgttagccgg    132360
     gctactgtga actctgttat tgaggagacc tttgctgttt tcgcggaaac ggtacgtgcc    132420
     ggcggtaagg tgacgattcc tggctggtgt tctgttacac gctctcatag agctgcccgt    132480
     actggtcgta atccccaaac cggtaagacc gttgagattc ctgccggtta ttctgttcgt    132540
     atcgctcccg gcagcaagtt gaaagccgca gttaagtaga ctgggggcac ttatttccgc    132600
     ccccaattca ttacagggat aaaggttttt ggcgcgtctt ctctctgccc gtttcttttc    132660
     tattcttatt gttttttttg ctttatcgtt ttttctcgcc tcttttgttt tgcctcgcct    132720
     cttgggcggt tttgatatca actgggccct tgtttccgta accggtgcgc ttcgttttct    132780
     tgtggcgatt ctggtgggct gccttgtatc cattgcttat tctctaagtc ccagatttcc    132840
     cgagtatgga aagttgttaa ttgttgcgcg cactctttcg tgttgtgtgg ttccggttgt    132900
     tttcttttgt atacttttcg cttttctgac tgagaaagct gagttttctg ggctcaattt    132960
     tgaaacttac ttaactgggc ccggttttgt ttggattatt gtcttggcac tggttctgct    133020
     tatctctttg gctcttttgt tttgcaaaaa acgtattcag attgccgtta taagtacaat    133080
     tacccttttg ctcctaattc ctcttgcatt cagtgaacat tcgggtcaca gcactgtttc    133140
     tgccaatgtt tcgcagcacg taacggatta tcagggttct gtgtctgaca agtcgcatca    133200
     cgctcatcat tcacataatc attcacataa tcattcacag ggcgaaacac gttctgcgca    133260
     cgatgtgcca ttagatgcga taggcgcgtc tcgcactccg gcgatgcatg gtgggtcgca    133320
     cggagctatg ggcgcatcgt tagtgtacgc catttctatt tcagttttag caggggtaat    133380
     tttctcaatg ctttacatta ccggactata ttttgcgcgg atcaaacaca taaagtcctc    133440
     tgttcaaata atgcctcaga gattctttag cattacaaac agattgtcag tgctatccat    133500
     gtttttactt ttattcgcat ttttttccga tgctgtgact gcgatgccgt acattagctc    133560
     tgaatttacc ccatacggga ttttgtctgc aacaaaaatt gcactgtttc ttctgcttgc    133620
     cctgtgtgcg ctgtacattc atttttttta ctttattaaa agtaggatga cgtgtgcgct    133680
     aattgtcatt ctggcatgtg aagctgttat tacgggtttg atttttttaa ttactgcttc    133740
     ggctgttacc cagatacccc aggcatcagt atctgacaga acaccaaccc ctgctgaatt    133800
     gttaacaggc cagatactgc ccccaaggga gagtttcact aattatctat caatttggat    133860
     gatcgatcct ttgtggcttt ctatatgcgt tgttttagcc tttttctatc ttcttggggt    133920
     tataaaactc caccgccgtg gggatagatg gccatggcta aagacagtaa gctggctttt    133980
     cgccgtgctt gttatgttct acgtaaccaa tgggggagtt gctgtatacg gtatgtatct    134040
     tttttcagct catatggtta tgcatatgac ccttggcgcc atcgtcccga tattcttggt    134100
     tgtggcatca ccggtcacac ttttactgag agctgttccg gcacgccggg atggcagctt    134160
     tggcccgaga gaatggatat tgttttttct gaataccaga tttattcagt ttattagttt    134220
     gcctcctatt gctgctgcaa tatttatcct gtcaatgttc attttttatt tcacagatct    134280
     attacagttt ggaatacaaa attacttagg ccatcaggta atgatgtttc attttctgct    134340
     gagtggatat ctttttgccc agagtattct ggtaacagac ccttccagac atcgctttag    134400
     cataccttcc agaatgttag tgctagtatt ggcgatggcg acgcatgcgt tttttggtat    134460
     cgctatcatg tcgtccaggt atcttttttt accagaatgg tttggcgcca tggggcgcac    134520
     gtggggtagt cctcccttgg tagatcagca aatgggcggc gctttggcgt gggggacaac    134580
     cgaaataccg accatcttgc ttgttacttt cttgtttttc aagtggttca aacaggacca    134640
     gcgtgaggcg cttcgaagag atcgtgcgga ggatcgcaat ggcgacaaag cccttgtggc    134700
     gtataacgaa tatttagccc gactacaggg ctagaatgtt tcccgaaatt caggagaata    134760
     tgacaaacgc ggttataaag gacaggactt cgcatttact gtcggctctt gcaagaactg    134820
     taagggaggt tgagatgtcc ctggtgcgca agagaatagg tccgtcatct gtgatgcgtt    134880
     ttcatgcagt ggctctgtta ttgaggcaag agcgagctcg cgtcaagtct gaccctgaca    134940
     taaccgatac agtacgcact gaactcatta gacgactcga tgggcttgct gctgttatgg    135000
     tgcgtatcgc cgcaagagac acagccctta tgtctattgt tacccccgat gctccggttt    135060
     ctgatggcgc actgttgtat cgccggagat tgctttctca gattggtgtt attgactctg    135120
     atggggagtc ttcagagatc cgcgaagccg cgccgccgcc tcccagctta gaattgtatc    135180
     cgcaaagcgt gaagatgtat cacgcaactc atatctttcg tccgcccggg ccagatatgg    135240
     aaagcgatct agttccaata ataagattgg ctaattggga ccttgttggt tccgtcttta    135300
     aggctttttc ccaaggcggc gcgtcggtgt gcaagtcctt acctgcacct tcaccatttc    135360
     ttgatcgact tgcgcccgac ggattgtcca tgatgccaca tcaggccggt ttcgtagaat    135420
     ctgcccgcct gggtcatagg agttttctct tggccgacga acccggtttg ggcaaaacgg    135480
     cccagtcatt acttgccgct ggagtgacaa actcatttcc gcttttagtt gtcgttccaa    135540
     atgttgtcaa gctcaattgg gtgcgtgagg ccaaaatgtg gcttcccggc aggcgggcaa    135600
     cgattattag tggagatgat cttgatgcct ttgcggatat tttcgtcata aattacgaaa    135660
     tgctggaccg tcacatgttg tggatggttg atttcggttt cgcgggcatg gttgttgatg    135720
     aggcacatct tataaaaaac ttttcttccc agcgctctgg gaatgtgcta gcgttggctc    135780
     aacacatacg aaagaaatgc tgtaaccccc tgatgatcgc cctgaccggg actcctgtga    135840
     taaacagtgt cgaagatttc agggctctat ggttattttt ggggtggctt gccggacctc    135900
     ggggcaggga tctaagcccc gtttttgtct ctgagcttga gaaaacaggc ttaacacccg    135960
     aagatccggg gttttctgaa actgttaggg atgtgatggg gcatcttgga attgtacgac    136020
     gaagaaaaac acaggttgca aaggatcttc cagaaagaat ggtcgtagat ctgcctgttg    136080
     aactggatgg cgacgcattc cgcagtgtaa aaaatgcgga agatgatctg gcagatgcgc    136140
     tctatgcgca gtatatttcc cttaagcacc ttagaatcga cgattaccaa attcgcctga    136200
     aggcagtgga gcgttttgcg gttgaatcga aagactctag tgcgttgaat attttttcta    136260
     ttgtcaggaa gataggtatt acaaaagcgc ccctcgcgat tgacttcacc attcagatgc    136320
     tggattccgt tggtaaaatc gttttttttg caaagcatat cgaggttatg aatatggctg    136380
     aggaaatgtt ttgccagcag ggcattcgtt ctgtttcaat cagggggagt cagacgccaa    136440
     atgaccggaa aaatgctctc cgtacatttg atgaggatcc ggatacacgt gttgcaattt    136500
     gctccctaac cgctgctgga cttggcataa accttcaagt tgcttctaat gtagttttgt    136560
     cagaattgag ttggactgcc gccgaacagg gtcaggcgat tgatagatta catcgcattg    136620
     gtcaaacgga gcccgtaacc gcctggcgca ttctgggcgc gggtacggtt gatattagaa    136680
     tggctgcttt agttgattca aaatcaaatg atgcaatcct gtctctggat ggcggagata    136740
     tgcgtgaagt acagcaagag agtcttcata taagatccct ccttgacttg cttgatgata    136800
     ggatacgtaa ggctgagcag cacgtagagt aacctgtgtc ttcgactctt tcgtcggtta    136860
     caggccgcgc ggtctgtccg cttttgtgtg cttttggccg tgtttatgaa atttgtattg    136920
     tagacttagt ccagcgcgtg tgcgacggcc gactagtaga ggagataatc gatggcaaag    136980
     gccaagtttg agcggactaa accccatgtg aatattggga ctataggtca tgttgaccac    137040
     ggtaaaacca cactgaccgc cgccatatcg agggttttgt ccgagaggct tccttcgaat    137100
     acgaatgtaa agcaggactt tgatgcaatt gactcggccc cggaagagcg ccagaggggt    137160
     attacgatca atatttcgca tatcgagtac gagacggaaa agaggcacta cgcccatgtt    137220
     gatgccccag gacatgccga ttacataaag aatatgatta ctggcgccgc tcagatggat    137280
     ggtgcgattc ttgttgttgc ggcgacagac ggtgcaatgg cccagacccg tgagcatgtc    137340
     ttgcttgcca agcaggtcgg cgtcccctat ctccttgtgg cactcaataa agccgatatg    137400
     gtgtctgatg aggaaatact cgagcttgtt gagcttgagg tgcgcgagct gttgtcaact    137460
     cacggctttg acggtgagaa tgttcccgtt gtacgcgtat ctggccttaa agcacttgaa    137520
     ggtgatcaaa agtggggcga tgcggttatg gagcttatga aagccgttga tgagagcatt    137580
     ccggaccccg ttagagatag ggataaaccc tttttgatgc ccattgagga tgtgttcaca    137640
     atcactgggc gcggaacggt tgttacaggc cgtgcagagc gtggtgttct tgcggttaat    137700
     tccgaggttg aaatagtcgg tatacgcccg acgcagaaaa ccactgtaac gggaattgaa    137760
     atgtttcgca agcagttgga tgaggcgtgg gcaggtgaga actgcggcct gctgcttcgc    137820
     ggcacaaaac gggaagatgt cgagcgtggg caggttgttg tgaaacctgg cagtgttaca    137880
     ccgcatacaa agtttgaggg aaaggcgtat attctgtcga aagatgaggg tggaaggcat    137940
     aacccgttct atagtaacta tcgcccacag ttttacttca ggacaactga cgtgactggc    138000
     gttataaccc ttcctgaggg aacagaaatg gttatgcccg gcgataccat ctctataaca    138060
     gtcgacttga ttcagccaat tgctatggaa gaaggcttgg gttttgcgat tcgcgagggt    138120
     ggcagaactg ttggcgcagg cactgtagtg aaaattcttg aatagctaag ggtcaaaagg    138180
     aattcagcta acagctgagt ataacagctg ggccttagtc caaacgggta tcctatccgg    138240
     tactattgct ccaatacttc ttgtgcatat tcatcagttt ggagacggca tcccagagca    138300
     atagatcagg accaggtccc tataggcagt aggagtctcg aacaaaagag aatgtaacag    138360
     aaactaatac atatacttct ttataatttt ggcgaccaga ggtgtcattc caggtaaata    138420
     gccttaccgc aggcaagaca aatacgcatg cattacttcc agctgggtaa aatcatcagg    138480
     ctttcccaat atttatagtg caccggccat gccatattga tcggtaggat gacgaagcca    138540
     cacacggttg ccgccaggag gaatgttaca accaacataa gccgcagaag aggggcttgc    138600
     ataacaggcg caatatccag gctggcaatt cgtgctggca taacaaaaca cgcttcgcgc    138660
     acacggttac cgcttccacg cagagccgca agcacccggg atccatactc aaatcgtcgc    138720
     gttcccaccc atggtgttgg caaaagccta ttttcggttt ttatttccag aatcttgtag    138780
     attgcagcag caatcatgat tatcataaac ggctcaaaga caatggtata gaaatgaaag    138840
     atagttctgt taacgtacaa aaaccaagga aagtatccac cagcgagagt cataagtata    138900
     aaattcatac gccaatcacg tcgactcggt gcaaaaatag cgattagtgc aaaaatgatg    138960
     aacagagcta cggctgccca ccaaagcaag gggtttggca ggccgattat aacccgcaca    139020
     tcatcaccaa tctttgtcca gtacatattc gtgggtctaa taaggaaagg ccacgtatac    139080
     actggggctt catagatatg aggggttgta agagtggagt taaatctgta catagttacc    139140
     tgaaaattca cccagctctg gaatatcttt ggcacccatg caagcggtcc tgcccaccca    139200
     tttcctggat aggttgccca gcttgagccc cacccaccta caatgaagta atttgcccat    139260
     agcgcgatgt agacaaacac ggaaatgata actgaactga tacccgagac aagtacctgg    139320
     tagaaggttc cctgaaagcg atatttgata ccaagctgct tgcgcgttgt ccagtcaatt    139380
     gccgttatgt acgggattat cccgaagtaa taaaaaatac ctgaccattt cacagaggca    139440
     gccataccca tcaaaacagc agcaagggca agccatggtc gccaccacac gagcggccct    139500
     gagacgaggt aattgccctt tgcatcttgg ctgaggtgct tacttcgatt ctgaacccac    139560
     tttgacatgg cttttctgta ccattgtcga tccagcaaaa cgcaccatac cgcaatcaat    139620
     gaaattatca tcagcacatt gtcgagtatg gcaacccgac tcattacaat tgcattgttt    139680
     tctatcgcaa acagaaagcc cgcaatcccc cctatgaggg tgctctcaaa taacctggcg    139740
     gctataacag ctgtcataaa gaccccgagc acccctatta gggcaaccgc aatccgccaa    139800
     ccgaattgac ttctcactcc aaataactca atccctgcgc caataatgta tttacctaga    139860
     tgtggatgag ctagaaattc cggttcattt gtgaaaaaat cggtatcccc ggatacgaat    139920
     ctcttatcta tatcctcggg cttcatatct cgtggccatt cggattcata cccgtttttg    139980
     tacagagtgt aagcgtcttt gacgtagtaa gtttcgtcaa aaatcagagt ttttgggtct    140040
     gataggttgt aaaaacgcag cagggttgcc agaacgacaa ccccaaatat catgccccaa    140100
     taggcaatca tgttgctttt atagcttttc aggagcttgt gccagaatgc acaagccggt    140160
     gttagtcgcg aagtcgcgct cagtggcgat ggtgtaaatc tcataggata catatagttt    140220
     atctgcacga gagttacagc gcccggaaaa tccgcaaaag cccgagtaat aacccgtgca    140280
     gagttgcacc ccaagacaag agcgcacccc aagacaacag agtaaaccaa ccgcacataa    140340
     tatttgtccc gctactaccg ccacaggtaa acatgtcgta acgggtaagc atgtcaagcc    140400
     gaacagaatg tatagcttag aaatgtattc tcagaaatag gtgtgcgttg aaataggtgt    140460
     gcttactcag aaataggcgt gcgttctgcc tgcatatccg caattgccta ccaaaacata    140520
     tcattcaaca cacatattcg acacatatcc gtgcatgcca tatcgcgatt ccaattgtgt    140580
     ctatatggct ttggcagctc aagcatcata tactctactg ttatgcgcag gcctgacatc    140640
     ttcttgctga agaatgcacc tatgaattac gattggggcg attgcacagc tatagctagt    140700
     cttcagggaa gacagcccac atcacgccca gaagctgaga tctggttcgg cacgcacccc    140760
     aggtcacctg cctatctttc agacggtaga ttacttgcta gtgctctaga agagcacgga    140820
     atctccatct cgtatttggt gaagctgctt gccgctgcaa agccactttc aattcaggtt    140880
     catccgaatt ctgcgcaggc tcgcgcagga ttcgccagag aaaagcatct tgattctgca    140940
     tccaagaact atagggacag atatgagaag tctgagatgc ttattgcgat aagcgatacg    141000
     ttcagcctat tgtgtggatt caggcccaag gatgagttgt ccgagacatt aaaccatttc    141060
     tctcttgttt caaaaaaatt caaaatcatg agggatcttt acgaacaaca cggattgaaa    141120
     tgcgctattg cttggttttt tgaaaatgcc aaccagagtg atatcgattt attgtgcgaa    141180
     ggaagaatgc cgtatgaatc acagaacacc acaatatccg acctaaagaa acaccatgtc    141240
     aatgaacctg gatttgtttt ggcggtcctc atgagtcgtg tcaatatcac tcgcggacag    141300
     tcggtttttg tacaagccgg caccctgcat tcgtacctca aaggctttgg ggtcgagatt    141360
     atgacaaata gtgacaatgt gattcgcgca gggctaacaa caaaacatat tgacacagtc    141420
     gagttacaaa aggtggccct gtttaagtca gaaccagttt gtcttctgca gccacacatc    141480
     agtaattcag gggccagtag gcgtttttgc acgccatact ttacagttga ggaggttacg    141540
     ctctctggta atgagggcag ttgccttagc tctactatcg gcaattgtgc gtactgtaac    141600
     agagatagcg attcagacct tacatctgtg ctgcaacatg atttggatca aaaacatgat    141660
     ggcatgacag aaccttcacc aggactttcc gagggtattc atgcatgtaa ttcaggtatc    141720
     acttgtactt ctgaatccat ctctaagtcg gccacggcca tccctggtgg caccttcggt    141780
     ggatcaggat acaccttacg gggtactgga cttgtgcttg tcacagctgg tgtggttcat    141840
     ttatcatcag gtgacgaaga attgatagta cgctccggat ttgccgcgtt tgtaatcgac    141900
     ccgtcgccat ctggcggtgt ttttctcaca gggtgcggtg tttgttatat cgttactgat    141960
     gataatcagt ttgacataat tgcttcttag ctcgtatcat tagtgagtta cagatgtgta    142020
     attttacaga ttggggtgag agtgtcagat aacttgccga taccggatga ctggcatatt    142080
     gaccctgttt tgcttggtat tcccggattg cgaggtgggt ttgactggcg cgcaagggcc    142140
     ctttgtgcac aagctgaccc ggagtctttt ttcccggaaa agggcggttc aacgagggag    142200
     gcaaagaagg tttgttcgtc gtgcgcggtg cgttctgagt gcctcgagta tgcgcttgaa    142260
     aatgatgaaa gatatggcat ctggggtggc acaagtgaac gcgagaggcg cattcttagg    142320
     cagcgcaggg cggcttctgg ccttgcatga aggtagctgc agtctttctt gccgatgacg    142380
     ggcagtatct agagcaggcc ctttcggccc ttaggtgtca gacgaaacct gtttcctata    142440
     tttttgttgt tgacctaacg gctaagcgcc gcagccagga gactctatcg acttttgccc    142500
     ccgacgggat aatgcgcttt cccccaggat acaatcgcgc tcgggcactc aatgctgcgt    142560
     gtttgaaatg ccctgatact gatttttact ggtttttgaa cacacgcatt gtcgcggccc    142620
     caacggctct tgagtatttg ctgaatacta ttgaagtttc gcccggagct tccgttgctg    142680
     caccaaaaat actcaatgat actggggtgt tctttgacta cggccagtca attacaacag    142740
     gtggccgtgc tgtccatctc gttcaggacg agcttgatca gggtcaacat gatgacaagg    142800
     ttgatactat gggcgctaat tatgcaggca tgcttgtcca tcgctcctgc tttgaggcca    142860
     taaaaggttt cgacccggga ttctcggaat acgagcaggg ccttgatttt tgcatacgtg    142920
     cacgcttgtc tggcgcccgg gtttcgcttt ccccaaggtc tgttgtgaca catgttggca    142980
     ccggactcag atcgtatcgt gtgcaagaag ggtatattca gaagcgaacc ggtcaactca    143040
     gacgacagat tgtttacgca ccttttgtaa agtccgtact cttatggttt tcccttatac    143100
     cccgcggggt gttgtggttt cttgcaagct tattgactag gcggagtgcc ctgaaagagg    143160
     cctgggctca catcaaatta gcctttttac caatctccct tgcaagatcc aggaaaattt    143220
     ctaatcgaca aaactcactt agggcacttt ctgttcttat gcaaaaacca aaacgagagt    143280
     tcatgtctta tgagaaactt gattttttct tcaggaatgg cctcgtaatc gttttgattt    143340
     ttgtatttat tggatttgtt gtatttctgc catttcttgc acatcctgcc ttgtcgggcg    143400
     gtagcctctt gcccattaat ctgtcttttt accaaatgtg gcgcatgacg gcagtctatg    143460
     tattcctcga tggggtgtat ccagcggatc cgtttaacat aatcccagca ttgctgggaa    143520
     gcctaacctt ttgggatacg aatttctcaa ttctgctttt gtattttgtg gcgctacccc    143580
     tttcgtgcac cgccgcttgg ctctgcgcat cgcgactgtt atcaagccct cgcaccatag    143640
     ccttttcagc tgccctttat tcactatctc catctctttg gttaggcttg tacaacggta    143700
     atttgcaggg tatagtcgta catatttgct tgccgttttt atgtttcctc atgctgggga    143760
     taaaaacatt ccggacattg tcactcgcat ctctcttatt tgcgtttatt acggtcgcgt    143820
     caccaagtat ttttcttccg cttaccgtct tggttttaat tgtcgccatc gcaactgcca    143880
     cttttagaat gctgtttatt gtattgccag ttattgtggc ttttattcca ctgttcttgg    143940
     ttcaaccatt gcgtgtgaat ctacttgccg atcctgtttt gtcaagcaca aatctcttca    144000
     gttccatttt tggattgggt aacatcttta ccacggcgca tttgtctctg ttcttactgg    144060
     ttttgccgat tatttttctt attcttatgg gcctgtggaa gacttactca agtttgccat    144120
     ttttgctgat aacttttgtt ggatttgtga attcggttat ttgggccgac gtatggcagg    144180
     gaccgagctt cagtcttgct tggctcggca taaccggtgc tgccgctatt ggctttactt    144240
     caattcgctg cataaaaaga atgattgccc ttgtatctgt gggcgccctc ggtgcatttt    144300
     ttgtttatat accgtacgct accaagatat ggcaagctca atctcccgtt gtttcaacaa    144360
     cttccgctgt taatttaccc gcatatgtcc ttgccgaggc caacagcaat tccaatattg    144420
     gcacccttat agtagaacct gtgtcagaaa aagagatcag ggtgaaagtt gcccgaggtg    144480
     cagtttttgg atttggttca cagaatacaa aactaatatc tggagcaaac ccccagtctt    144540
     ccgaccttgc aaatttggct gttaatcttg ttatgtctgg caatgttgat attgctgaag    144600
     gtatgaaaag actaaatctt gaaatgcttc tgctgtctgg tgataaatac ggtttctcgg    144660
     cgaatatcaa tgcaaattct atgtttgagg cagctggaaa cacgcccttc ggtaagcttt    144720
     ggcgactgaa ggatcgctta ccccctttgg gtcaggcaac ttttccgccc tattattggc    144780
     tttcgccgat tgtttttctt ttactgtttt tggttggcgt ctttggaaga tcttctagaa    144840
     aaccaccgga agaaatgggt attgacctag aggatcaatt tgcggagcct ggatatgcac    144900
     tcacatagga atatctctgt gttatctgct tgatcaggat gtatttggga tctctaagca    144960
     atgaaaattt ttccgaaaat acttaactgt tttattctgg ttttgttacc ggcgattgtc    145020
     tttttattta gcggtgttca cataacaact gcagttggtg tgcgccacaa aaccaaggtt    145080
     acatcgatcg aacttcggct gtcttgcccc ggctcacttg ttggtgttgg tggtgtgcat    145140
     gcgcgcggga tatcttttgt tccgcttgga aacccatcag ttctttatgc cgcctctcag    145200
     gcaggtcttt tgaaggcgga gcatccctct ggggttatgc ttcgtggagg ctacggcaca    145260
     tctggttctc aaattcaggg gcttagctct gacagggtaa aaggcctggc cgccgcctca    145320
     tgccagcaac ctcgtcagga gagttggctc ttgggcgggg caacaggtgt atttgataat    145380
     acacttttga ttcttggtaa cccctctgat tctcagacca gtgtctcatt taccgtctac    145440
     tcgggtaatg aaaagaaatt ctcctcgggt gtgccggttc ccagcagaag ccttaggttc    145500
     gtaaatcttg cgggaatagc tcccgggctt tcaagaattg cggttcaggt caagtctgac    145560
     gatgtcccgg tttattcagt tttgcagcac tccatagtca agggtgcagt tcccatgggg    145620
     gtctcgtatg tatcgaccgg caacattgac aaaagtcaat atatccccgg ggtgattatc    145680
     aatgacaata cgattaacga taatgataat ccccagattc tccttaggct atttgtgcca    145740
     ggtaaagacg atgctgacgt ctctgttagt gttgtttcaa aaaccactcc gggcacagct    145800
     cttactgcac atgtgaccgg agggtcaata cgagatatac caatttctgg ccttacatcc    145860
     tcaagttatt ttatttctat tacaagctct aaaccgcttt tagcgtcagc cctgtcttct    145920
     atgtcatttc agtcgggtgc acgggatttt gcgtggtatc cggcaaccca tgccacttct    145980
     gcggatactt ttattgccgt tccaagccgt ggcgtcttgg ctcttcaaaa tacccttgac    146040
     cagtcccagt ccgtaaaact tgaatccttg aatggatttt cggattcatt tcctagcggg    146100
     tttgtaaata catcacatgt ttttgtgcca aaacagccag aagtcacaaa ttcaaccgtg    146160
     atacatcttg atcgcagtgg cgtcgcgaca catccagtct cccgcgggtt ttacagatta    146220
     tcccataagg gccaagtggc attttcctta gcgtttgtta attcagaagg tattgcaatg    146280
     tacaatccac ctacgggcga cacacgaccc gatggtataa cagttgatgt gctgcagtga    146340
     actctcgtga catttcacta cagtaaattg tctcccttct gtatcgccta tctgtattgc    146400
     ctaatacccg cggtgccttt tacccgtttt ctgctatgcc catagtattc agtgcacacg    146460
     atattcagtg atctgcattc agtgatctgt attgagagtc agtttgtgct atccatataa    146520
     gttttcttga taggaagaaa gacgcgtaag agtgtacatt cattcagttt ctgcagttac    146580
     tctctttgca tatctgttgc gttgtacacg ataaactgaa ctacatgaag agggtatgtt    146640
     cgcgtcctgc ctgcactgaa actgcatctt tcagttttgt gtatgacccg cgtgagcgat    146700
     ttgtgacagt tggtcccatg tctgaatatc atatggcccc tgaatgtttt gatgtgtgtc    146760
     gacggcatgc aaaaaccctg aatgccccaa aggggtggac tttgttcaag cattcactcg    146820
     tattcagggc gtagtgtgtc tgtttttaag gcatatgacg tgcgtggcct tgtgccggag    146880
     cagcttacaa ctgacataag ccgcgcaatt ggtgcggctt atattgatag tctcggatgc    146940
     tcatctatcg tggttggcag agatatgcgc ccgtcttcta aagagctatt ttacgcattt    147000
     gccgaaggat gcactgcgcg cggtgcatct gtgatagaca taggcctatg ttcaacagac    147060
     gccgtctatt atgcatcagg tgcctggaat atcccagctg cagtattcac cgcaagccat    147120
     aatccgccag agtataacgg aataaagttt tgtcgccccg gtgcgcaggg catcgggtat    147180
     acaactgggt taagtgatgt tgagaaaata tcggataaat accttctaaa gggaatccca    147240
     cacgcagaga caaaaggtaa agttgtcaaa aagagtgtgg ggcgtgaata tgcggagtat    147300
     atctgtaacc tcgtaggccc tctgcaaaaa cctttaaaag ttgttataga cgccgggaat    147360
     gggatggccg gcaagatggt acccatagtt atgcagtccg ctttgaccga tattgaaatc    147420
     cttccgcttt attttgaact tgatggcact ttcccaaacc atgaggcgaa tccatttgat    147480
     ccaaaaaatc ttgtggatct ccagcatgca gtaaaagaaa ctggagcaga tattggtctt    147540
     gcgtttgatg gtgatgctga tcgctgtgtc gttattgatg aaatgtcaaa ccctgttacc    147600
     ccatcttcta tcgcgagtat tgttgtggga agaattctta aacagtacgg caacgcgaag    147660
     gctaccatag tgcataatct gcttgtttct aggggttttg cagagagtgt tatatcaaga    147720
     aacagcgaga atagacttgt ccgtacacga gttggtcact catttataaa agatattatg    147780
     cataaaacaa atgcgctgtt tggatgtgag cattctgcac attattattt ccgtgatttc    147840
     tggggtgcgg ataacggcat gcttgcggca ttgtacgtaa tggccgaact gtgtgagtca    147900
     cccatgccaa tgtctgtatt gtccaggaag tacaccccgt actttcagtc cggcgaaaca    147960
     aattaccgtg tacataaccc agatatgaca atgtctgcga tacgacaggc ctttccgggt    148020
     gcttatgtag agtttttgga tggcatgacg ctatatgaat cagttaaaga ccctggacca    148080
     gagaggtttt ggtggttgaa tgtcaggaag tctaatacag agcccttact ccgccttaat    148140
     gttgaggctc agacagagga cctaatgaga ctggttcgcg ataaagcagt aaagataatc    148200
     accggtggat gaagtttata tctggatgta tttggttata aattcatatt cactctctta    148260
     ttcactcctt tatgtttttt gatatttcga cccttaccgt cttttctgta cagctttgat    148320
     caaggtcttc cttgtgcgga gtgtgccttg ctctatagac atatgtcttt acggtgttat    148380
     tttcatgtaa tttgccttat ttcctgccga gtttcacata aataagtgcg ttcttttcaa    148440
     gataatgaaa cccctgacag acttatgctc tgtcttgcca tatccttcaa gccgtgggta    148500
     aaaaggaggg ttacgatcac tcaggtcaga ttgtcaatcg gcttggaatg ctaacccggg    148560
     agatgtctaa tctcttctat ccaacatctt gcccttgctg cggtatgcag gatactactc    148620
     tttgtgacct atgttttgcg cgccttgcag aacggcctta tagagaaagc cttgccggtc    148680
     ttgatgttat ttcttgctgc gattacacgc ccacagcaag ggccttcata acagcataca    148740
     aagtaatgaa aagaatgacg cttgcaaaat tcatgggctt aataattgcc aatcagctta    148800
     atgtgttttc tagtgagtac ggtaactact cggtaataac aatgccatca accagattga    148860
     gttggcgcag cagggggttt catccggttg atcatgctct gaaaactatt ggcgtggaac    148920
     ctgtggatct tttgtgtttt agaaaacaac ccaaagatca agcgtttttg gacaggcgcg    148980
     aaagaatggc aaatatgttc ggaaccttgc aggtgaagaa aatatcaaca tattcgaaga    149040
     atttattatt cgttgatgac gttatgacaa gtgcggccac tttgttggag gttcatcgcg    149100
     ctgtttcgct taccggaaaa accctaatag gggcggttgt tctattcagg actcgggcca    149160
     aatatccttt ggggtacaac gtccgaaata aacgctccga cagccagtct ctcaaatgca    149220
     ccaaccactt tattcccaca ttttcaataa cccgataatc agtaactacc tctgacccat    149280
     tcccacttgg tgcatatcaa tcacataatc catcatagac acaggcgata atgcgcgcaa    149340
     ataatagtgc atggagaatg acggaagtgg cacaaacaca agacccggta tgtaacccta    149400
     aattaccgcc tatggcaatc agatacgaaa cgccccagga acacttagag gacataatag    149460
     aatgaaagtt gttgtttcac catttgaagg ggtaagttaa tttgtcggtt aaattgctcg    149520
     agaggatcct gcgcgccggc gagggtcgca ccctcaagag attgcgtaat atagcccaca    149580
     ccgtcaatgc catcgaggac gaatataaag gctgtacaga cggtgaactg cgcacttttg    149640
     cttttgatct caaagttcgt catcagaatg gtgagtccct tgacagcatt cttccggaag    149700
     cattcgcaat ggttagagaa gcctcgtctc gaacgctggg tcttaggcat tttgatgttc    149760
     agattatggg tggtgccgcg ttacacatgg ggtatattgc agaaatgttc acaggtgaag    149820
     gtaaaacttt ggttgcaacg ctcccggctt ttctcaattc cctctcgggt aacggcgtcc    149880
     atatagttac ggtgaacgat taccttgctg gatatcactc acagcaaatg ggcagggtat    149940
     acaaggtatt gggactcgag accggggtta ttttggctga tcaggatccc tcaacgcgtg    150000
     ctcaacaata cagggcggat atcacttatg gaactaataa cgagtttggg tttgattatc    150060
     ttcgggataa catggcctgg agttgcgccg agagagttca aaggggtcat aattttgtga    150120
     tcctcgacga ggtagattca attttgattg atgaggcaag gactcctcta attatctccg    150180
     ggtcgtcaag tggtgaagtg agcaggtggt ttgttgagtt cgcgggtatt gcacgtgcgc    150240
     tgactgccgg tgaggattat gatgttgacg agagaaaaca cacggttggc gttctcgagc    150300
     cgggtatagc caaggttgag gatctgcttg gtataagcaa tctgtatgag tctgttaaca    150360
     cccctcttat atcgtttttg aacaactcga taaaagctaa agagcttttc aagcgcgatc    150420
     gcgactatgt cgtgcttgat ggtgaagtga tgatagttga tgaacatacc ggtcgtattt    150480
     tgagtgggcg tcgttacaat gaggggcttc atcaggcaat agaggcaaaa gagggcgttg    150540
     aaatcaaggc ggaaaaccaa acacttgcaa cggttacttt gcaaaattat tttcgtctct    150600
     ataaaaaaat ctccggcatg acgggcaccg cagtaacaga ggcctctgag ttcatgtcga    150660
     cgtacaaact gcctgttgtg tccattccga ccaataagcc aaatatacgt aaggaccatc    150720
     cggatgtcgt ctataagaat gagcagataa agttcgaaaa tcttgctgat catgttcgtg    150780
     agtgttacac tcgtggccag ccagttctga tcggtacaac gagtgttgaa aaaagtgaat    150840
     atgtttcaaa acttctttca aagcgtgggg tcagacatga ggtgttgaac gcaaagaatc    150900
     acgcaaaaga ggcccggata gtggcagagg ctggcagact tcgtgctgtt actgttgcaa    150960
     ccaatatggc tggcaggggt actgatatca tccttggagg taatccagag gtcttgactg    151020
     cggtggaatt gcgcagaaaa ggtcttgatc catcaaaaga ccccgaaaga tatgaacagg    151080
     cttggagttc agcatttccg aagctgcata ggagaaccag agaagaggcc gaaaaggtta    151140
     tagaagctgg tggccttatg gtaattggca cagagcggca tgaaagcaga aggatagata    151200
     accagcttcg cgggaggtca ggcagacagg gtgatccggg tgagagtcgt ttctatcttt    151260
     ccctaacaga tgatcttatg aggaagttta atcccggggc ggcatcggcc ctcgctgcac    151320
     gagtgcccga tgacactgca attgagtcaa aattagtcag tcgtgcaata cggtcagctc    151380
     aggctcaggt tgagagttta aatgctgaaa ctcgcaaaaa tgtcctcaaa tacgacgatg    151440
     tactaaaccg acagcgtgcg gcgatataca ccgacagaag ccgtattctg gaaggcggtg    151500
     atatagcaga cagggtacag gctttccttt cggacgcaat tgaggaaatc ataaacagtc    151560
     atgcagttac ggcatgggat tttgacgccc tgtgggccga cttgaagaca atttatcccg    151620
     ttggcatcag catagaggaa ttgacagatg aggcgggcgg aatgggcaga ataacaccag    151680
     attttgttat gcgagagatt ctgtctgatg caaaattcgc ctatgaaaag cgcgagagcg    151740
     agataggccc tgagtctatg cgtgatcttg agcgcaaggt tgttctttcc gtgattgata    151800
     gatgttggcg tgatcattta tacgagatgg aatatctgaa agaagggata ggcctccgcg    151860
     cgatggctca aagagatcct ttggttgagt atcaaaagga gggctttgat atgtttgagg    151920
     caatgatggg gcgaattcgc gaagaaagta tcggttacct gtttaatatt gatgcccaag    151980
     taagctccaa ctcaccgagc gatgcaagaa accgcccaat tgagcatgac gataatgctg    152040
     tctaatgtag ttgctatcca ttatttcctg cgcatcttcg gatttttgtc ataggcattt    152100
     ctgtagcctg tattgtttct tcttttgcct ggccaagatt acggagttgc cggtgatatt    152160
     actttgacat tactgggtct gaaggggtat cggtaacaca gaagcgcttt ttatttttta    152220
     gccatatatg accgcatcaa gcagttatat gaggtaacag cagtgcgtaa caaaggtgtc    152280
     taagataaac ccgagttcag attaccccgt aataccctgt ttataatccg tataacagtg    152340
     aggtcttttt gttagccttc agaaatggaa gaaatttata attttctgaa taacaaaaca    152400
     tttgctgaac acgtaaaaac caatctcgga cagaatgcat ttatctcttc tgcgaagcag    152460
     aatttttgca taaaacttga aacatacggg cagaactggc ttggtggccg cccactgcaa    152520
     ttgccaactt gcgtgaaatt tgttgcaatt ctttttaggt ctattagttg tattgaattt    152580
     acgaataata atccccgtaa gactgtttca ggtaggtgta tttcaattct tatgttttta    152640
     gaaactttgc gtgaacactg ccgtcgctgt cgtctgcaca ctccgcatac gattgcagag    152700
     ggggttgtaa ccggggtgca taaggatcat gtccatctta agaaggatat tgatcacgaa    152760
     ttattcttcc caatttgtaa tttgattgca attgagcttt tgtaatggac tgttgaaaac    152820
     tgcttgtatt cgaatttctt gattgcacaa tttaattttt agagattttt gcattgatat    152880
     tggtgagatt caaactgaag cgagaatgcg ctcttgagta gatttcccag gtaattcgag    152940
     agaggaagta tgaagattcg atccaaatgg tttccagaca ctcgtatatt gatcggcctt    153000
     gccctaattg cggcatcatt catcggtgtt ttttttgtta taaaaacaaa taattccaaa    153060
     tctcaggtgt atgtggcaac aagacctctc tcgattggtg acaaatttga tgccaagcaa    153120
     ttttctattg tcgaggcaaa tctcggtgcg aatcttgata aatacatcac cccgggcagc    153180
     ctaccgaacg ctgttttcaa tcgaccaatt atgcccgggg agtttcttcc gaaatcagca    153240
     ctcgtacccg tgattgataa ggatattgtt gcggttgtgc ttcgcatagc gggagattta    153300
     ccgggtgatg taaaagaggg tgatcttgtt gatgtgtggg cggcggtgaa aataaaagag    153360
     gaaggctttt ggcagtctga actaattgca aaaacactta gggtgagtcg tgtcattgtt    153420
     tctacaagcc agtttgaccc ccgaggcaca acaaaagttg aagttcaggc cagtagagac    153480
     cgcctgtcat acttactaaa tgcaattgca aatcaggata aagtatcaat tgtcagggca    153540
     tctcacaaag agattgagtt gcttagatct gcctccacac cgcgcaccct cgatgaacaa    153600
     gacaaacaga atgttggaga aacacctgat actaatcctc gcggtccgga tgaaaaagat    153660
     tctaattcag agagcataca cgagggtcac gaatagacaa tctaatgggt aaaacaattg    153720
     ctatatgggg gccggctggg tcacctgggc gaacaacgct gtcgataaat atcgctgcaa    153780
     cactggcctc ttatggcaag aaagttattt taattgacct agacactttt ggtggggttg    153840
     tcagtatata tttagggctt gatgatcaga agtctgggct ggctgctata tgctacaggg    153900
     ctgacagcag atcatttaca cccgaagatc ttttaaatat cgccatcaag gttccgatcc    153960
     gcggaggatt gttctatttt ctaagtggta ttgcgcatca ttccaggtgg cctgaaatca    154020
     atcaaccctc actacttaga gtaataggat cggcaaaaag cgcatttgat tatgtggtta    154080
     tggatcttag ttttgcactt gacagcgttg ggcaggacac tcgcggccgc ctaaattaca    154140
     ctcttatggg ttcaggcgat tttctggtta tggtcggccg cggcgaccct attggaatat    154200
     gtcgttttat tagggcttgg ccagaggtgc caaaggcaca aaatggcaga tcgttatcaa    154260
     taattcccgt tataaacatg gtcaggcata ccgctgtcgg gtcacgtccc accaaacagc    154320
     tgcgcgaagt aatttgcgaa tacacgtctt ttcagcaggt atggcagatc gattttgatc    154380
     aaaaggtttg tgatgctctt ttattgcgcg gaaaaactat tgttgactgt atgcaaaaca    154440
     gttctgttgc aatgcagatc gcctcaattg gacgggtgct tcaatagggt tcacttactc    154500
     ccaagatacc ctataattat cacatgtcag catttcactc gaaagtatct ccgcatgtat    154560
     ctagtgttgt acctacaact aatctcacat ataaacctaa tacgaggaat attcaagtaa    154620
     tacgaggaat attcaaggta ataacactct gtctaataaa gactctcata ataacactct    154680
     gcaccatgac attccagaca cagacatatg ctgcccagat acagacttca gggggggggg    154740
     gcacgctcac tagctgaaca agaacataat agaacaaaga ggggtgccaa tctctttgga    154800
     ttattcgcta gtgctgttgg cacagcagtc aagacgaagc taaaagagct aaagagcaca    154860
     gtgcagagaa aaggaaaaga actacagaac accatcacaa ggccattgca acaagctgta    154920
     gataacacgg tacagaccgt tgtagcccaa gcagcgcaat ctgccacaca ggctgtccag    154980
     tcacagcccg tacaggcaca ggtgcaacaa cttaccagca cagcaacaag cgctgtaagc    155040
     actttggcta atactgttct agatgacctc ctgggcagag caaaggagac agccaaaaca    155100
     gtcggctact ccctgctagg tgtgctagct gcagcactaa caggctttgc catctttgcc    155160
     attgtcaaat ggggcaggta agacatacat ctctaagacc aatattcaga taagaccaat    155220
     attcagggag attcccatac acatatttcc tgcccacgcg atacactgag gtgtatgcat    155280
     gagaggcata tcggcccgag ccaagaagag attgatcaca tgcttggctt tcttggttat    155340
     aagagccttg atgatctcat gcatgctgcg cttccaaacg gcgtacagtc gccaccagat    155400
     atcaagatcc cgtcacacga tgagctaacc tgcctcactc agctagcggc gtttgcgaag    155460
     atgaatcgga taaagacatc gatgcttggc caggggttct ataactgtat tactcccgcg    155520
     gttatacgca gaaatatcct tgaaaatccg tcttggtaca cgtcttatac gccgtatcaa    155580
     cctgagattt ctcagggtcg ccttgagatg ctgatcaatt ttcaaaccat gatttgcgat    155640
     ctaaccggcc tggaaatagc taatgcatca atgctagatg aggcgtcatg cgccgcagag    155700
     gcgatgcttc tggcaaaaag agtctctaga tctagttcca ataagtatct cgttcataac    155760
     ggtgtatttc cccatatccg aagggttctt gaaactcgtg ccgatgctgt tggcgtggaa    155820
     attgtggatc tgcccgaggg tcaatcaata gattttgacc atttcggtgt ttatgcacaa    155880
     taccagtcgg cttctggtaa gttgcttgat ttgcgccccc tgttttctag gtcgaaacgt    155940
     gcaggcgcaa tttgtgttat cgggtgtgac ctgctgatgc ttacactttt cacaagtccc    156000
     ggtgagcttg gtgcagacat agcatttggc tcagctcagc gctttggtat tccgatgaat    156060
     ttcggtggac ccttggcatc tttccttgcg gcccgtaaag caatggaacg ctctcttccg    156120
     ggtcggcttg ttggtgttag cgttgatgct gactcgaacc atgcctacag actgacttta    156180
     cagacaagag agcaacatat tcgccgcgag aaggcaacat cgaatatttg tacggcaacc    156240
     gttctaatgg caattgccgc tgtggctttt gcgcaacatc atggcccaaa gggtttgcgt    156300
