(data stored in ACNUC16935 zone)

EMBL: CP002688

ID   CP002688; SV 1; linear; genomic DNA; STD; PLN; 26975502 BP.
AC   CP002688;
PR   Project:PRJNA116;
DT   04-MAY-2011 (Rel. 108, Created)
DT   29-JUN-2017 (Rel. 133, Last updated, Version 8)
DE   Arabidopsis thaliana chromosome 5 sequence.
KW   .
OS   Arabidopsis thaliana (thale cress)
OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
OC   Spermatophyta; Magnoliophyta; eudicotyledons; Gunneridae; Pentapetalae;
OC   rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis.
RN   [1]
RP   1-26975502
RX   DOI; 10.1038/35048507.
RX   PUBMED; 11130714.
RG   Kazusa DNA Research Institute; Cold Spring Harbor and Washington University
RG   in St Louis Sequencing Consortium; European Union Arabidopsis Genome
RG   Sequencing Consortium
RA   Tabata S., Kaneko T., Nakamura Y., Kotani H., Kato T., Asamizu E.,
RA   Miyajima N., Sasamoto S., Kimura T., Hosouchi T., Kawashima K., Kohara M.,
RA   Matsumoto M., Matsuno A., Muraki A., Nakayama S., Nakazaki N., Naruo K.,
RA   Okumura S., Shinpo S., Takeuchi C., Wada T., Watanabe A., Yamada M.,
RA   Yasuda M., Sato S., de la Bastide M., Huang E., Spiegel L., Gnoj L.,
RA   O'Shaughnessy A., Preston R., Habermann K., Murray J., Johnson D.,
RA   Rohlfing T., Nelson J., Stoneking T., Pepin K., Spieth J., Sekhon M.,
RA   Armstrong J., Becker M., Belter E., Cordum H., Cordes M., Courtney L.,
RA   Courtney W., Dante M., Du H., Edwards J., Fryman J., Haakensen B.,
RA   Lamar E., Latreille P., Leonard S., Meyer R., Mulvaney E., Ozersky P.,
RA   Riley A., Strowmatt C., Wagner-McPherson C., Wollam A., Yoakum M., Bell M.,
RA   Dedhia N., Parnell L., Shah R., Rodriguez M., See L.H., Vil D., Baker J.,
RA   Kirchoff K., Toth K., King L., Bahret A., Miller B., Marra M.,
RA   Martienssen R., McCombie W.R., Wilson R.K., Murphy G., Bancroft I.,
RA   Volckaert G., Wambutt R., Dusterhoft A., Stiekema W., Pohl T., Entian K.D.,
RA   Terryn N., Hartley N., Bent E., Johnson S., Langham S.A., McCullagh B.,
RA   Robben J., Grymonprez B., Zimmermann W., Ramsperger U., Wedler H.,
RA   Balke K., Wedler E., Peters S., van Staveren M., Dirkse W., Mooijman P.,
RA   Lankhorst R.K., Weitzenegger T., Bothe G., Rose M., Hauf J., Berneiser S.,
RA   Hempel S., Feldpausch M., Lamberth S., Villarroel R., Gielen J.,
RA   Ardiles W., Bents O., Lemcke K., Kolesov G., Mayer K., Rudd S., Schoof H.,
RA   Schueller C., Zaccaria P., Mewes H.W., Bevan M., Fransz P.;
RT   "Sequence and analysis of chromosome 5 of the plant Arabidopsis thaliana";
RL   Nature 408(6814):823-826(2000).
RN   [2]
RP   1-26975502
RA   Swarbreck D., Lamesch P., Wilks C., Huala E.;
RT   ;
RL   Submitted (18-FEB-2011) to the INSDC.
RL   Department of Plant Biology, Carnegie Institution, 260 Panama Street,
RL   Stanford, CA, USA
RN   [3]
RC   Protein update by submitter
RP   1-26975502
RA   Krishnakumar V., Cheng C.-Y., Chan A.P., Schobel S., Kim M., Ferlanti E.S.,
RA   Belyaeva I., Rosen B.D., Micklem G., Miller J.R., Vaughn M., Town C.D.;
RT   ;
RL   Submitted (17-MAY-2016) to the INSDC.
RL   Plant Genomics, J. Craig Venter Institute, 9704 Medical Center Dr,
RL   Rockville, MD 20850, USA
DR   MD5; d6cb9d0b2cf3f54e5308adaa2af79e08.
DR   BioSample; SAMN03081427.
DR   EnsemblGenomes-Gn; AT5G00730.
DR   EnsemblGenomes-Gn; AT5G00735.
DR   EnsemblGenomes-Gn; AT5G00740.
DR   EnsemblGenomes-Gn; AT5G00745.
DR   EnsemblGenomes-Gn; AT5G00750.
DR   EnsemblGenomes-Gn; AT5G00755.
DR   EnsemblGenomes-Gn; AT5G00760.
DR   EnsemblGenomes-Gn; AT5G00765.
DR   EnsemblGenomes-Gn; AT5G00770.
DR   EnsemblGenomes-Gn; AT5G00775.
DR   EnsemblGenomes-Gn; AT5G00780.
DR   EnsemblGenomes-Gn; AT5G00785.
DR   EnsemblGenomes-Gn; AT5G00790.
DR   EnsemblGenomes-Gn; AT5G00795.
DR   EnsemblGenomes-Gn; AT5G00800.
DR   EnsemblGenomes-Gn; AT5G00805.
DR   EnsemblGenomes-Gn; AT5G00810.
DR   EnsemblGenomes-Gn; AT5G00815.
DR   EnsemblGenomes-Gn; AT5G00820.
DR   EnsemblGenomes-Gn; AT5G00825.
DR   EnsemblGenomes-Gn; AT5G00835.
DR   EnsemblGenomes-Gn; AT5G00840.
DR   EnsemblGenomes-Gn; AT5G00845.
DR   EnsemblGenomes-Gn; AT5G00850.
DR   EnsemblGenomes-Gn; AT5G00855.
DR   EnsemblGenomes-Gn; AT5G00860.
DR   EnsemblGenomes-Gn; AT5G00865.
DR   EnsemblGenomes-Gn; AT5G00870.
DR   EnsemblGenomes-Gn; AT5G00875.
DR   EnsemblGenomes-Gn; AT5G00880.
DR   EnsemblGenomes-Gn; AT5G00885.
DR   EnsemblGenomes-Gn; AT5G00895.
DR   EnsemblGenomes-Gn; AT5G00900.
DR   EnsemblGenomes-Gn; AT5G00905.
DR   EnsemblGenomes-Gn; AT5G00910.
DR   EnsemblGenomes-Gn; AT5G00920.
DR   EnsemblGenomes-Gn; AT5G00925.
DR   EnsemblGenomes-Gn; AT5G00930.
DR   EnsemblGenomes-Gn; AT5G00935.
DR   EnsemblGenomes-Gn; AT5G00940.
DR   EnsemblGenomes-Gn; AT5G00950.
DR   EnsemblGenomes-Gn; AT5G00955.
DR   EnsemblGenomes-Gn; AT5G00960.
DR   EnsemblGenomes-Gn; AT5G00965.
DR   EnsemblGenomes-Gn; AT5G00970.
DR   EnsemblGenomes-Gn; AT5G00975.
DR   EnsemblGenomes-Gn; AT5G00980.
DR   EnsemblGenomes-Gn; AT5G00985.
DR   EnsemblGenomes-Gn; AT5G00990.
DR   EnsemblGenomes-Gn; AT5G00995.
DR   EnsemblGenomes-Gn; AT5G01005.
DR   EnsemblGenomes-Gn; AT5G01045.
DR   EnsemblGenomes-Gn; AT5G01055.
DR   EnsemblGenomes-Gn; AT5G01065.
DR   EnsemblGenomes-Gn; AT5G01095.
DR   EnsemblGenomes-Gn; AT5G01105.
DR   EnsemblGenomes-Gn; AT5G01115.
DR   EnsemblGenomes-Gn; AT5G01125.
DR   EnsemblGenomes-Gn; AT5G01135.
DR   EnsemblGenomes-Gn; AT5G01145.
DR   EnsemblGenomes-Gn; AT5G01155.
DR   EnsemblGenomes-Gn; AT5G01165.
DR   EnsemblGenomes-Gn; AT5G01175.
DR   EnsemblGenomes-Gn; AT5G01195.
DR   EnsemblGenomes-Gn; AT5G01205.
DR   EnsemblGenomes-Gn; AT5G01215.
DR   EnsemblGenomes-Gn; AT5G01235.
DR   EnsemblGenomes-Gn; AT5G01245.
DR   EnsemblGenomes-Gn; AT5G01255.
DR   EnsemblGenomes-Gn; AT5G01265.
DR   EnsemblGenomes-Gn; AT5G01275.
DR   EnsemblGenomes-Gn; AT5G01285.
DR   EnsemblGenomes-Gn; AT5G01295.
DR   EnsemblGenomes-Gn; AT5G01310.
DR   EnsemblGenomes-Gn; AT5G01315.
DR   EnsemblGenomes-Gn; AT5G01325.
DR   EnsemblGenomes-Gn; AT5G01345.
DR   EnsemblGenomes-Gn; AT5G01360.
DR   EnsemblGenomes-Gn; AT5G01365.
DR   EnsemblGenomes-Gn; AT5G01375.
DR   EnsemblGenomes-Gn; AT5G01385.
DR   EnsemblGenomes-Gn; AT5G01395.
DR   EnsemblGenomes-Gn; AT5G01405.
DR   EnsemblGenomes-Gn; AT5G01415.
DR   EnsemblGenomes-Gn; AT5G01425.
DR   EnsemblGenomes-Gn; AT5G01435.
DR   EnsemblGenomes-Gn; AT5G01455.
DR   EnsemblGenomes-Gn; AT5G01465.
DR   EnsemblGenomes-Gn; AT5G01475.
DR   EnsemblGenomes-Gn; AT5G01485.
DR   EnsemblGenomes-Gn; AT5G01495.
DR   EnsemblGenomes-Gn; AT5G01505.
DR   EnsemblGenomes-Gn; AT5G01515.
DR   EnsemblGenomes-Gn; AT5G01535.
DR   EnsemblGenomes-Gn; AT5G01542.
DR   EnsemblGenomes-Gn; AT5G01545.
DR   EnsemblGenomes-Gn; AT5G01550.
DR   EnsemblGenomes-Gn; AT5G01555.
DR   EnsemblGenomes-Gn; AT5G01565.
DR   EnsemblGenomes-Gn; AT5G01575.
DR   EnsemblGenomes-Gn; AT5G01585.
DR   EnsemblGenomes-Gn; AT5G01595.
DR   EnsemblGenomes-Gn; AT5G01605.
DR   EnsemblGenomes-Gn; AT5G01615.
DR   EnsemblGenomes-Gn; AT5G01635.
DR   EnsemblGenomes-Gn; AT5G01645.
DR   EnsemblGenomes-Gn; AT5G01655.
DR   EnsemblGenomes-Gn; AT5G01665.
DR   EnsemblGenomes-Gn; AT5G01675.
DR   EnsemblGenomes-Gn; AT5G01685.
DR   EnsemblGenomes-Gn; AT5G01695.
DR   EnsemblGenomes-Gn; AT5G01705.
DR   EnsemblGenomes-Gn; AT5G01725.
DR   EnsemblGenomes-Gn; AT5G01732.
DR   EnsemblGenomes-Gn; AT5G01735.
DR   EnsemblGenomes-Gn; AT5G01745.
DR   EnsemblGenomes-Gn; AT5G01747.
DR   EnsemblGenomes-Gn; AT5G01755.
DR   EnsemblGenomes-Gn; AT5G01765.
DR   EnsemblGenomes-Gn; AT5G01775.
DR   EnsemblGenomes-Gn; AT5G01785.
DR   EnsemblGenomes-Gn; AT5G01795.
DR   EnsemblGenomes-Gn; AT5G01805.
DR   EnsemblGenomes-Gn; AT5G01815.