     gcaatagctc ataggataaa cacggttgct gtgggttttg cccgcctctt gaagcaaacg    156360
     gctttcaggg tgtcatcctt ggatatattc gacactatcg aaataaacaa tccaacacag    156420
     gtctgcgtcg aggctgaatc aaaatacgat ctcttgttct ggaaagtcga tgataataaa    156480
     ctcaggatta cctttgatga ggtaacggct agactggacg gagatttgcc agagagactg    156540
     tcaaaagtct tcggcatatc ccccgacaag attagagatc ttgggtgtaa ttacgattca    156600
     tgtgattgtt ctttttatgg cgatttgcag caggcccgcg aaggcttgag ttcagttgca    156660
     tcgcgaaata tttctgttca ttcagatctc gcccggcatc cactcaggcg cttttcaggt    156720
     tatctaaaac atcctgtttt caataactac actggcgagg ttgctctaat gcggtatttg    156780
     aaggctttgt cggataaaga ctttgccctt gacaggggaa tgataccgct cgggtcgtgc    156840
     actatgaagc taaatgcggc gttccaatta gaaccggtgt tatggccaga atttgcaaat    156900
     ctacatccct tcgcacctct gggagatgct gacgggacac tgcaaataat cgatcaaata    156960
     gaaacgtggc ttgcaaattt aagtggatat gatgctgtat ctttacaacc caccgccggc    157020
     agtcaaggcg aactcgctgg gttgttggcc attcgcggct actacaagtc tttaaacctt    157080
     gatcgggatg tctgcctaat tcctgcaagc gcacatggta ccaacgcggc cagtgcggtt    157140
     ctcgctggca tgcgcgttgt tgtggttgcc tgcgatcaac agggcaatat agatcttgat    157200
     gatctaaggc ttaaggcgtc aaaaaacgca catgcgcttg cagctctcat ggtaacttac    157260
     ccctcaacac atggggtcta tgaggacaat atttccgagg tatgctctgt ggttcacaaa    157320
     tacggaggac aggtttatgt tgacggtgca aattccaatg ccctgatcgg atatctgagg    157380
     acgggtgatt ttggcggtga tgtgtcacat ctgaatcttc acaagacatt tggcattccc    157440
     cacggcgggg gtggtccagg aattggcccc gtcgttgcca aagcacactt ggctcccttt    157500
     ttacccttca ggaaccgagt gcataaacca tctactgact tacctgctgt gaaacatatg    157560
     ggtgggccca ttgcgtcgag tgattacggc tttgccggcg ctttgtatat cagctgggcc    157620
     tatatatttt gcctcggctc gcagggaatg aagcgttgca ctgctgttgc cgttttggtt    157680
     gctaattaca tcgcaaaaca gctttccgat acatttccgg ttttatatac agggaaaaat    157740
     aatcttgttg cgcatgagtt cattatggac tttagggaag taacaagggt aagcggaatt    157800
     acggttgatg atgtgtgtaa acgacttatc gattacggtt ttcatgcccc aacaatgtct    157860
     tttccggttc ctggaacctt aatggttgag ccaacagaat ccgagccatt ttctgaaatt    157920
     cagcggttca taaaaactat ccgttcaatt cgggctgaaa tcgaccgggt aatagacaag    157980
     acgtatgatc cagataataa ccccctgaag cgcgccccac acactctgga gcagattgca    158040
     tcggataaat gggataggcc atattcacgg cgtacaggca ttgtttatac ctcgggaaag    158100
     tactggcccg catctgcgcg gattgataat gcatatggtg atagaaatat cttttgcaca    158160
     tgccctgatt tgccggatta acataactct tagccctgat ataggttttg gtattaccat    158220
     ccatgcacgt gccaacaaat cttcaccagt aaatccccta aaacagacga tcgtgcatat    158280
     cgtagagctt tgtaaatcgc ctaagctagt gggacatctg caaagcaaaa tttgtctaaa    158340
     tgaaaagttt tgtgtaggat catgcacaag atattcgttg gggtaggggt atgcgtaagg    158400
     gattttcgag ggtctttact tttacggcag tctcagccgt gctgtttgtg acagcatgtt    158460
     ttggtggtaa gcctaccgat tcgtatgtca atgtgaatac gactaagatc agcacaggcc    158520
     tggttcccgc taattccaat gagctgtcgg ctcacaggat tctcagcatg cttttttccg    158580
     gccttgtata tattgacaaa gatgcgcgca tccaaaacga ggttgcaaaa tccatagaga    158640
     ccgcagataa tcgcgtgtgg accattaccc tgagggagga ttttaaattc tctaatggtg    158700
     aaaaagtcac cgcgaagagt tttgttgacg cctggaattt cgcggccaag atttccaatg    158760
     caatgggtaa ccgtgatttt ctgggtaaca tagagggttt cacagaaaag ggtgataccg    158820
     acctgtctgg gttaaaaatt ctggatgaat acaagtttcg cgttattcta aagagcccta    158880
     accggaattt tgttgccaag ttgtcgtatt cagttttttg gccgcttccg tcggatgcgt    158940
     ataaggatat tcgggctttt ggcttgaagc ccatcggtaa tggcccatac tctcttgtca    159000
     gtttcacgca ggatgttgag gctgtgctga aaaaaaatcc tgattacaag gggccaaggc    159060
     agcctcgtaa ttctggcctc aggtacaaga tatattccga ccccgggcct gcgtatgctg    159120
     acgttttgtc tgatagctct gatgtcacag atataatccc accgaatgcc caggaaaagt    159180
     tccagtccga ttttccttct cgttgggtta ggcgtgagat cgcggcaact atatacatcg    159240
     ccattcctgg atacgttgcg cattttgctt ttgacaggga gggaatcctg cgcaggaagg    159300
     ctgtttctat ggcaattaac cggcaggata tagctgataa gatttaccac ggcgccagag    159360
     tgcctgcgcg agactttact tctccgtcag tgctggggta caaggccggc ctgccgggct    159420
     cggatgttct gaaatatgat cctgagcgag ccaagcagtt atgggcacag gctgatgcta    159480
     tatccccttg gggctcgggt gttttgtatc ttaactttgc cgctacccgc ggcgataaag    159540
     ccctattcga agctttggcg aattccataa agaacgttct tggtatagag gtgcaggcct    159600
     atcccaatac tgattggaag gcaaatcttc tgcatggcca gcaaacgaag cagcctttta    159660
     gaattggctg ggccgctgac tggccggcta tagacactta ccttgggtcg ctgtttcata    159720
     gtcaagcttc taacaattat tacgagtttc gtaatgcgga gtatgactca ctgctggtca    159780
     aggccgcaga ggctttgacc tttccgaaag ctcaagatta ctatgacaaa ctgcaggaaa    159840
     ttttattcca gaatatgcct gttgtaccgc ttttttatga ccgcggtggt cttgtatggt    159900
     caaagaatgt cagcaatgtt gaaagcaact gggttggtgt tccggtttac tatctgataa    159960
     cgaagggatg aaatatatga attctaggtt caaatttttt gcggctttta tcccggtcgt    160020
     gctgttcatg gctgcgtgtt tcggaggctc tcctggcgtt aagggtaaag agatgcgctt    160080
     tggaagttgt gaaccgcaga ccgctctttt accgggatct gtgcgtgatg aatgtggctc    160140
     gggcattgtt acgaatcttt tcgttggcct tgtcacgcgc gatcgtgagg gcaatctgat    160200
     aaatgaggtt gcagaatcta tagaaactca agacaatctg acctacgtga ttaaggtaaa    160260
     aaaggactgg aaattctcta atggtgaaaa agtcaccgcg aagagttttg ttgacgcctg    160320
     gaatttcaca gcgaaaaaat ccaatgcgca gagtaatcgt gacgacttga aatatattga    160380
     tgggtatagt gctgatctgg atggtgacct ttcgggtctg aaaattaccg acgaattcac    160440
     atttaccgtt aagctaaata agaagctgaa tgacttttct gagcggctga gcaatactac    160500
     tgcctttttc ccgctaccat ctgttgcata tcaggatatt aaaaagttcg gacagaaccc    160560
     aataggcaat gggccatacc ttctgcacga tcgtcgtaag aatgtttcgt ggtcttatcg    160620
     ccctaatcgt gattatcacg gttatgcatc tcaattccca atcccgcctt ctgttcgtgt    160680
     tacggtctat cagtctggat ccgcgaaata tgctgactat cttgccggca atcttgatct    160740
     tgttgatgtg ccgcaggaga atatcgaaac ttacaaacaa gattctgaag gtcggcatat    160800
     agagggcgtt acatctgttg tatcgtatat cggtattacc gccaacaccc ctggctttga    160860
     actgaatact gaggctggca aactgcgaag aagagcattg tctttggcaa tagatcggca    160920
     ggaaatgggt gataagctct atcatgggct aagattccca gccacgggtt tcttttcctc    160980
     cgcatttttc ccgaattatg ccgacttacc tggctccgat gtattgaagt tcaatctgga    161040
     gaaagccaag gagttttggg ccgaagcaga aaagctatct ccgtatccac ggcgccagat    161100
     agacttcttc tacaatgtgg atggtggcca taagatctgg atcgatgcag ttgttaatca    161160
     gctaaagaat ggacttggta taaccaatat tattccgaaa cccgttccaa cctttaggga    161220
     atttcttgat ctggttgacc aagatgattt cagtggcttc tttaggtccg gctggcaaac    161280
     aggttatatt gctgccccca gtattgagac tttgtttact tcggacggat caaacaactc    161340
     ttcccgttac cgcaatccgg agtttgataa gcttgcagtg agggcggtgg aagccaaaac    161400
     atctgaatct gcttccctgt ataaggagct tcttggcatc cttcttaagg atttaccact    161460
     tattccgctt tttggctata aagatgccct tgtctatggt aaggacgtca agggtataaa    161520
     actgaataag cgaggaattg ttgacacctc tgacatgatc agggaatagt caatcctcaa    161580
     atccgcgtga agcgattgct gttgctattt cctgagccat attaaggctt aggactgtaa    161640
     atggcaggaa gattgcgagg ggcttttttt gaacccccct cgcaatctgg gcttccctaa    161700
     cctgtgtgtg tagggtcagt atttctggca caaatcggac tgtcattgat agggttaagc    161760
     cgaccctttt ttggtttaac ccaaatatcc gaagaggcgt tgccacaata ataaagaagt    161820
     tcaggaattc tgagaatcgc gtcgtgcggc tgacggtgta tgcgccagca agcagtgctg    161880
     acatcctgag tgccgagtaa gccgcgtact ctgcacctga aaaaacaagg tttactagag    161940
     aaacaatccc aacgagaata atcagttgct ttataaaggc tacggagacc ctgaggaaga    162000
     acaaaaggct tgggaggaat aagagtaata gatacacacc agatatgttg tacataagca    162060
     ctccgtagac ggcaaggcca agcagtttta ccgccacagg tgttttgggt atcctcctgc    162120
     ctacgtattt ctgaccgtct ttgttatact ctttcacctt cacaccgacc ttcacaccat    162180
     ctctttaggg caataaatca gcaccatcat ggcgccgcat cgttgttact caaatctcgc    162240
     tcaattactc aaggttcaat tactcaaggt cattgccaaa gatccttgtt ttatacgttt    162300
     ttcatgcgct tttacacagc tcacggtact tcgcaatggc atttttcgga ggtccatcat    162360
     aggctacttg tccttggttc attaatatca cctggttaca ggtttgtatc aaatcaagat    162420
     tatggctgat tgtaataatc tgttggggta acgtgtttac aatctcagac agtctattga    162480
     agctcataag atccaaatat gttgttggct catcaaacac caaaaccttg ggttttgtga    162540
     caagaatcgt cgccagggca accatttgtt tttcaccgcc gctcagctgg tacgtgttac    162600
     gccctaacaa attctgtatt ccaagcatca cggagacctc ttctatggcg gactcgatgt    162660
     tttgaatccc catgtttttc agtccaaact tcagatcttc tcgcacctct ggcatgacaa    162720
     gttgggtttg tggattctga aatacgaacc caaccatccg cctaatttgt tttacggttt    162780
     tcttatttac ctcaatcccg tcaaccttga cacatccatt agacggaaag tgtaggccat    162840
     ttataagcct cacaagggtg ctcttaccag agccatttac acctattatg ccaatcctgt    162900
     gcgcactgaa caccaggttt atctctcgca gaattttaca atcgtcaatt tctaggctta    162960
     cattactgaa ttctatggct atcatactgg tgacccttcc acaatttttg ggcaactggg    163020
     ttgctatatc tctaaatatg gtacaatgca ggaaacgcgt ttagagcctc gtagctgtgt    163080
     ggcccgcgcg gtttttttgt ttcgccgttg agctgtgtga aaccgtggag gtgtgttttg    163140
     gggcgctatg tcttgttccg gctcctgcag tttgttccgg tgttcgttgg tgcgacattc    163200
     ctgatttatc ttcttgtatt tctcatgcct ggggatccca ttgctgcact tttcggcgat    163260
     aaaaggccgt cgcctgatgt tgttgcggca attcgtgagc agtacaacct tgataaaccg    163320
     ttcattgtcc aatatttcat ttggttttct ggcatactca cgggcaatat gggtgttaca    163380
     ttttctggcc agagtgtaac cgaggttctg ggcagtacaa ttccagtcag tgcgcaactt    163440
     gggtttatgg cccttgttat acaacttctt ctgggtcttt cggttggcct aatagctggg    163500
     ctgcggccgt atagattatt tgacacaacg agcactctgt tcttacttgc ccttgtttca    163560
     ataccatctt ttgtgctcgc atttttgctt cagtttttta taggaattca gcttcgtctt    163620
     ctgcctgtaa cggtcggtgg tgacaccagc ttttatcgaa tgcttctgcc cgcattctcg    163680
     ctcggacttc tcggtatggt tgggtatgcc cgagttttta ggggtgaaat cctcaaaacc    163740
     cgcgcacaag atttcgttaa tttcgcttac agtaaaggtc tctccaaagc ccgggttatt    163800
     ttcggtcata tagtccgcaa tagcctccta gttgttgtga ctctaattgg ttttgatttg    163860
     gcaggtctaa tcggcggtgc gattataact gaaggcatat tcaatgtccc aggggttggc    163920
     aatgtgttct accaggcgac aattcgcgga gagggtccaa cgattgtttc gttttctgca    163980
     gtttttgtaa ttgcctttat gcttgcgaat ctcttggttg atatcagtta ttcctacatc    164040
     gacccgagaa taaggctgtc tggaagaaaa taaagtgagc aataataaat cccttgatgg    164100
     ctatgccaat ccggtcgagc attatgttgc cccgtttgac gaggatgatt tttccgcacc    164160
     cccggataca tctgttggca gacgtgcttc caaactgcgc gatatatggg tttatctcag    164220
     gcgcaggttt gcattctggt tttctgtagt tgtgcttttt accctcaccc ttgctgctct    164280
     ttttccgggg ctatttacac gtgttccgcc gaacagcgat tgttatttga aaaattcgaa    164340
     cggcggacca acaggcgagc atattctcgg gtttacaaaa caggggtgcg atgtcttttc    164400
     tcgcatagtg catggcgcct cgacatccct atcggttggg ctacttaccc ttgcatttgc    164460
     tttggcaata ggggttacga tcggtgccct cgctggattt ttcggtggct gggttgatgc    164520
     aattatttcg agggctgctg atatattctt cgttattccg tttcttgttg ctgcaatcgt    164580
     tgttatgagt gcgttttcgt cattccgtag tgtttttaca attgcacttg ttcttgcagt    164640
     cttcggctgg cccgggacag cgcgtttggt aagaagtgag gtttatagag taaaaaacct    164700
     tgagtttgtt ttggccgctc attgcttggg tcaaagaaaa tggggtattt tgatgaaaca    164760
     tataatcccg aattccctaa gccctatcta ttcccttgcc gctatcagtg ttggttatgc    164820
     cattatctcc gagactgtgc tttcttttct tggccttggt cttccatcaa atgtgatgag    164880
     ttggggtaat gatatagcgt ctgcacagcc tgatttacgc aataacccca tgactctttt    164940
     ctggccctct ttggtcctgt ccgtcacggt acttgccttt acacttcttg gcgatgtaat    165000
     acgcaaagcc aataatccag ctgaaagatc caagggatga atacggttga gcccccactt    165060
     ctggatgtta gaaatctaca gatcgaattt tctacaccta cccgcgcaat aaaggccgtt    165120
     gatggcgtca gttttaccct tgaaaaaggt gacacgctcg ctattgtcgg tgagtcgggt    165180
     tctggaaagt caacccttgc acattctgta ataggtctct tgccgggtac gggaagaatc    165240
     accgaggggc aaataaatta tgccgggcgg gaccttgtaa agttgtccca gaaacagctc    165300
     gagggcgtcc gcggacataa tataggtttt gttccacagg acccgatgca gagccttaat    165360
     cctgttctgc gaatcggcgc tcaggtagag gaggccattc gcgcaaatgc gcttgcatca    165420
     gataataaag agatcagaaa gttggcaatc caggctctag agaatgcggg tttgcccaac    165480
     ccctctgaca gaatacgctc atatccgcac caactttcag gtggcatgca acaaagggtg    165540
     ttgatcggta tagcgctttc ctgtcaccca ggtcttctta tcgctgacga gccaacaagt    165600
     gcattggatg taacagttca gaaggttatc cttgatcaca tagctgagcg tacttcttct    165660
     ctcggcactg ccgttatgct gattacgcac gaccttgcct tagctgctga acgggcgagg    165720
     cgtcttctgg ttatgtacaa aggaaaagta gttgaactgg gttcatctga ggagattcta    165780
     aaaaaccctc gccatcctta taccaagaaa ttactgggcg cagctgcaag ggcacgacgc    165840
     tctcccctta ggtcgaaaga gcaagacact gcccctcctg cagttgttgt agacagtctg    165900
     gtaaaaagat atccaatacg gtcagggacc tttagtacct cacttcttac cgctgttgat    165960
     ggcgtgagct tttcgattcc cagcgggtct acggttgctc ttgtcggtga gtcgggttct    166020
     ggcaagtcca ctatcgcaaa gataattctt gggtttgaaa agccgacgcg ggggactgta    166080
     accatagccg gtgttaatac aagctcgcta tctgcatctg gcttgcgccg tatggctgcg    166140
     aggatccagc cggtatttca aaatccgtat ggcagcctgg atccgcttcg caatattgca    166200
     tcaattattt ctgagccttt gagtatccat aaggttggaa acagggccag ccgtaaagcc    166260
     cgcgttgtgg agcttcttga ccaagtcgca ctgccgcagt ttattgcgac tcgttatccc    166320
     ggtgagttgt ctggcggtca gcgccagagg gttgcaatag cccgtgctct agccctaaaa    166380
     ccagagataa tgattctaga tgaggcggtc agcgctctgg atgctcttgt tcagtcgcag    166440
     atcttagatc ttttggatag cttacagaaa cagctttcgg ttagttatct atttatcaca    166500
     catgatcttg ctgttgcacg ggctatctct gactttgtgt gtgttatgca ccagggcaag    166560
     ctggttgaac aaggcccggc tgagcgtatc ttcaacaatc cggagagtaa gtatacaagg    166620
     actcttttgg agtcgatacc tggacgcctg ttttcttggg gttgaagtgc attctgtgta    166680
     tagttagcct gttattcgtt tgccgcatgg ctgcgttatg tccgtattat gccgttggtc    166740
     tagcaagcgt ctgtgtagat gcaagagtgt atagacaaca cagcctgtaa gccatacagt    166800
     cacacactgc acaatcacac accgtacaag ctgtaacccg tgcggcacct actgctcaag    166860
     cgccgcagcg caacctgtaa ccccccgttg cgttacctgt aacacacacc tgcgcgactg    166920
     gtaactcgtg tgttgtgtta caggttactc cacacccgca acctgtaacc cccgttgtat    166980
     aacaggtaac ttattcagta aaacctgtag cccatccttc aagagttgta tacattacac    167040
     taaccacata taaagtcagg ccacatataa agtcaggctg tgatccagat cgccacatat    167100
     ccttcatgca actacgttgc ataactacct aagtgctggt aggagcagtg taccaagtgt    167160
     taatcctgtg actttacaag ataccagact cacaaccctt cacagatcta agagagctgc    167220
     cccaacacga tcatccggaa gcttcttggg cggcctacta ggtggtctag gcggactcct    167280
     gggtactaca gcatctctat ctgccacagc ccaatccatc gcacagcaag gcaccgcact    167340
     ccagtccaaa caagccaagg tttccttggt cttgcaggcg ccctactacc cactgcagta    167400
     acaacactgg ttagtatctg cccccataca atcacccaga tacttcgtgg gcgccctagg    167460
     cagtgccgca ggcagtgcca taaccaatat cctgggtgca tctctatcta accaagccac    167520
     aggtgtatct ataagtcaga gtagtataac tattacaccc agcgcaagag gttctctatc    167580
     tggctatata gctacgtcca taaatgtata cagatacacc cataaatgtt atatatggca    167640
     gatgctacat atgtctaagt atcagtgaat acctgagcca gataccaacc ccacaaccca    167700
     tcacagatct aagagagcca cccgcacacg atcacccaga agcatcttgg acaacctact    167760
     cggtagccta ggtggactcc tgggtactac accatctcta tctgccacag cgcaatccat    167820
     cgcactcaag tccacaacaa gccaaggttt ccttggtgct gttgcaaacg ccgtcctacc    167880
     tgccgcagta acaacactgg tttatgccta caatgactgt tatctatacc atgagtatga    167940
     agaagaatcc attaccccca ggccttaccc taaacacagg tacaacacca gagatgtact    168000
     gatttcacca cagagttacc tgtaacccca cccgcattac cggtaacccg taacagaatt    168060
     actggcaacc cccgccgtgt tacctgtaac tcacacctgc gcgacttgta atacagccgg    168120
     taaccacaaa catatatccg ggcatgtggt gggcaaagac catcacatgg ctgcacgata    168180
     cttcacacaa attcacaacc ccacaacccc tcacagatct aagagagctg ccaccaggca    168240
     atcatccgga ggcttcttgg gcaacctatt cagtggcata ggcggactcc tgggtactac    168300
     agcatctcta tctgccacag cccaatccat cgcacagcaa ggcaccgcac cccagtccaa    168360
     acaacccaag gtttccttgg tgctgttgca aacgccgtcc tacctgccgc agtaaccgac    168420
     gtggttagta gagccacccc acacgatcac ccagaggcct cttggacggc ctaggcagta    168480
     tcataggtgg attcgcaggc agtgccataa gcggtatcgt aggcggactc ctgggtagat    168540
     caccagaata tatggcatgt cataaccgta ggtgcatcta agtgcataaa ttcagcgaaa    168600
     caaacctata tacacccaca tacaacatag gaaaccccag aactctcaca acacaaacat    168660
     acacaagaac atactatggt ctaataatgc aggatattgc actagatgat gcaccaacca    168720
     actttcctgt caaagctata cctaactact atgactatag tttcaagaac aaactctctc    168780
     atcgagtaac cctgtggaac tacacaggca caacccgcat cccacccagg tacgtcccat    168840
     acagttactt tgtggaacta cacaggctct ggcagaggca cagtgccgtg gattgatgtg    168900
     catatctgga agagataata gatacacaac ctctcacaga tctaagagag ctgccacaca    168960
     atcacccaga ggcctcttgg acaacataat cggtggccta agcggagttg caggttatat    169020
     cgcgatcagt gccgcgaccg gtatcgcaaa ttacctcttt ggtacagcac catctctatc    169080
     tggtacagcc caatccatcg catagcaagg caccgcaccc cagtccaaac aacccaaggt    169140
     ctccttggtg ctgttgcagg cgccatccta cccaccgcag taaccgacgt gtaaactaac    169200
     tctataaacc aacgtggtta taaggtaaat catccggaag cttctttggc ggcatactcg    169260
     gtagcatagg cggattcttg ggtttatcac catctctatc tgccacagcc acaggtgtat    169320
     ctataggtca gagtaatata aacattccac ccaagtcaag aggttctcct atatcctctt    169380
     atacggttcc taatacaaca gaaacaagtc caactggatg ctgtatctgt aggtgtgcca    169440
     agtatcaatt atgtgacttc gactttgtca aatggcagta agacattcct ataccccaca    169500
     gatcaattaa cccaatcacc ttaactacat caccttaacc aagggtggag caggttattc    169560
     accaaaccca acatctgcac ccattactgt tatctatacc atgaacacgg gaggcaagaa    169620
     taccttaccc ccaggcctta ccctaaacac aagtacacag atgtactaac tgcagtaata    169680
     gagtaactgg taactcacaa ccggttacct gccacacgca catccgttac atgttaccca    169740
     tgtaactggt aaccccaggt gcaaccataa ccattgatac aacaacacct tatattaagg    169800
     caggtgatgg cagagatcat catatggcag cgtacctcac gcggctacac gacacttaga    169860
     ctgcaacaac ccttaacaga tctaagagag acaccaccag gcaatcatcc ggatacttct    169920
     ttggcagcat aatcaatggc ataggcaatg ccctaggcgg actcacaaac tccctctttg    169980
     gtacagcacc atctctatct gccacagccc aatccatcgc acagcaaggc accgcactca    170040
     agtccacaac aagccaaggt ctccttggtg ctgttggtgg cctcctaccc accgtagtaa    170100
     caagtctggt tgatgcctac aatgcttttt actctgcagc acataattca gatgcatgtt    170160
     atgactggaa aagctatgcc tatccagcag catctctata tgtcacagcc tcctcaagtc    170220
     cacaacaagc caaggtctcc ttggtcttgt tggcgccgtc ctacctgccg cagtaaccga    170280
     cgtggttagt agagccaccc cacacgatca cccagatacc tctttggcaa cataggcgct    170340
     gccatagccg gtgccctagg cggtatcgta accaatgccc taaccggact cgcaggcccc    170400
     ttcctggatc aacatacgac acaactaatc tctcagaatt acctgtaacc cccggtgtgt    170460
     tacgtgtaac tcctgcccgc attactggta acccgcaaca gagtaacctg taacccctgc    170520
     cagtgcaact tgtaatacag cccgtaatca caaacacata tccgagcaac atataccctg    170580
     gcaggttctg gcggaaacac tgtgccaagt atcagtgctg caacttcgac tgtaggtggc    170640
     acatacatat acctttacag ccctacaacc cctcacagat ctaagagagc taccaccaga    170700
     cgatcatccg gaagcttctt gggcagccta ctcggactcg taggctccct ctttggtaca    170760
     tctgcatctc tatatggcac atctctatct aaccaagcca aggtttcctt ggtggcctcc    170820
     tacccaccgt agtaacaagt ctggttgatg cctacaatgc tttttactct gcagcacata    170880
     attcagatgc atgttatgac tggaaaagct atgcctatcc agcagcatct ctatatgtca    170940
     cagggttacc tgtaaccccc ggtgtgttac gtgtaagctg taacacgcac ctgcgcgact    171000
     ggtaacatct ggtgccgtgt tacgtggtta cctgtgttgt gttacaggtt acctatacct    171060
     gcgcaacgtg taaccccggt gtgttacagg taactccaca cccgcaactg gtcacctgta    171120
     accccaggtg caaacactaa taagcccaac caccctaacc acatccagtc aaaaaacaga    171180
     caccgtaacc atcaatattg ataccagtaa cccttgatag aaccaatgga accacaacaa    171240
     catatatcca gacaggtaac gacataaccc tacctatggg cgctgcagtg tatgttatgg    171300
     aattgtttat tgttgaattg cacagttacg tatattggct acaccataca accaaaggaa    171360
     ccataacagg aaccatacaa ggaagcatag atacaggtgt tagccaaggt atatatacag    171420
     tagtagtaac tgccactgca tcatcaacaa ctgttactgc tgtatatacc cttgtgctaa    171480
     gtagtatgaa attcttccaa agggtcaaat actatataac caagccattc aaagccatat    171540
     acagttggtt ctctcacact tgcaccccag tccaccacac aacaagccaa ggtttccttg    171600
     gtgctgccgg cgccgtccta cctaccgcag taacaacact ggtcagtatc tacccccaca    171660
     caatcatccg gatactcctg ggacaaccta agcaatatcg tagccggtat taacatcgtg    171720
     gttacgatat acccacgctg ccgcccttgt cccctgatgc tactgttacc gccatcctta    171780
     ttacctttgc cagtcatcct taccaggtct ccttggtggt cttgcaggcg ccgtcctacc    171840
     taccgcagta accagtaatt accgtggtca gtaggggtcg gagagagcta attggtctat    171900
     tgaaagtaat acagcgtgaa gtatgacaca aataacagag aacaactaac aataagcagc    171960
     gcgatattca gtgtattata cgatcttgag atcaacctgg tgtctatttc ggcgcccatc    172020
     tctgtgccca cctctgggga cgatattgca gaggtgcagc ctctcggtat ttcgctgtgg    172080
     ctaatgctga gctgcaatgg atttttctgc aacggatctt tttcaggggc attgtgtttg    172140
     ttgcattcat gcccgcctcc atactgcccc ttttcccgtt ctttttcatc atccaaccgg    172200
     atcgttcctg ccctcagatt agggtggatt tccgaggaat acgtttgccc agactgactg    172260
     acaggaatta tttcactcca ttcaccgctc agtctggcct cctgaatttc tgactctaac    172320
     agtcttcctc tttttataat tccccagcag gagatgactt tgccactctt tagcttcaag    172380
     gtcaacatgg gcgctgccag cacttcttct atatcatcga agggaagcct caactctcgc    172440
     actggcccta caacgcgcaa atactcctgg tgtacttcca gttttggaga ggcaaaaagc    172500
     acgtaaaacg gaaggcatga acatacacac agaataagag caagcagcgc atactgccat    172560
     tcggttgcga ttagggacag gataacaaac ataacagaca ggcaaagcgt gaaaaagaat    172620
     ataacaaggc actgcctgga gcgtatggtt tttatcggtc tattcatgcg tttgttcgtg    172680
     cgtaactaat tcctctccaa agcttacccc ttactgtttc gatatgtgca ctaacgatgt    172740
     attgcaccgc cccacacgat catccagagg cctcttggaa ggcctactcg gtggcataag    172800
     caatggccta ggctccctcc tgggcacagc agcatctcta tctagtacag ccacaggtgt    172860
     atctataggt cagagtacta taactattac acccaacgca agaggttctc caaccagtta    172920
     tatagctaca cctacaggtg ctacatcagg tggagctaat gccgcatctg gcatatgtta    172980
     cacaaatgtt acatatgtct aagtatcagt gcatacctga gcacgatacc aacctcacac    173040
     agatctaaga gagctgcccg cacacgatca cccagaggct tctgggacaa cctaggcaat    173100
     gccctaagca atatcgcagg cggacttctg ggctccagta ctacaccatc tctatatggc    173160
     acagcctcaa gtccacaaca acccaaggca tccttgcagg tcttgcaaac gccgtcctac    173220
     ccactcaagt aaccagtctg gttagtaggg gagtactgta actattacac ccaagtcaaa    173280
     aggtgcccct ttatccggtt atatagctac acctacagat gctacatatg gcatatatga    173340
     catatatcta agtatcagtg catacttgag caagacttac aacctctcac agatctaaga    173400
     gagctgcccg cacacgatca cccagaaaca tctttggcga cctgctaggt ggcataggca    173460
     atgccctaag cggattcaca ggcagcctcg taaactcctt cttggatcca catcaaccac    173520
     ccagttaccc catacaccta acacaggctc tggcaatggt ggtgtggtac ggattacact    173580
     gtgctgtgga ttaatggaca ggttgcgggt ggcatatccc ctgtaccaag tgtttatggt    173640
     gtgaccaagt gttagtcctg tgacttcgtc aaatggcggc gagaaatatg tatggcgaga    173700
     aatatgtatg gcgagaaata tgtatggcga gaaatatgta tggcacagta tcagtgccac    173760
     ggaggtaaat ggcatattct tatacccaac aaatgtacta accgtgctaa tacagtgcgg    173820
     accaggttat ccatcacaga agtaatctag acaatccacc cgcacacgat cacccagagg    173880
     cctctttgac ggcctactcg atggcctaag cggactcctg ggtggatctg catctctatc    173940
     tgccacagct tcccgcagta acaacactgg ttagtagagc cacccctaca cgatcatcca    174000
     gaggcctctt ggacaaccta ggcagtgccc taggctccct ctttggtaca gcagcatctc    174060
     tatctaacca agccattcaa agctatatac agttggttct ctcacacttg caccccagtc    174120
     caccacacaa caagccaagg tctccttggt cttgttgcag gcgccgtcct acccaccgca    174180
     gtaacaacac tggtcaacaa ccgtggttag tatctgcccc caggcaatca tccggatact    174240
     cctggggcga cctattcggc aacataacca gtgccgcagc cggtgccata accagtgccc    174300
     taagtggact cgcaaactcc ttcttgggct ccagtaccac accatctcta tctgccacag    174360
     cctcctcaag tccaccacac aacaagccaa ggtctccttg gtcttgttgc aggcgccgtc    174420
     ctacctgccg cagtaaccga cgtggtatct aatctgctgg gtaatctaac agacacatca    174480
     ctaaccacgc acacccacac agcacacccg cacaaatgct aacggtataa ctgtcataag    174540
     cgcttaccat ggcactgtgc caagtgtcac gcacttccac gagttaaatg tgtcatgagt    174600
     tactgcacct gcctattctt cccctgctac aacccttact agcacaattg ttattgctgc    174660
     ggtactagct gcaacaacct ctcacagatc taagagagct gcccccatac gatcacccag    174720
     aggcttctgg gatagcatta ccagtggcct aggctccatc tttggtggat ctgcatttct    174780
     atgtggcaca tctctatcta accaagccac aggtctacct aaaggactaa cccttaattc    174840
     ctctggaacc ataacaggaa gtatagatac aggtgttagc caaggtatat atacagtagt    174900
     agtaactgcc actgcatcaa aaacatcaat tgttagtgca acatataccc ttcttgttac    174960
     cagtactaca ccatctctat ctggtacaac catggactgt ctaacagtag gtgcgggtaa    175020
     gtgtatagac aaacagaacc gactgcagta acagggttac ctgtaaccca tacctgcgtt    175080
     accggtaaac cgtaaccaca aacatatatc agagcaggtt ctggcagagt acagtgcaac    175140
     acgtgacaca cccacacagt taccctgtgg aactacacat ctgctggtgc gggtggtgtg    175200
     ccaagtatca gtgcatacct gagcaagata ccagactcac acagatctaa gagagctgcc    175260
     accaggcaat catccggcag catctttggc aacctactca gtggcataag cagtgtcctg    175320
     ggcaatatcg taaccaaggg caatatcgta gccggactcg aagactccat cctggatctg    175380
     catacgacac aactaatctc tcaggtctaa cctgtaacct ataccagcac aacccgttac    175440
     ctgtcacaca tacctgcgta actggtaccc gcttgtgttg tgttacgtgg ttacctgtgg    175500
     tgcgcaacct gtaacctctg cccgcattac tggtaacccg taaccgtgtt acctgtaacc    175560
     cccggggtgt tacctgtaac ccttaccagc aagacttgta atacagcccg taatcacaaa    175620
     catatatccg ggcatgtgct ggcagagcaa cacacacggc tgcacgatac ttcacacaaa    175680
     tttacaaccc ctgcaacctc tcacagatct aagagagctg caaccacacg atcacccagg    175740
     aggcatcttt ggcagcataa tcgatggcat agccggtatt aacatcgtgg ttacgatata    175800
     cccacgctgc cggccttgtc cccctgatgc tactgttacc gccatcctac ctaccgcagt    175860
     aacaagtctg gttagtatct gcccccacac gatcatccgg cagcatcttt ggcaacctac    175920
     tcagtggcat aagcagtgtc ctgggcaata tcgtaaccaa gggcaatatc gtagccggac    175980
     tcgaagactc catctttggt ggatccgcat ctctatatgg cacagagtaa tccatcgcac    176040
     cccagtccac cacacaacaa cccaaggcat ccttgcaggt cttgcaaacg ccgtcctacc    176100
     taccgcagta acaagtctgg tcaacaaccg tggttagtat ctgccaccac acaatcatcc    176160
     ggaggcctct ttgacggcct actcagtggc ctaggctccc tctttggtac atctctatct    176220
     atcacagcgc aacctgtaac ccctgctatg taacctgtaa cctatactgt gcaacccatt    176280
     acatgtaaca cataggcatt ggcacaacca taaccatata cacaacaaca cctgtcagct    176340
     tatctgtaac aggttttata accggttaca caataagccc aaccacccca accacagaca    176400
     gtaacaccgt aaccatcaat attgatacca gtaacccttg acagaaccaa tggaaccata    176460
     acaggaagta tagatacagg tgttaggaca gattactgtt aacacggatt acactgtgtc    176520
     aagtatcagt ggcacacctg acccaaatgg cacaaacact gtgccaagta ttaatgctgt    176580
     gacttcgcgt ggagcaaatg gcagtggcac atacacaccc ttacgcaata aacccaacca    176640
     ccccaacaga cacatccagt caaaaaaccc acaccgtaac catcaatatt gataaaacca    176700
     atggcaatat aacaatcacc ccaagtattg tgcctggaac atatacagta actattactg    176760
     caactgcacc ttcctatact tcctctgcta caacccttac tagtacaagt gttagtgctg    176820
     cagtatcagt tgtacaatgt acacctaaca taagtgctgg caagggtgat gtgccaagtg    176880
     ttactgctgt gccatggata acactgtgac acagcatcag tggcacgttt ggctcaaatg    176940
     acacatatcc tgtgccaagt atttatcctg tgactttgac tgtaaatggc ggtaagacac    177000
     cacccccaca caatccccaa gatacttctt ggatagccta gccgatggca taggcagtgc    177060
     catagccggt gccataagca gtgtcctggg caatatcgta accaagggca atatcacagg    177120
     cggactctca aactccatcc tgggctccag taccacacca tctctatatg gcacagagta    177180
     acctgtaact gtgtaacctg taacctctgc cagcgcgact ggtaaccgtg ttacatgtaa    177240
     ctcaccccag cacaacccgt tacgtacaac ccctgccagc gcgacttgta accgcttgtg    177300
     tgttacaggt tactccacac ccgtaagcgg taacccccgg tgtgttactg ccggtcttat    177360
     cccctgatgt tactgttacc gccatcctta ttaccctgcc agtcaccctt gccggtcttg    177420
     caggcaccgt cctacccgcc gcagtaacaa cactgccccc gctagtgtta caagaccttt    177480
     gctgacctta cccctgttat gggtatccgc gccgctgtgt atatctgtgt cacagtgtat    177540
     atcacactgc agtaaccata ccaagtgcca caattagcac tgttacctcc actgtcactg    177600
     ccgaccctat cccctgatgc tactgttact gccatcctta ttacccttgc aggtcaccct    177660
     taccaggtct ccttgcaggt tttgcaggcg ccctcctacc cgccgcagta acaacactgg    177720
     ttagtatcca ccccccacac aatcatccgg atactcctgg ggcaacctag ccggtgccat    177780
     aggcggtatc gtaagcgaac tcgtaaactc cctcctgggc tccagcacca tctctatcta    177840
     gtacagcgca acctgtaacc gtgtaacctg taacccacac ccgcgagacc tatggcgtat    177900
     gagctgcatg acctgtaacc cctgcctgtg ttacatgcaa ctccacaccc gtaacgttgt    177960
     gttgcatacc cgtgcgcgca acagagttac tggcaacctc cggtgcgtaa cctgtaacct    178020
     atctctgcac cgacctgtaa cgccccggtg tcactgcagg ccttatcctc tgatgttacc    178080
     cttaccagtc atccttgcca ccgccctcct acctgccgca gtaacaacac tggttaatgc    178140
     ctacagtgct ttttactctg cagtatgaag ttttagacac acctctaaaa tgacacacaa    178200
     tctgtcactc agatagactt tactcgcatt tgtaaatcac gtaacatgcg atagaatcct    178260
     caagcagcgc ttttcgattg gggattgatg tcttctaagc agtgggtttt ggttgacgcc    178320
     aaggatatgg ttttgggccg tcttgccacc caggttgcag ttttgctgcg gggcaaacac    178380
     aggcccactt acgagcctca tcttgacaca ggtgactgtg tcattgtagt gaatgccgct    178440
     cttatccgcg tgacttcgaa taagcatgct aaaaaagttt tctacactca ctccgggtat    178500
     ccgggtggac tgaaaaaacg tggcttttct gatgtatttc aaaaaagccc ggagagggtt    178560
     ctggaaaaag ctgttaaggg gatgttgcca aaaaacaaac ttggcagatc ggtttttcgc    178620
     aacctccggg tctatcccgg gcaggatcat ccgcatgccg cgcagaagcc atctgtctat    178680
     gcacctacta gggttgcgca ggtgctcgtc tgatggtacc cccacagagg gcaaaaaacg    178740
     atacctcatc tgccccggac tccgcggcag agactcgcgg gcctcttgtt tcctccggtt    178800
     cgggtctggg gcgccgtaag agtgcaacag ccagggttta cctctctccc ggtgagggtg    178860
     tctttgttgt gaacggtcgc gatatcaacg agtattttac gagcaaattg cataggcagt    178920
     ttgcctgtca acccctgaaa attctggact tattgggtag ctacgatgtt aaggttaccc    178980
     tccacggcgg cggcgcttcc ggacaggctg gtgccgtgcg gttgggcatc gccagggcac    179040
     tgaacacaat cgaccctgag aataacagga agcccctcaa gtctgccggt tttctaaccc    179100
     gtgacagtcg ggtgaaagag cgcaaaaaag ccggcctgaa aaaggcccgc aaggcacctc    179160
     agtattcgaa gcgttagata ttggccaggc tgtttggaac agatggcata cgggcgctgg    179220
     caaatggtga tttgctcacc ccagaactgg ccatggccgt cgcccgcgcc gccgccgtcg    179280
     tctttaccca tggccgcgtt gcaaaaagaa ggcaggtctt aggcaagcga ccggtagcta    179340
     ttgttgcgcg cgatcccagg atatcgggtg attttttggt agcggcaatt tccgcgggtc    179400
     ttgccagctc tggggtagat gttctcgacg ctggggttat tccaactcca gccgtagcct    179460
     ttttggtaaa aaacgcaaat gctgactttg gatttatgat atccgcatct cacaacccgg    179520
     gttacgacaa tggtgtaaag atatttgccc atggtggggt gaaactgccc gatgtagttg    179580
     aagaccgcat tgaatatttc ctggataaac agaaactgtc accgattggt tcaaaggttg    179640
     gccggataac acgttttgtt gatgcagagg atcgatacca aatgcattta ctgtcaacct    179700
     tgttcaccag aatagacggc gtgaaagtag taatagattg tgccaatggc gcagcgtctg    179760
     gtgtttcacc agatgtattt aagtctgctg gtgctgcggt gaaggttatt tgcgcagacc    179820
     cgaacggcgt taacataaac gatggtgttg gctcggcata cccagaaaga cttagggcag    179880
     aagttattcg taactccgcc actctcggcc ttgcttttga cggcgatgct gatcgctgca    179940
     tcgcggttga ttcaaacggc aacacggtcg acggggatca gataatggca attttggcca    180000
     gatcaatgca acagcgcggc acactacgga ataaaaccct cgttacaacc attatgagca    180060
     atattggcct tgatcgcgcc atgaaaaaac tcggtatcaa ccttaaaaga acgcaggttg    180120
     gcgatagata cgtcattgag gccatgaccc aagggggatt caatattggc ggggagcaaa    180180
     gcggccatat aatcctatct gattattcaa ccgccggtga cggcattctt gcgggcctgc    180240
     atctatgtgc ggaaatcatt cgaaccggta aaagcttgac ggatctagct agcatcatgg    180300