DR   EnsemblGenomes-Gn; AT5G01825.
DR   EnsemblGenomes-Gn; AT5G01835.
DR   EnsemblGenomes-Gn; AT5G01845.
DR   EnsemblGenomes-Gn; AT5G01855.
DR   EnsemblGenomes-Gn; AT5G01865.
DR   EnsemblGenomes-Gn; AT5G01875.
DR   EnsemblGenomes-Gn; AT5G01885.
DR   EnsemblGenomes-Gn; AT5G01915.
DR   EnsemblGenomes-Gn; AT5G01925.
DR   EnsemblGenomes-Gn; AT5G01935.
DR   EnsemblGenomes-Gn; AT5G01945.
DR   EnsemblGenomes-Gn; AT5G01955.
DR   EnsemblGenomes-Gn; AT5G01965.
DR   EnsemblGenomes-Gn; AT5G01975.
DR   EnsemblGenomes-Gn; AT5G01985.
DR   EnsemblGenomes-Gn; AT5G01995.
DR   EnsemblGenomes-Gn; AT5G02015.
DR   EnsemblGenomes-Gn; AT5G02025.
DR   EnsemblGenomes-Gn; AT5G02035.
DR   EnsemblGenomes-Gn; AT5G02045.
DR   EnsemblGenomes-Gn; AT5G02055.
DR   EnsemblGenomes-Gn; AT5G02075.
DR   EnsemblGenomes-Gn; AT5G02080.
DR   EnsemblGenomes-Gn; AT5G02085.
DR   EnsemblGenomes-Gn; AT5G02095.
DR   EnsemblGenomes-Gn; AT5G02105.
DR   EnsemblGenomes-Gn; AT5G02115.
DR   EnsemblGenomes-Gn; AT5G02125.
DR   EnsemblGenomes-Gn; AT5G02135.
DR   EnsemblGenomes-Gn; AT5G02145.
DR   EnsemblGenomes-Gn; AT5G02155.
DR   EnsemblGenomes-Gn; AT5G02175.
DR   EnsemblGenomes-Gn; AT5G02185.
DR   EnsemblGenomes-Gn; AT5G02195.
DR   EnsemblGenomes-Gn; AT5G02205.
DR   EnsemblGenomes-Gn; AT5G02215.
DR   EnsemblGenomes-Gn; AT5G02225.
DR   EnsemblGenomes-Gn; AT5G02245.
DR   EnsemblGenomes-Gn; AT5G02255.
DR   EnsemblGenomes-Gn; AT5G02265.
DR   EnsemblGenomes-Gn; AT5G02275.
DR   EnsemblGenomes-Gn; AT5G02295.
DR   EnsemblGenomes-Gn; AT5G02305.
DR   EnsemblGenomes-Gn; AT5G02315.
DR   EnsemblGenomes-Gn; AT5G02325.
DR   EnsemblGenomes-Gn; AT5G02335.
DR   EnsemblGenomes-Gn; AT5G02345.
DR   EnsemblGenomes-Gn; AT5G02355.
DR   EnsemblGenomes-Gn; AT5G02365.
DR   EnsemblGenomes-Gn; AT5G02370.
DR   EnsemblGenomes-Gn; AT5G02375.
DR   EnsemblGenomes-Gn; AT5G02385.
DR   EnsemblGenomes-Gn; AT5G02395.
DR   EnsemblGenomes-Gn; AT5G02405.
DR   EnsemblGenomes-Gn; AT5G02415.
DR   EnsemblGenomes-Gn; AT5G02425.
DR   EnsemblGenomes-Gn; AT5G02435.
DR   EnsemblGenomes-Gn; AT5G02445.
DR   EnsemblGenomes-Gn; AT5G02455.
DR   EnsemblGenomes-Gn; AT5G02465.
DR   EnsemblGenomes-Gn; AT5G02485.
DR   EnsemblGenomes-Gn; AT5G02495.
DR   EnsemblGenomes-Gn; AT5G02505.
DR   EnsemblGenomes-Gn; AT5G02515.
DR   EnsemblGenomes-Gn; AT5G02525.
DR   EnsemblGenomes-Gn; AT5G02535.
DR   EnsemblGenomes-Gn; AT5G02555.
DR   EnsemblGenomes-Gn; AT5G02565.
DR   EnsemblGenomes-Gn; AT5G02575.
DR   EnsemblGenomes-Gn; AT5G02595.
DR   EnsemblGenomes-Gn; AT5G02605.
DR   EnsemblGenomes-Gn; AT5G02615.
DR   EnsemblGenomes-Gn; AT5G02635.
DR   EnsemblGenomes-Gn; AT5G02645.
DR   EnsemblGenomes-Gn; AT5G02655.
DR   EnsemblGenomes-Gn; AT5G02665.
DR   EnsemblGenomes-Gn; AT5G02675.
DR   EnsemblGenomes-Gn; AT5G02685.
DR   EnsemblGenomes-Gn; AT5G02695.
DR   EnsemblGenomes-Gn; AT5G02705.
DR   EnsemblGenomes-Gn; AT5G02715.
DR   EnsemblGenomes-Gn; AT5G02725.
DR   EnsemblGenomes-Gn; AT5G02735.
DR   EnsemblGenomes-Gn; AT5G02745.
DR   EnsemblGenomes-Gn; AT5G02755.
DR   EnsemblGenomes-Gn; AT5G02765.
DR   EnsemblGenomes-Gn; AT5G02775.
DR   EnsemblGenomes-Gn; AT5G02785.
DR   EnsemblGenomes-Gn; AT5G02795.
DR   EnsemblGenomes-Gn; AT5G02805.
DR   EnsemblGenomes-Gn; AT5G02815.
DR   EnsemblGenomes-Gn; AT5G02825.
DR   EnsemblGenomes-Gn; AT5G02835.
DR   EnsemblGenomes-Gn; AT5G02855.
DR   EnsemblGenomes-Gn; AT5G02865.
DR   EnsemblGenomes-Gn; AT5G02875.
DR   EnsemblGenomes-Gn; AT5G02885.
DR   EnsemblGenomes-Gn; AT5G02895.
DR   EnsemblGenomes-Gn; AT5G02905.
DR   EnsemblGenomes-Gn; AT5G02915.
DR   EnsemblGenomes-Gn; AT5G02925.
DR   EnsemblGenomes-Gn; AT5G02935.
DR   EnsemblGenomes-Gn; AT5G02945.
DR   EnsemblGenomes-Gn; AT5G02955.
DR   EnsemblGenomes-Gn; AT5G02965.
DR   EnsemblGenomes-Gn; AT5G02975.
DR   EnsemblGenomes-Gn; AT5G02985.
DR   EnsemblGenomes-Gn; AT5G02990.
DR   EnsemblGenomes-Gn; AT5G03005.
DR   EnsemblGenomes-Gn; AT5G03015.
DR   EnsemblGenomes-Gn; AT5G03025.
DR   EnsemblGenomes-Gn; AT5G03035.
DR   EnsemblGenomes-Gn; AT5G03045.
DR   EnsemblGenomes-Gn; AT5G03055.
DR   EnsemblGenomes-Gn; AT5G03065.
DR   EnsemblGenomes-Gn; AT5G03075.
DR   EnsemblGenomes-Gn; AT5G03085.
DR   EnsemblGenomes-Gn; AT5G03095.
DR   EnsemblGenomes-Gn; AT5G03105.
DR   EnsemblGenomes-Gn; AT5G03115.
DR   EnsemblGenomes-Gn; AT5G03125.
DR   EnsemblGenomes-Gn; AT5G03135.
DR   EnsemblGenomes-Gn; AT5G03145.
DR   EnsemblGenomes-Gn; AT5G03155.
DR   EnsemblGenomes-Gn; AT5G03165.
DR   EnsemblGenomes-Gn; AT5G03175.
DR   EnsemblGenomes-Gn; AT5G03185.
DR   EnsemblGenomes-Gn; AT5G03195.
DR   EnsemblGenomes-Gn; AT5G03205.
DR   EnsemblGenomes-Gn; AT5G03215.
DR   EnsemblGenomes-Gn; AT5G03225.
DR   EnsemblGenomes-Gn; AT5G03235.
DR   EnsemblGenomes-Gn; AT5G03245.
DR   EnsemblGenomes-Gn; AT5G03255.
DR   EnsemblGenomes-Gn; AT5G03265.
DR   EnsemblGenomes-Gn; AT5G03275.
DR   EnsemblGenomes-Gn; AT5G03285.
DR   EnsemblGenomes-Gn; AT5G03295.
DR   EnsemblGenomes-Gn; AT5G03305.
DR   EnsemblGenomes-Gn; AT5G03315.
DR   EnsemblGenomes-Gn; AT5G03325.
DR   EnsemblGenomes-Gn; AT5G03335.
DR   EnsemblGenomes-Gn; AT5G03375.
DR   EnsemblGenomes-Gn; AT5G03385.
DR   EnsemblGenomes-Gn; AT5G03395.
DR   EnsemblGenomes-Gn; AT5G03405.
DR   EnsemblGenomes-Gn; AT5G03425.
DR   EnsemblGenomes-Gn; AT5G03445.
DR   EnsemblGenomes-Gn; AT5G03452.
DR   EnsemblGenomes-Gn; AT5G03465.
DR   EnsemblGenomes-Gn; AT5G03475.
DR   EnsemblGenomes-Gn; AT5G03485.
DR   EnsemblGenomes-Gn; AT5G03515.
DR   EnsemblGenomes-Gn; AT5G03525.
DR   EnsemblGenomes-Gn; AT5G03535.
DR   EnsemblGenomes-Gn; AT5G03552.
DR   EnsemblGenomes-Gn; AT5G03565.
DR   EnsemblGenomes-Gn; AT5G03575.
DR   EnsemblGenomes-Gn; AT5G03585.
DR   EnsemblGenomes-Gn; AT5G03590.
DR   EnsemblGenomes-Gn; AT5G03595.
DR   EnsemblGenomes-Gn; AT5G03605.
DR   EnsemblGenomes-Gn; AT5G03615.
DR   EnsemblGenomes-Gn; AT5G03625.
DR   EnsemblGenomes-Gn; AT5G03635.
DR   EnsemblGenomes-Gn; AT5G03645.
DR   EnsemblGenomes-Gn; AT5G03668.
DR   EnsemblGenomes-Gn; AT5G03685.
DR   EnsemblGenomes-Gn; AT5G03695.
DR   EnsemblGenomes-Gn; AT5G03705.
DR   EnsemblGenomes-Gn; AT5G03715.
DR   EnsemblGenomes-Gn; AT5G03735.
DR   EnsemblGenomes-Gn; AT5G03745.
DR   EnsemblGenomes-Gn; AT5G03755.
DR   EnsemblGenomes-Gn; AT5G03765.
DR   EnsemblGenomes-Gn; AT5G03775.
DR   EnsemblGenomes-Gn; AT5G03785.
DR   EnsemblGenomes-Gn; AT5G03805.
DR   EnsemblGenomes-Gn; AT5G03815.
DR   EnsemblGenomes-Gn; AT5G03820.
DR   EnsemblGenomes-Gn; AT5G03825.
DR   EnsemblGenomes-Gn; AT5G03835.
DR   EnsemblGenomes-Gn; AT5G03845.
DR   EnsemblGenomes-Gn; AT5G03875.
DR   EnsemblGenomes-Gn; AT5G03915.
DR   EnsemblGenomes-Gn; AT5G03925.
DR   EnsemblGenomes-Gn; AT5G03935.
DR   EnsemblGenomes-Gn; AT5G03945.
DR   EnsemblGenomes-Gn; AT5G03955.
DR   EnsemblGenomes-Gn; AT5G03965.
DR   EnsemblGenomes-Gn; AT5G03975.
DR   EnsemblGenomes-Gn; AT5G03985.
DR   EnsemblGenomes-Gn; AT5G04005.
DR   EnsemblGenomes-Gn; AT5G04015.
DR   EnsemblGenomes-Gn; AT5G04025.
DR   EnsemblGenomes-Gn; AT5G04035.
DR   EnsemblGenomes-Gn; AT5G04050.
DR   EnsemblGenomes-Gn; AT5G04055.
DR   EnsemblGenomes-Gn; AT5G04065.
DR   EnsemblGenomes-Gn; AT5G04075.
DR   EnsemblGenomes-Gn; AT5G04085.
DR   EnsemblGenomes-Gn; AT5G04105.
DR   EnsemblGenomes-Gn; AT5G04115.
DR   EnsemblGenomes-Gn; AT5G04125.
DR   EnsemblGenomes-Gn; AT5G04135.
DR   EnsemblGenomes-Gn; AT5G04145.
DR   EnsemblGenomes-Gn; AT5G04150.
DR   EnsemblGenomes-Gn; AT5G04165.
DR   EnsemblGenomes-Gn; AT5G04175.
DR   EnsemblGenomes-Gn; AT5G04185.
DR   EnsemblGenomes-Gn; AT5G04195.
DR   EnsemblGenomes-Gn; AT5G04205.
DR   EnsemblGenomes-Gn; AT5G04215.
DR   EnsemblGenomes-Gn; AT5G04225.
DR   EnsemblGenomes-Gn; AT5G04245.
DR   EnsemblGenomes-Gn; AT5G04255.
DR   EnsemblGenomes-Gn; AT5G04270.
DR   EnsemblGenomes-Gn; AT5G04275.
DR   EnsemblGenomes-Gn; AT5G04305.
DR   EnsemblGenomes-Gn; AT5G04315.
DR   EnsemblGenomes-Gn; AT5G04325.
DR   EnsemblGenomes-Gn; AT5G04335.
DR   EnsemblGenomes-Gn; AT5G04345.
DR   EnsemblGenomes-Gn; AT5G04355.
DR   EnsemblGenomes-Gn; AT5G04365.
DR   EnsemblGenomes-Gn; AT5G04375.
DR   EnsemblGenomes-Gn; AT5G04385.
DR   EnsemblGenomes-Gn; AT5G04405.
DR   EnsemblGenomes-Gn; AT5G04415.
DR   EnsemblGenomes-Gn; AT5G04425.
DR   EnsemblGenomes-Gn; AT5G04435.
DR   EnsemblGenomes-Gn; AT5G04445.
DR   EnsemblGenomes-Gn; AT5G04455.
DR   EnsemblGenomes-Gn; AT5G04465.
DR   EnsemblGenomes-Gn; AT5G04495.
DR   EnsemblGenomes-Gn; AT5G04505.
DR   EnsemblGenomes-Gn; AT5G04515.
DR   EnsemblGenomes-Gn; AT5G04525.
DR   EnsemblGenomes-Gn; AT5G04545.
DR   EnsemblGenomes-Gn; AT5G04575.
DR   EnsemblGenomes-Gn; AT5G04585.
DR   EnsemblGenomes-Gn; AT5G04595.
DR   EnsemblGenomes-Gn; AT5G04605.
DR   EnsemblGenomes-Gn; AT5G04615.
DR   EnsemblGenomes-Gn; AT5G04625.
DR   EnsemblGenomes-Gn; AT5G04635.
DR   EnsemblGenomes-Gn; AT5G04665.
DR   EnsemblGenomes-Gn; AT5G04675.
DR   EnsemblGenomes-Gn; AT5G04685.
DR   EnsemblGenomes-Gn; AT5G04695.
DR   EnsemblGenomes-Gn; AT5G04705.
DR   EnsemblGenomes-Gn; AT5G04715.
DR   EnsemblGenomes-Gn; AT5G04725.
DR   EnsemblGenomes-Gn; AT5G04745.
DR   EnsemblGenomes-Gn; AT5G04755.
DR   EnsemblGenomes-Gn; AT5G04765.
DR   EnsemblGenomes-Gn; AT5G04775.
DR   EnsemblGenomes-Gn; AT5G04785.
DR   EnsemblGenomes-Gn; AT5G04795.
DR   EnsemblGenomes-Gn; AT5G04815.
DR   EnsemblGenomes-Gn; AT5G04825.
DR   EnsemblGenomes-Gn; AT5G04845.
DR   EnsemblGenomes-Gn; AT5G04855.
DR   EnsemblGenomes-Gn; AT5G04865.
DR   EnsemblGenomes-Gn; AT5G04905.
DR   EnsemblGenomes-Gn; AT5G04915.
DR   EnsemblGenomes-Gn; AT5G04925.
DR   EnsemblGenomes-Gn; AT5G04935.
DR   EnsemblGenomes-Gn; AT5G04945.
DR   EnsemblGenomes-Gn; AT5G04955.
DR   EnsemblGenomes-Gn; AT5G04965.
DR   EnsemblGenomes-Gn; AT5G04975.
DR   EnsemblGenomes-Gn; AT5G04985.
DR   EnsemblGenomes-Gn; AT5G04995.
DR   EnsemblGenomes-Gn; AT5G05005.
DR   EnsemblGenomes-Gn; AT5G05015.
DR   EnsemblGenomes-Gn; AT5G05035.
DR   EnsemblGenomes-Gn; AT5G05045.
DR   EnsemblGenomes-Gn; AT5G05055.
DR   EnsemblGenomes-Gn; AT5G05065.
DR   EnsemblGenomes-Gn; AT5G05075.
DR   EnsemblGenomes-Gn; AT5G05095.
DR   EnsemblGenomes-Gn; AT5G05105.
DR   EnsemblGenomes-Gn; AT5G05125.
DR   EnsemblGenomes-Gn; AT5G05135.
DR   EnsemblGenomes-Gn; AT5G05155.
DR   EnsemblGenomes-Gn; AT5G05175.
DR   EnsemblGenomes-Gn; AT5G05185.
DR   EnsemblGenomes-Gn; AT5G05195.
DR   EnsemblGenomes-Gn; AT5G05205.
DR   EnsemblGenomes-Gn; AT5G05215.
DR   EnsemblGenomes-Gn; AT5G05235.
DR   EnsemblGenomes-Gn; AT5G05255.
DR   EnsemblGenomes-Gn; AT5G05265.
DR   EnsemblGenomes-Gn; AT5G05275.
DR   EnsemblGenomes-Gn; AT5G05295.
DR   EnsemblGenomes-Gn; AT5G05315.
DR   EnsemblGenomes-Gn; AT5G05325.
DR   EnsemblGenomes-Gn; AT5G05335.
DR   EnsemblGenomes-Gn; AT5G05375.
DR   EnsemblGenomes-Gn; AT5G05385.
DR   EnsemblGenomes-Gn; AT5G05395.
DR   EnsemblGenomes-Gn; AT5G05415.
DR   EnsemblGenomes-Gn; AT5G05425.
DR   EnsemblGenomes-Gn; AT5G05435.
DR   EnsemblGenomes-Gn; AT5G05445.
DR   EnsemblGenomes-Gn; AT5G05455.
DR   EnsemblGenomes-Gn; AT5G05465.
DR   EnsemblGenomes-Gn; AT5G05475.
DR   EnsemblGenomes-Gn; AT5G05485.
DR   EnsemblGenomes-Gn; AT5G05495.
DR   EnsemblGenomes-Gn; AT5G05505.
DR   EnsemblGenomes-Gn; AT5G05515.
DR   EnsemblGenomes-Gn; AT5G05525.
DR   EnsemblGenomes-Gn; AT5G05535.
DR   EnsemblGenomes-Gn; AT5G05545.
DR   EnsemblGenomes-Gn; AT5G05555.
DR   EnsemblGenomes-Gn; AT5G05560.
DR   EnsemblGenomes-Gn; AT5G05565.
DR   EnsemblGenomes-Gn; AT5G05585.
DR   EnsemblGenomes-Gn; AT5G05605.
DR   EnsemblGenomes-Gn; AT5G05625.
DR   EnsemblGenomes-Gn; AT5G05645.
DR   EnsemblGenomes-Gn; AT5G05665.
DR   EnsemblGenomes-Gn; AT5G05685.
DR   EnsemblGenomes-Gn; AT5G05695.
DR   EnsemblGenomes-Gn; AT5G05705.
DR   EnsemblGenomes-Gn; AT5G05725.
DR   EnsemblGenomes-Gn; AT5G05745.
DR   EnsemblGenomes-Gn; AT5G05755.
DR   EnsemblGenomes-Gn; AT5G05765.
DR   EnsemblGenomes-Gn; AT5G05785.
DR   EnsemblGenomes-Gn; AT5G05795.
DR   EnsemblGenomes-Gn; AT5G05805.
DR   EnsemblGenomes-Gn; AT5G05815.
DR   EnsemblGenomes-Gn; AT5G05825.
DR   EnsemblGenomes-Gn; AT5G05835.
DR   EnsemblGenomes-Gn; AT5G05845.
DR   EnsemblGenomes-Gn; AT5G05855.
DR   EnsemblGenomes-Gn; AT5G05865.
DR   EnsemblGenomes-Gn; AT5G05875.
DR   EnsemblGenomes-Gn; AT5G05885.
DR   EnsemblGenomes-Gn; AT5G05895.
DR   EnsemblGenomes-Gn; AT5G05905.
DR   EnsemblGenomes-Gn; AT5G05915.
DR   EnsemblGenomes-Gn; AT5G05925.
DR   EnsemblGenomes-Gn; AT5G05935.
DR   EnsemblGenomes-Gn; AT5G05945.
DR   EnsemblGenomes-Gn; AT5G05955.
DR   EnsemblGenomes-Gn; AT5G05975.
DR   EnsemblGenomes-Gn; AT5G05985.
DR   EnsemblGenomes-Gn; AT5G05995.
DR   EnsemblGenomes-Gn; AT5G06005.
DR   EnsemblGenomes-Gn; AT5G06015.
DR   EnsemblGenomes-Gn; AT5G06025.
DR   EnsemblGenomes-Gn; AT5G06035.
DR   EnsemblGenomes-Gn; AT5G06045.
DR   EnsemblGenomes-Gn; AT5G06055.
DR   EnsemblGenomes-Gn; AT5G06065.
DR   EnsemblGenomes-Gn; AT5G06075.
DR   EnsemblGenomes-Gn; AT5G06085.
DR   EnsemblGenomes-Gn; AT5G06095.
DR   EnsemblGenomes-Gn; AT5G06105.
DR   EnsemblGenomes-Gn; AT5G06115.
DR   EnsemblGenomes-Gn; AT5G06125.
DR   EnsemblGenomes-Gn; AT5G06145.
DR   EnsemblGenomes-Gn; AT5G06155.
DR   EnsemblGenomes-Gn; AT5G06165.
DR   EnsemblGenomes-Gn; AT5G06175.
DR   EnsemblGenomes-Gn; AT5G06185.
DR   EnsemblGenomes-Gn; AT5G06205.
DR   EnsemblGenomes-Gn; AT5G06235.
DR   EnsemblGenomes-Gn; AT5G06245.
DR   EnsemblGenomes-Gn; AT5G06255.
DR   EnsemblGenomes-Gn; AT5G06275.
DR   EnsemblGenomes-Gn; AT5G06285.
DR   EnsemblGenomes-Gn; AT5G06295.
DR   EnsemblGenomes-Gn; AT5G06305.
DR   EnsemblGenomes-Gn; AT5G06325.
DR   EnsemblGenomes-Gn; AT5G06335.
DR   EnsemblGenomes-Gn; AT5G06345.
DR   EnsemblGenomes-Gn; AT5G06365.
DR   EnsemblGenomes-Gn; AT5G06385.
DR   EnsemblGenomes-Gn; AT5G06395.
DR   EnsemblGenomes-Gn; AT5G06405.
DR   EnsemblGenomes-Gn; AT5G06415.
DR   EnsemblGenomes-Gn; AT5G06425.
DR   EnsemblGenomes-Gn; AT5G06435.
DR   EnsemblGenomes-Gn; AT5G06445.