     agattgtccc gcaggtcacg gcaaacatag aaacagatga tccaacaacc ctgctgaaca    180360
     acaaaaaaat tcgccatgag atatcacgca ttgaaaaatc tctaaagggt agagttgtaa    180420
     ttcgtccaag tggcacagaa cctcttatcc gtattatggt cgaggattta aatccggaga    180480
     aagcggagcg cgcctgctcg catttagcag attttttcaa acaggaaatc cagaagagct    180540
     agcttcattt ctgtaaagtg tcattttatg tctcggattt ttatacacaa taaagtctgc    180600
     cgtatgtttc actggcaaaa tattttccgt gaagtttttt cggtttacgt cgcgccaaac    180660
     ttgttttagc atttttatac actgtcttct ggggagattc gcatactttc gaaaatatgt    180720
     gtttttctca tgttgcgccc tcagttcaaa aaatcttttt acataccatt tgaatacaga    180780
     tctcttcggt gcttcaatat aaatacccag gtcaaccact gtttttaccg gatgccgcat    180840
     aacgtttagc ccttcaatga ttaatatttc cggcttatta acagttttta tcacccccgt    180900
     tacatcatgg atcggatgtg catactgtct tatcccaatc gtttttgccc cagctttaat    180960
     attttttaca agtgatgcga ggtgtgcggt atcatacgac tcaggaaatc cctttttaag    181020
     catcagcccc ttttgctcca ggattttatt tggatacaaa tatccgtcag ttgatataac    181080
     ctcaacactt atcccatcca acattttggc tagatcgctt gcgagtgtag atttaccagc    181140
     agcaacagaa cctgttatgc caatgataaa acttttgcca acctttcctc tttccctaac    181200
     cctctttcgt atatccttta gcatttcggt atacgttttt gttatatctt tcttgaacac    181260
     ttcaattccc aaataactct ttcatataaa ttcatatcta atagatttga acatatgtct    181320
     gagtgtatgt tattattgaa gcgcatctct ctctactgca ggtgtgtttg cacctcgcag    181380
     gtgtgtcaca aaacttaata cgtataacct taatacgtat aacaaacata cacaaccgtg    181440
     tatgtagtaa acacatgtgt aacgaacata tgttgtacat acatgtatca cagtacatac    181500
     atgtattaca tatgtgactt acatatgtaa tacaacaaat acgaataaca aacaaataca    181560
     tgtgcaaaca tgtattacaa aacaaacata aaacataagg ggacggaaag ataaggacct    181620
     tacgtattgt tataacaatc attcataaca acacgtagaa ctgaaagatt ggggcgcgtc    181680
     ggcttataca gaggtcgggg tgattctcat atctatatga gaatcacata ccaatagact    181740
     gtgctataat agttatgctg tgtaattaac aacactgtgt aattaacaca tttactgaat    181800
     aacactgtaa tatttatctc tgcagtgtta agagagagaa caaataacat gtatatgaaa    181860
     aaacaatata gacaccctct ctcttacctc accaaagcct ttaccttact attaaccctt    181920
     ctcctcctat catccctaca atatgaaaca gcctttgcca gacagacacc tcctgcccta    181980
     tccctcctat catctgtttc atctacatct gtttcatcta ataccaaata cacaagagta    182040
     agtaatacaa atacacaaga agtatgtgta acaactaaca caaatgtatc tctcctaata    182100
     gatcctgtta caagcagtac aaaacaaacc ctgtcctgca ccccatctct ctcaccccaa    182160
     ccacagacac atatatatgt cccatacaca gatacatcct catacctata tgtcccatat    182220
     ataaccaaca cacatatatc cctctattac acagataaga aagcagatcc atcatctttc    182280
     ctaaccttcc ctcatacaga catagcaacc ccatacggag atgagaaagt agtctccata    182340
     acaaagacaa caaccaatct catagctctc ctaacaaccc gtaacatctt cttctttgac    182400
     atacatgtaa cagagaaacc aaagataact gttcccatac acaaacagat agataacaca    182460
     tatctctcag acataccatc actcagaaac tccagataca ccttctctct aacacaccca    182520
     aacaaagaca taaccataga tagatacacc ggacagatac atctctcatc cctaccaaca    182580
     tctcccataa cagccatagc cataaacaaa gacacaagca cccatatcac ctatgcaata    182640
     gatacacaca accccacaac ccataacaga tctaagagag ctgcccccag gcaatcatcc    182700
     ggatactcct ggggcgacct attcggcaac ataaccagtg ccgcagccgg tgccataacc    182760
     agtgccctaa gtggactcgc aaactccttc ttgggctcca gtaccacacc atctctatct    182820
     agtacagcca caggtgtatc tataggtcag agtactataa ctattacacc caacgcaaga    182880
     ggttctccaa ccagttatat agctacacct acaggtgcta catcaggtgg agctaatgcc    182940
     gcaggtctac ctaaaggact aacccttaat tcctctggaa ccataacagg aagtatagat    183000
     acaggtgtta gccaaggtat atatacagta gtagtaactg ccactgcatc aaaaacatca    183060
     attgttagtg caacatatac ccttcttgtt accagtacta caccatctct atctggtaca    183120
     accataacca tatacacaac aacacctgtc agcttatctg taacaggttt tataaccggt    183180
     tacgcaataa acccaaccac cccaacagac acatccagtc aaaaaaccca caccgtaacc    183240
     atcaatattg ataaaaccaa tggcaatata acaatcaccc caagtattgt gcctggaaca    183300
     tatacagtaa ctattactgc aactgcacct tcctatactt cctctgctac aacccttact    183360
     agcacaattg ttattgctgt atataccctt gtgctaagta gtatgaaatt cttccaaagg    183420
     gtcaaatact atataaccaa gccattcaaa gccatataca gttggttctc tcacacttgc    183480
     accccagtcc accacacaac aagccaaggt ttccttggtg ctgccaccgc cctcctacct    183540
     gccgcagtaa caagtctggt tgatgcctac aatgcttttt actctgcagc acataattca    183600
     gatgcatgtt atgactggaa aagctatgcc tatccagtag catctctata tgggcaagtt    183660
     ggcattaagg ccttgtatag aaagatatct gcccatttac ctagtttttc tggctggggt    183720
     ggtaagtttt tccgagcttt tatgtctgct gtttctgttg gagctgttta cttcttgccg    183780
     ttttatcttt atggtaaatt agtcaaaaag ccagcttcat cctccggttc gggatctaat    183840
     tcaaataatt caagtttgtc aggtattatt cgtaattatt tcactggtaa ttggcgaacg    183900
     cttttgccag ggttgtttgc cccagctttg actttgttaa ctttatggtt ctagggtgtt    183960
     ttattatgaa tttagatttt tccgtgcggt tttaatgtga aaccgcacgg aaaaattttt    184020
     tttagggttt ccatttatct agctcggtaa gtggaatgct tctgttagca gaataaatcc    184080
     ggaaattcgt ctatttttgg ttatgtgtga agctctgttc gcttacaata aagaaattac    184140
     aaaaatctga acaaccaaga tgatacactg aagttccatg tgtgggatca ttggttattc    184200
     tggcccgcgc cctgcggcag aggttctgtt aaaaggctta gagcgccttg aatacagggg    184260
     ctacgattct gcaggtatcg cggttgtaac agataaagct tatattgaga gcgtaaagaa    184320
     atccggaaag cttaatgtcc taaaaacatg ccttgaaagg cgcacaacac ccattgttgg    184380
     gtctacagga attggccata cgcgatgggc aacccacggc gaacccagtg atagaaatgc    184440
     gcatccacat atggatacag aacagagctt agcaatagtt cacaacggga tcatagaaaa    184500
     cagcgatgtt ttaaaaaggg aactacttgc gtcgggaaaa agcttcacaa gtgaaacaga    184560
     cacagaggtc gttgcgcatt tactgtctga cgcttttaag aaaacacaag atctggttca    184620
     agcatttgta gaagttacgc agcgactcga aggtgcgttt gcagttgttg caattcacaa    184680
     agatcagccg aataccattg ttgctgccaa aaataattca ccgctgctat taggatttgg    184740
     tcagggtgag aatttcctgg ccagtgatat tgctgcattt gcagaatata cacagcgtgt    184800
     ggcaaatatt gatcaagagc gaatagtcgc tctatcaggt gattctgttt acataactga    184860
     ttttgctggg caccctgtcg attatgaagt acataccgta agctggcatc cggcatctgt    184920
     tgatagttcc ggctggtcat cttttatgct taaagagatc tttgaagaac cacaagctgt    184980
     tgagaatacc ctgaaagggc gcacggagga tggcacagtc atcctgccag aatgtgatca    185040
     catccgggat gacctgcttg caatagatag ggtagtgctt gtgggctgcg gaacggccgc    185100
     ctacgcggca atgactgcta gttactctat cgaagcctgg gcaggtttac cagtgtctgt    185160
     tgagttaagc cacgaattta gataccgcga accggttctt aattcaaaaa ctttagctgt    185220
     atttataagt cagtccgggg aaaccatgga cagcctgatg gccgttcggt atgcgcggca    185280
     ggctggggtc aaaaccattt ctgtttgtaa tgtaatggac agttctattc caaaagaaag    185340
     tcatgctgtg atatatacca aagccggccc cgaagtagct gttgcgagta caaagtcttt    185400
     tgtctgtcaa attgttgttt tgtacttgtt ggcactatac cttggacagt tgcgtggctt    185460
     tcggtcgatt tttccaagac agaaagcggt ttgcgagtta aatcgcttgc cggtaaaact    185520
     gaaacaggtt ctggagattt atgaaagtgt tcgtcagctt gcgcattgga tgagcgattc    185580
     tcgctcaatt ctgtttttag gtcgacatgc aggctatccg attgcactag aagcagcact    185640
     gaagctaaaa gagctcgcgt atatacatgc tgagggattt gctgccggtg agctgaaaca    185700
     cggcccgatt gccttgattg agccgggaca gccagttttt gtaatagttc catcaccggt    185760
     tggttcgcca attttgcacg cgaaggttat ttcgaatatt cgagaaataa aatcccgtgg    185820
     tgctaggatc attgctattg ccgcagaggg cgactcggct gttttaccac acgctgatag    185880
     cgttttgagg ataccgctta cgcgttacag ttttgagcca cttttatcta tagtacccct    185940
     gcagatcttt gcccttgagc tagccgctga taaggggttt gatgtcgatc gccccagaaa    186000
     tctggccaaa agcgttacag ttgagtgaac cttgccccta ttcgagaaat aaaatcccca    186060
     tcattgctat tgctgcagag ggcgactcgg ctgttttacc acgcgctgat agccttatcc    186120
     cctgatgtta ctgttaccgc catccttatt accctgccag tcacccttgc cggtcttgca    186180
     ggcaccgtcc tacccgccgc agtaacaaca ctgcccccgc tagtgttaca agacctttgc    186240
     tgaccttacc cctgttatgg gtatccgcgc cgctgtgtat atctgtgtca cagtgtatat    186300
     cacactgcag taaccatacc aagtgccaca attagcactg ttacctccac tgtcactgat    186360
     agcgttttga ggataccgct tacgcgttac agttttgagc cacttttatc tatagtaccc    186420
     ctgcagatct ttgcccttga gctagccgct gataaggggt tcggacacct tctgtgtgtg    186480
     cgcctgtacg tgcgggtcat tcgtgtttgt gaatgtatga gccgccaggg ttgcactgcc    186540
     ccaacacaat cacccagata cctcttggac agcctaggca gtgccatagg caatacccta    186600
     ggcggattcc tggatccaca tacgacacag agttacctgt cacccctgcc tgcattactg    186660
     gtaactcgtg tgttgtgtta caggttactc cacacccgca agcggtaacc ctcgttgcgt    186720
     gacatgtcac ctctgttgtg ttacctgcaa cctataccag cgcgacttgt aatacgatca    186780
     cccagagacc cactcagtga cctaggcaat accctagccg ggactcacaa actccctctt    186840
     tggtacagca ccatctctat ctgccacagc ccaatccatc gcacagcaag gcaccgcact    186900
     caagtccaca acaagccaag gtctccttgg tgctgttggt ggcctcctac ccaccgtagt    186960
     aaccgacgcg taaactagcc ctataaacca acgtggttat aaggtaaatc atccggaagc    187020
     ttctttggcg gcatactcgg tagcataggc ggattcttgg gtttatcacc atctctatct    187080
     agtacagcca caggtgtatc tataggtcag agtactataa ctattccacc caacgcaaga    187140
     ggttctccta tatccagtta tacagctaca cccataaatg ttacatatgg cagatgctac    187200
     atcaggtgga actggtgcta caggtctacc taaaggacta acccttgata aaaccaatgg    187260
     caatataaca atcaccccaa gtattgtgcc aggaacatat acagtaacta ttactgcaac    187320
     tgcaccttcc tatacttccc cctctacaac ccttggtagc acaactgtta gtgcaacata    187380
     tacctttctt gttaccagca ctacaccatc tctatctggc acaaccataa ccatatacac    187440
     aacaacacct gtcagcttat ctgtaacagg ttttataacc ggttacacaa taagcccaac    187500
     caccccaaca gacacatcca gtcaaaaaac cgtaaccatt acagagcaac atgtaaccat    187560
     aacaacatat atccagacag gtaacgacat aaccctacct atgggcgctg cagtgtatgt    187620
     tatggaattg tttattgttg aattgtacag ttacgtatat tggctacacc atacaaccaa    187680
     aggaaccata acaggaacca taacaggaag tatagatacg agtgttagta cgggcacaga    187740
     agtatccagc atacccagtt tctaaacttt taccgataaa cacgtaagga gaaacacgaa    187800
     gcgctccgcc tctaggattc gaacctagac caacagctcc aaaggctgct gtgctgccgt    187860
     tacactaaag cggattatta cgtctgccag tatatactcg aatacgccgg agatgatact    187920
     gctttgcaga taacacccgt gtctttcagg atactgcatg ccctattagc cgcctctgcg    187980
     tcttctgcca acagggcaag ggtcggtccg gatccgctta tgattgctcg cagaatccca    188040
     gggcatcttt ctgctgcttt gatccgctct gcaatttctg gcataagcat ctttgcggcg    188100
     cttgtaagat cattatgcaa aagagctgct agcgcttctg gccctctttt tattgccttt    188160
     tttagcattt ctgcacactc tgctgggttg gaaaaaacag ggtgatgatt gcatccggca    188220
     ccactgcgct gtcgatcgag ctcttgaaat accttgcgag tggatagagg atgctttgaa    188280
     aagcataaaa cccagtacag agtttgtgtt tcaaaaaaag tcacacatga accggttccg    188340
     cttccatagg cagccccacc ccagattaaa aagggtacat ctgcaccgag tgcacctgcc    188400
     tttcctagca aatcacatct agaataattt gtttgccatg cactgtttat cccaagcaag    188460
     accgctgcag cgtcagctga accccccgcc agaccagcgg caaccggaat attcttctca    188520
     atcgaaatac gcgtactggg taaaatatgt gtattttgaa gatctatatc cttagatagt    188580
     aaaagggctg cacgcatcgc gagatcatcc attggattca agacgggatt tcggccgttt    188640
     gcgtattcta tttgtatcgg gaattgctct gtatttgata cattcagcgg taaaacatta    188700
     cgcatagcat ggtttgacac gtccgtaaaa cattgtgtgt gagggttttt tacgcatggg    188760
     tcttgtgtgc acccctgccc acctcgcagc attttgcacg cctgggcaat atccacacac    188820
     cccgtacaat ctgacccaat agcagcgata tttgactgtg tgcaaatgca gtgtattttg    188880
     ggacatggat gcacaacagg atggccatat ctgttagtat tcagcctgct agtgttcata    188940
     cagggattat cctgaccaga atgttctgtc aattcattta gatagaattc agattgatcc    189000
     gcatgcactg aatattcaga atgactaaaa ggttccccca tagtatttgc agtatttagt    189060
     ggcttgctat ggctggcgcg ccaagtatta ccaccatcgg ttttcatctc gcgggaccta    189120
     ttgtaagaat catcaagcgt aatgtttatg tgctcataaa gcgatatccc aagatatacg    189180
     gtaaaaagcc catgataccc atctggtcgc tttggtccaa ccaataagat tgggtttatt    189240
     tttcctggga cgcttactct ggttattttt tttatcatca tgcttttatg aatcggattg    189300
     taagtgattt gttattgata atttctgcat attttatttt gttgaatatt ttcacgtcta    189360
     attttgctga aaactatcaa caaaaacaag ctgcccccaa cgatcaccca gaggcatctg    189420
     gggcggccta ctcggtggcc tagccggtgg cctaagcggt atcgtaggtt ccgcagtaac    189480
     aagtctggtt agtaggggag tactataact attacaccca agacaagagg tgccccttta    189540
     tccagttata tagctatacc cataaatgtt atatatggca gatgttacac ctgtaggtgt    189600
     atcaagtatt aatgcatacc tgagcaagac ttacaacctc tcacagatct aagagagctg    189660
     cccccacacg atcatccggc agcatcttgg gcaacctact cagtggcata ggctcattct    189720
     ttggtggatc cgcatttcta tatggcacag cgcaacctgt aacccctgct atgtaacctg    189780
     taacctatac tgtgcaaccc attacatgta acacataggc attggcacaa ccataaccat    189840
     atacacaaca acacctgtca gcttatctgt aacaggtttt ataaccggtt acacaataaa    189900
     cccaaccacc ccaaccacag acagtaacac cgtaaccatc aatattgata ccagtaaccc    189960
     ttgattcctc tggaaccata acaggaagta tagatacgag tgttacacct ggagagtata    190020
     aagtaagctt ttatgctttt gctgcacctg ttgaagcccg tgttactgct taccggcttt    190080
     gccatcgcag tagtaattac tgtgtaataa acaaccaaag caatgactgt tatctatacc    190140
     accggcagag ggcaatcctt accctcaggc cttaccctaa acacaggtac aacaccagag    190200
     atacactgac ttcaccacag agctacctgt aacccctgcc tgtgtgcaac cggttacccc    190260
     acacccgcga cctgtaacac acacagagtt atatgtaacc cccggtgcac aactggtaac    190320
     ccataaccac aacaaccata tatcaacgca ggttctagca caacacatca cacagctacc    190380
     ctgacataca agccatatag taacttctct accactgcta gccgtactat atatctacct    190440
     gcaccaaccc gtttgccttg tgttaccggt aacccataac ccaacaaccc tgtataacta    190500
     cacaggcgcc gcccgggtgg tgcgccaagt atcagggaag tgcctgtgcc tttgccaggt    190560
     ggcagagaga catttacagc cacagtatca gtgccacgcc tgacccaaat gacacatgtt    190620
     gccaagtgtt actgctgtgc cttcgacttt gtcaaatgac agtaacactg tgctggcaca    190680
     aacactgtgc tgtggatcag tgacacagca tcagcgcaac acgtaacata gttagcaaca    190740
     cataacacat ttacccatta ccctgtggaa ctacacatct gatggcacaa acactgtgct    190800
     gtggattaat ggacaggttg cgggtggcaa attcactgcc aagtgtcagt gatgtgccaa    190860
     gtattcatgc tgtgacttcg actttgccaa atggcagaaa cactgcgcta tggatttatg    190920
     gggtgctaag tatcagtgcc acgcctgacc caggtggcaa attcactgcc aggtgttact    190980
     gctgtgccaa gtgttaatgc tgtatgtatg gatcagggtc agatggcagt gtcacagaca    191040
     cagccccaca agtgtactaa ccccaccaat gcactcacca agggcggatc aggttatgca    191100
     tcaaacccaa catctgcaaa ttattgtgcc agcggggtat atctgcaaaa cttagactgt    191160
     tacgaaacgg agatattaca ttaaaacatg aaagataacc atgacaggga aagaaaaaag    191220
     tggcgccggt atctacgcag agaaataacc gaggcgcgca tatacgaaat actcgcaacc    191280
     cgttttaaac aaaagcagat ctttctcgat cttgccaagg cagaaaagcg ccacgcacaa    191340
     cactggcgta acttgctcgg caacgagccg gacccaaaac caaaggattt cttgctgcgc    191400
     ctaatggcaa aatacggtag caaggtaatt gtattatcct ttctgcaaag agccgaagca    191460
     aaggcaccct atttcaggga tgtaaatgcc gttcatatgg cagcagatga aacaatacac    191520
     aaagaggtaa ttcgcgctgt tgctgcccca aacagacaaa gtatatccgg gcccttccgt    191580
     gcggccgttt ttggtataaa tgatggcctc gtctcgaata cagctttgat agtaacaatg    191640
     gcagttttta cagacaatat aaccctcctg ctcctcactg gatttggcgg tctcttgtcg    191700
     ggcagtctat caatggctgc tggtgaatat gtctctgtca caagtcaaaa agaactcata    191760
     aactccaaca cacctgaccc tgaaagttac aaagccctta gcaacctatc aatagatgca    191820
     aacgaactgt ctcttgtata ccgtgcaagg ggcatgactc ctgcccaagc tcagcatcgc    191880
     gccaaccgtg tccttgaaat agtgcgccac acagacaatc tccgccttca cgtgcccgat    191940
     ccaatcacat ccaacctgaa ccaacatcac tccaatacta caggtctacc aaacgatcat    192000
     aaccaagccc ttggcaaccc atggaccgct gccattacaa gttttatcct gtttgctaca    192060
     ggcgccctta tccctctctt gccattccta attccaattc ccattcatct tgctttacca    192120
     acctcactga ccctctttac tctctgtctt ttaataacag gtgcagtaat tgccctttta    192180
     tcaggatcaa acataatcgt caaagcctta cgacaactaa taataggtgc cttagcaacc    192240
     attctgacat ctatcctcac actctttttt ggtcaccact aagctttaac atgtgttcat    192300
     aacacgtgac acaattacgt gctaactgtg ttatgttcac ttatgattca aacactcaag    192360
     agtgttatat ccaggaaccc caaccacctc aggcacatat acatacacag ttacatatgg    192420
     aaccaccaca gcgttacatg taactcacac ctgtgtaacc cgtaaccgtg caacccgtaa    192480
     caggttttct gtaatgcaac atataacccc gccgtgttac atgttgcact gtgccgcgca    192540
     gggtggtacc cactacacag aataacctgt aacccgtaac agagttactg gcaacccccg    192600
     ccgtgttaca tgtaacgcac actgcgcaat ctgtaaccac atacacagtt acatatggaa    192660
     ctaccacaaa aaccacagga cttagatcaa atggtgtcta tacaggtgac tatctatccg    192720
     gtacatgtcg tgcctgttta ggaccacagg caattgccta tgtggtaaat tctcccaccc    192780
     ccgtctacac cacgacaact gctgtggcaa cccctattgc tgcaacatat acctatgtct    192840
     ttactgtttc tccttctcag tcaagtagca ccggtaaggt acgcaagcgc cgtgaccttt    192900
     ctaatcaacc caccacccat aatcaatcca ctcaactatc agcacaacca tcagccccat    192960
     ggtggttagt gatgatcact ggattatcag gtctattact aggatctgga ctggctgccc    193020
     tccccttcct cttataaaga gagatacagt tgtggctccg accggtatcg atccggtgac    193080
     ctttcgattt tcagtcgaac gctctaccaa ctgagctaca gagccatgag cgaccctgac    193140
     gggactcgaa cccgcgacct ccgccgtgac agggcggcgc gctaaccaac tgcgccacag    193200
     ggccaaagaa taagggtgac cccaacggga tttgaacccg tgctaccgcc gtgaaagggc    193260
     ggggtcctag gcctctagac gatggggcca gaaagatgga aatcatacag aatgaacctt    193320
     cctacgttct attactatat acgtatctat atcagagaac cgatgtatct gtgatatata    193380
     cgacacaact aatcccacag agttacctgt aacccccggt gtgtaacctg taacacaggt    193440
     tacttgagac gcccatacac aatcatccgg aggcctcttt gacggcctac tcagtggcat    193500
     aggctcattc tttggtggat ccgcatttct atatggcaca gcgcaacctg taacccctgc    193560
     ccgcgcaacc cccggcgaca ccagcccaca tgtaacacag tattactgtg tcatgtgtgt    193620
     ggttacctat atatacataa tctgaattat caagactaag atgcatgtct gtgtgaatga    193680
     acaaatgttc tcaggtaagt atttcaggca gatgttcctt gttctttacc tacgatcgtt    193740
     ataattgtgt tccgtcgttt ctgtaaatat gccaacatcg cctaaccctc tctcttacct    193800
     caccaaagcc tttaccttac tattaaccct tctcctccta tcatccctac aatatgaaac    193860
     agcctttgcc agacagacac ctcctgccct atccctccta tcatctgttt catctacatc    193920
     tgtttcatct aataccaaat acacaagagt aagtaataca aatacacaag aagtatgtgt    193980
     aacaactaac acaaatgtat ctctcctaat agatcctgtt acaagcagta caaaacaaac    194040
     cctgtcctgc accccatctc tctcacccca accacagaca catatatatg tcccatacac    194100
     agatacatcc tcatacctat atgtcccata tataaccaac acacatatat ccctctatta    194160
     cacagataag aaagcagatc catcatcttt cctaaccttc cctcatacag acatagcaac    194220
     cccatacgga gatgagaaag tagtctccat aacaaagaca acaaccaatc tcatagctct    194280
     cctaacaacc cgtaacatct tcttctttga catacatgta acagagaaac caaagataac    194340
     tgttcccata cacaaacaga tagataacac atatctctca gacataccat cactcagaaa    194400
     ctccagatac accttctctc taacacaccc aaacaaagac ataaccatag atagatacac    194460
     cggacagata catctctcat ccctaccaac atctcccata acagccatag ccataaacaa    194520
     agacacaagc acccatatca cctatgcaat agatacacac aaccccacaa cccataacag    194580
     atctaagaga gagatgcaag ataggcagat aaaaaatccc cacgtgaata gatcacctct    194640
     caaggtgcag gatcgagctc ttatcaatac ctctttggac aaatggtgtt ctgaactcac    194700
     tatatgtaat ggcggaaacg aacctattat caggtattac ggttacctta tgctaacacc    194760
     caatataagc aatatcacaa ctactgtttc tgtaaatcaa tcaactataa ccatttcacc    194820
     atcctggtct ataccaggaa aaataattcg cacatctacc gatagtcatg gatggcttca    194880
     tggcactggt tttgccaagt catatgccac cccaacatca tttcttataa acacaagtaa    194940
     tgtaatcaca aatggaatga actctatgtt ctccttaccc tcaggactaa cccttaatac    195000
     aagcaacgga gagataacag ggtctataga taagagcgtc acccccggtc tatatcaatt    195060
     tgtcgtaact gcattttttg gaaaaacact gagctatgtt aatccatttt ttgggaaaaa    195120
     ttggacctat acatttacgc tgtctgactc gtataccact gccacatatc agatctatgt    195180
     gacgtacagg gaaagcaata gcctgtatat aacccttatt cagggacaga atcttagtct    195240
     aaccgcacca tttccatcac gctatgcaat gacattgttg catacagccg gcagtctgcc    195300
     atccgggtta aatcttgtaa gccgttctat aacaggaatc gttgcaggtc cgcccggagt    195360
     gtatgaatat gttgtaacct acgcgagaac agcaacaatc gggcagtatt caaaacacgg    195420
     gacaagtagt acgaatgtat ttctgaaggg tatatgcaat acctgttcgc gcaaaactgc    195480
     tatttttgag cacatgccaa aggatgttta tacaacatta tccactgtta taactcctga    195540
     gctcgccgtt gttacatata tctttaccgt tttggggcaa ctcaagacaa atactgtgca    195600
     tacttatgca tctttggggg caaagagagt gtcgatctct cttcctgtcc caccattctt    195660
     tctgttgttt tctcagtata cgtacactac cctgacatca cccggatctg gcctacccaa    195720
     aggccttact cttgatcgat acagaaaata tataacggga tctataaatc ccagtattac    195780
     ccaaggggtg tatattgcgt atataacagc tcttgctgtt tttacaattg ctgtggatgc    195840
     ggtgtatata accgtataca acaccgatat atctacaacg agtatcaaga cgagtgtatt    195900
     aattggacag agtagcgtct atattccact tccatcatcc agcttttaca cattgtctgt    195960
     tacagaaaca gatagaaccg aacctggggt cggtttacct tctggccttt ttattgacac    196020
     agccgttggg gttgtaagag ggcaggtgaa tcgtaatgtc cgccctgggc tatatacggt    196080
     aaatatttct cttgatgtat ttaaaattag gaaaaaagat acgcttttta tatacgtttt    196140
     gccctatacc cctctgtgat ttttgaccga gaagggtcac gcgtgtaatg cgttaacaac    196200
     tgcgtgccgg tctaaccttg agggggttgt gcttgctcta tggaacctgt aactcacagt    196260
     aacctgtaat acacacagcc catacgccta cataagtgct ggaaacactg tgccgtagat    196320
     cagtgacaca gcatcagtgt caagtatcag tggcacgcct ggtccaggtg gcacataccg    196380
     ccaagtgtta ctgttgtgac tttgagtggg tcaaatggca gagtcacata catatacctt    196440
     tacaacccta cacagatcta agagagctgc ccccacacga tcacccagag gcctcttggg    196500
     cggcctaatc ggtgccataa ccagtgccct aagtggactc gcaaactcct tcttgggctc    196560
     cagtaccaca ccatctctat ctgccacagc ctcctcaagt ccacaacaac ccaaggtttc    196620
     cttggtcttg ttgcaggcgc cgtcctaccc accgcagtaa ccagtctggt tagtagggga    196680
     gtactataac tattccaccc aagtcaagag gttctctatc tggctatata gctacgtcca    196740
     taaatgttat atatggcaga tgctacatca ggtggagcta atgccacagg tctacctaaa    196800
     ggactaaccc ttaattcctc tggaaccata acaggaagta tagatacagg tgttagccaa    196860
     ggtatatata cagtagtagt aactgccact gcatcaaaaa catcaattgt tagtgcaaca    196920
     tatacccttc ttgttaccag tactacacca tctctatctg gtacaaccat ggactgtcta    196980
     acagtaggtg cgggtaagtg tatagacaaa cagaaccgac tgcagtaaca gggttacctg    197040
     taacccatac ctgcgttacc ggtaaaccgt aaccacaaac atatatcaga gcaggttctg    197100
     gcagagtaca gtgcaacacg tgacacaccc acacagttac cctgtggaac tacacatctg    197160
     ctggtgcggg tggtgtgcca agtatcagtg catacctgag caagatacca gactcacaca    197220
     gatctaagag agctgccacc aggcaatcat ccggcagcat ctgggatagc attaccaatg    197280
     gcctaggctc cctctttggt acatctctat ctctatatgg cacagcgcaa cctgtaaccc    197340
     ttaccagcat tactggtaac ccgcaaccgt gttacatgta acccccgggg tgttacctgt    197400
     aacccttacc agcaagactt gtaatacagc ccgtaatcac aaacatatac caaggcaggt    197460
     gctggcaaaa acaaggtgcc aagcatcagt ggacagcttg taggtggcac atacacaccc    197520
     ttacacaata aaaacaacca ccccaaccac agacagtaac accgtaacca tcaatattga    197580
     taaaaccaat ggcaatataa caatcacccc aagtattgtg cctggaacat atacagtaac    197640
     tattactgca actgcacctt cctatacttc ctctacaacc cttactagca caagtgttac    197700
     tgctgtattt ggtttccgag taattccaga taatgcatgt tgttcagtaa tttcttgtga    197760
     gtgccctgcg caacaacccc gccattgtcc agcactatta tgtggtcagc tatgcggatt    197820
     gatgccaggc gatgtgcgat aactatggtg gttcgccctc cgcggagcct gcgaacattg    197880
     gctgcgatat tcgcctcaag cagtggatct atatttgcca gcggctcatc aaggattagc    197940
     atatctggat tacgcagaaa tgccctggca attccaatac gctgacgttc accgcccgat    198000
     agggttgtac cacggtcacc aaccggtgca tctaggccac caagtgattc aaccaatgta    198060
     gcaatatcag ctagctttag cgcctcccag attgcatcat cactaacccc atcttttgcc    198120
     aattctagat tttgtctgat tgtccccgca aagatatgac aatcttgcgg cacaagagac    198180
     aagcgttgcc gataaacatc agggttgtag ccgtgtaaat ttagcccatc aaacctcatt    198240
     tcaccatcat cgggatcaag gaatcgcatt gccaaattgg caagtgtgct cttacctgcg    198300
     ccggaatgcc caacaatggc gaccgatctt gacggactga ctgttaaatt aacgccggat    198360
     aatacaggtt gagaatcata cgaaaaccct atatcatccg ccacgagggt attatcctca    198420
     ttatgatgct tttctaagcc gcgcctaggt tcagttggaa tgggatcttt agctttcagt    198480
     atcttgttta ttcgcattgc acatgcacca aagtctccca ttcttcccat tgcgtcagca    198540
     agaatataac tcggtattac acttagcccc gctaaaagta ttgcaaccgg tagaatccgc    198600
     ccatcaagtt gcccatttaa caccctgtcg gtcaagatta ttagcaggat tattgaccca    198660
     gcagctgtga ctaatgaaga aaaggcaagc tctaaagcct ttcgcaggtt atgtgcattc    198720
     ttgattttct gaacccgctc tgttgctgca ataactactt catgctgttt cttcaccatt    198780
     cccagagatc gcaattcgcg ttgtccctga acggcattca gaaccgctgc gcgcaggtca    198840
     actagggttt cccgcgatgc aacaccttga cgtctctgta tgggcactag cacaaatgga    198900
     aatataattg tcaggatcat tgggataatc ataaatagcc caattggacc gattaaccaa    198960
     gttaatatgg tggtaaaaat aatcgagttc actatcgtaa atattgcgga cggaagtatt    199020
     tgtgtgtaaa accattccaa ctcactggta tcgctcaatg cagctgatgc aatatcagcc    199080
     gttcgtttgt tttgtaaacc taatggagca atacggttta tagctgaata tgtgctgact    199140
     cgaaggatat gcaggatcct gttcgcaaca tcatgtgcca accatatatc caatagatta    199200
     aacacgggat aaaccacaac cagtgagaat aacaagatga aaagcccttg tagttcagcc    199260
     tgagtatctg aaaagaatgc cgaacttata aataaggaca caaccgcaat cccggtctca    199320
     gccagattcc atataatcag gacaagtgtt gcaagggtaa atagccccag gcatttgcgt    199380
     aacttgccag ctaggatcaa gagatctttt agcatttttc ttgttacacc cttactcaat    199440
     ctcgtgttat tcaatgcgct cgacatttac atcacctaac tgtgctttta ccagttttga    199500
     ccagacagag tctttatccc gcgcaagcaa ttgcggggca ccggcacagg taacactgcc    199560
     gttggccata acaaccacct ggtcagcttt agctgctgtg tcaattcggt gcgtaacaat    199620
     caacagtgtt aaatctggcc gtgcggtcct gatagccttt agtaaagcac tttccgtcat    199680
     ggtgtcaagc gcggatgttg actcgtctaa tactagaatc ggcgtattcc tgataagcgc    199740
     ccttgcaatg gccaatcgtt gtttttgacc ccctgaaagg ttctttccgt gttcgaatat    199800
     acagacgtcg agtatatcca gttcgtcatg ttctgtttca agatgcagag ttgtttcttg    199860
     cgcatagcgt agagcctcaa tcatttctgc ctctgttgct tttcggtttg cactagcgag    199920
     tatttcacgg attgttccgg ggaaaataac aggatcctgc ggcacaagtg tcattacctt    199980
     ggttgtatca atactgactg ggtcatttcc aaaaaccctg atttgcccag aattgggtct    200040
     atcaaacccc atcagcaagc ccagcgcagt tgacttaccc gatccagata agccaacaat    200100
     tgctgttgtc ttgttggatg gaattgaaaa tgtagtgtgc gttagggcgg atttatcagc    200160
     accgatatat gtatatgaaa ccctatcaaa gcctgttagt ccagttagcg agggagtctc    200220
     atgattatta tgtgcaacac tgtgagatct ctcttcaagt atctcattta tactagagac    200280
     agctgcaatc ccgaaaaacg ccccataata caaaataact agggtgttga gtgggcggaa    200340
     taattctatt gacaacatga taaccaagaa cagctgacca atctccatat gaccggcgcg    200400
     gatttgaaaa atggcaatta ccaagccgag tgcaggcccc aatgcacgca ttagcgatct    200460
     gagtccattt tcacccaatg atattcttag ccgtctgcgc gtagaagaaa ggagcctgtt    200520
     tgattgctcc tccagttttt tgccatatcg ttcggctgcc ccgaaagatt tcaaagttga    200580
     catgcccatc attgcgtcga tgaaatctgc gttcatgttt tcataagcaa cccagtgctc    200640
     ttgccccttt ttccctagtg ctttatccca aagccttggg atgccaacca ttccaatggc    200700
     gcaaaacaac aacacaacgg caataatcca attgatttgc caaatgataa tgactattac    200760
     aattccagaa acaactgttg ttataaaatg cacaaaatac ttaacaaaat acaaatcaat    200820
     agattcaatg ccatcactga ttagggcttg tattttgccc gatcgccaaa accccacgcg    200880
     cattgggccg cgcctatcta gctcagttaa tagagcttgt ctaagattct gtttgactct    200940
     tgtaccagca cgggtttcaa gaacagcttc acccacacta ataagtggac gagcaattag    201000
     tgtcagggca ataccaccaa taagaatagt aatttcaaac aacctgcgct gcgagagaag    201060
     ttcggtaaaa aggagggcat taaaaactcc ggcaataata tacgctccga aagacagcag    201120
     attcattaaa acgggtggca gcaataaccg gatggttatt ttaccggcac gcataacacg    201180
     taatttttcg cttaacacta aagaatcaca actcctatag tttgacccca agaggtccag    201240
     gcgactgttt ggcggtcgct ttccgtagca tactctcaac ctcaccaaca gacgtgtcaa    201300
     gaatgagatg ggctccatct gcgcatgtca agagggcgcg tccgcaagat agtggcctta    201360
     gctccacaca aatatacagc gacattatcg gcaatagcgc acgataatac tcgtatctct    201420
     gcgatttaag cccaggtaaa acctttctgc ggcccagaat aatgatgatg gtgaaaacac    201480
     ggaactgcag tacgatcact gtctagtgtg gcaacttcga tgatctcaag atttctcatt    201540
     tttctcctaa tcgatatcac aagactcctt ctgttctgag gagtacactg gtaacagtat    201600
     ttcgtccatt gtaatacatt taatgtcaaa tgtttgttac gagaggactc ccctttccag    201660
     agcccacaac aatagccatt tacagcagaa tatgtctgga caggtggtgg cagaatgcat    201720
     ggccacccca accaccccca cacgatcacc cagatattca cccagaagca tctttggcta    201780
     cctactcggt agcataggca atatcgcagg ctccttcctg ggctccagta ccacaccatc    201840
     tctatatggc acagcgcaac atgtaaccgt gtaacctgta acccctgttg tgttacgtgt    201900
     aactcatacc agcgcgactg gtaactcgtg tgttgtgtta cgtggttacc tatattgtgt    201960
     tacgtggtta cgcatgccca cgttactggt aacccccggt gtgtaactgg taactcctgc    202020
     tatggaacct gtaacgcagc cccatacacc aatctgtctt atacagtcac acccaacgca    202080
     agaggtgccc catccagtta tatagctaca cctacaggtg ttacatctgg tggaactaat    202140
     gctacaggtc tacctaaagg actaaccctt gataaaacca atggagagat agacatcaga    202200
     ctttattagt cacagtccac aacaaaccca ggtctccttg ccggtcttgc aggtgtccta    202260
     cctaccgcag taacaagtct ggttgatgcc tgcccccaca cgatcaccca gaggcatctg    202320
     ggatagccta gctggtaaca ctgccaagtg ttaatcctgt gccaagtgtt actgcttcga    202380
     ctttgtcaaa cggcagtact gcattaccgg atgttactgc tgtgcatgta ggtaacaaag    202440
     tatgtaaata acaaactcaa atacccaaaa tgcactaact atgtatgatg cgtgcagcgt    202500
     gactcaggtt acgtaccgag cgatctgacc gtgtacgata ctcaaccccg tgaaggtcgc    202560
     ttgactggtt tctttagatc cattcccttt ggtactggca tgtaattttt tggaatggca    202620
     tccagaagct tgccagcctt ccacacttcg cttcgatgaa gggttttctt tagggacctc    202680
     atttttttac caagtctatt caatggtacg gactttggat ctagatggtt tacattcaga    202740
     acatggatct gtatgttagg aagcacacgt tttaccctgc gctgttcttc ggccagcatt    202800
     ttctgggccc tttgtctcat tccctcgata atcagaacaa ccccacattt accaactgcc    202860
     ctgtatattg catctgcagt tttagggttc acagcaactg gtatctcact ggtctgccag    202920
     catcctctaa aggtttttat aacagccccc gttgccccgg ggcggccctc cacctggcta    202980
     tacgcgacct tttcagcttg tttaccaagt gtgatcataa aacttaacaa tgcagcacca    203040
     acagagatta gaatcaaaag aataaacact aatatcgagg tataggccaa aataacggca    203100
     gcactaatcc ccgcgaccag cggagtgatg ccggctgcta tcagataaac aaccaccttt    203160
     ggcctacccg aacaggctat acgaagaacc tgcattatct gcgcaatgcg cccgggtgct    203220
     ttcttgttac tctttggcat ttctaaacca cctcagggta ccagaatact ttagttttca    203280
     acaatttgtg cttattcgct aaggtgcaaa acaatatgcg cgatattcga gtatgtgatt    203340
     ccattcttca acaaacacac gcgttcaaca gatgacaaag acacagagaa agcccgtcaa    203400
     ataataggta attatcgtgt cataaaaact ctgcatgaat ctgaccgcgc ggttatttac    203460
     cttgcacagg agataagcgg agatccggga atggtagccc gccaatcatt catggatccc    203520
     ggtgaattag taaatctcgt cgcccttaaa atgtaccggg cgggtgttac ttctgaacac    203580
     attgcaattg aagctgatgc tctggattca ctcaggggtc cgggtgttgt tgaattgcgt    203640
     gatgtcttaa atttgccgga taaaaggggt cttgtgatgc gggctttgca tggacccgca    203700
     cttgttgact tatgggaaac caggggcagt ttgagtcctg gggaaatggt tacaattctt    203760
     gcttcccttg tcgcaaccct cgcaaggatt tcatcagcag gctatgctca tggtgctgta    203820
     tggcctggca atattcgttt cgatgatatt ggaaggcccg ttctgaccgg gtttagctct    203880
     gccagaaagc atgccccacc taatgcagac tggcttgatt tttattcctt gttgcggggg    203940
     tgtgcagtac tcataaacga aaaacaagaa caaatgttgc aaatatccgc aggggtaaga    204000
     aaaagacttg atccatttga tccggaatta cccgcatggg tcgaggcaag tcttttcagg    204060
     ctggccgatc cccagccact caggtttgaa cacccaattt ctttgcatga tacttctggg    204120
     tataacttac gcgaatcacc caatcctgtt gattctaata gacagaccgg aaaatcacag    204180
     attattctga aactaactga taacaaatac gttgctgcca tcctcggtaa actaaaacgt    204240