DR   EnsemblGenomes-Gn; AT5G06455.
DR   EnsemblGenomes-Gn; AT5G06465.
DR   EnsemblGenomes-Gn; AT5G06475.
DR   EnsemblGenomes-Gn; AT5G06495.
DR   EnsemblGenomes-Gn; AT5G06505.
DR   EnsemblGenomes-Gn; AT5G06515.
DR   EnsemblGenomes-Gn; AT5G06525.
DR   EnsemblGenomes-Gn; AT5G06535.
DR   EnsemblGenomes-Gn; AT5G06545.
DR   EnsemblGenomes-Gn; AT5G06565.
DR   EnsemblGenomes-Gn; AT5G06575.
DR   EnsemblGenomes-Gn; AT5G06585.
DR   EnsemblGenomes-Gn; AT5G06595.
DR   EnsemblGenomes-Gn; AT5G06605.
DR   EnsemblGenomes-Gn; AT5G06615.
DR   EnsemblGenomes-Gn; AT5G06635.
DR   EnsemblGenomes-Gn; AT5G06655.
DR   EnsemblGenomes-Gn; AT5G06665.
DR   EnsemblGenomes-Gn; AT5G06675.
DR   EnsemblGenomes-Gn; AT5G06685.
DR   EnsemblGenomes-Gn; AT5G06695.
DR   EnsemblGenomes-Gn; AT5G06705.
DR   EnsemblGenomes-Gn; AT5G06715.
DR   EnsemblGenomes-Gn; AT5G06735.
DR   EnsemblGenomes-Gn; AT5G06745.
DR   EnsemblGenomes-Gn; AT5G06765.
DR   EnsemblGenomes-Gn; AT5G06775.
DR   EnsemblGenomes-Gn; AT5G06785.
DR   EnsemblGenomes-Gn; AT5G06795.
DR   EnsemblGenomes-Gn; AT5G06815.
DR   EnsemblGenomes-Gn; AT5G06825.
DR   EnsemblGenomes-Gn; AT5G06835.
DR   EnsemblGenomes-Gn; AT5G06845.
DR   EnsemblGenomes-Gn; AT5G06855.
DR   EnsemblGenomes-Gn; AT5G06865.
DR   EnsemblGenomes-Gn; AT5G06875.
DR   EnsemblGenomes-Gn; AT5G06880.
DR   EnsemblGenomes-Gn; AT5G06885.
DR   EnsemblGenomes-Gn; AT5G06915.
DR   EnsemblGenomes-Gn; AT5G06925.
DR   EnsemblGenomes-Gn; AT5G06935.
DR   EnsemblGenomes-Gn; AT5G06945.
DR   EnsemblGenomes-Gn; AT5G06955.
DR   EnsemblGenomes-Gn; AT5G06965.
DR   EnsemblGenomes-Gn; AT5G06975.
DR   EnsemblGenomes-Gn; AT5G06985.
DR   EnsemblGenomes-Gn; AT5G06995.
DR   EnsemblGenomes-Gn; AT5G07005.
DR   EnsemblGenomes-Gn; AT5G07015.
DR   EnsemblGenomes-Gn; AT5G07025.
DR   EnsemblGenomes-Gn; AT5G07035.
DR   EnsemblGenomes-Gn; AT5G07055.
DR   EnsemblGenomes-Gn; AT5G07065.
DR   EnsemblGenomes-Gn; AT5G07075.
DR   EnsemblGenomes-Gn; AT5G07095.
DR   EnsemblGenomes-Gn; AT5G07105.
DR   EnsemblGenomes-Gn; AT5G07115.
DR   EnsemblGenomes-Gn; AT5G07125.
DR   EnsemblGenomes-Gn; AT5G07135.
DR   EnsemblGenomes-Gn; AT5G07145.
DR   EnsemblGenomes-Gn; AT5G07152.
DR   EnsemblGenomes-Gn; AT5G07155.
DR   EnsemblGenomes-Gn; AT5G07185.
DR   EnsemblGenomes-Gn; AT5G07195.
DR   EnsemblGenomes-Gn; AT5G07205.
DR   EnsemblGenomes-Gn; AT5G07255.
DR   EnsemblGenomes-Gn; AT5G07265.
DR   EnsemblGenomes-Gn; AT5G07275.
DR   EnsemblGenomes-Gn; AT5G07285.
DR   EnsemblGenomes-Gn; AT5G07295.
DR   EnsemblGenomes-Gn; AT5G07315.
DR   EnsemblGenomes-Gn; AT5G07322.
DR   EnsemblGenomes-Gn; AT5G07325.
DR   EnsemblGenomes-Gn; AT5G07335.
DR   EnsemblGenomes-Gn; AT5G07345.
DR   EnsemblGenomes-Gn; AT5G07355.
DR   EnsemblGenomes-Gn; AT5G07365.
DR   EnsemblGenomes-Gn; AT5G07385.
DR   EnsemblGenomes-Gn; AT5G07395.
DR   EnsemblGenomes-Gn; AT5G07405.
DR   EnsemblGenomes-Gn; AT5G07415.
DR   EnsemblGenomes-Gn; AT5G07425.
DR   EnsemblGenomes-Gn; AT5G07435.
DR   EnsemblGenomes-Gn; AT5G07445.
DR   EnsemblGenomes-Gn; AT5G07455.
DR   EnsemblGenomes-Gn; AT5G07465.
DR   EnsemblGenomes-Gn; AT5G07485.
DR   EnsemblGenomes-Gn; AT5G07495.
DR   EnsemblGenomes-Gn; AT5G07515.
DR   EnsemblGenomes-Gn; AT5G07525.
DR   EnsemblGenomes-Gn; AT5G07535.
DR   EnsemblGenomes-Gn; AT5G07555.
DR   EnsemblGenomes-Gn; AT5G07565.
DR   EnsemblGenomes-Gn; AT5G07575.
DR   EnsemblGenomes-Gn; AT5G07585.
DR   EnsemblGenomes-Gn; AT5G07595.
DR   EnsemblGenomes-Gn; AT5G07605.
DR   EnsemblGenomes-Gn; AT5G07615.
DR   EnsemblGenomes-Gn; AT5G07625.
DR   EnsemblGenomes-Gn; AT5G07635.
DR   EnsemblGenomes-Gn; AT5G07650.
DR   EnsemblGenomes-Gn; AT5G07655.
DR   EnsemblGenomes-Gn; AT5G07665.
DR   EnsemblGenomes-Gn; AT5G07675.
DR   EnsemblGenomes-Gn; AT5G07695.
DR   EnsemblGenomes-Gn; AT5G07705.
DR   EnsemblGenomes-Gn; AT5G07715.
DR   EnsemblGenomes-Gn; AT5G07725.
DR   EnsemblGenomes-Gn; AT5G07735.
DR   EnsemblGenomes-Gn; AT5G07745.
DR   EnsemblGenomes-Gn; AT5G07760.
DR   EnsemblGenomes-Gn; AT5G07775.
DR   EnsemblGenomes-Gn; AT5G07785.
DR   EnsemblGenomes-Gn; AT5G07795.
DR   EnsemblGenomes-Gn; AT5G07805.
DR   EnsemblGenomes-Gn; AT5G07815.
DR   EnsemblGenomes-Gn; AT5G07825.
DR   EnsemblGenomes-Gn; AT5G07835.
DR   EnsemblGenomes-Gn; AT5G07845.
DR   EnsemblGenomes-Gn; AT5G07855.
DR   EnsemblGenomes-Gn; AT5G07865.
DR   EnsemblGenomes-Gn; AT5G07875.
DR   EnsemblGenomes-Gn; AT5G07885.
DR   EnsemblGenomes-Gn; AT5G07895.
DR   EnsemblGenomes-Gn; AT5G07905.
DR   EnsemblGenomes-Gn; AT5G07915.
DR   EnsemblGenomes-Gn; AT5G07925.
DR   EnsemblGenomes-Gn; AT5G07935.
DR   EnsemblGenomes-Gn; AT5G07945.
DR   EnsemblGenomes-Gn; AT5G07955.
DR   EnsemblGenomes-Gn; AT5G07965.
DR   EnsemblGenomes-Gn; AT5G07975.
DR   EnsemblGenomes-Gn; AT5G07985.
DR   EnsemblGenomes-Gn; AT5G07995.
DR   EnsemblGenomes-Gn; AT5G08015.
DR   EnsemblGenomes-Gn; AT5G08025.
DR   EnsemblGenomes-Gn; AT5G08035.
DR   EnsemblGenomes-Gn; AT5G08045.
DR   EnsemblGenomes-Gn; AT5G08065.
DR   EnsemblGenomes-Gn; AT5G08075.
DR   EnsemblGenomes-Gn; AT5G08085.
DR   EnsemblGenomes-Gn; AT5G08095.
DR   EnsemblGenomes-Gn; AT5G08105.
DR   EnsemblGenomes-Gn; AT5G08115.
DR   EnsemblGenomes-Gn; AT5G08120.
DR   EnsemblGenomes-Gn; AT5G08125.
DR   EnsemblGenomes-Gn; AT5G08135.
DR   EnsemblGenomes-Gn; AT5G08165.
DR   EnsemblGenomes-Gn; AT5G08175.
DR   EnsemblGenomes-Gn; AT5G08185.
DR   EnsemblGenomes-Gn; AT5G08195.
DR   EnsemblGenomes-Gn; AT5G08205.
DR   EnsemblGenomes-Gn; AT5G08210.
DR   EnsemblGenomes-Gn; AT5G08215.
DR   EnsemblGenomes-Gn; AT5G08225.
DR   EnsemblGenomes-Gn; AT5G08235.
DR   EnsemblGenomes-Gn; AT5G08255.
DR   EnsemblGenomes-Gn; AT5G08265.
DR   EnsemblGenomes-Gn; AT5G08275.
DR   EnsemblGenomes-Gn; AT5G08285.
DR   EnsemblGenomes-Gn; AT5G08375.
DR   EnsemblGenomes-Gn; AT5G08385.
DR   EnsemblGenomes-Gn; AT5G08395.
DR   EnsemblGenomes-Gn; AT5G08425.
DR   EnsemblGenomes-Gn; AT5G08435.
DR   EnsemblGenomes-Gn; AT5G08445.
DR   EnsemblGenomes-Gn; AT5G08455.
DR   EnsemblGenomes-Gn; AT5G08465.
DR   EnsemblGenomes-Gn; AT5G08475.
DR   EnsemblGenomes-Gn; AT5G08485.
DR   EnsemblGenomes-Gn; AT5G08495.
DR   EnsemblGenomes-Gn; AT5G08515.
DR   EnsemblGenomes-Gn; AT5G08525.
DR   EnsemblGenomes-Gn; AT5G08575.
DR   EnsemblGenomes-Gn; AT5G08585.
DR   EnsemblGenomes-Gn; AT5G08595.
DR   EnsemblGenomes-Gn; AT5G08605.
DR   EnsemblGenomes-Gn; AT5G08615.
DR   EnsemblGenomes-Gn; AT5G08635.
DR   EnsemblGenomes-Gn; AT5G08645.
DR   EnsemblGenomes-Gn; AT5G08655.
DR   EnsemblGenomes-Gn; AT5G08665.
DR   EnsemblGenomes-Gn; AT5G08670.
DR   EnsemblGenomes-Gn; AT5G08675.
DR   EnsemblGenomes-Gn; AT5G08685.
DR   EnsemblGenomes-Gn; AT5G08705.
DR   EnsemblGenomes-Gn; AT5G08712.
DR   EnsemblGenomes-Gn; AT5G08715.
DR   EnsemblGenomes-Gn; AT5G08717.
DR   EnsemblGenomes-Gn; AT5G08725.
DR   EnsemblGenomes-Gn; AT5G08735.
DR   EnsemblGenomes-Gn; AT5G08740.
DR   EnsemblGenomes-Gn; AT5G08745.
DR   EnsemblGenomes-Gn; AT5G08755.
DR   EnsemblGenomes-Gn; AT5G08765.