     ccttctgtgt tgtttatcgc actgttcgta tctgtatttg ttgttctttt gatggttatc    204300
     ccgaataact caggagagga taatgagaga aaatcagaaa aacccggata cgtaaaatct    204360
     aaaggaacat tcaaaaagcc tagtaaaacc ggtaaatctc gtaaaaggtc tgaggtttct    204420
     gaaaagctta ggaagaatat ggaggaatgt ttggccagca aggatgccga ttgtgtggat    204480
     gttatgtcag agataaacgc agatcttgga gagaaactcg atgaaggtta atctgttcac    204540
     ctgttgccgc tgatattacc aagtctcgta taccttctta tcttgttaca tatacctttt    204600
     atgtattacc cagtaatagt agtagtgttc atgcactaac ttcaccagat agaacagctt    204660
     ctgttacgtt tatgagtaca acatacattt cttgttgatc aaagtacagc accatctcta    204720
     tctaaccaag ccacaggtgt atctataggt cagagtaata taactattac accaactaca    204780
     cagggttata taacttctta tgcagttgct aatactctta tacagtttct aatacgagtg    204840
     ttactacggg attatacaaa gtaactatta ccgcaactgc accttcctat tcttcctcta    204900
     caacccttac tagtacaact gttagtgcaa catatacatt tcttgttacc agtacagcac    204960
     catctctatc tggtacaacc ataaccatat acacaacaac acctgtcagc ttatctgtaa    205020
     caggttttat aaccggttac acaataagcc caaccacccc aaccacagac agtaacaccg    205080
     taaccatcaa tattgatacc agtaaccctt gattcctctg gaaccataac aggaagtata    205140
     gatacaggtg ttagccaagg tatatataca gtagtagtaa caggtactgc acctactgtt    205200
     actaataatg ctacaaccct tagtagtaca actgttagtg ctgtatatat actgaacaag    205260
     ctattactgt gttatttaac tgtgttacca gttatttaac tgtgttactt ataaggaaaa    205320
     catatctgtg ataaccaagg atataagaaa tattgctgtt gtagcacatg tagaccacgg    205380
     caagacaacc ctgattagcg cgatgcttca acagacgagc gattcaacca ctgcagaaga    205440
     tagggttctt gactcgcatg agctcgagcg tgaaaaggga atcacgattc tcgcaaagaa    205500
     taccgcagtt acctacaagt catccggaag atctgtgaca ctaaatatag tcgacacacc    205560
     cgggcatgcg gatttcggtg gagaggtcga acggggaatg tctatggtcg atggtgttgt    205620
     tgtactggtt gatgcaagcg aaggcccact tccacaaacc cgctttgttc tgaaaaaggc    205680
     attactcaaa aagcttccga ttgttcttgc ggttaataaa acagatagaa gtgatgctcg    205740
     tatagatgat gttgtttctg aatttcagga cttattaata tccctggcag aagagataaa    205800
     cgatccggcc atatacagta tccttgatgt cccgattgta tatgtttctg gcagggcagg    205860
     ccgggcgagc ataaataagc cagataatgg acaattgcca gatagaaata atctcgatga    205920
     cctatttgaa aaaataataa gttatatccc ggcaccggaa tatgataaaa gcgccccact    205980
     ccaagcacat gttgccaata tcgatgcctc agcgttcttg ggtcgccttg ctcttacaag    206040
     aatttataac ggcagcatat caaagggaca gacagtttgc tgggtaaata cctcatctaa    206100
     acagcgggtg aatgtcaggg taactgagct gctcaagaca gttgctttgg atcgcgtgcc    206160
     cgtcccttca gtctctgctg gtgatatagt cgccattgct ggcataccgg atgtaatgat    206220
     aggtgactcc atatgcgacc ctgatgatgt cagacccctg cccggtatat ccattgatga    206280
     gccggcaatt tcggttgtta tcggtgtcaa cacatctcct ttggcagggg gtgtcccggg    206340
     ccataagctc acggcaacgc aaataaaaga gcgacttgac agagagacaa ttggcaatgt    206400
     ttctatacgg gtcattccaa cccggggaac cgatgcctgg gaagtgcagg gtagaggaga    206460
     gctggccctt gcagttctta tcgagcaaat gcgaagagaa gggtttgagc taaccgttgg    206520
     aaagcccagc gccgtaacac gtattgtaga tggtagtctc catgaaccat atgaactatt    206580
     gaccgtaaac ctcatggacg agtattttgg ttcagtgaca aaattacttg ccgaacggaa    206640
     gtgcagggtg gagagcgtta tatccaatgc cgggtggaca aatgctgatt ttgttgtccc    206700
     ttcaaggggg ttaattggat ttcgtactga gtttttgaca attactcgcg gcactgggac    206760
     tgcaaatgcg atttttcatt cctatgctcc gtggtccggt cagattaacc agcgagcaca    206820
     aggatcagcc gtagccgata gggcagggca tgtgacatct tatgcaatcc ttgggcttca    206880
     ggagagggtc ttgttttttg tatccccatc cgagcgggtt tatgaaggta tggttgtcgg    206940
     cagaaactct cgtcccggcg acctaaatgt taatgttaca aaaggaaaaa aacttactaa    207000
     tacccgctct tccacggctg aggagctgga gaaaatagtc cccgccagac atttgtcact    207060
     tgaagaatgt cttgagttcg cgggaccgga tgagtgtgtt gaggtaacac cagaggctat    207120
     taggattcgt aagattgaac tcagtcaatc ggttcgcagt aagcaaaggt gaccgcatct    207180
     ttgctaatat tagcttcaac actgttccgt accctgctat ccgtattgta tactcagtca    207240
     gccacactat atactcatac gctaatccaa gcctaaaagc acgtgtatta ctgtacacac    207300
     agagtcagag taatgtaagt attacaccta tactctacgg aagcttttct atatccacat    207360
     atgtattagt agatacaaca ggtgctacat caggatctac gggtctacct aaaggactaa    207420
     cccttgattc ctccggaacc ataacaggaa gtatagatat acgcccgcat gttagactga    207480
     actgcgtatg cgcaccggag tggatcttgt tgacatcatc gacttcaaaa aaaagataga    207540
     cagatccaat cgccttcttg agcgtttgtt tgcgccaacc gagctatcga attcttataa    207600
     cagaaaggcc ctttctgtta gatttgccct caaggagagt gttataaaag cccttggcgg    207660
     tcttgctggt acatggcacg atatccaaac atccggcggg acacacttgc caatctctgt    207720
     atctctttct ggtagtatgc tgctcaaagc agatgaattg ggcctgaatg aatgggcggc    207780
     cagcgtaacc cactcatccg gttttgcaat tgcgaatgtt gttgctcagc acaatacaac    207840
     tatttcgcat cctccatgga gcatacaagt cccaacttgt ggtgcaacag aatgtcttgg    207900
     ttatgttttg ggaagtgtct taaaaccggg agatgttgtc ttgcttgttg gtgagcttgg    207960
     tgcaggaaaa accaccttta caaagggtat agctgccggt cttggaattg agagtgcggt    208020
     tgttagcccg acctttacct tggtaaggga gcatgttgct caaaacggcg gaatgaatca    208080
     tgttgactgt tacaggctta ttcatgactt tgatgatttt gatcttgacc tagataatag    208140
     agtcactgtt gtcgaatggc ccctgagttt cttttggaat ttgccgaggt atcttagctt    208200
     caagattgat tttacatcca aggataatac ccgtattttt acactgcatg caaagggttt    208260
     tgatatcaaa gaacttgcat tcataaccca cacaatgtct cagtcacaca caatgtctca    208320
     gtcacagtag ggcactcacg cagtaggcgt atgaagattt tggcaataga tacatcctcg    208380
     cgcttggcta ttgcgtgcct cgaaattgac aataatcgta ttacaacggt tgggaagtgt    208440
     atagaggatt ctggccgtct gcattcagaa cttatagcag aggcaatcag tcaggcatgt    208500
     tcagagctgc agtcattatc atttatcgct gtttgcttgg gtccggggtt ctatacaggt    208560
     ttgaggtctg gcttggttgc tgcgcgcatc cttggactgt cgttatctat ccctgtttac    208620
     ggtgtcatgg cgcatgatgc gatttatatg ggttatctct cttgcgaaga acatgttttc    208680
     tgcgaccgag ggttgcatac atcgcaggtt ttttcacatc atgaacctgt cagcaaaagc    208740
     gccgatggag ccaatcatga agaattctgt gacaggaata catattccat gggcgacgct    208800
     atacatcgaa atgtgccatc tattgcaaga acaattatta caccagcggg tcgcaggcag    208860
     ttttattgga gtcgctatac gggacttgat aatgacggac tacctattat ttatgcaggt    208920
     ccaggactaa tcgattcttg cgatataaat attttgtctc aggacttccc gttcaatccg    208980
     gtatttgttg caagcgcaca cgaaccccag tttgaggcac agaaagagtc aaatggcacg    209040
     ttaaccggat cgccaagacc gcgccggaca gggcggcata tcgatcgggg ttcctgtcca    209100
     ccaaatgtgt catctacaat accccccgga atattccgcg cacgagttcc gcaagcacac    209160
     gactgcgcaa tcaacgtagt gtcaaaaaat tcaatgcgtg aaacagatac tctaaaaaca    209220
     gacgcctcga ttgacaaatc gatcacatct gaccgtccga atacccaacc catcctgcct    209280
     gttagcgctg ttaatcctgt tatcttgggt aagttggcgt atttgcaact caaggcaaaa    209340
     agggcctgtt caaggattga accattctat atgcgccgtg ccgatgtaac tcttagggtg    209400
     ccatcgggcg aaatcaataa ggatttagtc tctattcacc ccgcgtcctt acatgatttg    209460
     cccgatatta tgaagattga acgcgggtcc tttaccgggg aagaatggtc atctgcgacc    209520
     atgctacagc agctgcgctt gggtagctat tttgtgctaa aggtcagcga tatgccggtt    209580
     gggtatgccg ggatatcgca cccgaggttt gaggatgttg atcttgaaac attagcgatt    209640
     gatcctgctt ggcgtcgtaa gggattgggg ggtattttat tgcgacatct ctttgaatat    209700
     gcgagagatg ctggcgtgaa aaggtgtttt ttggaagtca aggtgtgtaa tcttccagct    209760
     attggaatgt ataaaaaaca cggttttgtt accctgggtc ggcgaccaaa gtactataac    209820
     ggcgttgatg caataactat gaagaaagag ttatagtgtc tattatcctc ggaatcgaaa    209880
     catcttgcga tgaaacaggt gttggcatag tgtctggttc aactgttctt gcaaatgagg    209940
     ttgcctcatc aagcttacgc cataaacctt ttggcggtgt tatccccgaa atagctgctc    210000
     gggcgcatct tgagtatttg ccaaatttgc ttgaattggc gcttgagacg gcacagctct    210060
     gtattaaaga tattgatggt atagctgtta ccgcaggccc tggacttgtt accagtcttt    210120
     ctgttggcgt ttctgcggcc aaggctttgg gattatctac ggggacgcct gtttatggtg    210180
     taaatcatct tgttggacat gccgtatcgg cttttctgga tgattacact aatgatggcc    210240
     ttggtgttat tcaccgcagg gacagtatcg gatctaatgg aattgagaat gacgccagtt    210300
     cgacacactc acatacgcat acaacgcagg taaacagaca ttcaaacctg tgtgtctata    210360
     cacctccccg gcgtgtttta cgagatgttt gtaagtatat gcatgtcaga gattcagttg    210420
     ttttgcttgc atcaggtggg cattcctgtc tgttgaaaat acataacaat aagatatcgc    210480
     ttttaggtga gacactggat gatgcagccg gtgaggcgtt tgacaaaatc gcaagactta    210540
     tgggccttca gtatcccgga ggtcctgcga ttgagatgct tgccagttcg ggtaacccca    210600
     atgccgtgga gtttccaagg gcgctgttga cgcattttga agaacacaac aggtatagtt    210660
     tttctttttc agggttgaaa accgcggttg gtagggttgt tgaaagaata aagagtaatc    210720
     cagcccattc gatacccaag atagaagata ttgctgcaag ttttcaggaa gccgttgcag    210780
     atgttttgac agcaaaaact gtagcggctg ccttggccag tgatgtggat ctaatagtta    210840
     tgggtggtgg ggtagctgca aataatcgca ttagagagat gctttgcgaa agagcgaaaa    210900
     tccacggctt ggacgtaaag atcccaccta ttgcgctgtg caccgataat ggtgcaatga    210960
     ttgccgccgc tggctcgtgg cttatgcagc tgggatacaa tccgagtcat tcaaggtttt    211020
     cgcccgtatc gattatgccg ctaacccaga tggttgtgtg acaatttgcg tctcttcttc    211080
     cacttaatag cgcttgactg ttattcagca ctgcaagtgg gattgttggg tatccacaat    211140
     cccaagtgtt aatggtctca agcatcaagg atgtgtttgt aaatgccaca gtcacagacc    211200
     caaagcatca cagatctaag agagctgctc ccatacgatc acccagatac ttctggagta    211260
     acccactcgg tgtcctaggc aatggtctag gcaatatcgt aaccaagggc aatatcacag    211320
     gcggactcgt agactccttc ctggatcaac atacgacaca actaatctct caggtctaac    211380
     ctgtaacccc cggtgtgtta ctggtaactc acacctgcgc gacttgtaac gtaatgttgt    211440
     gttacgtggt tacctatgtt gtgttacgtg taatacccac acccgtaatc tgtaacccgc    211500
     tggcgcacaa catgttactc acctgcgcat aacatgtaat gctgtgttac gtgttgcaca    211560
     tgcctgtgtt acctgtaacc cacacctgcg cgacttgtaa cgctgtgttg tgcggggtgg    211620
     tcacctacaa tccgtaacag gttacccatt aaacagagtt actggtaaca cacgctgtaa    211680
     taaacaaccc acacccatga ctgttatcta tatcatggac aagaagagga acttacccca    211740
     ggcttccggt tacatgtaac tcggcacaga gcaacctgtt acctatcccc gcgcaaccta    211800
     tggcgtatga gctgcatgac ctgcaacccc tgcctgtgtt acatgtaact catacctgcg    211860
     cgggtggtaa tcactacctg cgtaacctgt aacgttgtgt tgtgtaaccg gtaacccctg    211920
     ctgtgttacg tgtaatacgc acacccgcaa cctgtaactc atggtgcgtc acgtgttgca    211980
     cataaccgtg caaccggtaa ctcgccggtg cgtaacctgt aacctatact gcacaacctg    212040
     taacacacat agagtatacg taaccccccg gttcgcaact ggttacctgt gactatcaca    212100
     caacaaacac atatcaacgc aggtgctggc ctaaaacccc acacagctac ccttacatat    212160
     accgacaccc ttacatatac cgcatatcgt gacctctcta ccactgctag ccgtactata    212220
     cactcatatg tcaacacggt acactgaagt accgtgttgc acaggccccg cataactcct    212280
     gcagttgcaa atgcacggcg cgctatgcta aacacccttc cagcggattt gcataatcaa    212340
     ctcgttttga ttgctctttc tggcgggaga gactcgctgg ccgctatggt aatcgcgtca    212400
     tgggttattc cgcgcctgaa cggacgcgtt ggtgccgttg tggtagacca tggtttgcag    212460
     gagaattctg cacgcattgc tgacgaagtc agaatacggg cagagcagtt tgcactaaat    212520
     cccattctga taaagagagt ctcgccctcg agagtatctg ctgggccaga ggcgtctgcc    212580
     cgcattgcac gctatgctgc cttttatgat actcttgaag aaactaaagc ttatgcgatt    212640
     atccttgccc atacactcga tgatcaagca gaaacggttt tactcggcct catgcgcggt    212700
     tcgggcccgt caagtttgcg aggtatgaag gctgtatcgt acactccgga agattgcaga    212760
     tacatgaata ataaggcgtg taattccgtc accgccgtgt atgcccacaa tacacagcgg    212820
     tgttcatgtg actcacgccc gtacccaccg cctcccgaac cgcgcaatga gaacagaagt    212880
     tattttccgc acccatcttg taaatgcgtg gagggttccg caacgcgctt cacaaacgca    212940
     gatatagatt cgcgctttgg cgtgtttata aggccatttt tggatattac ccggcatgaa    213000
     acaggtaaga tttgtgagtt ctatgggctc gattactgga atgatcctca taatgaggat    213060
     gtgcgttttt cgcgtgttcg gattcgtcac aatgttatgc cggttttgga aaatgaaatt    213120
     ggaccgggtg ttaaatacgc gctatcgcga accgctaagt tggcacaatt ggatactgaa    213180
     tatcttgatc atttatcaaa tgaattgctc gatgagatag cgtctaaaga atcagattgg    213240
     tcaattaggc tgccgattaa tactcttcaa aaaaccccag tacctattcg acttagggtt    213300
     atacgacttg ctgccctaca gtattttact gttagtttga gttttaaaca cacccgtcaa    213360
     atagagagac tactgtgctc atcttgtgac ataaagcatg taaacctgcc acggttaatt    213420
     acggcacaga gggttggtaa ttacatttac atgcacacct tacgcggtaa actgtaagca    213480
     tatgaagccg cttttatcag aagcagtaat ccataggaga cttgcacagc tcgctttgca    213540
     gatagacgag gattatcgtg gaacctcgat tgttctgctc ggggttttaa agggttcgat    213600
     tatgcttatg gctgatctaa gcaggctttt gagcagtgat ctcagaatag agtgggttac    213660
     attatcatcc tacggaaatg acactgttag cagcggtagt atacggattg tccatgattt    213720
     agacgccgac ataagggata ggcatgtcct tattattgag gatatagttg atagtggtct    213780
     aactctcggg tggcttttgg ccaagatgcg cgagagacgt cctgcaagta tcgaggcatg    213840
     tgttctgtta cgcaaacccc atgcgagggg cactgacgtc agatacctgg gttttgatat    213900
     tccagatgag tttgttattg gttatggtat ggattacgcc gagaaatatc gtaatctgaa    213960
     gtcagtgtac gttttggagc aataatcttg tcgaagataa caaaatcccc tgtgctctat    214020
     atcgtgctcc ttgttgtggg ggtttgggtc gctgtcaatc tgtttctcac aaatgcatat    214080
     caatctatac gcaccgaaga ggggttagag ctgataaaaa gcgactccct ggtgtccgtg    214140
     aggatagttg acagagatca gagggttgat ctggagcttg cgacccccta caagaaccac    214200
     ggaacaaaag tacagttcaa ttatgtcagt cagcgtgcta ccgagatcgt aaatgccgta    214260
     aacaaagcaa aaataaagga tggctttaca gatgaagtgc cagcgcccag tgtctggggg    214320
     tctattatca gcatgctatt gccaattgct gcaattggac tatttctctg gtttatggca    214380
     ggtccgcaag ctgccggcgg ccgggggatt gcccagtttt ctaggatgcg ctcacgtctt    214440
     gttagcaagg aaatgcccaa ggtgcgtttt acagatgttg caggcgccga tgaagccgtt    214500
     gaggagcttc aggagataaa ggattttcta agcgaccctg ataaataccg caaactcggt    214560
     gcgcgtatcc caaagggggt tttactgttc ggacctccgg ggaccggaaa aacccttttg    214620
     gctcgtgcag ttgccggtga ggccggcgtc ccgtttttct caatttccgg ttctgatttt    214680
     gttgagatgt ttgttggtgt tggtgcaagt cgcgtcaggg atttgtttga gcaagcgaag    214740
     cagaattctc cttcgataat atttatagac gaaattgacg ccgtgggtcg ccgccgtggg    214800
     tcaggctttg gtggtggtca tgatgaacgc gaacagaccc tcaatcagct tttggttgag    214860
     atggatggat tcgatgttaa aacaaacata atactcattg ccgcaacaaa caggtctgat    214920
     gttctcgact ctgcgctatt gcgccccggt cgttttgacc gacatgttgc aattgatgcg    214980
     ccaaatttgc agggtcgcct aaaaatactt caagttcatg cacgcacgaa gcctgttagt    215040
     aagtcggttg atcttgaagt gttagctcgt aaaacccctg gctttacagg cgcagatctt    215100
     gccaatgttt taaatgaggc tgcgcttctt acagccagga gcaatgccca gataatcgat    215160
     gaccgcgcgc ttgatgaggc tgttgatcgg gttatggcag ggcctcaacg ccgcagcagg    215220
     gttatgacgg atcacgaaaa gcttgttacg gcttatcacg aagctggaca cgccttgacc    215280
     gccgcggcta tgcgttattc ggatccggtt acgaaggtca ctattcttcc gcgcagcagg    215340
     gccctaggtt acacgatggt tatgccggtc caggatcgct actcagttac gcgcaatgaa    215400
     ttacttgaca agttggcata tgcaatggga ggtcgcgccg cagaggagct tgtctttcat    215460
     gaccccacga caggtgcaag taatgatatt gagaaggcaa ccagtatcgc ccgcaagatg    215520
     gtaaccgaat ttggtcttag taaagatttg ggtgcagtga aatttggtaa cgcacataac    215580
     gaaacgctta tgggtgtagg tcaaatgacc gctcgtgatt attctgaagt tactgcggaa    215640
     aggattgatg tccaggttcg ggcgcttata cagaatgccc gtgacgaggc ttgggaagtg    215700
     ataagcaata atagaaacct cttggacgat ttagccctaa atcttcttga gaaagaaact    215760
     ctgaatcagg atgaaattgc tgagattttc aaaggtgttc gcaaattgcc tgagcgtcat    215820
     gtttggcagt ccgcccctaa tcgcgagccg agtaataaac cacccgtaaa gtacagtgcg    215880
     atggggcccg attccgaagt gaccgcaaaa tcgccaaaga gaacttccaa cagacgtagg    215940
     ttgccttcag caaggcgccc gaggaaggat tcggagactc aggaataagt tcagccattc    216000
     ggtgacgaag ttgtgtagat ttgagagtgg ttcggcgcaa tccgcggtgg cgaatttgct    216060
     gtccgcgctt gggcaggacg taggcaggct aaaggagact ccttctattg catcctctgg    216120
     ccttgagtct cttatctctg gtagtgaaac gaatccagca gattgccttg ttgacctaat    216180
     tcccaacaca caaaagggga ttgtgatttt gcgcgatata ccattcagat cgatctgtga    216240
     acatcactta ttaccatttg tgggcacggc gaatctgctg tatgaaccag ggaagtttct    216300
     tgcaggccta ggtaatctca cttccctggt gcgatgtgct gcgcggcgcc ttagcattca    216360
     ggagcgcgta acagatcaaa tagctgatgc gatttatacg ggcctttgtg cgcgccgcgt    216420
     tcttgtgtca cttgctgccc ggcatacctg cattttggat gaagctggaa atacagaagt    216480
     tacgaccttc gcgcatcggg gtataggaga tgccgatatc atctctttta tgacaataat    216540
     ccggtagcgt gtacctgcta tttcgcttgg gttaacgtgt attgtgatga acatgagcta    216600
     tactcccgac ccatttccac ctcctaatgt aatgggcatt ctgaatataa ccgatgattc    216660
     tttcagtgat ggtggactgt ttttagaccc ctctgctgcc attacccaag gtagaaagtt    216720
     atttgctgag ggtgcttcaa taatcgatgt tgggggtgaa tcgacacgcc cgggtgctga    216780
     gcggattagc gtggaagaag aaaaaaaaag ggttttaccc gtagttaggg aacttctatc    216840
     cgaaggtatt catgtaagtc ttgacaccat gaatgcagac acagcaaaag agggccttag    216900
     catgggtgtt gccattataa atgacgtatc agcgggcaaa gccgacccgg acatgctaag    216960
     agtgatagcc gatgcaggct gtaaatacat cgcgatgcat tggcgtgggc actccatgtt    217020
     tatggatagc cttgctcatt acgacgatgt tgtgagtgat gttcttcgag agcttaagtt    217080
     tgatatcgag cgtattactg ccgctggggt aaagagcgac cagatcatcc ttgatcctgg    217140
     ttttggcttt tctaaaacaa gtgaccataa ttggcagttg ttcagaaacc ttgattgctt    217200
     tgttaagctg ggctttcccg tgctgattgg tctttcgcgc aagaggtttt tgagtcgagt    217260
     atttaagggg catgattttt ctcctaaaga ttctaagaat gttggagggt tggataaccg    217320
     cgaaatactt gcgcgcgatc tgccaagcgg gatactgagt gctattgcca taacacgtgg    217380
     agcatggggc gtgcgtgtac atgatgttgc ctcagctcac acggcgctgc ggactctaca    217440
     gcttgcgcaa tacggctcgg tatatcaggc ccacaaacgg gcggcaaata ccggaataga    217500
     caccgcaata cccggccaag gcaacactga tgacaccact gcctccagta accacaccaa    217560
     caattctgaa acaggagctt ctttaaaaag tggcgtgagt caagtccgca acatgattgc    217620
     cccgcccgtt ataaagataa gaagtctgcg cgtgtatgca tatcatgggg tgtatcgttc    217680
     tgagcgggac tacggtcagc aattcattat cgatgcagat attcaattaa aacattttcc    217740
     agaagacaag attgactcaa ccctagacta tgactcattg actggaaagt ttgtgcaata    217800
     tgccaccgca tcatctgtga atcttattga gacactcgct gatcaccttg caaagattgc    217860
     cgtcctagat ccaatggttg agtgggtaag cctcagcata acaaagccaa accctccgct    217920
     cgcttatatg aaacaaagta acacagccgc ctgtcatgct atgcataaac ctgataccag    217980
     aggtgattat gctaaagaac acacaaatct tacaggcctt caattatcgt gcacggttag    218040
     gaaagtgcgt tccgaaagtg taacaagggt ctatataggc atcggtgcaa atgtaggtaa    218100
     ttgcctggat aatgtccagc gcgcgatcaa ggatattgca gatcatccaa tgattgaact    218160
     tgtctcactc ggcaggcttt tccgaaccac cgccgttgtt ggcgagagtc ttgatgaatc    218220
     tctaccggta tttttgaata ctgcaatcgc aatcgatact gctttatcca tgcaggattt    218280
     gcttgcctta atgctttgta tagagaaaaa gcttggaaga actcgtcaca gtagaactcg    218340
     tcacagttta tcttccgctc aagacgccca ccaggctgat tcaactagcg ataatcctaa    218400
     ccagttacat tatccttgtg ccggacgcca aggcatccaa cagcctttac attcgtcaac    218460
     tttggcgcac actcaggatg ggtttgttaa tcggcatatt gaccttgata tcctgctcgc    218520
     ggagggggtt caaattactg aacacgggtt atgtattcca catccaaggc tcagtaagag    218580
     agcctttgcg cttttgccac ttgagagtat agatcctgat ctgcatatcc ccggacatgg    218640
     cccaattact gacttgatac atggtcttcc tgaggatcaa ataagctctg ttgctaccct    218700
     tcgagattcc gggtatgaat tattcaggca ctctattacc agactaaaca attgttcagc    218760
     gcataataaa gcgtatgtta ctccgtcagc gggccagaat tatgattctg aacaggattt    218820
     tgatgctgga ttgtcacaca cagaatcacg cggaaaaaca gagccacacg gaaaaatatg    218880
     aataaaaccg cagcgctcgt cgcggcactg attgttttta gtgctgtaat cgctgcccta    218940
     gcaagccagg ttctttctga acttggatac agtgtgtttg tcccatcgta cacttttgtt    219000
     ttcgcttgct tggctcttgc attgatacaa attattctcg cgattagaat aaaactcgtt    219060
     ctcgtaaagg gcaagagggc aataaatcca gcctttgctt ataggattct tgctcttgca    219120
     aggagttata tcttggctgg atccctattc tttgggtttt tctctggaac cgcactgtac    219180
     tttgtgcgag ggggctttat tccagaaaag ttttatttac ttatcccacc tgccattgct    219240
     tcgttgattg taattatcgc gggtgttatc tctaagtttc tcttacgtat cccaaaaaac    219300
     cacggtgcag ccgcaaactt agaatgaatt caatatcttg ccataaatat acacatgtta    219360
     ttagtcggtg tctttatggt tgaacttgga tttagggtaa gtgggtcagg tcttgctttc    219420
     ttttatccag gtgcagtcct cggtattttc ttttttgaga ttttcttata caatttgatc    219480
     attcggtgga acccaggtat gcatctgaat tgctatttgg ttcgtccgtt tgtgaatggc    219540
     aggggagtga agtggcaaag cttttggatt atattgccga gtcgcgtgta aaaaaaggcg    219600
     agcttctgtt tgctgcggat ggcctttcaa agttctacgg aaaagatgcc gccatagaag    219660
     gtgtgagttt cgaggttagg gcgggtgact gtgtcggcct tataggtcca aacggtggtg    219720
     gtaaaaccac cctcatcaac ctgattctcg gctttatgcc accgtcctcc ggggcaatag    219780
     cctttcactc ggttctaagc acaccgaccc agcgcggtct caatactggg attatgcttg    219840
     atatcccggc tgttccctat ggccttagcg ttattcgtta tttctcactt gaggcgaggc    219900
     ataggcaact gaatgacagt gatgtctata ggtacataaa tgattttgat cttgcttcca    219960
     agagaaagaa gagcttcaag tcgctttccc agggttggaa gcgaagggtt cttcttgttt    220020
     gtcttctgat gctgtctcca gagttcttgg ttcttgatga gccaacgaac agtcttgata    220080
     ttgagggtat tacttggctt agggaaatta taaaagccag gacgcagcgc ggtcttacaa    220140
     cttttgtatc gagccataat catcatgagc tctcccaggt tgtaacccgc actctgatcc    220200
     tgaagaggca gcttcgttac aatggtgatc ttgcagacct ggccaaggat ggtggggatc    220260
     ttgagaaggc ttatttccgt cttacagatg atagtgcggt tcagtatgga taattttaga    220320
     tttttgtata tagatttcct tagatctctc agatctgcgt atctttgggt attcttttca    220380
     atcaacattg ctctcgtcat tttgaccgca ttgtctaatt ggttattagt ctctcaaggg    220440
     ggtgtctctc acgaatccgt cagtaaggcc attgtttcca tgcccgtgtc gaccattacc    220500
     atatttatcc cggctgtggg gattatgttt atttctaggg attttgtaag tgggtatatt    220560
     cttcgtgcca cgctattgct tggcgattgg cgtaggttct ttttcttgag agctattgag    220620
     gctgttgttc tgtctgcact ctttgtgctg gctatttgtg ttctgtcggt tcttttcagt    220680
     tcagtctttc tggcctttgc cggctacccg gttgggaagg cttttagttc tgatctcttc    220740
     ttgtcgcttt tgtcttgtat ccctgtatcg tgtgttgttg gcctcatggc gtattttctt    220800
     ggctgggctt tgcgcggtgc tgttgttttt atgtcggtct attttccata tgttttcgtc    220860
     gctgatccgg tgctttcgct tcttatcccg aattttgtct ggttttccta tcccggtgca    220920
     gttacgcgtg ccactaactt ttttccgact acaccgggtg aacatgcact ctctgggtac    220980
     acatctccct atataggctt ttcggttgta ttggcatact gcgctgtcgc gttcctattg    221040
     gcatatttca gaaatactag acgtggtggc attctctagc tggggatggg ctatcttcat    221100
     gttttggcgc aacgtggcgt tattcatgcg acatgggttt ctgctctgga gccggtttca    221160
     tccaatctcg ccgcaatggg ggattgcttg cggtcgcttc gctcaaaggg tgagtcattc    221220
     ttaccggcac cgcgtaatat tctcagggct tttcgctatc cattcgactc tgtaagggtt    221280
     cttatagttg gccaggatcc gtatccaacc caagggcatc caattggtct tagctttgct    221340
     gtcgatcata aggtgcgtcc gcttcccggc agtctgcaaa atatatacac tgagtatcga    221400
     agtgatttga accttgatcc gccacagcac ggtgatataa gtctttggtc ggaacgcggt    221460
     gttatgctct tgaacaggac tttaacggtc cgcccgggca taccctcaag tcacagaggt    221520
     cttggatggg aagagattac gcagactgcc gttagagctc ttgcggcccg cgatgttccg    221580
     ctgattgcga ttttgtgggg caggcatgca caggagctta agtctgttct acagagtgac    221640
     agggttgcca tactcgaatc tgttcatcca agtcctatgt cggccacgag gggctttttc    221700
     ggatcaaagc ctttcagtaa agcaaatgac cttttacgag accttggttc cgctccaatt    221760
     gattggcgtc ttacctaatc gggtcgagag aataattgta agcggacact gtgagggtct    221820
     ttagaagttt tgattgcctt gggcgggata agcgtaccgc tttaacgata gggaaatttg    221880
     atggagttca tctcggccac aggcgtttgt tggaaagaat cgtagcatta cagaatcagg    221940
     acacatctgc gcttgtagta acttttgatc gtgatccaaa aactttcttt aaaaaagaca    222000
     tgtcctttgt gcccctctgc agtttggagc agaagctttc tcttttagag aattgcaata    222060
     ttcctaactg tcttattctt agatttgatg atgagtttgc gtcaatgtcg gctgaagatt    222120
     ttgtacataa agttttgctt gagaaattga atatgtcttc gatcgttatt ggagatgggt    222180
     ttcgttttgg cgctcgtggg cttggtgatg cgatgctttt ggagaaactt gcgcgcgaat    222240
     tgggctttta tcttgaagta attccaaaaa tacaatttgg caagacaaat atttcttcga    222300
     cgcttatacg taaattttta tctctgggtc aagcgggcaa tgcgtcaagc tgccttggca    222360
     ggaaccatgt ttgtacgggg acagttgtgc acggcaaaaa gcgtggtcgc gaattgggat    222420
     ttcctactgc taatttaggc aaggacgtct cgggctttat tccggccgat ggggtgtata    222480
     tcggcagaat aatttctgac cgatcctatc ccgcagcggt ttcaataggc cgaaatccaa    222540
     ccttcggtga tttggaattt tcgcaaatag aggcccatgc gctttatgag gatatttcct    222600
     cacttgatct gtatggcagg cggattgacg ttgagttcat cgcgcacttg cgagatacca    222660
     tgttgtataa atctattgac tcgttaaagg cagccattcg ctctgatgtt gagcggtgta    222720
     aagagtattt ttccacaacc gtgggttgat atctagtcgt gcccgcttag tcagtcagcg    222780
     caacacgttt ataagcttca ttacacagtc atcattacat aacatcggta acacgtttac    222840
     atatggagca tggcgggttt tattcgcaca gcaggtgcaa cgcatgaccc caccgacagg    222900
     tatctcgcgc ctaagagtta cagggcgtgc aaacgaaccc accaggcacc gaaggctttg    222960
     ttgcgtgtgt aaccttcatc tgtaatgcat agacctgcac tcagctttat gtgttaaatc    223020
     aggtgttaca atgcgtggac catgtgttaa aatgtaggcg tccattacag agagagggcg    223080
     agtctgtaat gattgaatat gtgtaatggt gatgagtgtg gttaaaatga ggattcttgc    223140
     cgcattgcta acaatccctt taatgtttct gatcgcaatc gggcctgtta gcgcggagac    223200
     gcagcacgta caagaaacag ccataaggtt gacagctgat gacacaaacc aaataatcaa    223260
     agaactagaa caagcaggat tcaccaaaca agtaacaggt aacaagagac aagaaacaat    223320
     aaccctaacc aaggatggtg taactgtaac ccttacacat gtaacacaac agacacagac    223380
     aagactttcc tggggtgatg acccatgggg tttctacata aaactggaat ggcatgaaca    223440
     agttgccctt gctgcaggca ctcttgccgc tggtggcggt gccggcctgg cccttaaggc    223500
     cgctctaaaa atagccgtga aggcaggcac cgcatttctg gctggcctgg aggtggtaga    223560
     caagttgagt gacatcattg gcgcagggcc ctgccctccc ttccaacccc gctacatccg    223620
     ctttgatccc ttcagaacca aatgcaatta acccaggtgg ctttgttgca agcgtatgta    223680
     atgcacttcg tgcaactcgc ctgctgtggg tgctgacgcg atgaacagac aatcatcctt    223740
     ctttcccctc ctaacaggtt tcttcaccta tctctttctc cttacaagac cacataagag    223800
     aagactgttc atggcaggat tagttaggaa atattacaga gatagtactg cacgtacgtt    223860
     gatctttgat ttttatgagt attctgtcga agggggtatt ttatgtcttc tgttgggtgt    223920
     accttcctat atccaactta cagaaccgct cttacttgct ctggtggttg ctctggtggc    223980
     actttgcgta gcactaatta tgcaccattc acagtatact ctcgtgctat tcgatgattg    224040
     gggaattgat aaacgatcct tcctcctccg ctactcctat tactcacaaa ccccatcttt    224100
     ccaaaaccca accaaacgca gacaaatcct cctgcttgac actgttacaa gatatggcag    224160
     caaatggagc agagtgtatg tggctaccat ggctgtatgc attttttttc tagttggaac    224220
     cccgattagt gcctggtatc tcggtgcgct atctttcttt gcttgccttt tttacacttg    224280
     tttttttacg attctcccat cgatcatatt cccgttcgca ttcgatggtt tccccgccct    224340
     cctagtccgc aaactcctat ataacctaca tataagaaga catggaccaa taccaaagga    224400
     actaacagat atggttaccc aagcctatga gatatatcca gaaaggcttt atccttggtt    224460
     ccgctcaagg aaaaaccaga aatgtgaaag ccggtaactt ggtgatgcat aacgcttctg    224520
     atggactttc gtcggatgat acagatgccg atacgggtaa aagatcaaag ccaggcagga    224580
     taagaagggc actcaagtcg actattaact ttattattga tcttcttccg tgaaggttta    224640
     ccaaatcact tcttgtgtca ctaactaaga cgtttgttga aaacctgttt tagtattctc    224700
     cgcgcggtgt agtgtaaagc ccatgacaaa acccgtggca tactctatct atgcacttat    224760
     cgttatcctg actggtattg gtctgggtat tattggactt ccctttgcca cccttgcgtt    224820
     tatcgcgatt ttcgtctcga ctcctgcttt gtttagagct gatatcagag agttacggct    224880
     tcccaatgca attacgcttc cgcttatcgc aattggcatt gtggcgttac ttgcggatca    224940
     gattgttcac cccaatttgg atattgtctt ttctgctctt atcgcaattg gcctatcctc    225000
     attccttttt attgtgtcta tttttggcgg tatgggaatg ggggatgtaa agttatcgct    225060
     tgccctgctc ttgtgtgcgg cgaatctggg ccctgccttc cctataattg caatctctag    225120
     tgccttcctt gtggcattct gtttctgcat cctgatattt gtaggtctct ttagattctt    225180
     taaaaatagt gggagaatta gctgtttgcc gtttgggcca tttttattgc ttggattctg    225240
     gacaactgtt attgtgtggg gtatagacag atggacagat gtggatatcc tcagaattat    225300
     ttggtgacag tttctgcggc actgcctttg cccggatacc tgctacgaca gcactgaaaa    225360
     gctgacaaat aggtctcctt ggttacattc ctttttgtct tttatttcat tagttatcca    225420
     ggcctgcttg tcgtgccacc cagaaaaccc ccagactaac ccaaacataa tcatgtatat    225480
     cacctggatt acaccacagg ttagacctat cactccttat atcgtcacct gcgcgttaat    225540
     cttgtcacct gcgcgttacc gctaccgtat tacggtaacc ccatcacaac aagcacatac    225600
     cctatctctc cagagtgtcg cacacggtca aaggctgata tatttagacc tagaaatgtg    225660
     gtccgtacga tttttccgcc tggtctgcct gcgtttgggt gttttgcttc tgcttgtcct    225720
     cgttagcagt ctattttctc tttttggaac agctggtgtc acatttttct tgggcggtgt    225780
     tccggttggt ctcttgctcg gaatttctac tttaacccta ttctatttgt cgatacgtct    225840
     catgttccta agtaggattt atttggcaat aagcggagta accaattttg ctgttgttgt    225900
     attttatggc aggaatattc cagcagacca ggttgttatc tggatttgga tggcatcttt    225960
     gccaattatt tgcggtacaa tcctctctgt gcctttgttt ggctccagac gttatggtgc    226020
     ttcggcaccc gatgcttagt ggttgttctc ttgtcttttt gttttcttgg gttggagtta    226080
     aatgacctat gttatcgcgt tcccgtgtgt agatctaaaa gatagggcct gtattgatga    226140
     gtgccctgtt gactgcatat acgagggtgg ccggtcactt tatataaacc cggatgagtg    226200
     tgttgactgc ggtgcatgtg agcctgtttg tccggttgag gcgatatact acgaggatga    226260
     tctccctgag gagtggggag agtactaccg cgctaatgtt gagttttttg atgaaatagg    226320
     ctctcccggc ggcgcggcca agcttggacc tgttgatttt gatcatccaa taattgccca    226380
     gttgccaaag tcatcggata gtgtttagcc gccaattgtc ttttaagacg gtgtcgtctc    226440
     gcttctctct ttttaccccg cggtgtctcc tgcgctttgc ctgtattatt gcgcaattta    226500
     ccaagagggt atttcttcgt ttttggaacg gccattgggt tgttaccatt cttggaatat    226560
     atatcgcctc gagaatagta accacgattt tggtgttgat tgtttccacg aatcagcagc    226620
     caacttttgc aatctcgcat aacccggact attttgcctt tgcaaatata tgggatgcaa    226680
     ggtggtacga gtcaattgtt tattttggat atccaaaggt cttgccgact aatgcgtttg    226740
     gttatgtggg gcaaaatgca tgggcctttc tccccgggta tccaattgcg gtaaagcttg    226800
     ttatgttcct gtttggcctg ggcttccaaa aggctgcagt tgcaatctct ctgatatttg    226860
     gcttccttac ctgtattgtt atgtatctct tgcagaggag tctgttttcc cgagacaggg    226920
     ctatgctgtg tgttttgtta tttgccttta acccattatc tccgctgttt caatttgggt    226980
     atgcagatac ttacagcttg ttctttgtgc tcttagcgtt gtggtttcta aggcttcgcg    227040
     aatatgccct attagttgct gttttgccgg gtatagcctt ttctagacca attgccctgg    227100
     cgtttgcctt gggtcttata ttgttgtttc ttatgcgctg cgtaaaatcc aggcaaggaa    227160
     aagaggaatt tccaaaaaag gactttatgt ccctcctgat agctagcgtg gttgcggtaa    227220
     tccttggctt tgcttggccc gtcatagcag gtatattttc tgggagactc gatgcttatt    227280
     tggctacaga gctctcatgg aggatttata tgcagtcaga tccgcatttt gcaatctttc    227340
     agccctggtt tctcgcattt tatttctatg caacttattt tggtatgccg ggctggattg    227400
     gcatactgac cgcggcggtc ataatcctga ttttgctttt cgttttgttc tgttatatac    227460
     gacgccttgg tgatgaaatc tttagctggt ctgctgccta tattgtctac attctcgcgg    227520
     ttttttttcc tcagagcagt gtttttagaa tagctcttcc actgtcacct gcgcttgttc    227580
     ttcttgcgcg aagaaaaagc attgttatca tatttctcgt tctatctgtg attcttcagt    227640
     ttgtatggct cgatgtcttg tgggttatat cacccggggg agatccagcg ccaccgtagg    227700
     atttgcgctc tgcattacgc gcgtgtttgt gtctatttcc tgaattcctt tgctgttttg    227760
     tgactgtttg taccaaactt cccagattat ctctcagggt ttgttgtatt cagggtccgt    227820
     tgtgtttatt gtcgtaaaac atctgcggtc tggcattgag ggtatgggtc ctctggattt    227880
     attctgccaa tctgatatcc ttctgtacag gaacggaaag gggttggccg tgcttttgtt    227940
     cccttggggg ggggggcgtc ctcaatcgct ctgcagccag tggtgtttcc tctggcgatg    228000
     ctctggctag tgatcgtccg actactaatt ctgtcctgac cgattgtgtt ctggggagga    228060
     tagggtgagg cggaagctgc ttcccgtttt gctattttct gtttttctgt gggtttgcct    228120
     tcccgcgcaa tctgcccagg cttttttatt tgacggtaag aataatattt ttaagcagct    228180
     acagcaaacg gcagaaaaga aactaaagga attaaagggt actgcacaaa aagctgtaaa    228240
     cacggtaaag aagaaggttg agcaggcgaa gcatacggcg gaaaccaagg taaaagaatt    228300
     acagaataca gtggcaaccg ccgtgcataa tgcggtgcag ccaaaacccc agaagcgacc    228360
     agcaaagcct gttgctacaa aggcccctcc tgcacccaag ccatcatcca gctctgctcc    228420
     ctcgcgggta tcaccgccta caccccccac tcactcttct agcgcctcgg cgtcggtgac    228480
     tcattcatca tctattccat ctgctactca ttcatctaat tcttctagtg ctcgcgagtc    228540
     ttctggcgca accagtacct catcttcctc ggccgatgct ggtaaatctg ttgcggcaga    228600
     gtcttcaccc ggcttgctta taccggccgc cataacggca gctgtaacgg ttgccattac    228660
     atcaattact gccgttatgt atatcgtgtt ttctcgtttt ctttagattc cacgtattct    228720
     tgtccgcttt cactcgcatt taactgcatt cgtaatctgc gcccctggtt tatcggttac    228780
     gcttgctctt ctagataaga gattgctcct acggcaggat ttaccacaca aggttctata    228840
     gcattgcatg caggattgca tgacttaaca gtgccctgtt tgggcttgtc gaagggccct    228900
     gcagttctgt aactaccgac cttgagctaa atttctaata agctgctcta tttcggtttt    228960
     gtaaccgtta ggatcccatc tccaatcggt gacaggcagc ttacaaaagt ttcggaattt    229020
     acaacctcgt gaatcagagc gcgaaagctt atctctggtt catctttata aactgggcta    229080
     gcaacttttc cctgccatag ggcatgtggt acgagaattg ccccacctga ctttacaacc    229140
     ccgagtgcca actcgaaata attcaaaaca tcgcgcgggt tcgcgtcaat caggacaagg    229200
     tcatacatat tgcgattcat gcgcgggata acctccagcg cattactatt tataaaacgc    229260
     agacaggaga agtagttggt aaggttattt tttgctcggt tataaaagtc ggggtttacc    229320
     tctatggttg ttatatgagc cttcctattg accgagacca tttttagagc cgatagccca    229380
     atacctgttc cgatctccag aacctgcggg gcaggcaatg ctgcaacctg agtttttata    229440
     tgtgccccaa ttgcagggca aattgactga atataaagct cttctgacag cagtctgagg    229500
     tgtttttctt cttcagtatc ctttggtagg ctctgggtaa aattccaatt aatctcggcc    229560
     ttcacccggc aatgatatca aaagagctat tattgtttgc gtgcatgtat tgggtattgg    229620
     ccttgacaag atagttatta ttgctttttt tgctgcccta ttattgagcc cgtcgcagct    229680
     tttggcctat gccaaaaaaa ttggtttcta tgctgggaag atacgagtaa tgtctgatct    229740
     ggtgaagaag caatttgttg atgcaactag tgaacgcaag gttcccgtgg gtgactttag    229800
     cgtaactgat gacgaggcaa cgtgattaac atcaggaatc tcccccagac taacccaaac    229860
     acaatcatgt atatcaccta atacaccaca gtgatataca cccatctaac ccccatgtta    229920
     taatcaaccc ataacaggtc aaaggagata aaatgcctaa gacaaacata aagttcctaa    229980
     taataaccct ctccgtaatc ttctctctaa tattcatagc aacacccaca tacgcaacaa    230040
     catctgtaac aacagataaa gcagtagcaa caaccacaga accaaaagcc aaccaaataa    230100
     tcaaagaact agaacaagca ggattcacca aacaagtaac aggtaacaag agacaagaaa    230160
     caataaccct aaccaaggat ggtgtaactg taacccttac acatgtaaca caacagacac    230220
     agacaagact ttcctggggt gatgacccat ggggtttcta cataaaactg gaatggcatg    230280
     aacaagttgc ccttgctgca ggcactcttg ccgctggtgg cggtgccggc ctggccctta    230340
     aggccgctct aaaaatagcc gtgaaggcag gcaccgcatt tctggctggc ctggaggtgg    230400
     tagacaagtt gagtgacatc attggcgcag ggccctgccc tcccttccaa ccccgctaca    230460
     tccgctttga tcccttcaga accaagtgtg gctaatctgt aacagataag gagataaaat    230520
     gcctaagaca acaacatctg taacacaacc cagacaatca tccttctttc ccctcctaac    230580
     aggtttcttc acctatctct ttctccttac aagaccacat aagagaagac tgttcatggc    230640
     aggattagtt aggaaatatt acagagatag tactgcgcgt acagtactat caaccacaga    230700
     tatcttcctg ttctcatttg ttatcacctt tgccattgct gtattgattg gtatgtcctc    230760
     tgcgctatat ttcatcatcg cttctgtccc aggagctgtg gtatatgaat cctctctatg    230820
     gcaatttgta tggtggtcct ccattctggt ttcctttgtt gttgcctacc tttatctaca    230880
     gatcttttca ccttctgaca gatccttcct cctccgctac tcctattact cacaaacccc    230940
     ctctttccaa aacccaacca aacgcagaca aatcctcctg cttgacactg ttacaagata    231000
     tggcagcaaa tactacagag atttagctaa gttctggctg acactattag cgatactcgt    231060
     ctttattggc gcgttgttca tctttgtcac gcagaacttc tcaattctca atcctatttt    231120
     cctgcttctt tttcttctct cttgcctcat ctcgtttttg gtgatcgact cgctctcggg    231180
     tagcctagtc cgcaaactcc tctataacct acatataaga agacatggac caataccaaa    231240
     ggaactaaca gatatagtta cccaagccta tgagatatat ccacaggtaa ctacataagc    231300
     cttagttatg tactgcataa ctaaccgaca ggtgcaccct ttagggtctt atcaagtaat    231360
     tgatcgaacc tcttagcaaa gtcctctgca tgctcattag gccatgaata ggcgtttgtc    231420
     cggatttttc tttatcattt accaaacgca ccgctccaga gatctgcaaa ccgagggaat    231480
     gttttactcg tgcactcgat atcttctata gtcagtttat gacgaaggcc gattattgcg    231540
     cctgacgttg ccattctgtg gtctttgtag gttttccata caccacttct tgtaagagtg    231600
     gttggggtga tttttatata gtctttccca gctgttatcg tcccgcccag tgaacttatt    231660
     tcattaacaa gcgcttcaat tctgtcagtt tcgtgatatc ggatgtggcc tatgttataa    231720
     aacacacttg gcgtttctgc cagagtggcc agtgcaacaa gattgggcac aagctctcca    231780
     atatgcccaa gatctgccct aattcctgtt atatttcctg ttccactgac ggtaatagta    231840
     tttgcggttt ttgttatctc cgcaccaaac tgcggcaaaa tagcttccaa atattttcca    231900
     ggttgcgatg ttttgcttgg ccagttctgt atcgttgcac tgcccccggt aacaattgca    231960
     ccaatcataa atggagccgc attggataga tctggctcaa tggtgatatg tttaccagtt    232020
     aattctttgg gtgttactgc ccatacacca tcggagtgtg ttacattgat tccccactcg    232080
     cgcataactt caactgtcat atcgatatat ggacggcttg gaagggggtt accgatatgt    232140
     tttagagtaa gcccattttt gaatctgcat gcagataaaa gaagaccgga gataaattga    232200
     cttgaagaat gttcggtggt ttcaagagcc ccaccctcta tctcccccct tccgtgtacg    232260
     gtaaatggaa tacgatcccc atcaacttga acaccaagtt ttcttagagc atgaagtgtt    232320
     ccatccattg gtcttcgaat tgcctgatcg tcaccgaaaa attcaactga tcccttgcat    232380
     agccctgcca aaaccggtaa aaatcgcatt acggtaccgg caaggccaca gtcaattttt    232440
     gtgctgcagg tgtaatgctt tgatgggatt atcctcacgt cgctcggctg tatcagatcg    232500
     ttgaggcatg tacagtgtgg cgatatcacg ccggtatcat gcgtaccggt gtgattgagc    232560
     ttctctattt tgcacccgat acgccttaga ccttcgatca tgaggttcgt atcacgagac    232620
     tcaagcaagt tatgtattgt agtttcccca ctcgcaatcg ctgcaattat caagtgtcta    232680
     tttgttagag attttgatcc gggtatcgac atcttaaaga gtgctctatt gcctagaggt    232740
     ggttggtaca tttcagtttt cgccatcttg ttgcccacta aaattgtagt aatggagcat    232800
     gtttttttca gtgatgtgtc tgtccacact ggcaaaaaaa tggcatcact attagccaaa    232860
     gagtttggta ttagtcgggt gatagacctg ctcacatatt accctcgaag gtacatctgc    232920
     aggggtaagc ttactaagct ttcagagcta attcccggag acgaggttac gattgttggc    232980
     cgggttctaa gcaccgagca gcgtaagaca ttcagtggag cgaattttct cagcgttacg    233040
     ctcagtgatg gagagaatat cattcaactt gttttctttc accaaccctg gcgcgcagaa    233100
     aacttgaaac ccggtgcatg tgggctattt tcgggaaagg taacagagtt caataacaag    233160
     aagcaactct cacatcccga atatgaatta ttttcatcag agccaacaag ggaacagata    233220
     cagaagtgga atgagcagat aataccgatt tatcgcgctt gcatcgcgtg tccaagctgg    233280
     aaaatagccc gggctgttga tttggcttta gaagcggtaa agggccaaac tgtagatttt    233340
     atgtcgggta attatggcta tatgtcagtt gaaaaggcgt tttatgttat tcatcatcct    233400
     acggacaacg aagagcttga ggccgcaaaa gaaagtttgc gcttttttga ggcatttttg    233460
     ttacaaagcg cccttctaca ccgaaagcgg ttccgcaata gagcaagcgc aacacctttt    233520
     attcgtaaaa atggcggttt tttagagaga tttgatgcga ggctggagtt ttctcagact    233580
     aatgatcagt tgcgcgctgc agatgaaatt ttcgaagact tgtcgctgtc agagccaatg    233640
     acccgtctct tacatggtga ggtcggtagc ggaaaaactc tggttgcgat aagagctatg    233700
     ctccttgcgg cagataacga catgcaggcc gtcctcgttg cgcctaccga agttcttgca    233760
     aaacagcatc acaggaattt aactcgcatg ctgggccacg agctatgtgc cgagatacag    233820
     ccatctctct tgcttggtag ggaaaaacac accttgcgta ttgcctcagg cagaagcaag    233880
     atcattatag gaacacattc ggtctttagt aaaaaaaccg tatttcataa tctcgccctt    233940
     gttgttatcg atgagcagca ccgctttggc gttggccagc gggacgaatt acttttgaaa    234000
     ggggattcac ctcatttgct tatgctgtct gcaacaccaa ttccacgaac agttgccctt    234060
     tctctgctga attttatagc aataagcgag ataaagacac caccaagcgg taaggctgaa    234120
     atttcgacgc atgttgtacc ccttgcagaa aagcctcaat ggggaaggga ggttataagg    234180
     aggatttccg aggaaataca aaaaggtcac caggtttttg ttgttgcgcc cgttatagaa    234240
     caaagccgta cgggcgcggc cagcataagt gccttgctaa gggagcttga ggaaacccct    234300
     ctccttcaag gcgcgaagat ctcccgactg catggcaagt tgaccgctgc ggagtgcgag    234360
     aagtctatgg aagagttctc ttgcggggcc agcgatattc tgctctcaac aaccatgatt    234420
     gaggtgggta tagatgttcc aaatgccacg gcaatggtta ttgtgtcagc cgatcgcttt    234480
     ggtatcgctc agttgcacca gttgcgcgga cggatcggtc gaggtaattt gcccggcgtg    234540
     tgtcttcttg ttactaatgc ccccgagggc tcggcggcgc gctctaggtt ggatttagtt    234600
     gcaagaacac atgacggatt ttctcttgcg gaaatcgata tgaaaatgag gagagaggga    234660
     gatttgctcg gcctgggtca atctgggcag ggtaattatc gccttttacg ccttgatgag    234720
     gacctgcagg ttttatcgga cgcccgatta cacgcggagg gaataatgga gaatgacata    234780
     aaactcgaga agaataagct tcttcgattg tttttgtctc aatatttgtc gggcactaat    234840
     ttgagtcgat tgctttcata agaaatttat gtattgagca atttatcctg tactatcatc    234900
     tccgccgacc acctgatttt agagtcagtt atctagctgt gtgcgatttt atatctagat    234960
     gttctatcct gatactctgc gatgagtaac aggatagctg ttgttccggg tacgtttgac    235020
     cccgttacaa gaggacacat ggatatcctt accaggactt caagaatttt taacacactc    235080
     tacgtcctgg ttgcaaataa tccggataaa accccacttt tacctatgca tgaccgagtt    235140
     gatctggttg gacaggcttt ggaagaatac ggatttcccc gcagtgagcc aaaatgtgac    235200
     agtgaatcag accgtaatgg gccaatagtc aagattcatc gctttgaaaa aggcctgttg    235260
     gttgattgct gtaaacagct tggcgcgacc gttattgtaa ggggacttat ttcggccgat    235320
     gcacaccgag aggcgtcgat ggcatatgcc aatcggaata tgagtggcat tgagactgtg    235380
     tttattttac ctgacccccc actgagcgtt gtttcaagca gcatggtcag gcagcttatc    235440
     gcacttggtg gtgatatatc cccgtatgta ccggcttgtg taacgcgttt ttttgggacg    235500
     cacagcggtt agggcaaccc ttagattcat tctgcagtta tgagttgtac ctgtctaggg    235560
     gttttattgc cgtttaaccc cactctcgga tgatcttgca atataagtaa tttgttttgc    235620
     tactcgaaat acttgtttcg aaatacttgt ttcactgggc ttgtagcatg aaatgctgag    235680
     cgaaacctgt caagatggcc cacaggacaa atggacgcat tctatttcac agagttcgtc    235740
     tatttcacag agttcgcgtt tccagaaccg gtattgttgc acacacctat gatcttattc    235800
     gacggtttta ttcgaccctg acatcccgat tattaacaat ttcgttcaac cacggaaata    235860
     cccaagtgaa caaaattgtg aacaggataa ccagtaacag caatgcctgc agtagcttaa    235920
     tccaaaaaga tccggggaga attctccata tgaacgcata catatcagct gtttacaata    235980
     ttcactattt catgtggtac gtctgcttgc catttttcaa gaaccgcata tgcgataagc    236040
     ctctcggcta cagagaatgg tggattacat gttgtcatcg tcataatata ggtttcgtct    236100
     ggaacagcaa atgactgtgg caaaggccgc aggacattca ccccatcggg ttttacgtac    236160
     tcactgctcc gatacgcgta tatgtaccaa ccctttggcg tcaaaacata gattttgtca    236220
     cccagccgaa gttctgacaa ttttccaaaa gccgcgcccc acccaacttc atgtgctgca    236280
     acagcaaagt taccggatgt gccaggtagc gcggtatgcg ggtagtgccc aactccagcg    236340
     gttttgctgt tcaaaacgcg cgtaacatcc gtagtttctc taattacccg cttgtatttg    236400
     tttccaaaac gaggaacgaa caaaactgct atatcctcat aatcctttac cctgtcggta    236460
     accggcatag tctccgtggc gtcggacctg tggcgcatga actgagaagc ggtgaggttt    236520
     gcgctattgc cctgttccca tgcggttaag ggtgagtcta tatataaaac ccaggtatag    236580
     aaaatcccaa caagtacccc ggcggtcatc gatagttcgc caaatatcat gacaatcctc    236640
     gaccatcctg acgccggttt tgcctgttcc cctcgcggaa atttgacgcc cctttttgta    236700
     tgtttggcga tcatacccac ttgaataatg ttactgccag taatttgacc gagacggtat    236760
     tatctcgcac cgcgggctat ttgtttagtg gattctaacg atcctgattt cttttatatc    236820
     tgttactttg gggtgctgca cagtaaggcg agtctcaaca aaggtccgcg ttttccctaa    236880
     ggtataagcg gagctttatc cataagaata tttagaactt aattttgttc agttagtatg    236940
     tagttgtatc attcacctgt tagtgagatt gcggggttgc tgtggctgtt ccaaaaagga    237000
     agaagtctcg tgctaacact cgcgcccgtc gctcgcagtg gaaggcttct gttcccggtt    237060
     ttgccaggct ggaggagcgc gggagacctg ttttttacct tccgcatcgc gcgcgccgta    237120
     ttcttgactc caatggaaat gagctcttta tggaatacaa gggccgccgc gtcgggtagg    237180
     tggatggcgt tgatgaactt cttttgcgga agttcaatct aacacttcct cctgggttgc    237240
     ttcgtacggc gtttgtccac aagtcctttt cttttgagaa cggcgcgtgt cagaataacg    237300
     agcgtcttga gtttcttgga gatgctgttc ttggccttgt tgtatcgcat tacctatttg    237360
     agacctgtcc tgaatacact gagggccaat tatctgccgc tcgctcatat attgtttccg    237420
     gcacatccat tgcacaaatc gccaaagagt taaatcttgg tcagtttatg ttgcttggga    237480
     aaggggaaaa acttgccggt ggtatggata aaacatctct tttggctgat ttgcttgaaa    237540
     gtcttattgg ggctgttatg gttgatcagg ggttcgagag tgccagagat tttgtattag    237600
     cccttgttgg agaaaagcta agacaagtag gtgagttttc tgtcgacgat ccaaagacga    237660
     aactgcagaa gcttacccga acacagttgg tgtacgaggt tgttaccgag ggcccgccgc    237720
     acagtcgtac attcaaggca agcgttattg tgaatgaaaa gagatttttc gggcaagggt    237780
     caagcaaaaa acaggctcaa gttgcggctg caatgtctgc acttgcatct ctggagaaca    237840
     aaagttcata gcttatttct tgattagagc gtttgtatga tacgatccta agaaatctag    237900
     gtaggctgag gtgatgtgtt ttgaataagc ttagggttcg tgttctgttt gcggcttctg    237960
     ccgcgctttt gttcttcagc gggtgttttg gctcgggtga taataagtcg agtgcggaac    238020
     atatagtcct tccaaaagtc acagctcctg tctcgtttaa gaatgcgcta tttcccgcag    238080
     gtgatggtaa ggcggtgtgt cctaagggtc tttctattgc ctatgtcggt attgttaccg    238140
     gtccgaatgc cgcctttggg aagagcataa atgaggcgtt tcaacttgct gttaagcagc    238200
     ataacgacaa taatcctggc tgtcaggtta caggtaaggt gtttgacaca gagggatcgc    238260
     cggataaagc tcccggagtt gtcgcgcagg ttattggaga ctcctcgatt gttgcagttc    238320
     ttggcccggc tttctcaggt gagaaccagg ctgttggggg tattttcgaa acggcgcgtc    238380
     ttgtacacat aactccgagt gcaaccctgc caacactttc atctcacggc tggaagacgt    238440
     tcttcagggc cgcctcgact gatctcgagc agtctacggg ggttattgct ttgctggaga    238500
     agctagaggc caaaaagact tttgttgtgt ctgatgacag tgcatacggt aaattcctcg    238560
     gcgatcttgt aaaaaagggt gtcgatttgg ctggaagcga tggaattata accggcagtc    238620
     gtgatttttc ctctgttgtc gcgaaggttg tttcttccgg cgccgactct gtctttttcg    238680
     ccggctatta cccggaagct gctgcattct ttacgcaact gaggggtgcg ggatttaatg    238740
     gttatttggt tgttccggat ggttcacttg atagaaatct cagtaagctc gctggacagg    238800
     ctgccgtggg cgtttacgcg gtttgccctt gcaccgatga ctcgcaggtc gccggttttg    238860
     gtgatgcaat gaaaaaggcc tacggtcact atccgggcat atactcctcg agtgcatacg    238920
     atgttacaac cattctgcta agggggatag actctgggcg cacctctcgg tcatccttac    238980
     tggactgggt caggggatat gatgcgtatg gggtttctgg tcactacaag tttaaggcaa    239040
     atggtgattt gcagcacacc cggctgtatt tctataggtt tgatgagtca ggtgctcctg    239100
     tattggttgg agagtacagt aaataaaaag ggtacagtag ataaaagcac aacaaaccgg    239160
     agtctggtcc ggtttgttgc ttagtttgga ttatcttttg agtcagtcgt ggatcacgtt    239220
     tgatgtggct tccttcatca agggctttgg ctttgctacg gttgaaggcc tgactttcgg    239280
     tgccatctat gcactgattg ccgttggcta taccgtggtg tacggtgttt tggggcttat    239340
     caatttcgct catgctgggg tttttgttac cggctgctac gcccttgtat ttacgctctc    239400
     tgcgcttggt tttagctctt ttccttctaa gaagcccatt tttattgttc ttatttacgt    239460
     cctcatcgcg gtgtttgttt ccattcttgc tgctgccgct gttgcctttc ttgttgagcg    239520
     cgttgcctat aagcctctta ggaagagaaa tgcccctaat ctggcatttc taattactgc    239580
     aataggtgct tccctgacca taagtaattt attttttctt cgttccccaa atccagagcc    239640
     tgcactttct atttttaccc cagtccctct ttttaaattt tttggtgcaa ctgttacaag    239700
     ctttaatgtg gtgacaattc tggctgcggt aatcctgatg tttttggttg actggttcat    239760
     aaggcggacc agatttggca ggggcattag agctgtggcg caggatccta acactgcttc    239820
     acttgttgga gtgaaccccg agcgggttat agcgctgact tttgttcttg gtggtgttat    239880
     agctggcgct gcaagtctgt tctatgttct aaaggttcct tcgggtgttg tgtacaatgc    239940
     ggatattgtt ctcggtttaa aggcttttgc tgctgccgtt ctgggtggca ttggcagcat    240000
     tcggggcgct ctactcggag ggcttctgct cggtctgttc tctaactggg gtgctctgct    240060
     tttgggtaat agccagtggg gtgatgtttc tgtctttgtt cttctgttac tagttttact    240120
     tttcaggcca tctggtatcc tcggcagatc tggcctttcg gctaaaagca ggatgtgatg    240180
     ggctttctat cgtctgttat gcggtggtgg aagggtatgt ctcgccccca gcagtggttt    240240
     tttcttcttc cgtttgtggt ccttgtttat cttttgccaa ttattaatcc tccggttatc    240300
     acaaccgaac cgggcaataa ttttccaatc tcactgttta caatggcaat ttatgccctc    240360
     gccgcggtcg gtcttaatgt agttgttggt tatgcaggac ttcttgattt gggttatatt    240420
     gcattttttg cggttggtgc ttatgtatct gctgtattta cgagtccgga ttctccgtat    240480
     gtcaaaattc cttatctttg gaccattcct gttgcgattt ttactgccat ggtttttggc    240540
     gcagccctgg gtgtacctac cctccgtctt cggggagact atctggcgat tgttactctt    240600
     gggtttggag agatagtcag aattatggcg actgttatcc ctgccctccg tggtaacctc    240660
     gggttttcca atgttggcca cccgccgggc gactatcctt ctggccagcc gattttcacg    240720
     cctgataatg gagtagcttg gtattgggtc gctattacag ttgttatatt cgttcttgta    240780
     atcgttggga atctcgagag gagtattgtc ggcagaaact ggtttgctat ctgccaggat    240840
     gaagatgctg cagaggttat gggtgtgaat accttttcct tcaaggtatg ggcttttgca    240900
     attggtgctg caattggtgg cctctccggt tccctgcagg ctgcacagac agggtttgta    240960
     aataatcagc gttttgatgt tgcgacctcc gttttattcc ttgttgcagt cgtacttggc    241020
     ggttctggta acaaatttgg tgctgcaatt ggtggtgcac ttgtggcgta tattccactg    241080
     cgttttacgg agattgcaca atacaagtat ttgatcttcg gtgtatgtct tatacttctg    241140
     atgcttttta gacatgaagg cctgtttcct atgaaggcaa atcttttttc aagacaggtt    241200
     ttgctgcgga aattgtcatt gcgccattca cccgataaac gtgcgtcatc ttcgccctcg    241260
     gggtcttgat atgcaagacg cgctgttaca gtctgagcat cttcttgatg tgcgtgatct    241320
     cgttgttcgc tttgggggta ttgtcgcgct cgacggcgtc tcgttcagtg ttggcagggg    241380
     cgagattctg gcgctcattg gccccaacgg cgcgggtaaa acaacccttt tcaacgtcat    241440
     aacgggtgtt tatcgaccaa cctcgggcga tgtatctctt gaatctgtgt ctttgaaatc    241500
     ggtaaagagg tatcgcatag cccgtatggg aattgcgaga acttttcaga atattcggct    241560
     attcggcggt atgaccgttt tagagaacgt cgcagttggg cttggagtgc atcacaaaac    241620
     ccatatattg ggtgcgctct ttagaacccc caggcattgc agggaagagc gtgaaattgt    241680
     ggagcgaggc cttgagattc tcgatatggt cgggatcgcc caggatgcct ataaactcgc    241740
     gggcagtctg tcttatggca gccagaggcg ccttgagatc gccagggctc ttgcttgtca    241800
     gccaaagttg ctttgcttag atgagccagc agctggcttt aatcctgctg aaaaaaatca    241860
     actcgtggag ctaattttaa aaatccgtga tgcgggatat tcaatcctat tgattgagca    241920
     tgatatgaag ttgatttttg atgttgctga tagagtggtt gtccttgatt ttggtaagaa    241980
     aatcgccgat ggattgccgg atgatgtgcg taatgatcct catgttattg ccgcctatct    242040
     cggggaaggg tagtgccgct tgttaactct tgagaatgtg aatgtcagtt acgggaagat    242100
     tcgtgtgttg tacgatatct cgtttacggt aaatcggggc gagatagtaa gtttgattgg    242160
     ttcaaacggt gcgggtaaaa ccactcttat gcgcaccata tctggccttc tgaacacgtc    242220
     gggtaaaatc ctttttcaag gtgaggatat aactaagtat gctccctaca agcgtgttct    242280
     ttctggtatt tcccagtccc cagaggggag gggggttttc ccaggcatga cagttcggga    242340
     aaaccttgac atgggggctt atgcgagaaa ggatcgtaag aatataaagg atgatttcga    242400
     cagagtttac gggctttttc cgcgtttgct tgagcgtcgt gatcagttgg gcggggctat    242460
     gtcgggcggt gagcagcaaa tgcttgcgat tgcccgtgcg attatgagta ggccaaaact    242520
     gcttttgctg gatgagccgt ctatgggcct tgcgcctcaa cttattcagc agattttcag    242580
     tattgtgcgt gagattaatc gtcagggggt taccatcctc atggttgagc aaaatgcgaa    242640
     tcagtcattg ggaatatcgg atcatgcaat ggtcctggag actgggaata ttacccgtac    242700
     gggaaccgga aaggagttat tacaagacgg gtccataagg aaggcatacc tgggggtcta    242760
     gtattttccg aagggtcttt gacaaagagg cacttaaagg ggttgtatct catggaacat    242820
     catccctttt tgaaatcctg cttagggctg atttcggata ttctgtagcg catgacatag    242880
     tcgcttctat tgggaataag tcgaatgtag atgatcgtga acggtgtttg cgggagtatc    242940
     ttgaatgccg gctatcttcc tttgatccta cgctgcgact cacaaatcac ccgtctgtta    243000
     tccttatcgt cggcgttaat ggggttggca agactgcgac cgctggaaag cttgcaaatc    243060
     ttttacatct acgaggcaag aaggtcctgt tagctgctgc tgacaccttt cgagctgccg    243120
     ctgttgagca gcttagtatc tgggctcagc gcgcaggtgt tgaaataatt acccccccca    243180
     agccacgcat agatccggca tccgttgcat attcttccgt caaaaaggcg attgatgata    243240
     attatgatgt tgtggttatt gacaccgcgg ggcgtcttca caataaggca aatctcatgg    243300
     ctgagctcga gagaatagcg cgggttaccg aaaagcttgt cagcatagat gaggtcttac    243360
     tggtgcttga tgcaactacc ggacaaaatg gcctgactca ggctagatca ttccttgagg    243420
     ctgtgagtgt aaccggaata gtcttatcca agactgactc gtccgcaaag gcgggtttta    243480
     tttttcaagt gcaggagagc acgggcgtgc ctgtaaagct cattggcaca ggtgaagcaa    243540
     ttgatgatat agcaggtttt gcaccatacg catttgttgc gcagatcttc ggttagtttg    243600
     tcttcgagct accttgattc atgctcggtt tgtgtttttt attttattct gacagaatca    243660
     tctggtcgtc tttttccgcg ttctagggct tgttgcacag tgggtttctc gcatgtttct    243720
     ttttggctct gggtgttccg ggttaggttg gttttatgga agagcagaag atacgtataa    243780
     ggctcaaatc ttatagccat gaaataattg acgtatctgc caagaagata gttgatacag    243840
     tcacgcgtgc tggcgctacc attgttggtc ctgttcctct tccaacgaag aagagcgttg    243900
     tttgcgttat tcgctctccc cacagacata aggacagtcg tgagcacttt gaaatgcgaa    243960
     cgcataagcg acttatcaat gtggtagatt tgacccccag ggctgttgat gcgctcatgc    244020
     gtcttgactt gtcctcggag gtcaatgtcg agataaagct ctaggggcgt gtcatggcga    244080
     gggctctttt gggtactaag gtcgggatga ctcagatttg gagtggtcgc agggttgttc    244140
     cggttactgc cgtcgcggtt accactaatg ttgtgtctca ggtgaaggcc ccagagaagg    244200
     atggttattc tcgccttcag attgctaccg gcgcaatcga tccgcgtcgc gtaaacagac    244260
     cgagaaaggg tcattttgct aaggcaggtc ttaccccacg gcggtttatc agagaggttg    244320
     actcagaggg atcgcttgga gatgagttcg ggcctgagat ttttcaagaa gggcagcttg    244380
     ttgatgttgt cggaaaaagt aagggtaagg gtttttccgg cacgatgaag cggcataatt    244440
     ttcagggcgt gtctgcaaca cacggctcgc atcgcaatca tcgtaagccc gggtcagtcg    244500
     gtgcttcttc aacccccagc agggtcttta aaggtaccag gatggccggg cgccttggct    244560
     caagcagagt gacggtgcat aatttgcgtc ttgtgaaaat tgattcagaa aatgggcttt    244620
     tgcttgttga aggtgctgtt ccaggatcgt ccggctcacc tgttattatc cgtgacgctg    244680
     taaagggcgt gccaattgtc tcctagcgcg accgtatttg atataggtgg gaatgcggta    244740
     ggtacattgc agcttgtcgg gcatcttttc gactctgatc caaacctgca tctgatacac    244800
     caggtcgtcg ttgcgcagca agccgcattc aggcaaggta cgcacaaaac aaagtctcgg    244860
     gctgaggtgt ccggatcggg gcgtaagccg tttaggcaga aggggactgg caatgccagg    244920
     tgcgggtcaa cccgtgcacc gcagatgcgt ggtggtggtg tcgtacatgg cccggttcca    244980
     cgcagttatg ttcacagaac cccaaagaaa atgataaagg ctgcgctggc tggttgtctc    245040
     accaataggg cgcgtgcggg gagagtgcat attgttgatt cctttggtga taccccctct    245100
     gttgctgatg cgcttactct gtttcagata accggattgt caagcaaact gcttgtagtt    245160
     gcacaggcta gtgattcagt tgcctacagg agtgtccgta atattccagg tgtgcgtctg    245220
     gtgcacgttg gtcaactcaa ttcgtatgat gtcttgagaa gtgacgatgt cctttttacg    245280
     agaggggcat ataacgtttt tgttggcccg tctggagatt tagcattttc tgaagaccgc    245340
     gacaatcccg gtacatcact tcccaaatct cccaccccgg aagatagctc cgatgccaca    245400
     aaagctcgtt cgtcccgtca tgatgatagg actggggcat gatgcgtcgt tacagctcct    245460
     ctgtaataaa taacaaacat gtgcacgatg tgatactcgg gcctgctatc tcagagaaga    245520
     cttatggtct tttagaagat tcgaaataca cttttctggt ggatccaaag tctaataaga    245580
     ctgaaattaa gctcgcggtc gaaaagatat tcggtgttaa ggtttcttct gttaacacta    245640
     tgaatcgccg tggtaagtta caaaggacgc gcaagggtat tggtagacgc aaggacagga    245700
     agcgtgctgt cgtcaccctc aagtccggca caatagattt gtttacgtag ggttgctatg    245760
     gctgttagga agagtaatcc gctgaccccc gcacggcgtg gtatgtcttt ttcagacttc    245820
     gccgaaataa cgcgcgctac gcctcacaag tcccttttat cgaagctgtc aaaaaccggt    245880
     ggtcggaata atcatggtag gatcactgcg cgtcatatcg gtggcgggca taagcgtcgt    245940
     tacagactgg tagattttcg ccggtcagat aaagatggcg taaaggccaa ggtggctcat    246000
     atagagtatg acccgaatcg taccgccaga attgcccttt tgcatttcct tgatggggca    246060
     aagcgttaca tcttggcgcc atctggcctg aagcagggtg atgttgttga atctggcagt    246120
     tcggctgata ttaggcctgg taacagtcta tgcatcaggg atattccggt tggtactatt    246180
     ttgcatgctg ttgagctgcg accgggccag ggtgcgaagt tggcccggtc ggccggcagt    246240
     tcggtccgct tatcagcgaa ggatggcgat tttgcgatcc ttaaactgcc aagtggagag    246300
     attaggatgg ttagcctgtc ctgcagggca accattggtg aggttggcaa cggacagcgt    246360
     cttaatgtaa gcttggggaa ggctggtcgc agcaggtggt gtggcgttag accttcggtt    246420
     cgcggtgttg cgatgaatcc agttgatcat ccacatggcg gcggtgaggg aaaaacttct    246480
     ggcggtcggc atccggttag tccttggggt agacccgaag gtaaaacccg cagagccaat    246540
     aagccgagcg atcgttttat tattcgtcgt aaatccagga agcgtaggta agcttgtgcc    246600
     aagaagtcta aagaagggcc catttgtcga catgcatctc ttgaagaagg tgcgggctgg    246660
     caatgagagt aaagacagga atatgattaa gacctggtcg cgcagatcga tgataatccc    246720
     tgagatgctc ggtcacacaa ttgctgttca tgacggcagg aggcatatcc ctgtttttat    246780
     aacagaatca atggttggtc acaaattggg cgagtttgcc ccgacacgga cttatcgcgg    246840
     tcatgtgaaa gatgacagga aggcgcggcg tagatagtga gcgaagagaa agataccccg    246900
     cttgaagcct ttgcatcttt aaagcactcg ggcgttactc cgcagaaggt tcgcaggatt    246960
     gttgatctga ttcgtgggcg gagtgttgat gaagcgttag cgattttgcg cttctctcca    247020
     cattctgcca gcggcattct gtacaagtta attgtttcag cccaggcgaa ttacgcgaat    247080
     ttgttaggcc gagatgatga cctttttgtt tcttcagttt atgttgatga gggtaagact    247140
     tataagcgtg gcaggcctcg tgctcgtggc tcgagctcgc gtatcctcaa acgtggcagt    247200
     catgtgactg ttactctgtc caaagaggtt cggtaagtat gggacagaag ataaatccgt    247260
     acggtctgag attgggtata acaacagacc atgtctcgca ttggtactct gatagcacaa    247320
     ggccaggtca gcgctatgca gattatgtgt cagaggatat aaagatacgc agttacctca    247380
     ccaaaaccct tgacagagct ggtattgcgc gcattgaaat agagagaacc cgcgaccgta    247440
     taagggttga catttacaca gctcgaccgg gtatagttat tggccgccga ggggctgagg    247500
     ccgatcggta tcgactcgaa ttggagaaaa taacttccaa acaggttcag ctgaatatac    247560
     tcgaggtaaa gaatccagaa acgactgccc ggctcgttgc gcagggtatt gcagaacagc    247620
     tggctgcacg tgttgcgttc aggcgcgcga tgcgcaaggg tctgcagtct gctacatccg    247680
     caggtgttcg tggtattagg attcgtttgg ctggtcgtct cggaggtgcc gagataagcc    247740
     gttcggagtt ctatattgaa gggcaggtac ctttgcagac ccttcgtgcc agtattgact    247800
     acggttttta cgaagcaaga actccgtatg gtcatatcgg tgtgaaggtg tggatttaca    247860
     agaagcccag cgttagaggt cgtactgaag gtggtgggtg atgcttattc cgaaaaaggt    247920
     taaattcaga aagcaacatc gtcccaacag aaagggcatg tctgggtgtg gcacccgtat    247980
     tgtgtttggt gattatggaa ttcaggctct ttcccgtgcg tatgtaacta atcgtcaggt    248040
     cgagtctgcg agaattgcga tgactcgtca tattcgccgt ggtggcaggg tttggataaa    248100
     catataccct gataggcctt tgaccaaaaa gcccgctgaa accaggatgg ggtcagggaa    248160
     aggttctccc gagtactggg ttgcgaatat acgccccggc aggattatgt ttgaggtttc    248220
     gggggtttct gagtcgcttg caaaagaggc tttaatgagg gcgattcaca agctgcccct    248280
     gcgcgcaaga attgttgaga ggcaggagtt tgatgatgct gggctctaag ggtttgtctc    248340
     ccaccgatct gagaggcatg acggatggtc atttgcgagt tgagctgaaa aatgcaaaag    248400
     aagaggtctt caagcttcgg ttccaatctg caaccgggca gctcgcgcac aatgcgcgtt    248460
     tgcgtgctgt gcgtcgcgat atagcacgga tctatactgt tatgcgtgaa agagatattg    248520
     gcattcgaag cgttcaggaa gaggttagtc aatgagccag cagcgcgggt accgcaagtc    248580
     gcgccgtggg tatgttacga gcaacagtat ggataagact attgttgtaa aaatagagga    248640
     tcgtgtcaaa catgctttgt acggcaaggt gattcgtaaa acatcaaagg taaaggccca    248700
     tgatcagggc agcatagccg gtgtgggtga tctggtcctt ataagcgaga cgaggccgat    248760
     tagtgctact aagaggtggc gtcttgttca gatacttgag aaggctaaat gacttatcca    248820
     cgttttactc tgccccagat gtggtcgctg tttgcggtct gtgaaagtca cgtctgtgtt    248880
     tatggggtat ttgagattgc gaggtcgagt tgatacaaca ggagtctcgg cttaaggtcg    248940
     cagataacac aggtgccaag agtttgtcgg ttatacgtgt gcttggtggg tcgaatagac    249000
     ggttcggatc attgggtgat gttgtggttg cgagcgtgaa ggatgcggtc ccgggcagtt    249060
     cggccgttaa aaagggtgat gttgtcaagg ctgtaattgt ccgctctact aaagaggtta    249120
     ggcgtacgga cgggtcatat atcagatttg atgataatgc ggctgttatt ctgcggcctg    249180
     acaatgatcc cagggggact cgcatattcg gtccggttgc tcgtgaactt cgtgatcgta    249240
     agtttacgag gataatttcc cttgccccag aggtggtcta gccttgagtg taaaaataag    249300
     aaagggtgac ctcgtccagg ttattacggg atctaaaact ggtggcaaaa aagggaaaca    249360
     gggtcgcgtt cttgccgttt cgggtgaccg ggtctgggtt gagggtgtta acttgactac    249420
     tcgtcatagg aaacgcgtga caaatgataa gggcacttct tctggtgggc ttgaaaaaag    249480
     agagtcgccc atgcatattt ctaatgttgc ccttgttgat cctgaaaccg gtgcgccaac    249540
     gaaggttggt tttcttgtaa agacctccgg tgataaaact gttagggtcc gttttgctaa    249600
     gaaatctggt aaggagctca cgtgacctgc tacactccaa gacttcttac gcggtacaga    249660
     gaggaaattg ttcctgtgct gatgagtcgg tttgatatta acaacgtgca tcaggtgccg    249720
     agtatcacca agattgttgt gaattctggg gtgggtgatg ctgctcgtga ctcgaagata    249780
     attgagggag ccgtttcgga tataacactt ataacggggc agaaaccgag gatcaatagg    249840
     gcaaaacagt cgatagcgaa gtttaaattg cgtgaaggtc aggcagtcgg agtaaccgcc    249900
     acgctccgcg gtagaagaat gtgggaattc ttagacaggt tgttgactct tgctctgcca    249960
     aggattagag atttcagggg catttctgac aagcagttcg atggtcacgg taattacacc    250020
     ttcggactca gcgagcaggg catctttcat gaaattgacc aagataaaat tgatcgggtc    250080
     aggggtatgg atattacagt tgtcacgaca tcgtcgagtg atgatatggc tcgtgcattg    250140
     cttggtgagt tgggctttcc gtttaagaag tgatttgagt tttatgagag ggggctctat    250200
     ctatgactat gacagatcct ttgtctgata tgttttcgcg tatcagaaat gcgaatcagg    250260
     ttctgcataa gaaggttact gttccctcgt cgcgacttaa agtgagcata gctgatctcc    250320
     tcaagcgcga gggctatatt ctcgactatt ctgtaattga tgaacatccg gggcagttgc    250380
     ttgttataga gcttaaatac ggccctgata agagcagggc gcttgttggg ctaaaaaggg    250440
     tctcgaagcc tgggctgcgt gtttacgcaa aatcatctaa cttgccggaa gtattcggcg    250500
     ggctggggat tgctatcctc tctacttcat cgggcttatt gacgtgctct caagccagga    250560
     agaaaggtgt aggcggagaa gttcttgcct acgcgtggta gatatgtcgc gggttggaaa    250620
     attgcctata gagatcccag tgggggtcga ggtatgtgtt aacggtcgaa ctgtgagtat    250680
     taccggccca aagggcagtt tataccttga tattgctgag cagattggtg tctctgtgag    250740
     tgacggtaag gttcttgttt ctagatctga cgatagccga acagcccgtg ccctgcatgg    250800
     gcttaccaga gcgctaatag ctaataatgt gcatggtgtc ctacatggct ataccaaaac    250860
     tctagagata gttggcaccg gatatagggt ctctaagaag ggtgagaatc ttgagcttgc    250920
     cctaggtttc tctcacccgg tttttgtcga tccagtaccg ggtgtttcgt ttggtgttga    250980
     gggtaatagt aagataattg tctccggaat agacaagcag gctgttggtg aagctgcagc    251040
     aagtatacgg aaattgtcta agcccgagcc gtacaaaggt aagggtatac gttattcaga    251100
     tgagattgtc cgtcgtaagg ttggtaaggc tggtaaatga gtttgacaag tcgtgcttct    251160
     gcccgtaaga ggcgccatgt ccgcttaagg aaaaagattt ctggcacatg tgacaggccc    251220
     cgtctttctg ttacacgctc taacaggcat gtttttgttc aggctgttga tgatatatct    251280
     ggtaaaaccc ttgtgagtgc ttcgactatg gagaaagata ttcgtgccct cgagcttggc    251340
     aaaacagaaa gggctttggc tgttggaaag ctagttgccc agagggcttt ggctgttggt    251400
     gttaaatctg ccgtctttga ccgtggtggt tgcaagtaca ctggtagggt tgcggcagtt    251460
     gccgagggtg ctcgagaggc gggtttgcag acgtgatcca cgatgatgac actgttgatc    251520
     taactgatac tttggctgat gcggcggatt ccacgcggtc tgctccagac cccgcgccgg    251580
     taagtgacgc atccccacgc gggagttctt ccggcgctga tgtttcggat gccgcacgtc    251640
     gtcaatcggg cacggtaaga cagtctggta atgacatggt aagacagtct ggtagtgaat    251700
     tgtcagatca atcagataca gatatcagtg cagactctga cacttccgcc tcccaaggct    251760
     ctgctcgtca ctccgctcgt gggcgtcatc gtgactcccg tcaaaaaggc gactcttctt    251820
     ctcgtgggca gtttttggaa cgggttgtcc ggataaatcg tgttgcgaaa gttgtgaagg    251880
     gtggtagaaa gtttagtttt tccgctctgg ttgttgttgg tgatggagac gggacggttg    251940
     gcgtcgggta cggcaaagca cgtgaggtgc ctcttgcaat ttctaaaggc attgaaagtg    252000
     cgaggaagaa ttttttcacc gtgccgcgtg ttgcgtcaac tatcccacat ccagttcagg    252060
     gtgaggctgc gtctggtgtt gttctgttga gacctgcggc acccggcacg ggggttattg    252120
     ccggtggtcc tgtacgcgcc gttctagaat gtgccggcgt aagggatgtg ctgagcaagt    252180