DR   EnsemblGenomes-Gn; AT5G08775.
DR   EnsemblGenomes-Gn; AT5G08785.
DR   EnsemblGenomes-Gn; AT5G08800.
DR   EnsemblGenomes-Gn; AT5G08805.
DR   EnsemblGenomes-Gn; AT5G08810.
DR   EnsemblGenomes-Gn; AT5G08815.
DR   EnsemblGenomes-Gn; AT5G08820.
DR   EnsemblGenomes-Gn; AT5G08825.
DR   EnsemblGenomes-Gn; AT5G08830.
DR   EnsemblGenomes-Gn; AT5G08835.
DR   EnsemblGenomes-Gn; AT5G08840.
DR   EnsemblGenomes-Gn; AT5G08845.
DR   EnsemblGenomes-Gn; AT5G08850.
DR   EnsemblGenomes-Gn; AT5G08855.
DR   EnsemblGenomes-Gn; AT5G08860.
DR   EnsemblGenomes-Gn; AT5G08865.
DR   EnsemblGenomes-Gn; AT5G08870.
DR   EnsemblGenomes-Gn; AT5G08875.
DR   EnsemblGenomes-Gn; AT5G08880.
DR   EnsemblGenomes-Gn; AT5G08885.
DR   EnsemblGenomes-Gn; AT5G08890.
DR   EnsemblGenomes-Gn; AT5G08895.
DR   EnsemblGenomes-Gn; AT5G08900.
DR   EnsemblGenomes-Gn; AT5G08905.
DR   EnsemblGenomes-Gn; AT5G08910.
DR   EnsemblGenomes-Gn; AT5G08915.
DR   EnsemblGenomes-Gn; AT5G08920.
DR   EnsemblGenomes-Gn; AT5G08925.
DR   EnsemblGenomes-Gn; AT5G08930.
DR   EnsemblGenomes-Gn; AT5G08935.
DR   EnsemblGenomes-Gn; AT5G08940.
DR   EnsemblGenomes-Gn; AT5G08945.
DR   EnsemblGenomes-Gn; AT5G08950.
DR   EnsemblGenomes-Gn; AT5G08955.
DR   EnsemblGenomes-Gn; AT5G08960.
DR   EnsemblGenomes-Gn; AT5G08965.
DR   EnsemblGenomes-Gn; AT5G08970.
DR   EnsemblGenomes-Gn; AT5G08975.
DR   EnsemblGenomes-Gn; AT5G08980.
DR   EnsemblGenomes-Gn; AT5G08985.
DR   EnsemblGenomes-Gn; AT5G08990.
DR   EnsemblGenomes-Gn; AT5G08995.
DR   EnsemblGenomes-Gn; AT5G09000.
DR   EnsemblGenomes-Gn; AT5G09005.
DR   EnsemblGenomes-Gn; AT5G09010.
DR   EnsemblGenomes-Gn; AT5G09015.
DR   EnsemblGenomes-Gn; AT5G09020.
DR   EnsemblGenomes-Gn; AT5G09025.
DR   EnsemblGenomes-Gn; AT5G09030.
DR   EnsemblGenomes-Gn; AT5G09035.
DR   EnsemblGenomes-Gn; AT5G09040.
DR   EnsemblGenomes-Gn; AT5G09045.
DR   EnsemblGenomes-Gn; AT5G09050.
DR   EnsemblGenomes-Gn; AT5G09055.
DR   EnsemblGenomes-Gn; AT5G09060.
DR   EnsemblGenomes-Gn; AT5G09065.
DR   EnsemblGenomes-Gn; AT5G09070.
DR   EnsemblGenomes-Gn; AT5G09080.
DR   EnsemblGenomes-Gn; AT5G09085.
DR   EnsemblGenomes-Gn; AT5G09090.
DR   EnsemblGenomes-Gn; AT5G09095.
DR   EnsemblGenomes-Gn; AT5G09100.
DR   EnsemblGenomes-Gn; AT5G09105.
DR   EnsemblGenomes-Gn; AT5G09110.
DR   EnsemblGenomes-Gn; AT5G09120.
DR   EnsemblGenomes-Gn; AT5G09125.
DR   EnsemblGenomes-Gn; AT5G09130.
DR   EnsemblGenomes-Gn; AT5G09135.
DR   EnsemblGenomes-Gn; AT5G09140.
DR   EnsemblGenomes-Gn; AT5G09145.
DR   EnsemblGenomes-Gn; AT5G09150.
DR   EnsemblGenomes-Gn; AT5G09155.
DR   EnsemblGenomes-Gn; AT5G09160.
DR   EnsemblGenomes-Gn; AT5G09165.
DR   EnsemblGenomes-Gn; AT5G09170.
DR   EnsemblGenomes-Gn; AT5G09175.
DR   EnsemblGenomes-Gn; AT5G09185.
DR   EnsemblGenomes-Gn; AT5G09190.
DR   EnsemblGenomes-Gn; AT5G09195.
DR   EnsemblGenomes-Gn; AT5G09200.
DR   EnsemblGenomes-Gn; AT5G09205.
DR   EnsemblGenomes-Gn; AT5G09215.
DR   EnsemblGenomes-Gn; AT5G09235.
DR   EnsemblGenomes-Gn; AT5G09245.
DR   EnsemblGenomes-Gn; AT5G09255.
DR   EnsemblGenomes-Gn; AT5G09265.
DR   EnsemblGenomes-Gn; AT5G09275.
DR   EnsemblGenomes-Gn; AT5G09285.
DR   EnsemblGenomes-Gn; AT5G09295.
DR   EnsemblGenomes-Gn; AT5G09305.
DR   EnsemblGenomes-Gn; AT5G09325.
DR   EnsemblGenomes-Gn; AT5G09335.
DR   EnsemblGenomes-Gn; AT5G09345.
DR   EnsemblGenomes-Gn; AT5G09365.
DR   EnsemblGenomes-Gn; AT5G09375.
DR   EnsemblGenomes-Gn; AT5G09385.
DR   EnsemblGenomes-Gn; AT5G09395.
DR   EnsemblGenomes-Gn; AT5G09405.
DR   EnsemblGenomes-Gn; AT5G09415.
DR   EnsemblGenomes-Gn; AT5G09425.
DR   EnsemblGenomes-Gn; AT5G09435.
DR   EnsemblGenomes-Gn; AT5G09443.
DR   EnsemblGenomes-Gn; AT5G09455.
DR   EnsemblGenomes-Gn; AT5G09465.
DR   EnsemblGenomes-Gn; AT5G09475.
DR   EnsemblGenomes-Gn; AT5G09495.
DR   EnsemblGenomes-Gn; AT5G09505.
DR   EnsemblGenomes-Gn; AT5G09515.
DR   EnsemblGenomes-Gn; AT5G09535.
DR   EnsemblGenomes-Gn; AT5G09545.
DR   EnsemblGenomes-Gn; AT5G09555.
DR   EnsemblGenomes-Gn; AT5G09565.
DR   EnsemblGenomes-Gn; AT5G09585.
DR   EnsemblGenomes-Gn; AT5G09595.
DR   EnsemblGenomes-Gn; AT5G09605.
DR   EnsemblGenomes-Gn; AT5G09615.
DR   EnsemblGenomes-Gn; AT5G09635.
DR   EnsemblGenomes-Gn; AT5G09645.
DR   EnsemblGenomes-Gn; AT5G09655.
DR   EnsemblGenomes-Gn; AT5G09665.
DR   EnsemblGenomes-Gn; AT5G09675.
DR   EnsemblGenomes-Gn; AT5G09685.
DR   EnsemblGenomes-Gn; AT5G09695.
DR   EnsemblGenomes-Gn; AT5G09705.
DR   EnsemblGenomes-Gn; AT5G09715.
DR   EnsemblGenomes-Gn; AT5G09735.
DR   EnsemblGenomes-Gn; AT5G09740.
DR   EnsemblGenomes-Gn; AT5G09755.
DR   EnsemblGenomes-Gn; AT5G09765.
DR   EnsemblGenomes-Gn; AT5G09775.
DR   EnsemblGenomes-Gn; AT5G09785.
DR   EnsemblGenomes-Gn; AT5G09815.
DR   EnsemblGenomes-Gn; AT5G09825.
DR   EnsemblGenomes-Gn; AT5G09835.
DR   EnsemblGenomes-Gn; AT5G09845.
DR   EnsemblGenomes-Gn; AT5G09855.
DR   EnsemblGenomes-Gn; AT5G09865.
DR   EnsemblGenomes-Gn; AT5G09875.
DR   EnsemblGenomes-Gn; AT5G09885.
DR   EnsemblGenomes-Gn; AT5G09895.
DR   EnsemblGenomes-Gn; AT5G09915.
DR   EnsemblGenomes-Gn; AT5G09925.
DR   EnsemblGenomes-Gn; AT5G09945.
DR   EnsemblGenomes-Gn; AT5G09955.
DR   EnsemblGenomes-Gn; AT5G09965.
DR   EnsemblGenomes-Gn; AT5G09975.
DR   EnsemblGenomes-Gn; AT5G10235.
DR   EnsemblGenomes-Gn; AT5G10278.
DR   EnsemblGenomes-Gn; AT5G10455.
DR   EnsemblGenomes-Gn; AT5G10525.
DR   EnsemblGenomes-Gn; AT5G10572.
DR   EnsemblGenomes-Gn; AT5G10945.
DR   EnsemblGenomes-Gn; AT5G10965.
DR   EnsemblGenomes-Gn; AT5G11100.
DR   EnsemblGenomes-Gn; AT5G11180.
DR   EnsemblGenomes-Gn; AT5G11225.
DR   EnsemblGenomes-Gn; AT5G11325.
DR   EnsemblGenomes-Gn; AT5G11400.
DR   EnsemblGenomes-Gn; AT5G11470.
DR   EnsemblGenomes-Gn; AT5G11475.
DR   EnsemblGenomes-Gn; AT5G11977.
DR   EnsemblGenomes-Gn; AT5G13225.
DR   EnsemblGenomes-Gn; AT5G13845.
DR   EnsemblGenomes-Gn; AT5G13887.
DR   EnsemblGenomes-Gn; AT5G14035.
DR   EnsemblGenomes-Gn; AT5G14495.
DR   EnsemblGenomes-Gn; AT5G14545.
DR   EnsemblGenomes-Gn; AT5G14565.
DR   EnsemblGenomes-Gn; AT5G15022.
DR   EnsemblGenomes-Gn; AT5G15110.
DR   EnsemblGenomes-Gn; AT5G15175.
DR   EnsemblGenomes-Gn; AT5G15805.
DR   EnsemblGenomes-Gn; AT5G15815.
DR   EnsemblGenomes-Gn; AT5G15833.
DR   EnsemblGenomes-Gn; AT5G15845.
DR   EnsemblGenomes-Gn; AT5G16235.
DR   EnsemblGenomes-Gn; AT5G16375.
DR   EnsemblGenomes-Gn; AT5G18005.
DR   EnsemblGenomes-Gn; AT5G18015.
DR   EnsemblGenomes-Gn; AT5G18085.
DR   EnsemblGenomes-Gn; AT5G18245.
DR   EnsemblGenomes-Gn; AT5G18255.
DR   EnsemblGenomes-Gn; AT5G18710.
DR   EnsemblGenomes-Gn; AT5G18755.
DR   EnsemblGenomes-Gn; AT5G19095.
DR   EnsemblGenomes-Gn; AT5G19221.
DR   EnsemblGenomes-Gn; AT5G20225.
DR   EnsemblGenomes-Gn; AT5G20260.
DR   EnsemblGenomes-Gn; AT5G20852.
DR   EnsemblGenomes-Gn; AT5G20854.
DR   EnsemblGenomes-Gn; AT5G20856.
DR   EnsemblGenomes-Gn; AT5G20858.
DR   EnsemblGenomes-Gn; AT5G21378.
DR   EnsemblGenomes-Gn; AT5G22315.
DR   EnsemblGenomes-Gn; AT5G22470.