     cacttggttc atcgaatagc ataaatgttg tttatgcaac cttggatgca cttaaacact    252240
     tagaggatcc ggcttcagta gcccgacgta gaggtcttga ctattaccat gtagttccta    252300
     aaaggattgt ccgtgcggtg aatagtgttg gggctagcag tgacacggct tagaattacc    252360
     cagattcgat cttcagttgg tgagaagcag aataagcgtg gctctcttcg cagtttgcgc    252420
     ctgagacatg ttggtgatac tgtcgactgt gatgataccc ctcaagtgag agggtatatc    252480
     agtgcatgca gtcatcttgt gagagttgag gagattcgtt gaccgtagaa gatgtgtcgg    252540
     ttgatatagg caccccggtg cgtcttatta aactgcatca cttacgccct gcacccggct    252600
     ctcggagagc ccgtattcga gttggtaggg gcgagggttc taagggtaag acagctggcc    252660
     gtggaactaa gggaacaaag gcccgtgcgc ccgttagacc cggctttgca ggcggccaga    252720
     tccctttgca catgagcatc ccaaagctaa agggtttcaa gaatcacaaa aaggttgaat    252780
     attcggttat ttcaataaag cgtttgtgtg aagcttatcc tagcggcggt gttgtgacca    252840
     gggataatgt gatgtctgtt attggtaaaa aaaggggttt tgttaagctt ctctcagatg    252900
     gtgaagtgac cgtgaagttt gatattactg ttgacaaagc ctccgccgcg gccgtggaga    252960
     agataacatc cgcggcgggt acggtaaccc aagcgcgcta agcactgcaa ataaggagag    253020
     ttttgtttgg cgtagttagg cggatgtttt ccaccacgga tctaaggcgg aaacttctct    253080
     tcagcgtttt tatcattgtt atttttaggc ttggttcgtt cattccatcc ccgtacgtaa    253140
     attttacgaa tgttcaggta tgtctcgccg ccaattccgg tgcgactggt atatacgaac    253200
     taatcaactt gttcagcggc ggtgcgctac ttcagctctc tgtttttgcc ctgggtgtta    253260
     tgccgtatat aacttcttca attattattc agctcctaag ggttgttgta cccagattcg    253320
     agcagctcta caaacagggt caagagggcc aggccaagct tatccagtac acccgatacc    253380
     ttacaatagg cctcgcggtg ttgcagtcta caacccttat aacagttgca cgatccggtg    253440
     cgctttttgc ggcatctaat agcccggcat gctcttcgct tctaacggat gatagctggt    253500
     attcgaccat aataatcgtt attgtcatga cagctggtac aggtcttatt atgtggcttg    253560
     gtgagcttat aaccgagcgc ggtattggta acgggatgag catcttgatt tttacctcga    253620
     ttgctgcagg gttccccggt gtgcttgttg gggtgtatca gacaagaggt tttgggatgt    253680
     tttcgactgt tgtcatcacc tcccttgtgg ttatggtcgg agttgttttt gtggaacaat    253740
     cgcaaaggcg tgtgcctgtc cagtacgcaa agcgggtcgt tggcagacgt atcctcggtg    253800
     gcggtagtac gtatttgccc ataaaactga atatggctgg ggttgttcct gttatctttg    253860
     cttccgccat attgcgcgtt ccgtctatta ttgcccagtt tagccagcca gctccgggac    253920
     agcctccagc agcttgggtt gtttggataa acgagaattt tacaacagga aacagtccgt    253980
     tctatattgc cctgtacttc tttatgattg ttggttttac ttatttttat gttgctgtta    254040
     cctttaaccc aactgagata gctgacaata tgaagaatta tgggggcttt atatcaggta    254100
     tacgtcctgg ggttccgacc gcaaattatc tttcatacat aatcaagcgc attacactgc    254160
     ccggttctct gtatttaggt atcgtttccc tgataccgct aattgccttt gctctcttcg    254220
     ggttgagtgc agatattccc ctcggcggga cctctgtgct gattatggtt ggtgttggcc    254280
     tggataccgt aaaacagatt gatgcgcaaa tgcaacagag gcattacagg ggcttgttga    254340
     cagcctaatg cgggctataa tggtcggccc tccggggtct ggaaaaggta cccagtgtgg    254400
     tcttattcag agcagacttg gtatatctgt catcgcaacc ggtgatgtgt ttcgtgaacg    254460
     catgaaaact gatatggcac taagggacat tgtgtcatca ggtggttatg tttctgattc    254520
     gacgaccaat cgcattgtag aggactgcct tgacaaggag gatgtgtcct ccgggtttgt    254580
     ccttgatggg tatccacgaa ccctgcaaca gctggacttt ctagagggct ttttaaaacg    254640
     acgtgccctt acgctggatg ccgtctttag cttggaggtt gcgacagatc tcctaattga    254700
     gaggctgcgt gcccgatcaa aggagtctgg ccgtactgac gacagagatt ctgtgattgc    254760
     tcgtagattg gaaatctata ccgaaatgac cttgccgatt atcgatgcct gcgaagaaaa    254820
     gggactgctt cacaggatag atgcttccaa gggtatagag gaagtttttc agtccatcaa    254880
     agatgtattt gacagggtga caatttaaaa gtgaataccg agtatttgca cgttttgtgg    254940
     tttaaccccg atactgattg tgagccccgt ttttatgacg tgcatcaccc gctcattcct    255000
     gccacatcgg atgcaataaa tcgtggtgtt ggtgtatttg aaacaattgg aattctatcg    255060
     ggcaggatac tgaatttaga tgaacatctt gagagaatgt gcacctccgc taatcgcttg    255120
     ggcctgaggt ctattgaacc ggatagatgg aggagcctaa tcttacaatc tgcaaaaaaa    255180
     attgctgatc aagagcgagc tggactcagg gttgtgtatg ccaggaatag caatcggtct    255240
     tatttggcat ggatagcagc ttttgctgta cgtgacccag atgcgcttag caaaggtata    255300
     aaagtaataa ctcttcaacg gggtgtgcgg tccgatgcag gtcgactgta tccctggctt    255360
     ctttttggtg caaaaactgt ttcctatgcg gtaaacatgc atgcactcga ggtggcacag    255420
     gcgcgcggtg cggatgatgc aattttcctc agtgaagatg gacttgtact tgagggaaca    255480
     acatccaatc ttattgccta caacaagggc gcttttataa ccccatgccc tcggacaatg    255540
     agtattctcc ccggcacaac acagaagagg ctgtttatgc ttttggaagc cgagggtaaa    255600
     aaaacacttg agacttctgt cgccactgag gcattgtaca attccgaggg tgtatggctt    255660
     acttcaagtg tgagaatgat taccccggtg gtttctgtgg atggaaaccg tgtgcgcttt    255720
     gacccgggtt tgaccgattg gctaaacgag ttactggctc ggtcagctgt ttaatttgct    255780
     cttgagtcgc ttttcgcgta gaatttctac ccggcgtttt gttttttgcg ttaggtcggt    255840
     ggtgtggcga aaaaggatgg ggtgatcgaa cttgagggct ccgtgcttga ggcgcttccc    255900
     aacgccactt ttagggttga gttgagtaat gggcacaaag tcctggctca tatttctgga    255960
     aggatgcggc agcactatat aaggattctt ccagaggaca gggttgttgt tgagcttagt    256020
     ccgtatgatc tggccagggg tcgtattgtg tatcgctaca agtaggggtg cttgtgaagg    256080
     taaagcctag cgtaaagaag atttgtgggg tctgtaaggt aattcgcagg aatggtcgcg    256140
     ttgctgtttt gtgttcgaat cccaggcata agcagcggca gggctaatgc ggttgtatag    256200
     ctttcatgga ggggcggttt cgtggcgcgc gtagctggcg ttgatattcc cggtaataag    256260
     cgggttgaga ttggcctgac atatatctgt ggcataggtc ccacgcgctc tcgacatgct    256320
     ctaactgctg cgggtatttc atttgatacg agagtgaaag atctgaccga tgatcagttg    256380
     gttgccctgc gtgcacacat acagaatagt tatagaatcg agggtgatct tcgtcgtgag    256440
     gttgcttccg acatacgtcg taaggttgag attggctgct atcagggttt gcgccatcgg    256500
     aggggtttac ctgttaatgg gcagagaact agaaccaatg ccagaagcag caagggccct    256560
     cgccgcacgg tcgctggaaa gaaaaaggcg aggtagtaat tgtcaaaaca ggctcagagt    256620
     aggtcgcgca aaaaagctag gaaaaatatc cctgcaggcc ttgcccatat aaagtcaact    256680
     ttcaataaca cgattgttac gataaccgac ctatctggca atgtaattgg ctggtcatcg    256740
     agtggtgcag ttggctttaa aggatccaga aagtcaacac cctatgccgc acagatggca    256800
     gccgatgctg ccgctcgctc tgctcaggag cacggagtga agaaagtgga tgtgtttgta    256860
     aagggtccgg gttccggcag ggagactgcc atacggtccc tccagacggc aggtcttgag    256920
     ataggctcca taagcgacac gacccctctt gcgttcaatg gatgtcgccc ccctaagaaa    256980
     cgcctggttt aaagcgaaag gaataatgcg ttgctgattg cccaccgccc gacactgatt    257040
     gaaaagaaag tttctgatat tcgctcgcga tttattattg agcctcttga gcctggcttt    257100
     ggctataccc tgggcaattc gcttcggcgc acacttctct cttcgattcc gggcgcagcg    257160
     gtgacatcga taaacatcca gggtgttatg cacgagttta gcactattcc aggtgttaag    257220
     gaagatgtaa ccgagattgt tttaaatgtg aagcgtctgg ttatttcaag tgagattgac    257280
     gagccgttta ctgtccgtct atataaaacc ggtgagggtg aggttttggc aaaggacata    257340
     gaggtgccaa ccggcataga aataggtaat ggtgatcttg taattgcaac cctcgccaaa    257400
     gatgcggttt ttgacatgca gcttacaata gagcgaggca ggggatatgt ttcagcggaa    257460
     cagaatagaa atgatggaat gtctcttgct gggcatattc cggtagattc gatctattct    257520
     cctgttcata aagtaaccta tcgcgttgag gctacgcgtg ccggtgagag gacggacttt    257580
     gatcgcctga taatcgatgt cgagactaag ccttcgattc ttcccagaga tgcagttgca    257640
     agtgcaggga agactctttg cgagctgttt ggccttgcac gcgaactgaa ttctcaggcc    257700
     gagggtgttg agtttggtgt tgattctatg atcccggaaa gtgatgaaga tctgcgtatt    257760
     ccgattgagg acttggggct ctcggtaaga tcctataact gcttgaagcg cgaaggtgta    257820
     aattatgtca gtgaactcct gggtttttcc gagcaagagc tcttggatat aagaaatttc    257880
     ggacagaaat ctgctgatga ggtccaggag aagttagctg agctgggtca cagccttaag    257940
     ggaagcgtcc cggggtttga tggctcttac tttgatccga attatggttc gtaggattgg    258000
     gtagaaagag tgcctaagcc aagcagaggc ccgcgtatgt gttcagggcc tgaccatgag    258060
     cggctcgttc ttgcgaatat gtctgcctcg ctttttctta acaagaaact ccggacaact    258120
     gaggcccgcg cgaagcgtct tcgccccttt gccgagaagc tggtcaccct ctccaagaga    258180
     ggagggttgc attctcgccg tcgcgccttg tcgattttgc gtaataaagc tgctttgcat    258240
     gagcttttta ccaatattgc tccacttgtt gaggatcgta acgggggcta tactcgcatc    258300
     actaaagttg gttttcgatc cggcgacggt gctccgatgg cgcttattga actaattctg    258360
     gagcccgttt ccgcacgcac ccgcggcact gatacgctgc ctgatactgt tatcgataca    258420
     ggtcctgata gtgcgcccga tcccgtcccg ggcagtgagc cgggtagcgc agcgggtgat    258480
     ttgcctgatg ccgatactgc acccgcggac cctggcgaat cttcttctaa ccagagagtc    258540
     attcggtaat ccgcgtaagt gccgacttat tctagtgaat aagacccgat atcgtcttga    258600
     tgttgcatat gatggagcga atttttgtgg ttgggcaccg cagcccgggc ttaggaccgt    258660
     cggtggtctc attcttgatg ctttacgcct tatctgcagc gaaccgcccg acattgtcat    258720
     agcggcaaga acagatgctg gtgttcacgc cctacaacaa gtgtgtcatg ttgaccttat    258780
     ttcatcacca gaccctgttt ggcttttgca cagactccgc tctctactga aatccgagac    258840
     cgaccttcat atcctttctg ctgtcaaggc accggtgaat tttcacgctc gtttctcagc    258900
     aataggcaga agatatgttt accgtgtcat tgacaagcgc tcttcgtggt atccccagaa    258960
     tagatatttt gtttacagag taaatgcttt tttgcaagat tatcggatgc gcagggcagc    259020
     ttctggcctt attgggctaa aggattttgg tgctttttgc aagccgcgtc gcatgggaag    259080
     tacagtacgt catctaaggc aatttgaagt tattaggcag ccagatggac agatacattt    259140
     ctttctcgaa tcagatgctt tttgtcactc tatggtcaga aacttagtgg gcagcttgat    259200
     agaagtgggt cgtggggcac ttacattaca agatctgttt tgctatacca aaattgcgaa    259260
     gagaacgcca aaaattccta ccctgccgcc ccatgcactc actttgattg gcattgacta    259320
     tccgcaggaa catctttttg agtgtcaaaa cagaaaaacc cgacagaagc gcacttgaag    259380
     ttatcaagac gactactacg gggcaagttt gtttttccgc aaggaatgaa tacacactga    259440
     tcggtttatc tgcagttttc aaacctgtcg aatacttgtt actgcaatgt ttatccgtaa    259500
     agtttcaagg caattttttc gtaaagctct ttgagtgcag tatgccctgg gcttccttca    259560
     tacttgtttt caacgagtag cggcacccct tcatccccac ttttgcgtat attcacatcc    259620
     aacggaatgc atgttattag atctattgct tcatgaggat tggtaattct gttatctttc    259680
     gcggtgctct cttttttgca ttgtttatcc aaaaattctg ccacgaactt accaccgcca    259740
     tggccaaaaa tgtctagttt actttccggg caagatgaca tattttcaac cacaccgata    259800
     atgttctgtt ttacagaaag ggcgaactgc ccacttcgaa ttgcaacatc agcggcaaca    259860
     atctgcggag ttgttatgac tagcacttca gaattcggca ataactgtgc aatagttatt    259920
     gccgcatctc ctgtgccggg aggcatatcg attagaagaa tatctgggtc agcaaaattc    259980
     acatcacata gaaattgatt gattgttctg tgaagcagcg gtccccgcca cgcaactgcc    260040
     cctcgacggc gcatgaacat tcctatggaa atgagcttaa cgccaaattt attggcaggc    260100
     attatcatgc cattctctct ctgtggaata aaatcttcat ctatgccgaa cattcgtggt    260160
     atagaaaaac cataaacatc agcatcaatt actgatacag aaaagcccat tctcgcgagg    260220
     ccaacaccga gattagatac tatggttgat ttacccactc cacctttgcc gcttgtaaca    260280
     gcgataattc ttgtttttga ttctttaaac gggttgctgc gtttttgtaa attgagaacc    260340
     tctttcaggt tttgacgttc ttggtgcgac ataacgccta tttcaatttt tatatcgtgc    260400
     tcagggcaca cggcagaagc tgcgtcggta actctttgtt ttattttgtc caccgctggg    260460
     caagtcgggg atgttatatg tataagaatt gagactgttt tgctatctgt ggttatggtt    260520
     tttaccatcc cgaggcgtgt gattggtatg tggagctcag gatcatacac cttctccatc    260580
     gcggaataga gttttttttc tatcacaaac ttttcaggaa tcgttcccga agtcctgtat    260640
     ggttttttct gtctcctcaa ggcgcttcag tcggttattg tttttctgtt gatctgtaat    260700
     tagctgtgct attgataacc ttaaatcggc aacttcacgc gccagatatt ctgtgctggc    260760
     aatattccgg tcggccattt cgcgcatttg tttcatgttc agactttcac gcttccactg    260820
     tctaatttct gccaaaagga tcaatggtgc tgcgtacgca gctagcacag aaagaacaag    260880
     tgttagaacc ggatatccaa tttctgcact gtcaaatcta agaccgtttg gagcatagtt    260940
     actccaaaga atccagagaa tacaaaatgt tgtgaaaaaa atgaagaatg aggctgtgcc    261000
     catatagagc gcaatcctct cggttcgcat ttcaaaaaca ccagggttat acctcaacct    261060
     catgcgcgat gttaaaagcg gagtgtgtaa cttgctactc tttttcattg tgaaccatat    261120
     tctctttatt gttggtactg tcgatttcat ttttacgcca attttttggt aacacgtagt    261180
     ccagaacatc atcaatggtt attattccga gcaacctttt gcggtcatcg attaccggaa    261240
     gcgagagcag gttataggtc gccaaaatcc tacttacctt ttctgcatca attgttggca    261300
     gaacgggctc gatagacgtg tcaattatat gagagagttt ctgatacggt ggctgtctca    261360
     gtaaggcctg gaagtggaca acccctatga acctcccggt cggtgggtca tagggtggta    261420
     atgccacaca gactgttgat gcaagggctg gtgcgatctc ttggcgcctt atcaaggcta    261480
     gggcttcggc aaccgttgtg tccggtgaga cgattacaaa atcagaggtc atcatgccgc    261540
     ctgctgtatt atgcgcaaaa ccgagaagaa gcctaagttt tcttgcctct tccggctcca    261600
     tgagttgtaa gaggccttct tttcttttgt ttgacatata gcctattagg tccacagcat    261660
     catcaggctg catctcttcc aaaatatctg ctgtgcgatt atcgtcaagg gcgtctataa    261720
     tctttgcctg ctccggctct tccatctctt ccagaacgtc ggcaagtcgc tcatccggaa    261780
     gatcttcaac aatcctggca gcatcagttg aaggcatgtc tacaatatct gccgccaagt    261840
     cagcagcctt tatttctggg ttagatatat agtcgggtac ttgatcaagt cccgagatat    261900
     cctgccagtg cataaagcag gtatttcccc tggaaaatag cctatttccc gaggttctaa    261960
     caaatatctt tccgacatac cattcgcctg ccgggtctgc aagtatctct atatcttcag    262020
     cccttgcagt tgtgttattt ccaatactga cttttttacc gacgatgtct tgggaaaggc    262080
     atatctcacc cgatctacgc ctgaacctct gaatattgat taccccacga gttgcgacgt    262140
     atccgttgtc tattgcggtg actcggttga tcgaaacaaa tatgtagcgc tttcccacga    262200
     tttcaaggac cataccgatt attcgagggg attttctaag cctcggagtg cccaacacat    262260
     ctttgacctt tcccaatctg tcacctgttg gcccgaggac cgaactgcca cagacccttg    262320
     agatataaac acttttactc atgatgcttg ttgaatccac tgttccacat caattcgggc    262380
     ccttggtata tcacgcgaca tatttacagg gccatctgag gctatgagta tgttatcttc    262440
     gattcttacc ccaattcctc gaaagtcctt cggaacagtt aggtcatttt tgtgaaaata    262500
     caatcccggc tctatggtaa gcaccatgcc atctgcaagc gttccattac gataattctc    262560
     gcgcttggca aaggcacagt catgcacgtc caatcctagg tgatgtcccg ttccgtggat    262620
     catgtatctt ctataaaact cgttttgcga ggccttacaa ataccccatt cggagaggtg    262680
     tcggcgtata acccccattg cagcttcgtg cattttgtgg aacggctgac cgggcatggc    262740
     cgcgtcaaac gctgcatcag cagcttcaag gacagcctca taggctttag cttgtacatc    262800
     ggtaaatttt ccacttatgg ggactgttct ggttatatcc gctgtgtaca aagtctcaag    262860
     ctcaatccca gcatcaacaa gcaacagatc accatcatta atcgggccat tatttacaga    262920
     ccagtgcaaa atacatgcgt tggcacccgc agcaacaatc gtctcgtagc ctgtttcata    262980
     acccagactt ctagcagaag tgtaaaatgc accttcgatt acgcgctcac cattcgtaac    263040
     agatttggcc tcgtttatcg atttcacgac gcgctcaaag ccctgagcag tagcatcgac    263100
     cgctttttgt aattgggtga tttcccatct atccttcaaa agtctcagtt cgcttattgc    263160
     aaccttcaag tcgttaattt cttcagcatc cttgcctctt gtcttgcata agagcacatt    263220
     atccgttggg catctaaagt cctttatatc ccggcacgta atgcccaaaa gagtctctat    263280
     ttcctgcaaa ctgggcctag atcctatcca gaatgtaccg ttatgagaat ccgtaaagaa    263340
     gtcatcgttt ttttttccag ccggtggctt aaagaacagt accggcttcg tgtcgggata    263400
     gataaccaaa acggcacctg gggtagtttc acatccccat cctgtaagcc aggtaaatga    263460
     actatctggc ctgtatctgt agaaggtatc gtttgcgcgg catcgcatat caccggcctc    263520
     aacaactatt gtcttgcccg gaaataacgc gcaaaccgct tgtcttcgtt tttctgtata    263580
     tttcgcaact tcactctgct ggattttctc ttccaagaag ctcccccacc cggagagcat    263640
     atattcggtg aattgggtcg atcctggtag ggtcgacctg ttgcgattct tgttcacaaa    263700
     ccgattttgc cctattttgg attattaaga aaatttttct gcccgctttt ctggtgcata    263760
     ccatgcaagt aacgccgcgc gagatcccat gttgtgtgag ctactctatt gcagcaattt    263820
     gtaaatattt tcggcctgac gcagatgttg cactgtttac aatcaaaagc ctattgccag    263880
     cgcgacttgt ggctaatgaa actttgcact tttctttgca cttttgttat actgacacac    263940
     cgagatcgta atgggtattt cagaggcaca tacaccgcac aaggatattc atctagatgt    264000
     ggggttaatt tccgctcaaa tcattttgct tcgtaacata ttttcaaccg cacttggcaa    264060
     tattcgcgcg tgtgattcat atgccgccag tttgattaaa cgctctgaat cagttcagaa    264120
     gtgttctaaa gcaccgaaag aggtgtttag ggccgaactt gttggggccg ccttgtccgt    264180
     gcagcaactc atgtccggaa ggggtgaata cgtagacttg atgagctatt ttcttatatc    264240
     cgagctgatg cgggattttc atcttctagc cctatctcat cttgaggtca gtgaaaaata    264300
     taggattgag gagctaacat gcgtggattt gaaggataag aaaaaactta gtcgtgaaat    264360
     ttttcgcctt ttatcgcgaa tagcaagaaa cgattcaacg ctatcctcaa tgatgtcgct    264420
     ttgggggagg cgcattctgg gtgatgtttt gctttttatc aagttgtgta ttggtcaaga    264480
     tcacaataac tcacgatcct tactatccac ccttgccgga aagcactcag agcgcatgag    264540
     ggcaattggc ctgatcgcct aggatttttt cgcagcctgt ttcaagagcc ctggctacat    264600
     cagatgtcgt ctgacatcac gcgccgctat agacactcag aaaccctgcg ccctaggata    264660
     cgaacccgca aacgcgcttc ttttcctgaa caatccagac atatgccaga gcggatcccg    264720
     ggatgatgat ctcttcgccc cccgtgtctt tgaggttgag caccccgtgg ttacccacag    264780
     cgtcattgac cttctgcaat aattgctcat gggttatatc cacatgaaag gatatttcct    264840
     ttatgcaatt tgcaataccg atctttagtt ccacgctccc attatagata ggttttgggg    264900
     tgtttatgga tatttctgag tgcagtttac ctgacgctat agattctatt gctcgaattc    264960
     ccgagggtag ccgcgtgagt gttatcggtc cccctggcag cggtaagaca agtcttctcc    265020
     tgagtcttct tgaaaagtat tccgaaagtt ttgaacccga ggaggttctt gtccttgccc    265080
     ctgggcgcct cttggccaat cgtctaaacg gcatagccct tccggcactt ctgaaagaga    265140
     aaaaggttcg ttcagggcgt cttgttgtta caccggcaag ttttgcattt cgcattgttc    265200
     agaacagtat gaagggtgaa cgacccaccc ttctctcggg agctgatgaa gatcaggtaa    265260
     tagctgaaac gattgcacaa aattgtgaat tattcaaaag ttcatatgct cgtagcccga    265320
     atttcaggag tcggatgcga ttctttatcg aagacctctc gagacacggg attgaccctg    265380
     cccatctcgg caaaattgac agatggaaga cgtacgctgc cctaatagaa aaatatcgcc    265440
     tggcaaggac ttctaacaat gcatttactg ccgtagaaat aattgagcgc gccgcacagc    265500
     ttgcctcaac gggctactta ccatacagag tcattatggt tgacgaggcg caagagcttg    265560
     ccgcagaaca tatgcgcctt ttttcggcac tcgcgagacg taacattacc gtaatcctgt    265620
     tcggtgatcc cgataaagct gttgcaagaa gcgcctcccc ctcaattttt cttgactttt    265680
     cagagaaatt gtttgtttta aaaacagtat ttcgcacacc cagaaatctg catctgctgt    265740
     cacagaagat ctgtcaaggg ataggtgtta caggtagtgt cttggcacat agacagtctt    265800
     tcaattcctc aattcttgaa ggtcgtgtag aaactgtcat ttcttcttct cgcgcgactt    265860
     ctatggcaga tatcgcgcga tggtttagag agaaacattt gctggaaggt attgattggg    265920
     aagacatggc tctgattatt tttcagagga gctctgccga ggtctactcg cattttcttg    265980
     agcgtttcgg cgttccggtc cagatcttgg gtggtggttt gaatctttct gaaaagccta    266040
     ttgctggcgc aattttgaat gcaatagagc ttgcctgctt tccagacatt cttaccggta    266100
     agacccttgt caaactactg ctatcgccta taggtggatt tgatgtattt ctgatgcgta    266160
     aattgacaat tgagctaaag agaattgcac caaagaatat tcaagttttg aatgagagat    266220
     tactttgggc atttcatgct taccgtaagc tacagaccca agacacagat gaggtttaca    266280
     gagtttttct ggccagcagg atagggagga gtttaaaaaa aatatttgaa tgcttgataa    266340
     gcctcgaacg tctgtatagg gaagataatg tcagtcttcc cgtacttata tggcatgtat    266400
     acagttttct caatttaaaa tcggctgtgt caaaagagcc ctggcaaact tcaaaagttt    266460
     cacatcgtgt tctagaagaa gttatagcac tacaaaagct cgccgatgcg gtcagcaaaa    266520
     aagaccctct gtgttctgcc gggcttattc tgcaaaaaat aattaacgcg gaagtgccgg    266580
     ttgacaactt gtccatcagg gaaaaacggg gttgcgtgac catcctgacc ccggcatcca    266640
     gtgttggata tgaatacagg gcagttgtaa taactgatat ccagggttca cataaaatgg    266700
     attccacaca gcttgatcca gagctagccc tggcagatat aaacaacatt ccgttttcca    266760
     gatatttgga aagtaaattg gcgggacgta ggcataattt gcttagaact ctttaccagg    266820
     ctgtaacacg gtcaacatcg gatttattgg tttctgtgat cgacagtgct gagacttcgc    266880
     catcctggct gttttatgct tttttttctg attatccatc ctgcgaattg tcatctttac    266940
     ccctcacact cagaggtatt gtgacacagc tcaggcttga tttagagcga gatccgggta    267000
     atactgaggc tgcatctgca cttaggttac ttgcaaaaga aggtattagt caggcagatc    267060
     cacagaattg gtatggatat ttgtcgagaa cagagaataa gtcgtatgtt atggacagta    267120
     taaaaccatc ggccctcgat aaatttcaca cttgcccatt gggttggttt acagatcaac    267180
     ttgattgcaa tcgatatccc ggtaacgcaa cagagattgg cacaataatt catagatgta    267240
     tgcaggagct tacatgtgat aacaggcagc caaacctgaa tgagttttta gattacgcgt    267300
     acgcaaaact tcgtgaagcg gattttgagt cgcgctgggt tcttgagcga gaaaaaaagc    267360
     gcctggttgg cattattagg aaattggttg attacctaat agattttgat gcacatggcg    267420
     gaacgctatt agcatccgaa aagagtttta gttttgatct aaatgtgttc aaagacaggt    267480
     cgattatgat atcggggcaa attgacagac tcgagcgtct ttccagtggc gagatcagaa    267540
     ttgttgatct caaaactggt agtagtttat tgagtaaaaa cgatgcggag agtaatttac    267600
     aactttctgc ttatcaactt gctgttgagc atctggatat tgtttacgag actttaccgt    267660
     cagctatgct gatttatccg gcggttggca cgaaaaaagc cgctattcgg ataaagggcc    267720
     caatggacag agattcaaaa agggttctga aaaatactat tcgtgatctt cttttgcaaa    267780
     acgaaagttt cacgctaaca gctgcccttg aggagcattg tgaatctagg actgcatgca    267840
     aaaaacttat ggtcccacac gttagttttt cagtgaaatg aatatgtccc tcagagacag    267900
     tcgtcatatg tgcagtattc tcaatctgca tgcgccgact gaagaacaga gggcaattat    267960
     tgaatctcca ctggaaaatg ctcttgttat tgccggcgca ggaagtggta aaactgaaac    268020
     tcttgttctt agactcttgt ggcttattgc atccggcaag ctcaagcccg agtctattat    268080
     gggcttaaca tttaccagaa aagccgcggg cgagttggca tcccgcctgc agaaatccct    268140
     tgcaatactc aattcttata ctggtgatgt attgagtcca gagattgatg ttcttaccta    268200
     caattcattt gccaattcca tatatcaaga taacgccctg ttgcttgacc atccggttcc    268260
     ctatacagca attgaggatt ctgaagccca actaatcgcg cgcagacttc ttgtggaaca    268320
     tggccttgac gaggacgagc cgtcagagac aattgacaac ttggcgtcaa gtctcataaa    268380
     acttgatgat gccatagtgg acaatctact cgatttgggt gaattaaatc agtttgcctc    268440
     agaatttatc gagtttgtag gtgcttttga tgcacccgtt gcgaagtcag acgtattcag    268500
     ggccaagagg ttaattgcac tttcaaaact tattccagct ttgaaagatg aaaaaaaact    268560
     tcgcggcaga atcagctatt ccgagcaggt tgcattcgca ctggaggttt gtcgccagac    268620
     tcatgttttg gcggagtttc aggagaaaat agcttacgtt gtattagatg aatatcagga    268680
     tacatcaccc atccaggttg agtttctgaa aactattttc ggcaatagat gtcgtgttct    268740
     tgcagtcggc gatccaaggc aggcaatttt tggtttcaga ggcgcaagcg tggctaatat    268800
     tgcaaacttt gcacgtgatt ttgtttccaa caaacagtac gaattgtcta ttagttggcg    268860
     aaatgacaaa aatattttgg atttagcaaa ccacatttct ccgaaaataa gacctttgca    268920
     cccaagacca gaagcaaatg atgggtcaac ttcgcttgag gtttacactg atcccgagca    268980
     agaggtgcat gaaggcgccc tgtggctcaa ttcggttgtg gaaaaaggta cggctgcggt    269040
     tcttacacga actagatcac gtttgatttc tgtaagccgt gttttggacg agatcggtgt    269100
     ttcgtacact cgtgctgatg tgaatatatt ttacgagccc ggagttgttg acatcttgtc    269160
     atgtatgcga ataataagcg gcgtaaatga aaatctttct ttcttgcgtc tcattacagg    269220
     tccgcgttgg caggtaggaa taagtgatct acacgccctg cggggttata ttgcggtcgg    269280
     taaaaaaaac ctggacagaa tatccctttt ggaggcggta aatcgtataa atatacaaaa    269340
     aacacctatg tcttgtgagg gaaagaagcg cctggaagat tttttggaat tttttcgcaa    269400
     aataaaaggt ctttcatttt tatcacccct tgagttggca tacctaattg aggagtccct    269460
     gaaccttgat atagaggttc aaatgtccca ccgtggtcgc gaaaacctag atgcactata    269520
     cgaactgatt gcgtccttta ggggagataa cttaagcgaa atgcttgcgt ggttcgattc    269580
     ccttgaagaa gaagatgcct tcagaggccc cataaaacaa tcctgccccg gacaagtcga    269640
     attattcaca gttcatagcg caaagggcct tgagtgggat tgggttttgc ttccattttt    269700
     ggacgacttt cccgcgaaga gcagagagaa gagtggatgg cttagcaaga caggcttatt    269760
     accattttgc cttcgtctcg acagagagag cctccccgag ttctattttc acaaatgctc    269820
     tgattcaaag gaatacagag ctgctcgccg acaatatgag gatgatgttc tgcagcatca    269880
     gatcagggaa gaaaggaagt tactctatgt tgctgtaacc cgtgcacgac agggcctgcg    269940
     aatctccgct tctgctagac aaaaacccgg tcaatttcta cgggagattt ctgaatttct    270000
     gcaaacagat ctaccacaag ctgttcataa taacccgaaa aagcgtgttg gttattggcc    270060
     ccttgattca cttggcgcgc gtagaaaacg ggttaaactc gccgctgcag ccgtacacaa    270120
     tagatctatt gaagaaagtg aagaatcgct caagaaagag ccattaaagg ctttgatagc    270180
     tggaatgcta aaggaattgg atataagcgt agataaaccg gaaaagagga tttccgcaac    270240
     agcgctttcc aaaaaagatc ctaatgtttt tttgttacca caaccgccta taaaaaatgc    270300
     atggcttgga gttgcatttc atgcatggat agaaaattat tactcaacat attcggatat    270360
     gttattccac gagaacagtg ccgacgaata cggcatctcg ggccctgtct ttgagcaatc    270420
     tcaacgattt tccccagagc ttgaccaatt acgacataac tttatgcagt ccgaatggtc    270480
     ttataaaaag cccattgcgg ttgagcttag ccttgaatgg cttattggtg atgttattgt    270540
     gccgtgcaca atcgacgctg ttttttttga tggcgataga tatacaattc tggattggaa    270600
     gtcgggacta tcatctaatc agtatcgcat tcagctttcg ttgtatcggc ttgcctttgc    270660
     tgaatggaaa ggtgtcaacc ctgacaaagt ggaagcaaaa atatattttg cggccgataa    270720
     tagaaccatc aaggttaggc catacactgt tgatgagctt ggtaagatgc cgggatttct    270780
     gtctgacctt ttctcataga aaaagccatg gtgatgttta aactattcat tttttgcttc    270840
     actattttcc tcttcagtgt ttgtttttgc actgccaagg aattcttcaa tattccgaag    270900
     attctcagat atcccactat ctgacacctg atcgcttttg tatgtctctt cgtcagaata    270960
     tgcatttacg tcatcagact gtatttcata tgacctttgt tgttcaaatg acagattctg    271020
     cgcattctca agcagacctt cagccttgtg tatggcttgt ttaggagtat cttcttgcgc    271080
     acttgtgcga tccaattcca agagaagacg ctttgccata tcaatgagtt catgcttttc    271140
     ttctctaact ccatcgatta gaatgcgtgc tatatcaagc tctgcataca gctttgcacg    271200
     ctccaggcag cctctatcat gagtggttgt actaaaggct tcatatgcct ttagtatgct    271260
     ttctgcactt tcatgagaca gttgattaag ccaatgcaaa tcataggcag ggtcatcaat    271320
     agatgcatct tcccattcca ggattgcgca taccgagctt tcgccctcct gattatcttg    271380
     aaagcgaaat gaatccatcg agaaattttt tttaacgact gtagtttgaa atttccacag    271440
     gtcttcatct tctaccaggg tctcccattt ttctttgagg gaccctggca acatattcgt    271500
     tgcatttgcc ttatcaacaa aatctataac ttcgtaacgg caatcctgag ctgttttgtg    271560
     tgtgtaccca gcagatatta gaagaccgct cggcagatta tgaatcgctg ctattgccca    271620
     gccaatcgaa gtcgcagcac cttcaccagg ctttatatct ctcaatgcat agccttgtgg    271680
     gtgatccata atgagagtca tattcatccc cgaagacagt ttgacaggct gataggccag    271740
     aacattcggt atcgaaaatg gcaagcgcgc tctgacaccc ttactaagtg ctctcaaatt    271800
     tttcacaagt ctggccattt tatctttcgc attctgcgag agtggcaccc ttattaacat    271860
     ccagcgatta tcatcacaac gtagtatgga gtctacgtgg tgtgaatcag aggtgcccct    271920
     ggcaacctgt agtacattca ggtttggtaa agtcgcaaca gccacagcgg ccattgacat    271980
     tggtgagagc gcaatcatga cccttaaaag gctaagactt ttttgtgaat tgagggcgca    272040
     gccacgcaaa tattggcaat gtttttgatg ggaaataatt gacaattgat gttttttcgg    272100
     gacttagcga ccaacagtgt gatgctgtcc gtaccctgag ggggcctgta aaaataattg    272160
     ccggcgccgg aagtggcaaa acactgacaa ttacaagaag aatagtcaat ggcattatct    272220
     ccaatgagta tgattccggg catgttatgg ctttgagttt cactcgccgc gcgagcatgc    272280
     aactcaggag tcgccttgta gagcacggcg ttaaaggggt ttattcaggc acttttcaca    272340
     gcgcggcact ttcacagctc aggttttttt gggagacctt tcacggaaag cctccaagac    272400
     agataattcg cgataaggtg aatttactgc gggacgcagc acgaggaata aactttagct    272460
     tttcggatga gtcattgtgt caggttgctt cggaaataga atgggcaaaa caaaacggct    272520
     acgacttgag tggatacgat aagtgcaatc acagaatttc tggtatgagt gccagtcagg    272580
     cgcgcactct catgcttgct tatgaggatg taaagaacaa tagaaggcta atcgactttg    272640
     aggatatact ttcgctcaca gttggcatgc tgtctgttca gccgagagcc gttgctcgtg    272700
     tgcgagacag gtttagggta tttttgattg atgaatttca ggatgtgtca cccctacaat    272760
     ttgagctcct gcgaatttgg cttgggcgca ggcgtgatat ttgtgttgtc ggagatccta    272820
     atcagtgtat atattcgttt gcaggggcaa aaagggatta tcttgtcaaa tttgccgact    272880
     attttccggg cgcgcgagag gtttttctta gccgtaatta cagatctcgt ccggaaatag    272940
     tgtgtttatc taggcacatt attgactctc actcaccgga tatcggactg taccagccca    273000
     ccgagggtat ctctcgcaat tatgccgata caaaaacggc tactcctgct caggatatgc    273060
     gggtaaatgc cggaaataga gcgaaatgtc attgcacggc accccctggc accaaaggcg    273120
     cggtgagatg tggtaattcc gatttgggtt atcgtgaaac ccctattcgt tggcatactt    273180
     ttgaaaacca gattcaggaa atgcatttta ttgctcagag tctgaagaat atttcgcaga    273240
     gctgtgctgt gctctacaga acggcaattc agggcgagcg gttggcaaaa tatttacaca    273300
     catcaggaat aatttataga agccaagaaa gccggctgtt tcatgaaact gatgttgcac    273360
     agattgcctg caagcgggtt attgaaaaga cgattgaatg taacgtcagg gtggttgatt    273420
     tggttgatag tgttgtgtct ggaatattcc cgcgcaagcc agatgcacta acaggcgagt    273480
     acgatggttg ggttgccctt caggcattgc gattgtgcgc taggcgtttc aatggcaatg    273540
     cttcgtcttt tgccacatat ttgctcgaaa tgcagcggca taggcgtgag cctgaaatgc    273600
     ccttcgcaac cctcgcaacc ttacattcaa caaagggtct tgagtgggac actgtataca    273660
     taatcggtgt caacgaaggt ctaattccac atcacaccgg tgacgaagat gaggaaaaac    273720
     gcctatttta tgtgggcgtt acccgcgcga gaaaaaacat tgtattcagc agcacacgca    273780
     ctcccagtag gtatttaact gaattgtgct tatcacctat atctgccaag gaataggcat    273840
     gcatgcctga atttatatgc gctatgtgcc ttgattagct tttacttgcg tcctttccgt    273900
     tgctatttgt atcaccttca tcgtcacctg tgctattttt gacatttcgt tctatttctg    273960
     agtcaagcag tcttgaaagt tcatcatcaa tcttgtcact cttattctcg ctaagtctct    274020
     tgatcagacc ctcaggatcg tcaatatcat gagacgtagg cacaaggtcg ggatgccccc    274080
     aaagactatc ccgcttataa ggcccaacag tttgtgttat cttgttccac atgctttggc    274140
     ttgcgcgtag cctacgtgga tgaaggtcga tccctatcag ggaggataaa gccttctcgg    274200
     ccggcccgcc gccagctctt ctccggacaa ttgtttcatt tattgcccca gcgtgcggca    274260
     gtcgggaagt tgcgatcgtg gtaacaatgc taacccatcc ctcaagaatt gctaactgat    274320
     cctcaagcac gcgcagcgca tttaattgtt gttcatttgg ctcgaacttt attgttcccg    274380
     taatctgcgt cagtgcgctt gccgcatcga agtgcatgtc atttatgtcc atcagttcgt    274440
     tatcaacgct catacttttc gaaaagctgt gaattgaggt aaatatccta ctctttatcc    274500
     aggcgcagtg ttgtaaaata catgcgtatg caatctctct gcatgcaaga taaatcccgg    274560
     cttcatcaag gggtagatga aagtcgcttg caaactttac gacattctcc gcaacgatga    274620
     gggcctttgg ggattcgaga agcggaatcc caacatcaca tccagacaaa acctctaaag    274680
     ataaattgcc tgctgcattg ccaacttgta caagtagcga tgctttacta acctgctgca    274740
     ttgcctgaga aagttgagag atgagtggct tgagggattc tggaagatta tgttgtgcct    274800
     gctgaatgag tttcgatgca ataactgaac taatcggcga agtcaggtct agccatccgc    274860
     gcgcagtatt ccttacccat tcatccctgg tgaggatttc acacggtact ttcacttctg    274920
     tcaaagaact agcttctgag agccataggt tcgctacatc aatgtttttt atcagccgct    274980
     ctcttgtgtc gctatctatc tgcactttcg gcactgtgtt tatcacttgc tctgcctgac    275040
     gtaggacctg aagttcagga ttctttaccg gtcctataat gtttggaaga aagatacctc    275100
     cttgcatcca cggtggaagg ccctcgttgc catcatcctc gtgtatcatt tcatgatgat    275160
     tctacctgaa atcatgatga ttctacctga aacggcaata gcctcccagc accctatttc    275220
     tcttattcaa agggtgtaat ttcattcaaa gggtgtaatt tcaaaacacg ctaacacatc    275280
     agtgcaccct gatacataca gctacataca gctacataca gcaaggtatg cgcacagaag    275340
     gagtatggaa tcacggaacc gcttcgcagc ccgctgccat gaatgtttta cgcgcctgaa    275400
     cacatccagc tgaatatatc agcctgcatc tttttacact ctcctgcatc tttttacact    275460
     ccggggtgca agaaagatga tgactgcgaa aaattgtgct tcgtcaaagg ttctgcgagt    275520
     actatcaggc gtacattcca tccttcggta aatgctaatt ggtggtgttt tcttataccg    275580
     aaccataaag taatgcttta accctatatc gagacacgcg tacgcgcttt ggcttgcgtt    275640
     acgcataaag gctttagcgt tgttcaggta agttgagcga tggagttgta tgcgcgatgt    275700
     tgtcggtagc cagaattatc tcgcggtcat aaaggttgtt ggaataggtg gcggtggtgt    275760
     taatgccgtg aatcgcatga ttgagcttgg cctgcgaggg gttgagtttg ttgcggtaaa    275820
     taccgacgct caggctctcc ttatgagtga tgccgatgtc aagctggatg ttggccgcgc    275880
     aagcacacgt ggcctcggtg ccggtgccga tcccgaagtt ggtcgcagat cagccgaaga    275940
     gcatgccggt gaaatagagg aaacacttac cggcgcggat atggtattta taaccgccgg    276000
     tgagggcggt gggaccggca cgggaggtgc accagttgtc gcaaagattg cgaaatctgt    276060
     tggtgcgctc acgattgggg ttgtgacgaa accttttggc tttgagggta aaaggcgcgc    276120
     cttgcaggca gagcagggga ttgcagccct gaaaaatgag gtcgatacct taattgttgt    276180