DR   EnsemblGenomes-Gn; AT5G22788.
DR   EnsemblGenomes-Gn; AT5G22810.
DR   EnsemblGenomes-Gn; AT5G23065.
DR   EnsemblGenomes-Gn; AT5G23115.
DR   EnsemblGenomes-Gn; AT5G23155.
DR   EnsemblGenomes-Gn; AT5G23212.
DR   EnsemblGenomes-Gn; AT5G23260.
DR   EnsemblGenomes-Gn; AT5G23410.
DR   EnsemblGenomes-Gn; AT5G23665.
DR   EnsemblGenomes-Gn; AT5G23770.
DR   EnsemblGenomes-Gn; AT5G24140.
DR   EnsemblGenomes-Gn; AT5G24205.
DR   EnsemblGenomes-Gn; AT5G24206.
DR   EnsemblGenomes-Gn; AT5G24560.
DR   EnsemblGenomes-Gn; AT5G24575.
DR   EnsemblGenomes-Gn; AT5G24735.
DR   EnsemblGenomes-Gn; AT5G24825.
DR   EnsemblGenomes-Gn; AT5G25040.
DR   EnsemblGenomes-Gn; AT5G25585.
DR   EnsemblGenomes-Gn; AT5G25625.
DR   EnsemblGenomes-Gn; AT5G26038.
DR   EnsemblGenomes-Gn; AT5G26146.
DR   EnsemblGenomes-Gn; AT5G26147.
DR   EnsemblGenomes-Gn; AT5G26800.
DR   EnsemblGenomes-Gn; AT5G26860.
DR   EnsemblGenomes-Gn; AT5G27093.
DR   EnsemblGenomes-Gn; AT5G27140.
DR   EnsemblGenomes-Gn; AT5G27570.
DR   EnsemblGenomes-Gn; AT5G27715.
DR   EnsemblGenomes-Gn; AT5G27807.
DR   EnsemblGenomes-Gn; AT5G28262.
DR   EnsemblGenomes-Gn; AT5G28824.
DR   EnsemblGenomes-Gn; AT5G32017.
DR   EnsemblGenomes-Gn; AT5G33399.
DR   EnsemblGenomes-Gn; AT5G33439.
DR   EnsemblGenomes-Gn; AT5G34871.
DR   EnsemblGenomes-Gn; AT5G35210.
DR   EnsemblGenomes-Gn; AT5G35407.
DR   EnsemblGenomes-Gn; AT5G35605.
DR   EnsemblGenomes-Gn; AT5G35715.
DR   EnsemblGenomes-Gn; AT5G35917.
DR   EnsemblGenomes-Gn; AT5G36002.
DR   EnsemblGenomes-Gn; AT5G36300.
DR   EnsemblGenomes-Gn; AT5G37450.
DR   EnsemblGenomes-Gn; AT5G37485.
DR   EnsemblGenomes-Gn; AT5G37795.
DR   EnsemblGenomes-Gn; AT5G37900.
DR   EnsemblGenomes-Gn; AT5G38005.
DR   EnsemblGenomes-Gn; AT5G38155.
DR   EnsemblGenomes-Gn; AT5G38212.
DR   EnsemblGenomes-Gn; AT5G38240.
DR   EnsemblGenomes-Gn; AT5G38660.
DR   EnsemblGenomes-Gn; AT5G38810.
DR   EnsemblGenomes-Gn; AT5G38820.
DR   EnsemblGenomes-Gn; AT5G38905.
DR   EnsemblGenomes-Gn; AT5G39100.
DR   EnsemblGenomes-Gn; AT5G39535.
DR   EnsemblGenomes-Gn; AT5G39635.
DR   EnsemblGenomes-Gn; AT5G39693.
DR   EnsemblGenomes-Gn; AT5G39790.
DR   EnsemblGenomes-Gn; AT5G39895.
DR   EnsemblGenomes-Gn; AT5G40275.
DR   EnsemblGenomes-Gn; AT5G40315.
DR   EnsemblGenomes-Gn; AT5G40316.
DR   EnsemblGenomes-Gn; AT5G40348.
DR   EnsemblGenomes-Gn; AT5G40384.
DR   EnsemblGenomes-Gn; AT5G40395.
DR   EnsemblGenomes-Gn; AT5G40545.
DR   EnsemblGenomes-Gn; AT5G40945.
DR   EnsemblGenomes-Gn; AT5G41160.
DR   EnsemblGenomes-Gn; AT5G41265.
DR   EnsemblGenomes-Gn; AT5G41310.
DR   EnsemblGenomes-Gn; AT5G41471.
DR   EnsemblGenomes-Gn; AT5G41605.
DR   EnsemblGenomes-Gn; AT5G41612.
DR   EnsemblGenomes-Gn; AT5G41663.
DR   EnsemblGenomes-Gn; AT5G41675.
DR   EnsemblGenomes-Gn; AT5G41905.
DR   EnsemblGenomes-Gn; AT5G42092.
DR   EnsemblGenomes-Gn; AT5G42490.
DR   EnsemblGenomes-Gn; AT5G42700.
DR   EnsemblGenomes-Gn; AT5G43403.
DR   EnsemblGenomes-Gn; AT5G43455.
DR   EnsemblGenomes-Gn; AT5G43535.
DR   EnsemblGenomes-Gn; AT5G43603.
DR   EnsemblGenomes-Gn; AT5G43725.
DR   EnsemblGenomes-Gn; AT5G44283.
DR   EnsemblGenomes-Gn; AT5G44286.
DR   EnsemblGenomes-Gn; AT5G44375.
DR   EnsemblGenomes-Gn; AT5G44562.
DR   EnsemblGenomes-Gn; AT5G44569.
DR   EnsemblGenomes-Gn; AT5G44705.
DR   EnsemblGenomes-Gn; AT5G44960.
DR   EnsemblGenomes-Gn; AT5G45307.
DR   EnsemblGenomes-Gn; AT5G45472.
DR   EnsemblGenomes-Gn; AT5G45475.
DR   EnsemblGenomes-Gn; AT5G45715.
DR   EnsemblGenomes-Gn; AT5G45745.
DR   EnsemblGenomes-Gn; AT5G45840.
DR   EnsemblGenomes-Gn; AT5G46105.
DR   EnsemblGenomes-Gn; AT5G46315.
DR   EnsemblGenomes-Gn; AT5G46325.
DR   EnsemblGenomes-Gn; AT5G46595.
DR   EnsemblGenomes-Gn; AT5G46845.
DR   EnsemblGenomes-Gn; AT5G48110.
DR   EnsemblGenomes-Gn; AT5G48412.
DR   EnsemblGenomes-Gn; AT5G48465.
DR   EnsemblGenomes-Gn; AT5G48675.
DR   EnsemblGenomes-Gn; AT5G48775.
DR   EnsemblGenomes-Gn; AT5G48835.
DR   EnsemblGenomes-Gn; AT5G49138.
DR   EnsemblGenomes-Gn; AT5G49152.
DR   EnsemblGenomes-Gn; AT5G49435.
DR   EnsemblGenomes-Gn; AT5G49615.
DR   EnsemblGenomes-Gn; AT5G50190.
DR   EnsemblGenomes-Gn; AT5G50717.
DR   EnsemblGenomes-Gn; AT5G50780.
DR   EnsemblGenomes-Gn; AT5G50805.
DR   EnsemblGenomes-Gn; AT5G50995.
DR   EnsemblGenomes-Gn; AT5G51055.
DR   EnsemblGenomes-Gn; AT5G51174.
DR   EnsemblGenomes-Gn; AT5G52355.
DR   EnsemblGenomes-Gn; AT5G52471.
DR   EnsemblGenomes-Gn; AT5G52495.
DR   EnsemblGenomes-Gn; AT5G52797.
DR   EnsemblGenomes-Gn; AT5G52815.
DR   EnsemblGenomes-Gn; AT5G53048.
DR   EnsemblGenomes-Gn; AT5G53487.
DR   EnsemblGenomes-Gn; AT5G53640.
DR   EnsemblGenomes-Gn; AT5G53902.
DR   EnsemblGenomes-Gn; AT5G54075.
DR   EnsemblGenomes-Gn; AT5G54365.
DR   EnsemblGenomes-Gn; AT5G54375.
DR   EnsemblGenomes-Gn; AT5G54569.
DR   EnsemblGenomes-Gn; AT5G54865.
DR   EnsemblGenomes-Gn; AT5G55045.
DR   EnsemblGenomes-Gn; AT5G55055.
DR   EnsemblGenomes-Gn; AT5G55505.
DR   EnsemblGenomes-Gn; AT5G55835.
DR   EnsemblGenomes-Gn; AT5G55855.
DR   EnsemblGenomes-Gn; AT5G56330.
DR   EnsemblGenomes-Gn; AT5G56365.
DR   EnsemblGenomes-Gn; AT5G56730.
DR   EnsemblGenomes-Gn; AT5G56745.
DR   EnsemblGenomes-Gn; AT5G56975.
DR   EnsemblGenomes-Gn; AT5G57735.
DR   EnsemblGenomes-Gn; AT5G57885.
DR   EnsemblGenomes-Gn; AT5G58465.
DR   EnsemblGenomes-Gn; AT5G58495.
DR   EnsemblGenomes-Gn; AT5G58550.
DR   EnsemblGenomes-Gn; AT5G58595.
DR   EnsemblGenomes-Gn; AT5G59055.
DR   EnsemblGenomes-Gn; AT5G59190.
DR   EnsemblGenomes-Gn; AT5G59385.
DR   EnsemblGenomes-Gn; AT5G59395.
DR   EnsemblGenomes-Gn; AT5G59505.
DR   EnsemblGenomes-Gn; AT5G59662.
DR   EnsemblGenomes-Gn; AT5G59732.
DR   EnsemblGenomes-Gn; AT5G59945.
DR   EnsemblGenomes-Gn; AT5G60022.
DR   EnsemblGenomes-Gn; AT5G60285.
DR   EnsemblGenomes-Gn; AT5G60408.
DR   EnsemblGenomes-Gn; AT5G60560.
DR   EnsemblGenomes-Gn; AT5G60900.
DR   EnsemblGenomes-Gn; AT5G60963.
DR   EnsemblGenomes-Gn; AT5G60966.
DR   EnsemblGenomes-Gn; AT5G61345.
DR   EnsemblGenomes-Gn; AT5G61445.
DR   EnsemblGenomes-Gn; AT5G61455.
DR   EnsemblGenomes-Gn; AT5G61680.
DR   EnsemblGenomes-Gn; AT5G61730.
DR   EnsemblGenomes-Gn; AT5G61835.
DR   EnsemblGenomes-Gn; AT5G62162.
DR   EnsemblGenomes-Gn; AT5G62848.
DR   EnsemblGenomes-Gn; AT5G63145.
DR   EnsemblGenomes-Gn; AT5G63195.
DR   EnsemblGenomes-Gn; AT5G63630.
DR   EnsemblGenomes-Gn; AT5G63715.
DR   EnsemblGenomes-Gn; AT5G64505.
DR   EnsemblGenomes-Gn; AT5G64572.
DR   EnsemblGenomes-Gn; AT5G64735.
DR   EnsemblGenomes-Gn; AT5G64855.
DR   EnsemblGenomes-Gn; AT5G65015.
DR   EnsemblGenomes-Gn; AT5G65305.
DR   EnsemblGenomes-Gn; AT5G65445.
DR   EnsemblGenomes-Gn; AT5G65535.
DR   EnsemblGenomes-Gn; AT5G65575.
DR   EnsemblGenomes-Gn; AT5G65615.
DR   EnsemblGenomes-Gn; AT5G66045.
DR   EnsemblGenomes-Gn; AT5G66535.
DR   EnsemblGenomes-Gn; AT5G66558.
DR   EnsemblGenomes-Gn; AT5G66562.
DR   EnsemblGenomes-Gn; AT5G66564.
DR   EnsemblGenomes-Gn; AT5G66567.