     tccgaatgat agattgcttg aaataagtga ccgcaatata agcatgctgg atgcgtttgc    276240
     aacagccgat caagtgctgt tgtcaggtgt tcagggtata actgatctca taacgacacc    276300
     cgggcttatt aatcttgact ttgccgatgt taggtcagtt atgcagggtg caggatctgc    276360
     tctaatgggg ataggttccg cacgaggcgc cgatagagcg attaaggctg cggaactcgc    276420
     cgtcgcatct ccactacttg aggcttcgat tgatggtgca cacggggtgt tgctgagcat    276480
     ccaaggtgga tctgatcttg gcatttttga aataaatgat gcggcaaagc tggtgcaaga    276540
     agtggttcat cctgaggcaa atataatttt tggagctgtt atcaacgata ctctcggtga    276600
     tgaggtgcgt gttacggtga tagctgcggg atttgatggg ggagagccaa ccctcaaacc    276660
     aacttctatc gctccgctac agcaagataa gtacccggat gcgctcaccc cctctcagtc    276720
     tgatgattac ccatttgaag aagatggtct ggatgtccca gattttctcc gctaggcgcg    276780
     acacgttctc ggatttttag caagattgca cactgaggct tgggtttaag gttaggatat    276840
     tccctggcgt aacaaggctg cgtcgtagta acagatagaa aggggcatgc gatggcgggt    276900
     ggtttgaaaa aggcaatggt ttatcttggt ttggctgaag ataatcaaga gctgcacagc    276960
     gcgcctagcg gtatgtcgca tctgaggcgc gttcctcacc ccaagcagca aatgagcgag    277020
     atattcactt ttcatccgaa gaaatatagt gaagtttcgg gcattgttga gcgttttcgt    277080
     cagaacatac ccgtgataat cgatatgtct cagctatctg ataccgatgc acgcaggatg    277140
     attgattttg ccagtggact ttcgcagggc cttgtcggaa agattgagcg cgtagttggt    277200
     aaggtttttc tcctatctcc ggagcatatt tccataagca ccgaatccaa gaaggaggag    277260
     taaacttctc tattctggtt ttttgagcag ttcttgtttt ggtatactgg ctcggaagat    277320
     cagaagtttt tgaggatcgg gctccacatg gttttgtctc ccagcgacat cgtgaacaag    277380
     aggttcgggg tgaccaagtt cagggaggga tatgaccagg atgaggttga tgattatctc    277440
     gatgaggttg ctgtcgatct tcgtcatttg cttgagagaa atgacgaact atcgtctgag    277500
     ctggagagtg ccagggggca aatccaagcc ctaaaggatg agctggccga ggcttctcgc    277560
     ggtgcctctg gtggctcgtt tggtgatcag gctgcagaga ttcttgctct cgcaaagcgt    277620
     gcccgtgatg agtatataca ggagggtgtt aagaggcggg atgctattgt tgccgaggcc    277680
     cgtgaatccg ctgaacgtgc tgctcgcaca tctgagagtg aactcaccag gcgggttgag    277740
     gctctcaaac tcgagatacc tgccctcgag aagcgtgttc ttgatttgcg tgctttcgag    277800
     agtgactata gggacaggtt gcgtgctttt ttgcagagcg ggctgcgtga cctagagcct    277860
     aagaacccct cttgacgact agaaccctgc ggttctacgc tctggtgggt tttttagttt    277920
     ttctggatca ggttaccaag tatcttgcgc atgcttatct tgcgcgcgat tttattgtta    277980
     ttccgaatct ttttaggctt actcttgcga agaattcggg tgctgccttc tcttttggaa    278040
     ctggcttttc ttggcttttc tttttgctcg ggattattgc ccttattttt attggatggt    278100
     ttttaccgag gacaactgga tcgatagtat ttttggccct gttacaggga ggtattgctg    278160
     gcaatgtgtt tgataggctt ttcaagcctc catattttgg taatggcgag gtggtggatt    278220
     ttctaaacac cccattgttc tctggagttg tgtttaacat tgccgatctt ttcatattgg    278280
     ctggagtctt tgggacgttc ttgtttttga aggggtcaaa gtaatatctg ggtcaaaagt    278340
     ttttgttatc cctccgcatc ttgatggatg caggattgat tttgcaatct ccagtcttag    278400
     cggaatgtca aggagttgtg ttgctcgggc aatttcattg ggcgagataa cacggcagaa    278460
     tgtctcggat aagaggctta caaaaagtga tcttgccagt ggggtttatg tgtggaacag    278520
     gcatgcactt catacatccg gtgaggattc tgccgcgcca gattccgtac atttttcttc    278580
     cacacttgat tcgtgctgcc tggatccgtg cgcatctaca agagacttac tgcgcgttat    278640
     ctattctgat gatgacttat tcgtgataga caaacctgcc ggtgttgcag cgcacgcgtc    278700
     accaggctgg tgcggcccaa ctgtgacggg ctgtctatct ggtttacttg cagcgtgtgg    278760
     tccgcaagat agacagggcg ttgtacatcg ccttgatgca aatacatctg gacttatggt    278820
     gcttgctaaa tccgatcttg cttatcacaa tctgaaggct gcctttcgtg acagagctat    278880
     tcataagcgt tataaggcct tagtgcaggg ataccctgac ccaagcagtg gtgttataaa    278940
     tgccccaatt ggaagggatc taaagcaccg cgatcggttt tgtattgatt actctggacg    279000
     tgatgctgtt actcaatatt ctacagagga ggtgtatccg ggatttaccc ttttatcagt    279060
     tgctccaaaa acaggaagga cgcatcagat aagagtgcat ttttctgccc tgagacatcc    279120
     attggttggg gatgtaaaat acggtgctga tccggttttc tcccagaagg tgaatctaaa    279180
     aaggcagtgg cttcacgcct atcacttgag ctttacgcac cctgtcagtg gtgtatttgt    279240
     tgaatttgag tcaagaatac atgaggatct tcaggagagt ctcaggattc tgtcgaagat    279300
     atacgatggg tcataaataa ggttcttgag ggattatatg agttttgtgc atttgcatgt    279360
     gcatactgac tattcgatgt tggacggtgc cgcccggaca gaggacctta tgcggaaggc    279420
     agcagaagac aagatgccgg caattgcaat aactgatcat gggaatactt tcggggcatt    279480
     tgatttttgg aaaactgcaa agacatatga catcaatccg ataattggta tggaagccta    279540
     cttgacgcca ggaacgaata gaaaagaaaa agttcgaaaa ttcttcgcct cgggcggtcc    279600
     tgatgacgtc tcagcaggcg gggcttatac gcaccttacc cttttatcac aaaataacga    279660
     gggaatgcat aatcttttca agctttcttc tcttgcaagc attgagggct actattttaa    279720
     accccgtata gatatagagt tgctcaatca gtattcaaat ggcctgattg ccacaacagg    279780
     ctgcccaagt ggggaaatac agactcggtt gcgtcttggt caatattctg aagctcgtca    279840
     ggctgcggca caaatgcgcg atatttttgg acccgaaaac tattactgcg aagtgatgga    279900
     tcataactta gagattgaaa aggcagttat gccagatcta ttgcgcttag cgggtgacct    279960
     gggcttgcct ctgttggcaa caaatgatct tcattatgtg aattctgagg attcggcaag    280020
     tcacgcagcg cttttatgtg ttcaatcagg gtcgactata aatgatccta atcgtttcaa    280080
     atttgactcg gatgaattct acttgaaatc ttccagtgag atgcggattc tttttgaaga    280140
     ccttcctgaa gcttgtgaca atacccttct ggtagcggaa cgatgtcata tcaattttga    280200
     tacacaaaga agtttcatgc cgcggttctc cgtaccggag ggtgaaacag aaaatagctg    280260
     gtttgccagt gaggtaaaga gaggaattgc ctcaagatac ccaaatggtc ccagtagacg    280320
     ggttattgaa caggctgaat acgaaattcg tgttgttcaa gaagctggct atgctggcta    280380
     ttttttgata gttgcggatt ttataaattg ggccaaactg aacggaattc gcgttggccc    280440
     aggtcgcgga agcggagcag cctcaatggc ggcatatgcg atgcgtataa cagatctaga    280500
     cccattggag catgggctta tctttgagcg ctttctaaat cccgcaagga tttcaatgcc    280560
     agattttgat atcgattttg atgaacgcag gcgcggtgaa gttatagact acgtcacaaa    280620
     aaagtacggg tcggatcatg ttgcacaaat tgtgactttt gcaaccatta aggctaaaca    280680
     ggccctcaag gactctgcgc gggtcttgag ttatccgtat agcttcggcg agcggctcac    280740
     aaaagctatg ccccccgcag tcatgggccg tgaaattccc ctgcgcgcta ttttcgatac    280800
     cactcattca cgtcatagag aagccagtga agtcaggcag atgattgaat ctgattatga    280860
     gatgcaacaa atctttaata cagcaaaagg attggagaac ttaaagcgcc aatgggccgt    280920
     gcacgcagct ggcgtaatca tgtctgatgc tcctattatc gacataattc caatcatgaa    280980
     gcgcgagtct gacggtcata tagtgacgca atttgactac gcttcgtgcg aatctctcgg    281040
     tcttgtaaaa atggactttc tgggccttcg taacctgaca attattgatg atgcacttgc    281100
     taatattcgg caaaataaaa ataccaaggt agatcttgaa aatctccccc tcgatgaccc    281160
     ggaggtttat aaacttttgc gcagagccga tacattaggt gtttttcagc ttgactccgg    281220
     gccaatacgg caactcttgg agcttatgca gcctgatagt tttgatgata tatctgcggc    281280
     aatagcactt tataggcccg gcccgatggg ggctaggtca catacgaatt atgcacttag    281340
     aaaaaaccgg aagcaagaga ttgatcatat tcatcctgag ctcacaaagg atctgtctgt    281400
     tttactgtct tccacatatg gcttgattgt atatcaggaa caggttattg ggattgcgca    281460
     aaaactcgcg ggatttaccc tcgaagaagc tgatgttctt cgttgggcaa tgggtaaaaa    281520
     gaaaaaggat gagctcgatc ggcagtacaa taaatttgct aacggtatgc gaaaggctgg    281580
     ttacagcgac ggtgctacgg aagcactgtg gaatgttctg ttgcctttct ccgattacgc    281640
     attcaataaa gcacacgcaa cggcatatgg actcatatcg tactggacag cttacctaaa    281700
     agcacattac ccaacagaat atatggctgc ccttcttaca agcgttgaaa cctctaggga    281760
     taaactcggt ctttatctac aggagtgtcg acatatgtgc ataaaggttc tgttaccaga    281820
     tataaatgtt tcaaggagcg gttttacacc atcgggggaa aatattttgt tcggcctggg    281880
     ggcgattaaa aatgtcggag ccaatcttat tgacgatatc cttgaggtcc gcgaggatgg    281940
     accatttgtg agcttgatag atttcgttca gcgtatgcca cactcggttt tgaatcgtag    282000
     aagtgttatg tctctaatac aagccggggc atttgattca attcatccaa atcgtagatc    282060
     tttgatggat atacacaggt cagtcttgga aaactgtcag gcaaatgccc gccgtagcga    282120
     tgtgtcattg cttgatggcc tgcttgatga atatgaggga ttttcaccac ccgatatacc    282180
     tgattggaac aatcgtgaac gattgaaata tgagcgtgaa atgcttggaa tgtatgtttc    282240
     ttcacaccct ctagatggcc ttgaggattc actcctaaaa ttcagggact gctctattgc    282300
     cgagtgtatt agccgtaagc ctcaagatgt tataagggtt gcaggtctta ttaccagcgt    282360
     agagcacaaa gttgcacgcc gcactggtat gcggtatgcc catgcgattc tggaagatac    282420
     cagtggtgag attcagatca tgctatccgg tcagaactac aacaattttt cagaacaact    282480
     tgttacagat tcaattgttt ccgttaccgg ccgcatcagt tttcgtgatg atgccacgac    282540
     cttatactgt gattccatca aagatgtatt gccagtcaag aaagaagcgc ggttacgcct    282600
     gaaatgttct gaagggtttc tcacgcagaa cgtgtttatt gcccttgacg atgttctgcg    282660
     gaaatatccc ggagatactc ctgttacgat ggaggttatt atcaccgata actcagttgt    282720
     gaagagcaaa acctttgagc tcagtcgctg tgttgaaatt agtaatgatc tcattgccga    282780
     agtgaaaggt atacttgggg tagaggggat ttccggttaa tttgctttct tttctttgcc    282840
     gttttgtgca ctttgttgca cccccacatc cggccccatc gtctagaggt ctaggacgtc    282900
     gccctctcac ggcggtagcg cgggttcgaa tcccgctggg gtcacacttg tttttctact    282960
     tccttcggcc tattcaaaaa catgtttgaa tccatatctt tgttgatctt tgctgtgatt    283020
     ttggtgcttg acatgctggt gactgtacgt cgacctgccg tgccgagttt caaagaagct    283080
     ctgttttggt gctttggcta tgtggccctc gcattggcgt ttttttgcat ccttttgcat    283140
     ttccgtggac ttgatgatgc gagtatgttt ctgaccgggt ggcttataga atatagtctg    283200
     tcaatcgata atatttttgt ctttattacg ataattgttt tccgttttgc ggttcctgaa    283260
     atcttccaga gatatgtttt gtcaattgga attcttattg caatttttct ccgagcgatt    283320
     tttattttct ttggatcggt cgttatagag gccttttctt ggacattttt tatattcggc    283380
     gcactcctca tatacacagc tctaaaacaa ttttctgcaa agggacacac atctggattg    283440
     cttgacaagg taatgatcag gatgaatgta agtaagaact acgattcgat gagacctaga    283500
     accggacctc gcggcagcag acggtggacc ccgatggttg ccgtttttat agcgataggg    283560
     gttgccgata cgatgtttgc ccttgattct ataccggcta tttttgggat aacaactgac    283620
     cccttccttg ttcttgcggc aaactttttt tctttgacag gcttgcggca gctatacttt    283680
     gttctatctg aatgcgtgca cagactggag tatatgaagt tcggggtcgc ggcgctcttg    283740
     gcttttatag gtattaagct cgtgcttgat gccgggcact ctcacggaat accttttatt    283800
     cctgggtcaa gtgttttgtt tcctgttatt aacatttggg tgagtttgtc ggtcatactt    283860
     ctcatcatcg ctctgtctgt tgcgcttagt cttataaaaa cgaaaaaacc taagaaactc    283920
     aatagcgttc cctagcgtct attgacctct agggaacacg atgtgttagt tgagatgaca    283980
     tgaagcttga tagcacccct gacaggtttg ttataacggg cggctcgccg ttacgtggtg    284040
     aaattgctgt taagggtgct aaaaaccttg taacgaaggc aatggtcgcc tcaatgctcg    284100
     gcaattcaca gagcgtcttg acaaatgtgc ccaatatatc ggatgtcctt attgtccgga    284160
     gacttatgga ggcttataac gtaagtgtac gtgccacgca gaacgacaca ctcgttattg    284220
     atccgattct tcttggacag tgctctcggg gtgatattga tgtttatgcc ggatccagca    284280
     gagttccaat cttgttttgc ggtccgctac ttcataaaac aggacaggca tttattactg    284340
     gcttgggcgg ttgcaggatt ggggaacgac caattgattt tcatttacaa gccctgagga    284400
     agtttggcgc aagtcatgaa aaacttccag gtggaatact tctttcaaca aaaaaaagat    284460
     tgaaaggtgc gagtgtacac tttccgtatc caagtgttgg tgccacggaa caggttctgc    284520
     tgacggctgt tttagcagat ggtgttacag agcttagagg tgccgcaatt gagccggaaa    284580
     taatggatct gatcgcgata ttgcagaaaa tgggtgcgat cattacctgc gcacgagaca    284640
     gggtaatttt tatagagggt gtcgacagtt tatcaggcta tacacaccac gctatcagtg    284700
     accgcaatga agccgccagt tgggcctgtg ctgcacttgc aacgcgaggt gatatcttcg    284760
     tgcggaacgc cgaacaggca catcttctcg catttcttag tgtatacagg aaggttggtg    284820
     gagtgtttga gatcaaagat gatggaataa ggttttttca tcccggtggt aacctgaatc    284880
     ccgttgttgt tgaaacagat gttcatccgg gcttctcaac agactggcag cagcccctcg    284940
     ttgttgccct gacacaggcg agcggcagat ccgtcgtgca cgagactgtc tatgaatctc    285000
     gctttggatt cactgaagct ctcaacagaa tgggtgcaga tatttctgtg cacgagaatg    285060
     gttttcaggg aacacttcgc agggtgccac acagagccat agagcaagct gctgtgataa    285120
     atggcccaac tccattgacc gggcaagaca tagatgttcc agatctgaga ggtggattca    285180
     gtcattttat tgctgcattt gctgcagaag gaaagagcat cataaccaat gcgggtatta    285240
     taagtcgagg gtatgagaac tttgtccata agcttgaaag attgaaagtt gattttgagg    285300
     catgaaggaa acgcgtttgc cttcgcgctt ttgggttttt acgtttctta tcaatcccct    285360
     tgtgcggctc ttgtttcgtt acacactgcg gggtaatgtt ccgctaaggg gtcctgttat    285420
     catcgttgca aatcacaata gtgaactaga tccgatttta tttgcgatag ctatttggcg    285480
     catgggtcga aagccatatt ttatggcgaa gcgtcagtta ttttccgtgc ctgccttagg    285540
     tgcatgcctg aggttcttgc ggcagattcc tgttacccga ccctctgata cgccatgtgg    285600
     tgatatgaca gaaaatacac acgcgccttc actcttgaca gctatcaggc gccttcgtgc    285660
     cgggggagtt attgtgcttt atcccgaagg gtctgttaca cggcatcccg agctgtggct    285720
     tgacagtttc aatccgggat ttgttcattt ggcaagccta acaggcacac ccattatttg    285780
     tgcggcccag tggggtgcac agaaaactct tccttatgga aaaaagttac caaaatttgg    285840
     gctgcgcaat gcgtacagtg ttgtattttg tgccccggtg catattccga gaaaaaggct    285900
     gtcagatgag gagattaagc gcttcagtaa cctgatgaag gaaaaaatta atacagccct    285960
     tgcagctatc aggttatccg atgagacagg cttcatgcga catgaaagag ggtgggttgc    286020
     gcaataaagt cgctgttata ggttctggat catgggggac cgccattgcc aatctgcttt    286080
     gtaaggcggg gaatgaaact attctatggg gcagggatga aaatgttatt gatgagataa    286140
     ataacgccag agtcaattcg aaatatcttc caggagtaga attattccta cgggcaactt    286200
     gtgatcttga ttatgccgtt gccgacgcct cccatgtata catagcatta ccgagctttg    286260
     cgctatcaaa agtattaccc aaattatccc tggataagtt ttccattgta ataagtctta    286320
     taaagtgtct tgagcctgac acgggcagac ggatgagtga ggttatttcg gaggctttgg    286380
     acctcggtca caatcgcctt gccgtcataa gcggccctaa tctcgcactt gaagtggcca    286440
     atgacgaacc cagtgtgtcg gttgttgcgt ctgcgaatat tgcaacagcg aatattgtgg    286500
     ctggcactct gaagtgtcct gggttttatt gcattccaag ttccgacatc aaaggtgttg    286560
     aaatatgtgc tgcctcaaaa aatctggttg cactaatatc tggaatagcc agaggtatgg    286620
     atcttgggga taatacacgg gctgcgctaa taacgctcgg attcagagag ctcttgcgtc    286680
     ttgtgcttga aaatggtggt actgaggaaa ctgtttttgg cgtagcgggc ctgggtgatg    286740
     tggtggcaac gtgcaattct catttgtcaa gaaataacaa agcaggagtt ttgcttgcaa    286800
     agggtgcccc ccttgatgag gtaaaacaaa ccgcagaggg ggttgttgcc atttcgggcg    286860
     ttctcgccct cgcggaacgc agtggtgtat acatgccaat tgcgcaagcg ttaagtcagg    286920
     ttattagcgg taaacgaacg gcacattcgc ttctggatat ttgttttagc ctggcgtaat    286980
     gcgcagcttg ctcttattat ttggtggtcg ctcacaagag cattcggtta gttatgcatc    287040
     ggccagggcg ttgcttgaac atatatgcga tgaatggact gtaattcctg ttggcataac    287100
     aaaacacggc gattttgtat actgcagcac tgtgtcagag caggattatg gcgaagtcat    287160
     tgataatggt aatagagttg tttggcccag ccgcgcgggg tgcaaaaaaa ttgaggtagt    287220
     ccaggctcgc ggcaaaagct tttttgttga gttcgatctc gtatttcctc tccttcatgg    287280
     ggtgtttggt gaagacggaa caatccaggg gatgcttgac ctgcttgata ttccttatgt    287340
     tggttccgga gtatttgcaa gtgcagctgc gatggataag cactatacaa aaatactgtg    287400
     ttcccacgcg ggcattccgg ttctgccgtg gtatctcatt aaggggcatg cttggcataa    287460
     gaacagagat tcttttttga agcaaatttc tgacagattt acctttcctc tgtttgtgaa    287520
     gcctgttgat gctggctcga gttttggttg cacttttgtt gattttttcg agcaattgcc    287580
     agtggctata gaacatgctc ttcaacacgg aaaatctgct attgttgagc ctgcccttga    287640
     tgctccagaa gttttttgct cactcattga aaataatggg gtattgcagt gctctgaact    287700
     cgtttttgta aaacatagtg gcagtaagtt ttatgattat tccgccaaat acctgaaccc    287760
     ggttgagttt gtgattccag ctcagtttga caataccgac ggatatgccg agattgcttc    287820
     aaaagttttt ttcgagcttg gctgtcgcca ctacgctcgg attgattttt ttgttacaga    287880
     atcgggtctt gttctaaatg agattaacac atcacccggc ctcactcaga aatcgatttt    287940
     tccatcaagc tttaagtcga tgcaatacag tcaagttata gagactattc ttgcctcagc    288000
     ctactgccag gtcaaacgct aaactgagac ttgcatcaac tgcatgaagc cacttttggc    288060
     aggtaattta ccgccaaccc aagtgttgcc agtgctgttg ctggtgatat tttaaaattg    288120
     tccaaaaaca cctcagctgc cggcgatcgc ccgtaggtaa cggctcttac attgaacttt    288180
     accccatgaa tatttgtatt aaatttgtca tttattaccc agtcaacatt gtttacactg    288240
     acacacaatt cagttgtcgg cttttgcaca ggaagtccgc aacgcaacac ggctcccaat    288300
     ggttctcccc atgcagctgt tgcctgggca gttgtttttc tgcttaccag atttcccagt    288360
     acttgcggaa gtcttactgt aacagctgca caattcgggt tattcgcact ttgtgcgggt    288420
     tcaagcacaa tagccgtgct gcagccaaaa agcgcagagc taacaataaa ggcacacacg    288480
     gttttgcagg aaactcccat cgtagcaacc ttaaatccat tgcacgctaa actgtacaat    288540
     ttcccgtttc aagcagggat tttatgtatc ctaaaaacct agcagcatcc gcgccatcaa    288600
     taaccctatg gtcgtacgat agggcaaaaa acgccacgga tcttatcgag atacactcgt    288660
     ttccttgcgc gtctaacaca attaccggac gccttgcaat agcaccaatt cccaaaatcg    288720
     cgagttgcgg aagaaataca accggcgtat caaatagagc acctcgggaa ccggtattcg    288780
     tgactgtaaa tgttccaccg gtaagttcat ctggagatag tttgttgtta cgtgcccttc    288840
     gcgccagatc aaaaacactt tttgcaaatt gcgccaccgt catatctcca gcgtttttta    288900
     ttacgggtgt cagcaaccct ctttcggtgt caacagcaag tgaaatattt tcataatccg    288960
     gaaaaactat ttgatcatcc acaatatggg aattaataac tggatatttt ctaagtgctt    289020
     gaactgtggc gttgattata aacggtagga cggttagatt cacaccctcc gcttctttga    289080
     atttttcttt tatgctattg cgatagtcaa ctatccttgt tagatctacc tcaattacag    289140
     tgctaagctg tgcggtgttc tgcattgaat gaacagccct ctcagctatt atgttgcgca    289200
     ggcgagacat cttaatccgc gtcccacgga gttctgatac ttcgctgtca aagcttgcgg    289260
     cacttttgtc atgttctgga cttgatggga tgttttgagc acattcggtt gaggtatttg    289320
     ttgtgcggtt actcgccaac aatacatcct cccttaggat tctgttgccc actccgctcc    289380
     cgactatgtt agttagatca atattcagtt ttcttgcaag ctgtctaaca atcggtgttg    289440
     cgtacggtat ttctgcatta tgcgcagcat acaaattgcc ttgcttgtcg ccttcatctc    289500
     caatatgatc tgcttttgct gatagatccg gtttgctctc tgcggtatgc agtgtgactg    289560
     gccattcatt atcttcgatt ggacgagtat tacccaacag gttaccggcg gaatcccctg    289620
     ttattacatc tgattgtttt accccgtggt caaaattgct tttcgtctca tctttatcga    289680
     ctgctatcct agcgagaatc tgcccaggtt ttgctgtttc atcgcgctga acaagtattt    289740
     cttccaatat cccagttaaa gtggacggaa gctcggtatc aactttatcc gttgagactt    289800
     caaccagtgg ttcatcaact tcaacccgat ccccagcttc tttgagccag cgagttatga    289860
     cgcactcact tacgctttca cccaatgcgg gcaggataaa gtcctcactc attcaaagtc    289920
     tccaggatta taaccatatg taacacacat cccgcacaag cgccgcattt tcaaaggttt    289980
     ttgtgggccg cattttgcct taaagttacg cggtctgcat ttacgcaacc acgcgataaa    290040
     tgatatttct tgtaatgccc aggtactaaa taccatgtag gggtttccct gcgagtgcaa    290100
     gcatcgcttc gccgatagct tctgcctggg ttggatgtgg atgaataagc gatgcaacat    290160
     ctgatgggtt ggcttcccaa tttacaatca attgagcctc ggatacaagc tcactaaccc    290220
     catcgccgac catatgaacc ccaaggacgt ccttgttttt gtgctggacc accttaatgc    290280
     ttcccgcagc ccccataatg gaactttttg cattgccagc gagattgtat tcataggtaa    290340
     ctatttcatt cacgccatat atctctgctg ccccagcttc tgtatatccg acagatgcga    290400
     cttctgggct tgtgtaaatc accctcggga tattaatgtc tgccacagcg gatgggtcaa    290460
     gaccagcaat ttgttcagcc aaatatatgc cctgctgata ccccctgtgc gcaagctgta    290520
     gaccacctac aacatctccc gcagcgaata cattaggcac agttgtcctt agtttttcat    290580
     caacagagat ggcacctcca tcaatttcta ttccaacttt gcctattgca tctgttgcgg    290640
     gtgccctgcc aattgccacc agaagcaggt cagcatttac tttttcgttt gaatcaaggg    290700
     ataccaccac accatctgtc tgtgacacat ccattatttt gtgccccaga taaagcttta    290760
     tacctcttcg cctgaaaacc cgttcgagct gtttgctaac acctcgctcc tcggaaggaa    290820
     taagagtttc ttgagcctcg agtatgctca catcaacacc gagataatta aagatacttg    290880
     caaactcgac gcctattaca cccccgccaa taatggcaag actcgacggg agatgatcta    290940
     tctcgagaat agaatcgctg tcaaagatgc accccccgct taatcccggt atgcctttcg    291000
     gtctagaacc tgttgcgatc actatgtttt tccctgtaat atcttctgtg ccgatccgaa    291060
     cagagttttg tgaactaagc gttgcaaaat tcgggtagac atggataccg taggatctca    291120
     aaagtgactg tagcccacgg tacttacttt caacaatgcc attcttgaag acatttacag    291180
     catttatatc aacaccagaa aaactattta taaccccaaa ttttgacgca tttttggcaa    291240
     tatgggcagc ttttgcacat tgtacaagcg attttgttgg gatacatccc ctatgcaggc    291300
     atgtcccgcc aactttatcc ccctcagcaa gtgcaacctt catacctaat tgcgttgcgc    291360
     gtatagcagt cgcgtaaccg gcacttcccg caccaagaac tatcagatcg tagtccataa    291420
     tgccctagaa cagctttcgc tctggagcag aagacaggca tcggcaaaat tcaacaaggg    291480
     accttacagc cacgccagtc gggccgcaag aattaaatcc ggtgtcgtaa gatgcatttg    291540
     ctggacctgc aacatccaga tgggcccatg ggatagcctc gcccgagtca tttgttgtct    291600
     caaattcttt gagaaagaca gcaccaaact gcatcccagg tactttattt gaagttggca    291660
     cattgacaat atctgcgata tcagacttta acgccttttg taaggcatca tcatctattg    291720
     ggacagcaag aaacttctcc ccaacacttt tcgccgcaac ctcaagcgaa caaagcaggt    291780
     cgggattatt acccataagc cccgaacaac tttctcctag ggcaactttt gctgcgcccg    291840
     ttaatgtcgc aatatcaata attacatctg gcctttcgtc accagcaagg gcaagcccat    291900
     cggctaaaac taacctgccc tctgcatcag tattcgttac ctcgaccgtt tttccgctgt    291960
     acgttcgaag tatatcccca gggcggatag cacttcctga cagcatattt tccgcaagac    292020
     ataaccaccc cgtcaccctc acagacaaac gcagaagagc gacaattctg agcacggcaa    292080
     atacattagc ggccccggtc atgtcgtatt tcatgccgag cattgcagat gccggtttta    292140
     gcgacaaacc accagtgtcg aaagtgattc ctttacccac caaactcaag tgcttcttgt    292200
     attgcccggg agtgtacgag atcttcacaa gccgcggcgg gaaattagac ccgcgcccaa    292260
     caccaagaat tccaccgcaa gacttttcct gaaggcgctt ttcatcccaa gattcaacag    292320
     aaatgtggtc aataccctcc aggtccttcg caacaaaact ggcaaactgc gcaggataca    292380
     ggtcatcccc ggttgtgttc acaaggtcct tcgcaaggcc aactgatcct gcaataacct    292440
     tagcgcgggc aattatctgc ctgcactcac tatccgttat gccgtttatg ttatgagaga    292500
     cacgtattac ttcgggacac tcgctcttct tgctgcgata tttatcaaat ctgtatgctc    292560
     caagaaatgc accttctacg atggcactaa gcttatcctt ctgcgtcaca gagaagtcga    292620
     tctgaataca tctggcacca atttgcctta ccgcagatcc agctgcgaac attaattctg    292680
     tcgcagaaaa tgccttgcca acccctataa aagccagaac aacatgttta ctaccgtcaa    292740
     ggggaatgcg agtgagctca tccttggatc ctgttacacc aagcttttga aggatatcct    292800
     cgtacgctct aaatttagag tcttcgggca gccttggcac tgcgccagaa gctacaggaa    292860
     ccacgatgac atctgccaca agtgaatcgt cacttgtaat ctctacggtc acagtattcg    292920
     tgtaatcact catgttaaac agactgcgcg cgcccacgcg cgagtagatc ccttccaaat    292980
     aaacatatct caaatgttac aacaaagcag gttatatgta gtcccaagca gcatatttcc    293040
     atgaatagct tcgtatagca cacaatagtc ccagtctcgc cgtgcggatt tcttcttctg    293100
     gagtcataac aagcgtatta tcgaaaaaat tattcacagc ttccggtaaa ttttttgctg    293160
     cacggtagaa tccttccaaa tcagtgcaat tcgtttgcct gatcgcttca aatgtgttta    293220
     ttaggttttg ctcgtgcaca gatttgaggg gtgcatcatt cctctcaaaa tagaagtttt    293280
     tacagatcct gtcaatccgt ttcaaacact gcactatctc cagaaattga cttttctgtc    293340
     taatctgaca gagttgcgaa aatgtcttat ctgcttcgga aagtactgtc ttttgggcag    293400
     catatacgat attttgaagg gaagctgtgt ccatggataa agtccttgat tgactgtctg    293460
     aaatgcgatg tcgccacctt cccaggatca ggtcaacaat agagtcctct acaccatcca    293520
     gaatcacatt gcttatgccg cggtgctcca taatgtaacc ctgcataatg tcaacaactt    293580
     tcccaacagc aacccgaata tcaattggat taagatcata cttctgcggc aaaacacgca    293640
     gaatgtcaac aagtccactt gcggtacgcc ttaccccaaa cagatccgaa ctgcctgttg    293700
     aggttatccc cagagcggtc atcgcaacta attgatccaa gcgatctgcg attgacaata    293760
     tcgcaccggc ttgtgttacg ggcagtgatt ttcccgcact tctgggtgcc tccatgtctt    293820
     ccagcgcttg tgcgacttca ggcggctttc cagcccgctg tgcatatatt tttgccataa    293880
     aacccgaaag ttctggcatt tcggttacca tttgtgaggc aaggtcgaat tttgctattg    293940
     ccgctgattg tcttgctgta ttcgaaagat ttttatcagc cttcataagt gcaagcagct    294000
     cgtctgtaat cctttgtatg cgctgtgatt tttgcaaata gcttcccagt ttttcctcat    294060
     acacaaggcc gtcaagcatt ttgtacaaat tttcgggtga cagtttagaa tctgcctcct    294120
     gaaaaaagag ggcatcttca aagcgagttc ttattacagc ctcattcccg gatcgcacag    294180
     tttctttatc gcacaggcca tttgcgaagg ttatgaagtg ctgacttatg gttttttgat    294240
     cacatttttc acgctgtata cgtttgcaag ttgcacattt ttcagatagc gttatgtact    294300
     tttgcttttt cataattgca ttcaagacaa cttccggcag ctccaaatac tttttttcaa    294360
     atctgcatat caccaaactt ggcgcctcaa ctaaatccgt tatttcttca attggctgag    294420
     ttgaaaagtc gatttcacaa gaaacacttt tagcagcgag attagcggat tcaaagatta    294480
     tttctcgtct tttgcttctg gagaggatta caccgtttcg tgtaagaaat tcttcgtaat    294540
     tgtcggcggc ctttaccggc acgatagggg ttttactatt gcgcaaaaca cgcgtatgca    294600
     tcccggattc caacaaagat acccttacat taagctgtct ttgtccatac aatgcaacaa    294660
     gccatcttat tggcctggag aataccaatt ttgggtcatt ccagcgcata ttccgcgaac    294720
     tccggatttc tagaacgatt tcggcaaata tctgctcaag gagtttggct gcggactgtc    294780
     ctggaatgtt ttttgttatg aagacatgcc ttctgttttt gtggacagca atttctattt    294840
     cgtcaagact cttaccattt gcttttaaaa acccggttag tgcatctgtt ggttttttat    294900
     catcatcaaa tgccgcttct acctttggtc ctcttattcg cacactcgag tcactttgcc    294960
     tggggtgcat tttatagatt cgtataacaa ttcttcttgg cgttgcatcc acgctatatt    295020
     tctcaaactt aagttgcgac cttcccagtt tttctctaag cgtgttttca acagtagtga    295080
     tgatttcttg tgtgctgggc atttcttctg ttccgatttc aaacaggaca gtttccgggc    295140
     cctttgttac agggtctttc atgtctggcg gtttttctat cgctatatcg atgccttttg    295200
     tgtgtactgt atcgtcactc acctcaccat ttgatctact ttcgacccac gtagcagaaa    295260
     tctctttggt tagtgtacgc atcagtgaga acgctttcgc gcgttcagcg gtgctaattg    295320
     caccccttgc atcaagaata ttgaaaacgt ggctgcactt cagtacaaat gtgtatgcgg    295380
     gaagaggaag gccagcgcgt aaaagcatct tagcctcatc ggaatatatc tcgaagagct    295440
     gtttatttct ctcgatattt gctttctcga ggtaataagc tgacatctcg cgttcgttct    295500
     gcgcaaacaa ttcaccatag cttatattct tcgaatactc tatgtctttg aagtgactaa    295560
     ccttctgaag ggccatcatt attctttcaa ttccataggt tatttcaacc gcacttgtct    295620
     ttagcggcac cccaccaacc tgctgaaaat atgtgaattg ggttatttca agtccatcaa    295680
     gccatatctc ccacccaagg ccccaagcgc ccaatgcagg actttcccag ttatcctcaa    295740
     caaaacgtat atcgtgtttt ttaaggtcaa ttccgatggc ttccagactt tctaagtaca    295800
     tctcttgcgg attgccaggt tcgggtttta ggagaacctg gaattgcgtg tggcactgca    295860
     gtctgctcgg gtttatacca tagcgcgagt cgtcaggtct aacacatggc tcaacatacg    295920
     caacacccca ggtcttgtca cccagcactc ccagcagagt tgccgggttc gcggtccccg    295980
     caccaacttc agtattcatc ggctgaaata cgagacaccc tctgtgagcc caatatgtct    296040
     gaagaatgag aatcgtgtct tgcattctgg gtgtgtgttt ctgcactaca gtagtctata    296100
     ttctctccgg aggggagtct catgttataa ttccccctag gttatgccgg taaagataaa    296160
     aacccagtcg cgcgggtctg ataaagaggc ttttgccggg gctccctcta cttcgggtgc    296220
     ttccggggcc gttcttgacg aggatctttc aactgatcct gcttcgcata tctctgcaca    296280
     agccactgca tccgataccg acgttgcatc tcaaggatcg gaaggggatt tcgaggcgat    296340
     cgtccttgcg gatacaaagg atgatgagtc aaccccggct tcgcccgtaa tttctggcgc    296400
     cactgctgac cctgtaaaag attatttaaa gcaaatcggt aaggtatcac tcctaacggc    296460
     cgacgaggag gttagccttg cgaagcggat cgaggcgggc ctgtttgccg aggaaaaact    296520
     ctcagagtca ggtgatctcg cgccgaagct caagcgtgag ctgaggtggg ttgtgcgcga    296580
     cggtcagcgt gcgaaagacc accttttagc cgctaatttg cgattagttg tttctctggc    296640
     caagcggtat acaggccgag gaatgcagtt tcttgactta attcaagaag gtaatttggg    296700
     tctcattagg gctgttgaga agtttgacta tgtaaaggga tttaagttct caacttatgc    296760
     gacatggtgg attcgtcagg ctatcactcg ggccatggcc gatcaggcac ggacaatccg    296820
     tattcccgtt catatggtcg aggttataaa caagctttcc agagtgcaaa ggcaacttct    296880
     acaggatctt ggacgtgaac cgactccgga tgaactgggt cgtgagcttg acatgccacc    296940
     ggagagggtc gttgaggttc agaaatacgg gcgtgaaccg atttctcttc acacccctct    297000
     cggcgatgag ggtgacagtg agtttggcga tttgatagag gatgttgacg ctgttgcgcc    297060
     tgacgatgcc gttgggttta gtatgcttca gcagcaactt cgtcttcttc ttgattctct    297120
     ttcggagcgt gaagccggcg ttattcgtat gcgctttgga cttgattatg acatgcccaa    297180
     gacattggac tacgtcggtg agtattttga tgtaactcgg gagcgcatta ggcagattga    297240
     ggcaaagacg atggcgaagt tacggcaccc atcgcgctct caatgtttga gggattattt    297300
     ggggtaactt gaggggttgc ctggccatct tcttcggccg cgctcttctt gttgccttgc    297360
     gtgttctacg ttctggcggg tcagtcttac ccggtgttct tgctgagttt atatcccctg    297420
     ggattctcat tcgtcttatt ggaaactctg aaattatttt tgtgactggg agtaacggga    297480
     agacctcgac aacccggatg gcagttagca ttctaagagc tcatgggcac gaggtcttta    297540
     cgaattctag tggtgccaat atgaaatatg gcataatcgc cagtttgttg gcagtgccaa    297600
     agcgcacccg taaaggtatt gccttgcttg aagtagatga agggcatatt gagacgcttg    297660
     cagatctctt gaagccgagt accgcgcttt tcctaaatct ccaggtcgat cagctgaacc    297720
     gttttcatga cccaggaaca gtgctcgtca agctgaaaaa tagtcttgca ttcgtcaagg    297780
     atgtacttat attcaatctt aatgaaccgt gtttttctga gctgctagaa agcagtctag    297840
     catctcagaa actgagtgtg tacggattct cttcaagcag tgacattcta aactcaatac    297900
     ctccaaccgg acttttaccg catcttaggg gtcaattttc ccctccggga cgtatagaga    297960
     gcttgtgcca tattgaacat tattcggccc gcacagcgca cttctcaata caaggtgtcg    298020
     acaggctaca agaaatacaa ttgcgcacag aaggggtgca tcatgcacag aacgctgctg    298080
     cagctttcgc gctgtgcatg aaaattttgg gcgatgaatt tgatccaaac aaagcatctt    298140
     ctgcggtaag tttatcaaca cctgcatttg gcagagatca ggttattagt ctggccggtc    298200
     aaccggtccg gatccttctt atgaagaacc caaggagtat gcaggtaaat cttgaaagta    298260
     ttgctgcagg atctcgtgta atgataggca ttgacggagg cacccctgat ccgtcctggc    298320
     tttatgatgt taatctttcc gatataaaac gcgctgtggt aaccggtagt atggcatggc    298380
     aggttgccct ggccctttcg tacgctggtg ttgtaattga tttggttgaa ccgaacttat    298440
     ttagggctac aaattatttc cttcgccact caagttccga caaatttcag tctttttata    298500
     acaagaaaag cgaggtgcta cgcaaatcaa attttgacaa taatcaatgt gtcaccgcta    298560
     cccatttgga tgctgatttc aacagagatc agtttggcgc gaaagatgat tcggcaatgg    298620
     ttatgatcct caattacgaa atgtccatga ggcttcttag gcactacagg tacctggata    298680
     gctcgtgcta ttagttgatt tgtttccaca ccagctgagt attcgtggtg ataggggtaa    298740
     tgtaacagca ttgaaggctc gagcgcattt tgctggccac aagcttgaga tatacgatct    298800
     tcacccgggg aatgttttgc cgaccggtgt atcgggagta gttatcggtt caggccctga    298860
     ttatgtttta gccgatcttc tcggtgatat gagaagactt gcctgtgacc tcaaagcctt    298920
     gagggatgac aatgtgccgt ttttagcgat ttcaaatggt ttacggcttc tgtcagaaaa    298980
     atttgtatca catgatgatg ttgaacacac tgccgcggga gtttatccaa tttcctgtca    299040
     tagaattcgc agacgtgttg gtgagtcgat tgtaaaatgc gattttggtg aacttgttgg    299100
     gtttgaaaat cacgatatcg agataactga caatgaacat ccgttaggtt acggcttgga    299160
     cagtagggga actttttcta ggccacacgg gtttttcctg gggaatttga tggcatgttt    299220
     tttgcacggt gcctttctgc cattgaaccc cattgttgcc gattggtttt tatcacgcat    299280
     gggtggctgt gcaacagcac attccgtcga taatgactgt aaccctaaac aatcttgtga    299340
     taatcgatat tgttgcgcac aacccagcgc aactgacttg gatttttatt cacacatggc    299400
     acggagggta atcaaaaaaa gggttacccg cgcgattaga tacaagttta ttccaggtaa    299460
     ataagctcag cttttacacg cgataagaca tcatctattg ttgtcccaca agactctgcc    299520
     cattgtctgg cagttagctc tgaaagccct ccggatccga aaagaataac atggttttgg    299580
     ctgacacgca gtgcatttaa aaaggggtct tgcggtacgt gatcataact attttgcaaa    299640
     ttgtcttgcc gtcgatcgat atcttgacag atctctataa cagatgtttc gggcccaacc    299700
     tcgattagtc ttgcccggtt acttcgtcct gtaagaggaa cattattgcg caccgcaagc    299760
     gggctgattc catcagcaaa cccacatgca attattgcac gcccctgctc gggaagaaat    299820
     tttataattg gcgcaactaa tgtcataacg ccttttagtt cttctttttc gtaataacca    299880
     aaacatgaga ggcctagcct tacgtaatct agcctgctct ccggcaggcc caatgccgca    299940
     acggacgctg cgatatgcat tattggcctg gcacgccggc tgtaacttgc gagatatggc    300000
     gtgacgtttt ccgtgaatat ctttagggaa cgtctatctt cctctggaga agtgttagac    300060
     aggtgggacc aaaatccagt tatctttata aggcccatct cctgaaagtc ttgtgcaaga    300120