DR   EnsemblGenomes-Gn; AT5G66568.
DR   EnsemblGenomes-Gn; AT5G66755.
DR   EnsemblGenomes-Gn; AT5G66817.
DR   EnsemblGenomes-Gn; AT5G67455.
DR   EnsemblGenomes-Gn; AT5G67488.
DR   EnsemblGenomes-Gn; ENSRNA049492615.
DR   EnsemblGenomes-Gn; ENSRNA049492616.
DR   EnsemblGenomes-Gn; ENSRNA049492617.
DR   EnsemblGenomes-Gn; ENSRNA049492619.
DR   EnsemblGenomes-Gn; ENSRNA049492621.
DR   EnsemblGenomes-Gn; ENSRNA049492622.
DR   EnsemblGenomes-Gn; ENSRNA049492623.
DR   EnsemblGenomes-Gn; ENSRNA049492624.
DR   EnsemblGenomes-Gn; ENSRNA049492625.
DR   EnsemblGenomes-Gn; ENSRNA049492627.
DR   EnsemblGenomes-Gn; ENSRNA049492628.
DR   EnsemblGenomes-Gn; ENSRNA049492629.
DR   EnsemblGenomes-Gn; ENSRNA049492630.
DR   EnsemblGenomes-Gn; ENSRNA049492631.
DR   EnsemblGenomes-Gn; ENSRNA049492632.
DR   EnsemblGenomes-Gn; ENSRNA049492633.
DR   EnsemblGenomes-Gn; ENSRNA049492634.
DR   EnsemblGenomes-Gn; ENSRNA049492636.
DR   EnsemblGenomes-Gn; ENSRNA049492637.
DR   EnsemblGenomes-Gn; ENSRNA049492638.
DR   EnsemblGenomes-Gn; ENSRNA049492639.
DR   EnsemblGenomes-Gn; ENSRNA049492640.
DR   EnsemblGenomes-Gn; ENSRNA049492641.
DR   EnsemblGenomes-Gn; ENSRNA049492642.
DR   EnsemblGenomes-Gn; ENSRNA049492643.
DR   EnsemblGenomes-Gn; ENSRNA049492644.
DR   EnsemblGenomes-Gn; ENSRNA049492646.
DR   EnsemblGenomes-Gn; ENSRNA049492647.
DR   EnsemblGenomes-Gn; ENSRNA049492648.
DR   EnsemblGenomes-Gn; ENSRNA049492649.
DR   EnsemblGenomes-Gn; ENSRNA049492650.
DR   EnsemblGenomes-Gn; ENSRNA049492651.
DR   EnsemblGenomes-Gn; ENSRNA049492652.
DR   EnsemblGenomes-Gn; ENSRNA049492653.
DR   EnsemblGenomes-Gn; ENSRNA049492654.
DR   EnsemblGenomes-Gn; ENSRNA049492655.
DR   EnsemblGenomes-Gn; ENSRNA049492657.
DR   EnsemblGenomes-Gn; ENSRNA049492658.
DR   EnsemblGenomes-Gn; ENSRNA049492660.
DR   EnsemblGenomes-Gn; ENSRNA049492661.
DR   EnsemblGenomes-Gn; ENSRNA049492662.
DR   EnsemblGenomes-Gn; ENSRNA049492663.
DR   EnsemblGenomes-Gn; ENSRNA049492664.
DR   EnsemblGenomes-Gn; ENSRNA049492665.
DR   EnsemblGenomes-Gn; ENSRNA049492667.
DR   EnsemblGenomes-Gn; ENSRNA049492668.
DR   EnsemblGenomes-Gn; ENSRNA049492669.
DR   EnsemblGenomes-Gn; ENSRNA049492670.
DR   EnsemblGenomes-Gn; ENSRNA049492671.
DR   EnsemblGenomes-Gn; ENSRNA049492672.
DR   EnsemblGenomes-Gn; ENSRNA049492673.
DR   EnsemblGenomes-Gn; ENSRNA049492674.
DR   EnsemblGenomes-Gn; ENSRNA049492675.
DR   EnsemblGenomes-Gn; ENSRNA049492677.
DR   EnsemblGenomes-Gn; ENSRNA049492678.
DR   EnsemblGenomes-Gn; ENSRNA049492680.
DR   EnsemblGenomes-Gn; ENSRNA049492681.
DR   EnsemblGenomes-Gn; ENSRNA049492682.
DR   EnsemblGenomes-Gn; ENSRNA049492683.
DR   EnsemblGenomes-Gn; ENSRNA049492684.
DR   EnsemblGenomes-Gn; ENSRNA049492685.
DR   EnsemblGenomes-Gn; ENSRNA049492686.
DR   EnsemblGenomes-Gn; ENSRNA049492688.
DR   EnsemblGenomes-Gn; ENSRNA049492689.
DR   EnsemblGenomes-Gn; ENSRNA049492690.
DR   EnsemblGenomes-Gn; ENSRNA049492691.
DR   EnsemblGenomes-Gn; ENSRNA049492692.
DR   EnsemblGenomes-Gn; ENSRNA049492693.
DR   EnsemblGenomes-Gn; ENSRNA049492694.
DR   EnsemblGenomes-Gn; ENSRNA049492696.
DR   EnsemblGenomes-Gn; ENSRNA049492698.
DR   EnsemblGenomes-Gn; ENSRNA049492699.
DR   EnsemblGenomes-Gn; ENSRNA049492700.
DR   EnsemblGenomes-Gn; ENSRNA049492701.
DR   EnsemblGenomes-Gn; ENSRNA049493349.
DR   EnsemblGenomes-Gn; ENSRNA049493350.
DR   EnsemblGenomes-Gn; ENSRNA049493353.
DR   EnsemblGenomes-Gn; ENSRNA049493354.
DR   EnsemblGenomes-Gn; ENSRNA049493357.
DR   EnsemblGenomes-Gn; ENSRNA049493359.
DR   EnsemblGenomes-Gn; ENSRNA049493360.
DR   EnsemblGenomes-Gn; ENSRNA049493362.
DR   EnsemblGenomes-Gn; ENSRNA049493363.
DR   EnsemblGenomes-Gn; ENSRNA049493364.
DR   EnsemblGenomes-Gn; ENSRNA049493372.
DR   EnsemblGenomes-Gn; ENSRNA049493376.
DR   EnsemblGenomes-Gn; ENSRNA049493377.
DR   EnsemblGenomes-Gn; ENSRNA049493379.
DR   EnsemblGenomes-Gn; ENSRNA049493385.
DR   EnsemblGenomes-Gn; ENSRNA049493388.
DR   EnsemblGenomes-Gn; ENSRNA049493392.
DR   EnsemblGenomes-Gn; ENSRNA049493395.
DR   EnsemblGenomes-Gn; ENSRNA049493400.
DR   EnsemblGenomes-Gn; ENSRNA049493401.
DR   EnsemblGenomes-Gn; ENSRNA049493402.
DR   EnsemblGenomes-Gn; ENSRNA049493403.
DR   EnsemblGenomes-Gn; ENSRNA049493404.
DR   EnsemblGenomes-Gn; ENSRNA049493406.
DR   EnsemblGenomes-Gn; ENSRNA049493407.
DR   EnsemblGenomes-Gn; ENSRNA049493408.
DR   EnsemblGenomes-Gn; ENSRNA049493409.
DR   EnsemblGenomes-Gn; ENSRNA049493410.
DR   EnsemblGenomes-Gn; ENSRNA049493411.
DR   EnsemblGenomes-Gn; ENSRNA049493412.
DR   EnsemblGenomes-Gn; ENSRNA049493414.
DR   EnsemblGenomes-Gn; ENSRNA049493415.
DR   EnsemblGenomes-Gn; ENSRNA049493417.
DR   EnsemblGenomes-Gn; ENSRNA049493418.
DR   EnsemblGenomes-Gn; ENSRNA049493419.
DR   EnsemblGenomes-Gn; ENSRNA049493421.
DR   EnsemblGenomes-Gn; ENSRNA049493422.
DR   EnsemblGenomes-Gn; ENSRNA049493423.
DR   EnsemblGenomes-Gn; ENSRNA049493425.
DR   EnsemblGenomes-Gn; ENSRNA049493426.
DR   EnsemblGenomes-Gn; ENSRNA049493427.
DR   EnsemblGenomes-Gn; ENSRNA049493428.
DR   EnsemblGenomes-Gn; ENSRNA049493429.
DR   EnsemblGenomes-Gn; ENSRNA049493430.
DR   EnsemblGenomes-Gn; ENSRNA049493431.
DR   EnsemblGenomes-Gn; ENSRNA049493433.
DR   EnsemblGenomes-Gn; ENSRNA049493434.
DR   EnsemblGenomes-Gn; ENSRNA049493435.
DR   EnsemblGenomes-Gn; ENSRNA049493436.
DR   EnsemblGenomes-Gn; ENSRNA049493437.
DR   EnsemblGenomes-Gn; ENSRNA049493438.
DR   EnsemblGenomes-Gn; ENSRNA049493440.
DR   EnsemblGenomes-Gn; ENSRNA049493442.
DR   EnsemblGenomes-Gn; ENSRNA049493443.
DR   EnsemblGenomes-Gn; ENSRNA049493444.
DR   EnsemblGenomes-Gn; ENSRNA049493445.
DR   EnsemblGenomes-Gn; ENSRNA049493446.
DR   EnsemblGenomes-Gn; ENSRNA049493447.
DR   EnsemblGenomes-Gn; ENSRNA049493448.
DR   EnsemblGenomes-Gn; ENSRNA049493450.
DR   EnsemblGenomes-Gn; ENSRNA049493451.
DR   EnsemblGenomes-Gn; ENSRNA049493452.
DR   EnsemblGenomes-Gn; ENSRNA049493454.
DR   EnsemblGenomes-Gn; ENSRNA049493455.
DR   EnsemblGenomes-Gn; ENSRNA049493457.
DR   EnsemblGenomes-Gn; ENSRNA049493458.
DR   EnsemblGenomes-Gn; ENSRNA049493459.
DR   EnsemblGenomes-Gn; ENSRNA049493460.
DR   EnsemblGenomes-Gn; ENSRNA049493461.
DR   EnsemblGenomes-Gn; ENSRNA049493462.
DR   EnsemblGenomes-Gn; ENSRNA049493463.
DR   EnsemblGenomes-Gn; ENSRNA049493465.
DR   EnsemblGenomes-Gn; ENSRNA049493466.
DR   EnsemblGenomes-Gn; ENSRNA049493469.
DR   EnsemblGenomes-Gn; ENSRNA049493470.
DR   EnsemblGenomes-Gn; ENSRNA049493473.
DR   EnsemblGenomes-Gn; ENSRNA049493474.
DR   EnsemblGenomes-Gn; ENSRNA049493476.
DR   EnsemblGenomes-Gn; ENSRNA049493478.
DR   EnsemblGenomes-Gn; ENSRNA049493479.
DR   EnsemblGenomes-Gn; ENSRNA049493480.
DR   EnsemblGenomes-Gn; ENSRNA049493482.
DR   EnsemblGenomes-Gn; ENSRNA049493483.
DR   EnsemblGenomes-Gn; ENSRNA049493485.
DR   EnsemblGenomes-Gn; ENSRNA049493487.
DR   EnsemblGenomes-Gn; ENSRNA049493490.
DR   EnsemblGenomes-Gn; ENSRNA049493493.
DR   EnsemblGenomes-Gn; ENSRNA049493495.
DR   EnsemblGenomes-Gn; ENSRNA049493496.
DR   EnsemblGenomes-Gn; ENSRNA049493497.
DR   EnsemblGenomes-Gn; ENSRNA049493499.
DR   EnsemblGenomes-Gn; ENSRNA049493501.
DR   EnsemblGenomes-Gn; ENSRNA049493502.
DR   EnsemblGenomes-Gn; ENSRNA049493503.
DR   EnsemblGenomes-Gn; ENSRNA049493506.
DR   EnsemblGenomes-Gn; ENSRNA049493508.