     cagacaagat tttgccagtc cttcacgcca cacccacccc gactgaggcc ggtatcaagc    300180
     tttagatgaa ttagagctgg tttataacca gacagcacct cgcatgtcat tgtctttttt    300240
     acacacgatg cgatatatcg caactgccat tctgcaccta tgccaatttc aatattgttc    300300
     tcaattaggc tcggcaggtc ttcacagtct ggggtaatat gccaagtaaa tactcgcact    300360
     cccggcgata aggctcgttt tatcagtagg gcttcttttg ggagaagaac ggcaaaattg    300420
     cgaattccac tcatttttgc cacctcggca acacgcatcg tcccgtgtcc attcgcattt    300480
     gcctttataa ccatgaaaac ttttgccggt gcgacttcat tttgcaacca cagaagattc    300540
     tttttcaaag tcccgagact aataaacgct tgagcgtggg aattggataa agcagttctt    300600
     tgtgtcattt ggtctgttcg ttatctgcgt ttcttttctt catccgacct tatcttttta    300660
     tgtaagccag cgtttctcaa ccctgtatgc tagtcctgcg gtaaggcaga gggggtctat    300720
     tcccgctgac aaaccccaag tctttgcacc gctttctccc catacggtaa ctcttgttcc    300780
     atgtttatac gagtcaggtg taaccttcgc aaccatgtag tccatggcta ttcttccgat    300840
     aatggggtat tttctctttt ttatttcaac agatccttga gcctgaaagg gcagtccgtc    300900
     tgcatatcct atgcctatga gtgcaacatt ttcctctgac tgtgttctgt atgtgtgaca    300960
     ataacttaca cccgctcctg ccggcagttt cttgcacgtt actacgcagc tttcaagatg    301020
     caaagcagct ttgcactctg tattatcacc caggccgtat atatcgtgtg agaatggctt    301080
     tataggcgca tctgatacat ccactgtgaa cccaatttct tcaagaaaga tcttttcgtg    301140
     ggctttgcgc acgaaacact ttctgacccc tgtgctgtac aaggtgtaag caattttcac    301200
     aagcccgtgc ccaaatgcgt cggcacgcag atcgaccgtt atatcaccat cggcctccag    301260
     gcacagaagg gcattattct ttatactctc caatgtaata gttgctaaac gcgatatcat    301320
     actttgacac aaaacacttg tttgatactg acttttagaa gatttcagga gctatcttgt    301380
     cgagtaatac tgattataac gccgatgaca ttgccctact agagggcttg gctgctgttc    301440
     gtaaacggcc tggaatgtac ataggctcaa ccgacaatca cggcttggcc cattgtctgt    301500
     gggaaataat cgataattct gtggatgagg ttttagctgg atttggcaat gttgtgaaca    301560
     ttaccttgca tggcgataac agtttttctg ttcaggattt tggccgaggg atacctgttg    301620
     atattgaaag caagacgggc ctaacgggtg ttgagttggt ttttacaaag cttcatgcgg    301680
     gcggaaagtt tggcacagga gcgtatttca catcgggtgg attgcatggt gttggtgcga    301740
     gtgttgtaaa tgccctttcc gaaaagctct ctgttgaggt tgacagagat ggaatgacat    301800
     gggtaatgga atttcgtaac caagtgacat ctggccttcg atctaagtgt aaaatcgcta    301860
     gtaatgtaac gggaacacgg gtgcgttttt ggcctgatcc gcttattttt ggtagtgcag    301920
     aaatctgtat tgagtctttg catcagcgcg cgatgcaaac tgccttttta gttccaggcc    301980
     tcagggtgaa tattgaagat agggtgcttg gcaagagctc ttcctatctc tttgagggcg    302040
     gttgcaaaca atttgtagag catctttccg caggagagct gattacagat gtcttgtgta    302100
     ttagaggtaa aggtagtttt tctgaggcgg ttcccgtttt gaaagagacg ggtaaccttg    302160
     ttatcagctc agttgagcgg gtgtgtgatg ttgatattgc tcttgcgtgg cgtaatgatt    302220
     ttgaaactca tatcaatagc tttgtaaatg tgatcgaaac cccgaagggc ggaacccatt    302280
     attctggttt tgagcaggct cttttgaaga ctattcgaaa cgcagtgtca agtcaatcta    302340
     ggtatttgaa gtctggcaat aaccgccccg aacgcgaaga tgttttttcg ggactgaccg    302400
     ctgtggtatc cgtaaaattg cccgaaccgc aatttgaagg ccagaccaag gaagtgctgg    302460
     gaacacccgc ggtgaaaggc atagttgcaa atatcgtggc agataatctt caaaaacttt    302520
     ttgaagatcc aaaatacaaa acccagatcc ggcgtgtctt agaaaaagtt gttgcacaaa    302580
     tgcactttcg gttagccgca cgggctagta gggagactca gagacgtaag aatgcacttg    302640
     aaacttcgag tttacccgca aaacttgtgg attgtcgaag caatgatgtt aacgaaagcg    302700
     aactgtttat tgttgaggga gattctgccc tcggcactgc tcgcagggcc agaaatagcg    302760
     agtaccaggc acttctgcca attcgaggga aaatcctaaa cgtacaaaag gcgagtgtag    302820
     ccgatgcact tgctaatgcc gaatgtgcaa gtattattca agtgattggt gccggatctg    302880
     gaagtaactt tgatatagca caggcacgct atggcaaggt gataataatg tctgatgctg    302940
     atgtggatgg tgctcacatt aggattctgt tgctaacctt atttttcagg tatatgcagc    303000
     cgatgatttc atccggccgt gtcttttcag cccttcctcc gttacatcgg gtggtggtta    303060
     aaaacagcaa tgagaagatc tacaccagat cagatcgtga gctagaaatg gttttgtcaa    303120
     gactgaaaca ggaggggctt gaacataggg agccgattca gagatacaag ggccttggtg    303180
     agatggatgc cgatcaactt gcagagacaa ctatggacag atcaaagcgt acccttctta    303240
     ggattaggat gtctgatgcc caacaggctt cagacatttt tgcgctcctt atggggaatg    303300
     atgtcgcacc acgcagggag ttcatagcaa attccgtggt tagcactgac agaatagaca    303360
     gctaagattg ccttactggc agaccttgtc aaggatccag gcgatttccc aggcttgact    303420
     cttccagatg tcatatctgc cgcttgcgcc aaaatgtcca catgtatctt ctacatggag    303480
     tattgcgttt gcaccttttt cgcgtagttt acatacccac tttgtgggct cgataaagct    303540
     tacccttgga tcctttgttc ctgttattgc cagaattgac ggataccgcg acgcatcatt    303600
     ggcgatattg tgatatggag agtaggactt tatccatttg taagcctctt cactgtcggt    303660
     tggattgccc cattctgtat attcatgaat ggttagcggt aagtttggca ttagcatcgt    303720
     tgtgagcacg tcaacaaacg gaactccagc tatcgctgcg gtaaatagct ctggttctga    303780
     attgataacc gccccgatga gcattccacc tgcactgcga ccttctattg caagcttttc    303840
     tgatgacgtg tagttatttt ctataagcgt ttttgcgcag gcaataaaat ccgaaaacgt    303900
     cagaggcttg ttttcatatt tggcttggcg gtaccaattt tcacccattt caccaccacc    303960
     tcggacatgg gcgactgcat aaataacccc tctgtccaac aggggtaatc ttttagttga    304020
     aaactgcgga tcaatacaca ccccgtaaga accatatccg tacaacaaac atggggctgg    304080
     ataatgcaca agatccctac gaaacaccag tgaaatagga atttcagttc catctttgct    304140
     ctttgcccag agtcgctttt cgacgtattt ctctggcaag tagtcaataa ctatttggga    304200
     atgtattttt gtaaatcgct ttgacttcac ttcatacata taggttgctt tgggtaattt    304260
     gaagctttca aggcttattt gaaggtaagc agatgaccat tcttcattag attccgaaaa    304320
     aactgaataa acttcccctt cacagttatc aaacttgact tcctcccatt tcagagcttg    304380
     cagacttgtt agtacatcgt gacgcgcctc acatgcaccg ttattatcga tgaattgcac    304440
     agtgtttttg tgtcgttctg tatttgaatc aaatacagtt tttgcactat gcatgtcgtg    304500
     tgtcagttgc gcaacggcaa tttttgggag tccgtcctgc ctgtacgaaa cggtcaaata    304560
     atcctcaaaa gcctcaatat cagttatatt gcgctcaagg ttatgtggaa ttattgggac    304620
     gcactgcaat gggtttatga aatttgccgc gaccagttcg aaattgacag cattgcgatt    304680
     gtgaactata aggaggatgt cttttccgtt gattattgca tgttctggcg tgtataagac    304740
     atcattttct cttggccaca cttctctaag tgaccggctg tctgattcaa ggtcaagaat    304800
     ccagtaggcc gaggtttgac tattcccgct tcctataaac agaactttct cgctttttga    304860
     tacttcaaat ccgagccaat actctgagtc atgaaacaca agatgttcta caccggaccc    304920
     aagtgtgtgt tgccagattt tatccggcct ccatgcttca tctgttgtgc agtagaaaaa    304980
     actttttccg tccggatgga aacatgctcc tgccgctgtg ttatagataa catccggtaa    305040
     atcctcaaaa gtttcaatat ttcttactcg aagtgtatat cgctcgctac cgtcgttgtc    305100
     tatcccatac agaagatatt ttccgtcgtt cgatatacaa aaagttccaa tagaaaaaaa    305160
     atcatttgaa cgtgactcgg catttgcatc aaaaataagc tcctcgttgc tggatggggt    305220
     tttatcaagt tttggaggaa aatccccaat tgactggatg cggtagtaat acggatatga    305280
     ttttcctgaa accgttctct gatagaacca ccacttcccc tttcgcaccg ggggagatac    305340
     gtccccgtct cccgtatatg atgttttatc tcgtgaaata ctgtgttttg aaggtccgcg    305400
     aggtgttttg tggcctgagc ggtacgtgtc tgctcttcct ttagatgctt ttctgctgcc    305460
     ttcttatccg atcgaagcca ttcgtaatca tcaattattc gatctccgtg attctcaaaa    305520
     aatgttgggg atttcacata aataaagcta ccatccagag aatttcttga ttttgggacc    305580
     ccttttattt ttctattctt cgagtagggc attgtcactt acgcagagta gggcattgtc    305640
     acttacgcaa ctcgatcgcc taacaaatct agatccgggg tataaaccgt gacatgcgtc    305700
     actcataaac cgtgacatgc gtcacaatgc gaactagacg tgaattagat ccgtgaatag    305760
     atccgtgccg tatctgcgac cgatagattc actccagtat acttgagttt tgaatgtggg    305820
     gctatggcgc aggctggtag cgcgtctcgt tcgcaatgag aaggtcaggg gttcgaatcc    305880
     ccttagctcc actcgcagaa cttcggtaat gttcagattg gagcgctgtg cgggctgata    305940
     tcggtgtata tggtcttgcg gttatgggca gtaatcttgc gagaaatttt gccggcaaag    306000
     gtatccgggt tgctattcat aaccggtcat ccgacagatc taattccctc gcacagcagc    306060
     acagtgagtg taattttatt gttgcgaagg atgataaaga ttttatagat tcactcagtt    306120
     cgcccagaac tgtccttctg atggttaagg ctggatctat tgtggatgaa gttatagctc    306180
     gactctccac ctttatgcaa ccaggagatg tgataatcga cggtggtaat tctctgtaca    306240
     ccgatacaat caggcgtgag gaagaactca aggcaagggg gttgcacttt atagggcttg    306300
     gtgtttcggg cggagaggtg ggcgccctcg aaggccccag tcttatgccc ggaggatctg    306360
     attacgctta ttcgatcgtt ggtcctatgc tcgagaagat agccgctagg gcgaatggtg    306420
     agccctgtgt tgcgcacata ggtcataatg gcgcgggaca ctttgtgaag atggtccaca    306480
     atggcattga atacgctgat atgcaaataa ttgccgagtc ttatgatctt ttaagacggg    306540
     gtttggggct ctctccgacg cgtatatccg atatttttcg tgagtggaac agcggtgagc    306600
     ttgagtcgta tttagttgga gtaacagctg acatactttc tcatagagac aagagaaccg    306660
     gaaagccgtt tgttgatatt gttctcgacc aggctggtgc aaagggaacc ggtgcttgga    306720
     cagcgcagaa cgcacttgac cttggtgttc ccgccggttc cgtgtctgaa gcagtttttg    306780
     cgcgcagtct ttcatcggat gaacagcgtt gccaggtgca acagaaactt tctagatcac    306840
     aagcatcaag tcatgaagca cccttgaagg aggcggagtt tatcgatgct gtacgcaatg    306900
     ccctttactt ggcaaagata cttgcgtact ctcagggttt tagaattatt agtgttgcag    306960
     ccgccaagca tgactggggc atagaccttt ctgcctgtgc acgaatctgg cgtgcgggct    307020
     gtataatccg ggcagttttt ctggataaag ttgcccatga gtacagtaag aatccggacc    307080
     tcacaagtct tatgtgttct ccgggttttt ctgatgaatt ggtaggcagg ttacggtttt    307140
     tgagggaagt tgttgcttct gcagcccgcc tggctattcc agcacctgtt ttttcatctc    307200
     tcttgtcata tatcgacgcg cttgcttcag atcgcttgcc tgcatgtctg attcaggcgc    307260
     agagagatga ttttggtgcc cacacttaca ggcgtgtcga cgttccgggg atttttcata    307320
     ccctttggtc atcagacctg agcgaagtgc ccgcctgaaa tacttctcgt gtttccggat    307380
     cctaaaaact attctccagc aacagcgtgt tgtaatccgc tcggcctttc cgtgccaggt    307440
     acagtcgttg cgtttctttt ttgcgtttct tttgtaaatt atgattctac ataaacagtg    307500
     ttgcataaca cacaccgctg ctctaatatg acatactcgc cctctgtggg ccatattaga    307560
     gctgaatgca atgcggcccc tagtcacgtt gtaaggtccg tcagcggttt gccattaata    307620
     ggtgtcattg ctaataggtg tcattgccgt gcacgaaagg atatccgaga tatctaatta    307680
     gtcggtcttc tcgcttactt tttcccgatt tctcttgtgg caatcgatat tgtttcactc    307740
     ctgcacaact ttttgcagtc acactgcttt tgccaatggc tacgacattg cccaaattgt    307800
     ctattgctgc caaattctct ccaacaattg ctgcgtgtaa ccactcttcg ccttttagaa    307860
     acttgtgaca ttgcacacct cttgttgccc tacctcttgt ttgataagag ctaaggcgtg    307920
     atgtcgtcat tctttttgat acagtcagta catttgccct atctacatct tctgtatagc    307980
     cgaaactgat aaccctgtcg tcatcatcct ttagggttac acctgcaacc cctcttgcgg    308040
     gccgattttg ggggttaaca aggcctgcac tgtagtgcaa gagattgcct tttgcagtta    308100
     tgaaaacaaa gtacccacaa ctggatacac ctctagcggc cccaacaacc ctgtcacccg    308160
     cactgagagt aattacccgc tcagttctat ctggccatat agccggagtt acacgcttca    308220
     caattccact tgatgtggca atggcaagac tttctttctg gtgaagctcg aaaagcaaaa    308280
     cagcttcttc gtcattttca agtccgagga aactctttgc agtgacaaat ccactgtcca    308340
     ataccggaag accgattgga gtgaatggta tgacctttcc cgcactggtc agagcgccaa    308400
     ttcttgatct caccccacaa acaatggaag atttcacaac acgcaaaggt tcgctgtggg    308460
     tattgaatgt catgtcaaac gtctcgggtt ggctcaattc tgatatcaaa tcattgttca    308520
     cctcaattgt gaatataaag ccattggtgg ttaaaacaac ttgacgagga taatccgtct    308580
     tttgtttttt acttttgaca cttgactcta aaatcgttct acggggtgat gggagtcttt    308640
     gtgccacctt ttttagttca tcgataagaa tcgcatcgat tttgttcggg tcagaaagaa    308700
     tttcttcaag gtcttgcgtg gtttttctaa gttcctcctg ctcagactga agttttatag    308760
     tcgagagttt ggttagcata ttcagtctta tatccaagat gtattctgcc tgatcccgtg    308820
     ttacattcag gcacttcata aggtttttcc tagcctcttt tataccttcg ctgtttcgga    308880
     ttatggagat tgttttatct atatcgacta gagccaaaag aagcccatcg atcatatgaa    308940
     gacgcttttt gtgtgttgcc aaatagaact tactgcgcct tgttatcaca catacacggt    309000
     ggtctataaa aaccttcagc atatccagca tgccaagggt tttaggcttt ccgtcgatta    309060
     gggcaacact gttgacactg aacgattctt caagaggggt atgccggtag aggttatcca    309120
     ttacctcatt tggcgaaaag ttcggcttaa ttcctataac aagctttaag ccgttttttc    309180
     tgtcactgag atcagtgaca tcgagaattc cgtcgattct gtgtgcattt acaccctgtt    309240
     ttattttttc aataaccctt tcagagccaa ccatataggg tagttcagtt atgacaagat    309300
     ttgtatgacc gatacctgcg taatcaattg atatctttgc cctgatttta aatgaacctt    309360
     tacccgttgc atatatttcc ttgaatgctt ctttgccaac aattatcgaa cctgtaggaa    309420
     aatcaggtcc tggcaggatt ttcattattt gctctagact tgactgccta ttgcgaacaa    309480
     gatatatagc tgctcgaacg gtttcttgta ggttatgcgg gggtatactg gttgccattc    309540
     cgacggctat tccgctactt ccgtttacaa tcaagttagg taacagagcc ggtaaaactt    309600
     caggttgcgt gaattggtta tcataatttg gcacaaaatc aacaacattg ctctctaagt    309660
     cgttaatcat cgcaactgcc gctctggata gtctggcctc tgtatatctg ctcgctgccg    309720
     gcccatcatt cagagagcca aagttgccgt gtccatcaat cagcggaatt cgcattgtga    309780
     agtcctgtga catcctgaca agcgtgtcgt agattgctgc atctccgtgg gggtgaagtt    309840
     ttcccataac ctcaccggtt acccttgcac acttgacatg ggctttatct ggggatagac    309900
     ccatccgact cattgtgtat aagatgcgcc tctgtacggg ctttaagcca tcccgcgcgt    309960
     ctggcaatgc ccgagagtga ataacagagt aggcgtattc cagaaacgag tcttgcatct    310020
     gatgcaagag gtctacatct gttattttct cgttatcgga aattacatca aatatctcag    310080
     ggatgtcctt atccaagcca ctcaattctt gtttttgtca gaaccgaaaa ggatttcatc    310140
     ccagctcgga acgctagtac gcctcgatgt ctgacgagcc ctttcagggt cagctgcccg    310200
     cgcatcccgc tttctatcta tgtctattag gttcgccact tgattgatat ctgtttttgc    310260
     aaccctttgc tgctcaatac tttctttatg tcgttttctg agtgcatcaa ccagatcccg    310320
     agcagagtca tccagaagag gctctttttc tctggcaacc gccacgtcgt ttactgagaa    310380
     aaatcccggt gtattttctg ccgcgcgtgt tctattttct gaatcaaacg agaggctgcc    310440
     aagagcccca aaattcattt cttttggaaa ggaatcaaaa gtctcgctgc atatttcttc    310500
     cggaactaat tcccttgctg tggcatcaac aggtcttagt gacatatcct tgtgattaaa    310560
     atcccatgtt gcatgatgcg gctctgcgtc tgatacgtac tcaacaccca acacccacgc    310620
     actgaatccc tttttggcag atattttgta ttccgaaaca ccttttttct caagggcact    310680
     gagaagaatt tcaccgaatg acttatcgcc gaaacttact ccgagtgcca tttgcgccat    310740
     atgcgacctt tctgcagcaa caggtggctc aaatcttttt actcgctcaa tgcttgttga    310800
     gagcttttgc gctacctttt ccgcaggcag gccctctcta atgagagcct gaatgtcttt    310860
     tacggatgct gctccacacc cgtctaatac atctcgtacc ggaggttgtg tagcggggtc    310920
     tgcgtagggc aacagttcat tggctgcaat tctgaatttt gtgccatcct cagctgcaag    310980
     aatgagaaag ccatcctcaa gccctatgac tgaaagatcg tacatattcc tatccccttt    311040
     ggtaataaaa cccgccgccc acataatatt ttcacaaatc tcccggataa ttttgtgtca    311100
     agttttgttt ttggaaataa acgtctataa atatagactg agatgttcct tcagaaggag    311160
     gtaatttgca tactgactac gatacccccc ggcagacaga agagcttacg gagtcgattg    311220
     aggtcttaga gaagaccgcc acggatgatc tcaacactga cgttgatgag gacttcgatt    311280
     ctgcttcttt tgagctgcct ggcgcagatc tgtctgatac tgatcttgag gttgttgtta    311340
     ttccacctca ggaaaatgag tttacttgca cttcttgctt tttggtgaag caccgcttgc    311400
     agcttagctc agtagcgaat atgtgtaaag attgtgccgg ctaggcgaag cagtctcgtt    311460
     tgtaacgggc aatattaacg gcagtatttg gaaagcttgc ggaatagtat ttagctgtct    311520
     gatgggcagg cttttatcgc atctaccagt ttttgtggtt ttcgggatga cacaatccaa    311580
     tacggtgttg ggtcttcagg gtcaattata gagatcttaa cgagatcttt gacccacccc    311640
     cgtgtcattt taaaactccg tgggtgcagt cttagtccga gttcgtcgtg cacgtctttt    311700
     ctgtttatta cccgacaagt tccgatgtat ttaattggta tttctacatg tcctgcacga    311760
     aatatcccac ctgatacttc tagtttcggg ctcatgactc ttagccatag acatagaagg    311820
     atatatacac ccgcggcaat tgggatagac cacaataggg taactcctgc cctctgcaac    311880
     accggcatag aaattaaacc cgaaatgggc attgcaagtg ctaccgccaa aaacagccct    311940
     ggacccggcc aaagcctttc tgtataacgc ataatcatac gaggtttatg aacaagaccg    312000
     agaaatattt tatttgatat ttatctgact cttgtgctag gtctattaga gtgactgttg    312060
     aggtgttgtt caagggtggc tacacgccgc agcgcgcttt tgatggtgat gccggttttg    312120
     atcttcagtc aagccacaca gcggttatac aaccgcgctg tcgacaggtt gtaaaaacag    312180
     gtattgcgat cgcgttgccg gatggctatg ccggttttat catgccacgc agcgggttag    312240
     cttctgagaa tggtattaca ctggtcaatt caccgggcgt gattgacgct gggtatcgtg    312300
     gtgaaatatc ggttgtgctg atcaatacgg atttgcacca ggcttttcat atttcacagg    312360
     gtgaccgaat tgctcagttg gttattatgc cggtttgtca tgcaagtttt atagaggtcg    312420
     atactcttcc tgggagtgca aggggcatct ctgcttttgg ttcaagcgga aggcacgata    312480
     cacgtggatg acaggtcaaa aacaggtcct tttgacgaat ccgaggtaga ttccgttaga    312540
     atcttcgttg atctcggcgg aattaaggta cctccgtgcg aacgcttgtc tattcggctt    312600
     gagtttgaca gggttactaa caagcctgtc gcgctcgggc ttgattatgg caaaagcact    312660
     ctgcaggtgc aaccattcgc tgccccgagt aactcaagtt tgtgggagga tgttagaaaa    312720
     caacttcgag atcaattact ctcacgcggt gcgcatttgg tcgagactga tggcgcactt    312780
     ggtaaggagc tgcgcgcgag tattccagtt ctgatggctg gtgagacttt ttcagagacc    312840
     cgttgggcac gtatagttgg tgttgatggt ccccgctggt tactgcgggg tgttattgtc    312900
     ggcgaggcct tgacaaacga ttctgccgca gcagaaatcg agaatctatt ccgtagcctg    312960
     gtcgttgtaa gggggaatct cccgatgcct ccacatgaga tgataccctt gcgtatgccg    313020
     cttgaactaa cttctggtgt aactcaaagt ttggtgtagt gtatgcgttt ttcagatttt    313080
     tctgaattgc ttgcaggtat ttcaggtaag cgctctggcg ggcgtactgg ttttagcaat    313140
     attctctcgg tgctcggtgg cgtacggggt gttgtggagt cgctactccc acctctggtt    313200
     tatattttga ctttttccat tctgaaagat ttgcttcttg cctgcattat ctcggttttg    313260
     ctttcattgt tcattgtttc cctgcgcatt gccaagcggc agtcgcttgt cccggcattt    313320
     tctggttttt ttgggtttgt catttctgtt cttgtttcgt tatatacagg ccgggctatt    313380
     gatgtttttg ttatcggtat tgtctggaat gcggttttag cgctactctt actggtttcc    313440
     gtattgctca ggatgcctgt ttttggtttc cttcttgctg gccttttagg tgacttagga    313500
     tggaggaagg atccgaacag ggtgtgggca tattctgtaa ttacgatagt ttttttcgct    313560
     gcctctctat tgagggctgt aattcagctg cccctgtatc tgtcgggaaa ttttgaatta    313620
     cttgcaacca cgaaaatttt tatgggttac cctcttcttg ggcttaccgt gtttacctca    313680
     tgggttttgt ttagaaaaat taactcgaag agtaagtaga ctggtggtgt ttttcacgga    313740
     ttttttatgt gtacaaaacg gcagtatggt ctacttgaaa gtatacgaag cccaagagac    313800
     cttgactctt ttaccccgca tcagcttgat gagcttgagt gtcaggtgcg cgattttctc    313860
     atccaaagtg tcgcaaaaac cggtgggcat ctggggtcga atcttggcgt tgtcgagctg    313920
     agcatagcgc tacacaggtc atttagatct cccgaagact gcataatctt tgatgtcggt    313980
     catcagtgct atgttcacaa gctaataacc ggcaggcacg atttcaaagc tttacggtgc    314040
     aagaatgggc tatccggtta tccgtcacga catgaatcaa accacgatat tgtcgaaaac    314100
     tctcatgctt ccgctgcact tagctgggcg gatggcgtgt cacgtgctcg gactctgtta    314160
     ggtaatgaca attatgttat tgctgttgtc ggcgatgggt cactgacagg cgggatgtgc    314220
     tgggaggcgc taaataacat cagcgacgac aataaccgcc ggcttgtaat agttgtcaac    314280
     gataatggac ggtcgtatgc tcgtacaatt ggcggtatag cacgattttt gaatgcggtt    314340
     cgtgcaagta agagttattt gtggctcagg gagtcaagcg aagcggtgtt ttcgcatatg    314400
     gggtcacccg ggcggcgcct gtaccagggg attagagggg caatacatgg gttcttgagc    314460
     cgcttttcaa gctcaaataa gcttttctcg aatcttgata tccggtattt aggaccgata    314520
     aatggccata atcgcaaagc tcttgagaag gcattcaaac aggcgaagca atatgcacgc    314580
     ccaattattg ttcacgtgat aacagaaaag ggtcatggat atcccccagc gctcgaggat    314640
     gctctggatt gtcttcacac tgttggtgta atagatccca gcactggtaa atccgcctct    314700
     gtgcagggcc aagtgcgtca agatacatgg actggcgtct ttggggaaga gcttttgcgg    314760
     cttgccgaga gcaatacaaa cattgttgct gtcaccgctg ccatgctaca cccaactggc    314820
     ctttccatgt ttgctgaaaa atttccacac agggttttcg atgttggtat tgcggagcag    314880
     catgccgttg catctgccgc tgggcttgcg tatgaagggc tacatccggt tgttgcgatt    314940
     tattcaacct ttatgaatag ggcctttgat caggttatga tggatgttgc cttacatggc    315000
     gcaccggtaa cgttcgtcct tgatagggca gggataacag gtcctgatgg ggctagccac    315060
     cacggaattt gggacctttc gcttttgcga attgtgccag gtattaaact ttatgctcca    315120
     cgggatgcta gcacattgag aaataccctc gcgcttgtct gctccgaaga ttgtcctact    315180
     gctatacgtt tcccaagagg gagtgtttgc gacgatcttc cggctttacg ttctctggac    315240
     gacggaattg atgtgctcta tggatcttgc gatcgcgaag atatcgttat tgttgccatt    315300
     ggcgttatgg cacatgcatg cgttagagct gcccaattac tggcagagtc tggaatagaa    315360
     tcaactgtta taaatcctgt ttgcttctgg cccctacata ggcaggtcct ggccagggtg    315420
     tcgaaggcaa agctggttgt gcttgctgaa gaaggggcga aatcacccgg tcttggtgac    315480
     tatattgccg gaagacgatt gttagaattt gtgatcccag gggatttcca accccaggga    315540
     tcacgcgatg agttacttga tgcaattggt ttaaatgggg agcatattgc ccgtaagata    315600
     aaggcccggt tcaatcaaat tatcaattgc gtgtaaggca ccacgcttta agacaccatg    315660
     cttgtgttat gcccttttga gccatgaaac atcgttattc accgtctctt tttcactgtc    315720
     tcttttgtag aaaaatatca tgaattcact ggataatttg ctagaacgta tacagtaaat    315780
     caactaaaca aacaagactt acgcagctga gacttacgca gctgtgcagt gttgcattgc    315840
     gctgtgttca gaatattttt gtgaccagaa atttttgtta cacaggggcg ctaattatct    315900
     actgacaacg gccagtaaat ttgacctgaa ataggttgtg tgatccgtga gggggtgacg    315960
     ggaatcgaac ccgcgccacc agtttggaag actggaactc taccactgag ctacaccccc    316020
     agtaaattca atgctactct tttatctctt tgagattaag cggtttacca attccatatg    316080
     atcgcctgag tgtacgagaa ttcagatgtg cgcctgttag gttgcttgag aaggctaagt    316140
     gcaaggaaga atcacgggca tcaatcaaat gattatgtca ggtgatttgt aaactccata    316200
     acccgtgggt atcgtattcc tgtgccctcc ggggtgtagc tcagtttggt agagcgcccg    316260
     ctttgggagc gggaggtcgc aggttcaaat cctgtcgccc cgactttatg ctgaaacatc    316320
     cctcccctgt tctataattt ccggagaagc aaaaatgggc agaactttga agagtatcgt    316380
     acaaagggtc agtgagacag agctgaagct gcaggtaact attccctccg aaagcttaaa    316440
     gccccatgtc gacagggcct atagggaagt tgcaaaaact gtcagtgttc cgggtttccg    316500
     tcgtggaaaa gttccagtca ggattattga ccaaaggatt ggaaagcatg tagtgctcga    316560
     tagggctatc aatgactgca taggcgattt tttccaatcc gcagttgatg agcagggcct    316620
     aacccccgtt gcagcaccaa aagcgcatat cgcttctctt ccgacagagc ccgacgcttc    316680
     gcttgaagtt gtgtttgatg tgcatgttta tccggatgta gatttcccgg cttttgagaa    316740
     taagcagata gaagttgatg caatagatgt cacagatagt atggttgatt ctgaaatagt    316800
     tggtattcgg gaaaagctgg caacttttac tgctttagat aggccagcta ttgatggcga    316860
     ttttctgatt cttgacttac agattcttga tggcgataaa gtcttaagcg aatcgaatgc    316920
     cgtgccgtac gagcttggtt ccaatactct gtttgacggc cttgattctg ccttgacctc    316980
     tgcccgtgcg ggttacacca caacaatcga tctaacccct cccgtagaag atccggcagg    317040
     cgaaaaccct cagcaagatc agtttgctaa aagcggggat acaagacgtg taaaactgaa    317100
     agtttcctct gtcaataaac gggacttgcc tgaggaaaat gatgaacttg cacgtcttgt    317160
     cggtgggttt gcaaacctcg aggagttaag gaaggattct gcaaagaata ttgagaggtc    317220
     aatgcttttt caaagaagtc ttcaggccag ggatttactg ctcgagcaat tgctgtcgga    317280
     aattaccttt cctcttccag gaccaatagc tgatgtatta gacgagatta aggatgaaga    317340
     ggaaaagcaa aacagaacaa agcaagctcg cagggatata ttgcttgatt tacttgcaaa    317400
     gactttttct gtaaccctca aagaggatga attggagcga tatttgtcaa gtgccgcagc    317460
     gcagagaaag atgagtgttg ccacacttgt ctctgtgata aaaagcgcgg ggcaggataa    317520
     gtatgttatt tctgatattg tccgaaacaa ggcactttca attgcattga gcagagttaa    317580
     agtgattgac tcggcaggaa atccgttgga tatttctgag tttacgatta agactgatgg    317640
     ggatccgaag gtcaggaggt ccgaatgaac agaaggcaag gattgcgctt tgtgaggtct    317700
     gcctgtttcc gtctgttgtg cgcattatcc ctcggtattg tcatgtatgg agcgtttgct    317760
     gttctatcat ttttgacttc gattgcgata ggtagtttta ctttcccttc attcgactcg    317820
     tcatcccccc cgggatccca gtttttttca tccggtccac agtcgctttt tgcagtgccc    317880
     atggtcggct ttttgcaggg tgcttctttg cttgcgacgg gtttttcaag atttgccttt    317940
     gacaccgcct ttggaagtat gcgctttacg gtctcttctc ttcctgtctc cacggttgtg    318000
     ttgcttgtga tcttgtttat ttcctccaga cttcttgagc gttttttacc gagtaagtct    318060
     ttgaaagaga agattctgct gtctctgtct tcgtctgttg ttgtcacact tctggcactt    318120
     ttttcactct ttgtttctga cccgacaata atttacggtt tattttttct aatttttgat    318180
     tttcttgctt tgtttctgac cgatctcctc ggcaggttac gtctgcgcct taccggattt    318240
     attcgcgaat cattattttt tgttaccctg tttgttgtac ttggatttgt tgttctggtc    318300
     gtgctgattg tgccaagtta caccgaattt ccttttcttc tttccgccct ggttatctac    318360
     agcgtccctt tgtctgtcgt gtttgctgcg tatgcgggtg gcgcggggtt ctttttgagg    318420
     gtcgatagcg tgtatgaaaa ggtatcgtac tttcatacgc atatgttatt cgtactggtt    318480
     ctcttgattc ttctgttttt tgtcgccctg cgtcttgctg ccatgagaaa gccatgcaca    318540
     aaaaaacagg ccctttcttc gatatggcat atgccgacag cggtgttttt attggccatt    318600
     gtgctgtctt gttttacggc cgggttttcc atttctcctg ttgttccttc gggtagtttt    318660
     gttacagttg aagttggtat gaacggcgtc atttttgctg tgttgttaat ggcctgggcg    318720
     taccttgtac aggtttttgc aatctatgcc gctccatttg ttgccaggag aatcccattt    318780
     ttgtacagga taataagact tggtgttcgg aagcgtggta ccgtgtcaag aaaacagata    318840
     aagcgagttc ttaaggggtt gccgtgagcg agacaaagca aacagttttt gatcgccttc    318900
     ttcaagagag gattgtttgg cttggtgagg ctatagatga caagcttgcg aatgagatat    318960
     gcgcaaaaat attgcttctg aatgctgatg acccgaagga agacattttt ctgtatatca    319020
     attcaccggg cgggtccata actgcaggga tggcgattta tgacaccatg cagtttgtta    319080
     gcaatgatat tgtcaccgtt ggtattggga tggccgcctc gatgggtcag gtgttgctta    319140
     cttcgggcac ccaaaacaag cgctacatta tgccgaatgc tcgtgttttg cttcatcagc    319200
     cattggccgg ttttgggggg acagcgagtg atatacagac acaggcgaag ttgattctag    319260
     acatgaagta taggctcagt cagataaccg cctctagaac gggtaaaact gttgagcaga    319320
     ttatggagga cggcgacagg gatcactggt tcactgccga agaggcattg gaatacggtt    319380
     ttgttgatca tatacgtacc gagtaggaaa gggctttatg tacccaaatt caagatatat    319440
     tttgccgagt ctcgacgagc gtactgccta tgggtataaa caggttgatc cgtacacaaa    319500
     gctgtttgaa gatcgcatag tttttcttgg agttcagatt gatgatgcat ctgctgatga    319560
     tgttatggca cagctcttgg ttcttgaagg tcaagatgct gaacgcgaca taattatgta    319620
     tatcaattca cctggcgggt cttttacagc catgacagcc atatacgaca cgatgcagta    319680
     tatacgtccg cagatacaga cagtgtgtct tgggcaggcc gcctcggctg ctgccgtgat    319740
     cctgtcggcc ggaactccag gaaagagact tgccttgcca aacgcaagaa tactaattca    319800
     ccagcccgtt gtcgcctctt ccggttacgg tcaggcaagt gatatagaga tacaggctcg    319860
     tgaaataatg cgcatgcgcg aatggctaga aaaaacactt gcccaacatt ccaataagtc    319920
     tgtaaaacaa gtcagtaagg atattgatcg tgataagatc ctttcttccg agcaggcttt    319980
     ggaatatggc ttgattgatc agatattggt tagtcgtaaa gctggcctgg gtaagaaata    320040
     ggggttatgc ttgacggatg ataccgaata tcggtgttct ttttgcggaa aggaacacca    320100
     tcaggttgat gatctgatag ccggtccgga tgtgcgtata tgcagcgagt gtgttgttct    320160
     gagctgcgag attgttgagg atagaagaaa tgaggctctt gcgaagcaag atgcttttat    320220
     caagagaaaa cagcggtcag ttcttgaggg cttaccgaaa cccgctgaga tatatgcctt    320280
     tcttgatgag tatgtaattg gtcagcagaa ggcaaagcgt gatttgtcgg ttgcggttta    320340
     taaccattac aagaggcttg tctcgacaaa aagtgagagc gaaaatgaag ttgagctctc    320400
     caagtcaaat attctactga ttggccctac aggttgtggc aaaacttacc tcgcacaaac    320460
     cctcgctcgg atgcttcgtg ttccctttgc tgtcgccgat gcaacagctt tgacagaggc    320520
     gggatatgtc ggggatgatg ttgaaaatgt cctcttaaaa cttttacagg acgctgattt    320580
     tgatattact cgcgccgagg cgggtatcgt atgcatagat gagattgaca aaatatctcg    320640
     caaggccgac agtccctcaa ttacgcggga tgtttcagga gagggtgttc aacaggctct    320700
     cctgaaaatt ctagagggta cggcagcgtc tgttcctttg caaggtggta aaaagcatac    320760
     ccaatacgaa caggccagca taaacacgag gaatattctt tttattgttg caggcgcttt    320820
     ttccgggata gaggaaatta tttcatctcg tatcggcaga tctaacatgg gcttcgggtc    320880
     ggatttgctt aggaaagata cggatgtatt tgaccagatt ttacccgagg acttgagaaa    320940
     atttgggctt attccggagt ttattggccg ccttccgatt gttacagcaa tttctcatct    321000
     tgacggagag gatatgattc gggttttgac cgagcctaag aatgcacttg taaagcagta    321060
     caaaaggctt ttttcgctcg atggggtttc tcttgggttt gaccacgaag cgcttgaggc    321120
     aatagtagaa ttggcactca aaagaaaaac tggcgcacga gcattgcgct ctgtcatgga    321180
     atcgattttg agccccataa tgtttgatgt tccatcaaga ggtgatatcg aaagtgtccg    321240
     aataactgcc gaaacagttg caggtggtgg cccgcatctt acgatgcgat gtgctaggtc    321300
     taattacatc agatcagcgt gatatctctc cgtactctat cgcgagaatc tgagcgtccc    321360
     cgtcgataag ctcacatttg tcgatttttc ccgctctccg caagtcatcc attattggca    321420
     taattatttc cggattgggt aatgcgattt tcaggtaagc aatttctgtt ttttgcgaca    321480
     gttttgcttc cgttttgccg cctctcacaa gagacataaa agagcatgca atttttaaca    321540
     gctcaatatc ccctgaatgg agtttcagtg tttctggcca gctctgcgta tgcacagagg    321600
     tttcgttaaa ccacgaccat gcttcttccg ttgcgtatgg tatgaacggc gcgagaagtt    321660
     ttatcacaat attcgtcact accagaagtg ttgtaagggc actttcatca ccggcgtatg    321720
     cccggtcttt tacaatttcc acgtaattat cacagaagtt ccaaaagaag gtttctgtag    321780
     tgtcaagcgc ttttgagtga tcaaaatttt tgagggcgtt tgtagattgc tcaatagtct    321840
     gatctaattg cttcaaaaga ctgagatcca aggggttcga aattgctgca aaatcaattg    321900
     ggtaacatcg cttcatatcg ggttgtcctg aataggtttc tttattttta tgcagatgca    321960
     caacaaatcg cgcagcgttt agcaccttga gggcgagtcg acgacctatt tttatctgtg    322020
     ttgggttttc aacatcaaga gccgtatcaa ccccgagtct agcgcaggct gcccaatacc    322080
     tgaccgcatc cgcaccataa cggtcgagta tatccttcgg agtctttgca ttaccttttg    322140
     actttgacat tttctttctg tctgggtcaa gaataaatcc ggaaatagcg gtactcttcc    322200
     agggcgcagt agcatgggca tactcacttc taataatgct tgagaagagc caagtcctga    322260
     ttatatcttg cccctgtggc ctgagtgaat acgggaaaat tgcctcaaat agcttcggat    322320
     tttttaggta ctttccggca agctgcggtg taagggaaga tgttgcccac gtatccataa    322380
     catcggtttc ggcaacaaaa ccattgggtg cccctcgttg attttcagag tatcctcttg    322440
     gtaccgcaat tgtcggatcg agtggaaggt cttttctatc cggaaagata ggatcatcaa    322500
     atttggcatt cccacggtca tctgtttgat accagatcgg aaatggcacc cctagaaacc    322560
     tttgtctcga gattagccag tcactgttca atccggttag ccagtcttca tagcgtctaa    322620
     gcattgtttt tggataccac tgaagttgtt tgccaagctc aattaatctt tcagtcaagg    322680
     cattatcgct gtagccattc cggatgtacc attgtcttgt tagcagtatc tcgagcggtt    322740
     tgtcaccttt ctcgaagaac tttacagggt gggttatttt tctcggctca ccgataattg    322800
     acttttcaga aataagcatt tcaagggtat gtttctttgc ggcacttagc gtttttccac    322860
     tgagggtagc aaaagctcgc cttcctcttt cagacactat tgggtctggg gcatcaggca    322920
     ccaccctgcc ggatgcgtcg ataatcgggc agctctgtag gttaaggtct ctccaccact    322980
     ggacatcagt tatatcgcca aatgtacata ccattgcaat tccacttccc ttgtccggct    323040
     gtgcggctct gtgtggtagg acgggtacct ttacgtcaaa taccggtgta atgacatgtg    323100
     atccaaaaag atgtttgtac ctgttgtcat cgggatgcgc aaccagcgcg acgcatccag    323160
     caagtaattc gggccttgtt gtttcgattt ctacggtagc gttttcattc tcgaaagcga    323220
     gtcggtagta aaatccggtt atttgccttt cttcaatttc cgcctgcgcc acagcggtgc    323280
     gatatgtcac gtcccacaat gttggtgccc aatcctggta cgcagcgcct gagttaacgt    323340
     tttctagaaa gaaatgctga gatagatgga ttgcatcatc atctatggtc ctgtaggttt    323400
     gtgaccagtc aaccgagagc ccgaggtaat tccaaagctc ctcaaacttt ctctcatctt    323460
     cttcggagag ctgttggcat agttcaatga agttccttct tgatatagat cgcgccatcg    323520
     aatcgttatt gatttgagca agtttcagat tctggcaata tggcaaagat ggatcacatc    323580
     gtaccgagaa gtagttttgt acacgtcttt ctgtcggcaa cccgttatca tcccacccca    323640
     ttgggtaaaa cacaattttg ccctgcatcc gctgaaatcg ggcaattatg tctgtgtgag    323700
     tgtaactaaa tacatgtcca atgtgcaaca ccccagatgc cgttgggggt ggtgtatcaa    323760
     tcgaatatac gtcttgtttt gcactaacct gctctaactc aaagttataa atctttgagc    323820
     ttttccaaag ctttgaccat ttttcctcaa ggccctctaa actcggttta tctggaatat    323880
     tcatttgtta tttctacaat ctccaaaaag ctgcatctct tgccgcttct tagcaagttt    323940
     atgttagcaa tttcactgtt agcaatttca aaagggattc tagctctgtt ggtgctttgc    324000
     tgaacatgtc attgtcataa taatgacatt gctatgggga tctcatagta               324050

If you have problems or comments...

PBIL Back to PBIL home page