DR   EnsemblGenomes-Gn; ENSRNA049493510.
DR   EnsemblGenomes-Gn; ENSRNA049493512.
DR   EnsemblGenomes-Gn; ENSRNA049493513.
DR   EnsemblGenomes-Gn; ENSRNA049493516.
DR   EnsemblGenomes-Gn; ENSRNA049493519.
DR   EnsemblGenomes-Gn; ENSRNA049493520.
DR   EnsemblGenomes-Gn; ENSRNA049493522.
DR   EnsemblGenomes-Gn; ENSRNA049493524.
DR   EnsemblGenomes-Gn; ENSRNA049493527.
DR   EnsemblGenomes-Gn; ENSRNA049493530.
DR   EnsemblGenomes-Gn; ENSRNA049493542.
DR   EnsemblGenomes-Gn; ENSRNA049493569.
DR   EnsemblGenomes-Gn; ENSRNA049493580.
DR   EnsemblGenomes-Gn; ENSRNA049493582.
DR   EnsemblGenomes-Gn; ENSRNA049493585.
DR   EnsemblGenomes-Gn; ENSRNA049493589.
DR   EnsemblGenomes-Gn; ENSRNA049493591.
DR   EnsemblGenomes-Gn; ENSRNA049493592.
DR   EnsemblGenomes-Gn; ENSRNA049493594.
DR   EnsemblGenomes-Gn; ENSRNA049493596.
DR   EnsemblGenomes-Gn; ENSRNA049493598.
DR   EnsemblGenomes-Gn; ENSRNA049493600.
DR   EnsemblGenomes-Gn; ENSRNA049493603.
DR   EnsemblGenomes-Gn; ENSRNA049493604.
DR   EnsemblGenomes-Gn; ENSRNA049493610.
DR   EnsemblGenomes-Gn; ENSRNA049493612.
DR   EnsemblGenomes-Gn; ENSRNA049493615.
DR   EnsemblGenomes-Gn; ENSRNA049493620.
DR   EnsemblGenomes-Gn; ENSRNA049493626.
DR   EnsemblGenomes-Gn; ENSRNA049493635.
DR   EnsemblGenomes-Gn; ENSRNA049493639.
DR   EnsemblGenomes-Gn; ENSRNA049493643.
DR   EnsemblGenomes-Gn; ENSRNA049493651.
DR   EnsemblGenomes-Gn; ENSRNA049493656.
DR   EnsemblGenomes-Gn; ENSRNA049493663.
DR   EnsemblGenomes-Gn; ENSRNA049493666.
DR   EnsemblGenomes-Gn; ENSRNA049493670.
DR   EnsemblGenomes-Gn; ENSRNA049493776.
DR   EnsemblGenomes-Gn; ENSRNA049493778.
DR   EnsemblGenomes-Gn; ENSRNA049493780.
DR   EnsemblGenomes-Gn; ENSRNA049493783.
DR   EnsemblGenomes-Gn; ENSRNA049493786.
DR   EnsemblGenomes-Gn; ENSRNA049493787.
DR   EnsemblGenomes-Gn; ENSRNA049493788.
DR   EnsemblGenomes-Gn; ENSRNA049493789.
DR   EnsemblGenomes-Gn; ENSRNA049493791.
DR   EnsemblGenomes-Gn; ENSRNA049493792.
DR   EnsemblGenomes-Gn; ENSRNA049493794.
DR   EnsemblGenomes-Gn; ENSRNA049493796.
DR   EnsemblGenomes-Gn; ENSRNA049493797.
DR   EnsemblGenomes-Gn; ENSRNA049493802.
DR   EnsemblGenomes-Gn; ENSRNA049493803.
DR   EnsemblGenomes-Gn; ENSRNA049493804.
DR   EnsemblGenomes-Gn; ENSRNA049493806.
DR   EnsemblGenomes-Gn; ENSRNA049493808.
DR   EnsemblGenomes-Gn; ENSRNA049493810.
DR   EnsemblGenomes-Gn; ENSRNA049493812.
DR   EnsemblGenomes-Gn; ENSRNA049493817.
DR   EnsemblGenomes-Gn; ENSRNA049493822.
DR   EnsemblGenomes-Gn; ENSRNA049493824.
DR   EnsemblGenomes-Gn; ENSRNA049493826.
DR   EnsemblGenomes-Gn; ENSRNA049493829.
DR   EnsemblGenomes-Gn; ENSRNA049493830.
DR   EnsemblGenomes-Tr; AT5G01175.1.
DR   EnsemblGenomes-Tr; AT5G01185.1.
DR   EnsemblGenomes-Tr; AT5G01215.1.
DR   EnsemblGenomes-Tr; AT5G01215.2.
DR   EnsemblGenomes-Tr; AT5G01335.1.
DR   EnsemblGenomes-Tr; AT5G01365.1.
DR   EnsemblGenomes-Tr; AT5G01542.1.
DR   EnsemblGenomes-Tr; AT5G01595.1.
DR   EnsemblGenomes-Tr; AT5G01690.1.
DR   EnsemblGenomes-Tr; AT5G01700.1.
DR   EnsemblGenomes-Tr; AT5G01715.1.
DR   EnsemblGenomes-Tr; AT5G01732.1.
DR   EnsemblGenomes-Tr; AT5G01747.1.
DR   EnsemblGenomes-Tr; AT5G01750.1.
DR   EnsemblGenomes-Tr; AT5G02025.1.
DR   EnsemblGenomes-Tr; AT5G02035.1.
DR   EnsemblGenomes-Tr; AT5G02080.1.
DR   EnsemblGenomes-Tr; AT5G02244.1.
DR   EnsemblGenomes-Tr; AT5G02385.1.
DR   EnsemblGenomes-Tr; AT5G02435.1.
DR   EnsemblGenomes-Tr; AT5G02505.1.
DR   EnsemblGenomes-Tr; AT5G02615.1.
DR   EnsemblGenomes-Tr; AT5G02725.1.
DR   EnsemblGenomes-Tr; AT5G02780.2.
DR   EnsemblGenomes-Tr; AT5G02815.1.
DR   EnsemblGenomes-Tr; AT5G03270.1.
DR   EnsemblGenomes-Tr; AT5G03285.1.
DR   EnsemblGenomes-Tr; AT5G03345.2.
DR   EnsemblGenomes-Tr; AT5G03377.1.
DR   EnsemblGenomes-Tr; AT5G03415.2.
DR   EnsemblGenomes-Tr; AT5G03445.1.
DR   EnsemblGenomes-Tr; AT5G03452.1.
DR   EnsemblGenomes-Tr; AT5G03520.2.
DR   EnsemblGenomes-Tr; AT5G03552.1.
DR   EnsemblGenomes-Tr; AT5G03590.1.
DR   EnsemblGenomes-Tr; AT5G03668.1.
DR   EnsemblGenomes-Tr; AT5G03705.1.
DR   EnsemblGenomes-Tr; AT5G03745.1.
DR   EnsemblGenomes-Tr; AT5G03775.1.
DR   EnsemblGenomes-Tr; AT5G03858.1.
DR   EnsemblGenomes-Tr; AT5G03950.1.
DR   EnsemblGenomes-Tr; AT5G04130.2.
DR   EnsemblGenomes-Tr; AT5G04220.1.
DR   EnsemblGenomes-Tr; AT5G04235.1.
DR   EnsemblGenomes-Tr; AT5G04275.1.
DR   EnsemblGenomes-Tr; AT5G04560.1.
DR   EnsemblGenomes-Tr; AT5G04650.1.
DR   EnsemblGenomes-Tr; AT5G04781.1.
DR   EnsemblGenomes-Tr; AT5G04880.1.
DR   EnsemblGenomes-Tr; AT5G05025.1.
DR   EnsemblGenomes-Tr; AT5G05435.1.
DR   EnsemblGenomes-Tr; AT5G05490.2.
DR   EnsemblGenomes-Tr; AT5G05540.2.
DR   EnsemblGenomes-Tr; AT5G05590.2.
DR   EnsemblGenomes-Tr; AT5G05795.1.
DR   EnsemblGenomes-Tr; AT5G05945.1.
DR   EnsemblGenomes-Tr; AT5G05980.2.
DR   EnsemblGenomes-Tr; AT5G05985.1.
DR   EnsemblGenomes-Tr; AT5G06125.1.
DR   EnsemblGenomes-Tr; AT5G06165.1.
DR   EnsemblGenomes-Tr; AT5G06250.1.
DR   EnsemblGenomes-Tr; AT5G06278.1.
DR   EnsemblGenomes-Tr; AT5G06634.1.
DR   EnsemblGenomes-Tr; AT5G06685.1.
DR   EnsemblGenomes-Tr; AT5G06710.2.
DR   EnsemblGenomes-Tr; AT5G06805.1.
DR   EnsemblGenomes-Tr; AT5G06865.1.
DR   EnsemblGenomes-Tr; AT5G06865.2.
DR   EnsemblGenomes-Tr; AT5G07135.1.
DR   EnsemblGenomes-Tr; AT5G07152.1.
DR   EnsemblGenomes-Tr; AT5G07215.1.
DR   EnsemblGenomes-Tr; AT5G07315.1.
DR   EnsemblGenomes-Tr; AT5G07322.1.
DR   EnsemblGenomes-Tr; AT5G07505.1.
DR   EnsemblGenomes-Tr; AT5G07530.2.
DR   EnsemblGenomes-Tr; AT5G07625.1.
DR   EnsemblGenomes-Tr; AT5G07675.1.
DR   EnsemblGenomes-Tr; AT5G07685.1.
DR   EnsemblGenomes-Tr; AT5G08075.1.
DR   EnsemblGenomes-Tr; AT5G08210.1.
DR   EnsemblGenomes-Tr; AT5G08712.1.
DR   EnsemblGenomes-Tr; AT5G08717.1.
DR   EnsemblGenomes-Tr; AT5G09230.5.
DR   EnsemblGenomes-Tr; AT5G09345.1.
DR   EnsemblGenomes-Tr; AT5G09410.1.
DR   EnsemblGenomes-Tr; AT5G09443.1.
DR   EnsemblGenomes-Tr; AT5G09462.1.
DR   EnsemblGenomes-Tr; AT5G09513.1.
DR   EnsemblGenomes-Tr; AT5G09585.1.
DR   EnsemblGenomes-Tr; AT5G09655.1.
DR   EnsemblGenomes-Tr; AT5G09690.3.
DR   EnsemblGenomes-Tr; AT5G09690.4.
DR   EnsemblGenomes-Tr; AT5G09710.1.
DR   EnsemblGenomes-Tr; AT5G09755.1.
DR   EnsemblGenomes-Tr; AT5G09795.1.
DR   EnsemblGenomes-Tr; AT5G09975.1.
DR   EnsemblGenomes-Tr; AT5G10020.2.
DR   EnsemblGenomes-Tr; AT5G10235.1.
DR   EnsemblGenomes-Tr; AT5G10278.1.
DR   EnsemblGenomes-Tr; AT5G10278.2.
DR   EnsemblGenomes-Tr; AT5G10455.1.
DR   EnsemblGenomes-Tr; AT5G10470.2.
DR   EnsemblGenomes-Tr; AT5G10480.2.
DR   EnsemblGenomes-Tr; AT5G10525.1.
DR   EnsemblGenomes-Tr; AT5G10572.1.
DR   EnsemblGenomes-Tr; AT5G10670.1.
DR   EnsemblGenomes-Tr; AT5G10850.1.
DR   EnsemblGenomes-Tr; AT5G10945.1.
DR   EnsemblGenomes-Tr; AT5G11010.1.
DR   EnsemblGenomes-Tr; AT5G11030.1.
DR   EnsemblGenomes-Tr; AT5G11180.1.
DR   EnsemblGenomes-Tr; AT5G11225.1.
DR   EnsemblGenomes-Tr; AT5G11242.1.
DR   EnsemblGenomes-Tr; AT5G11320.2.
DR   EnsemblGenomes-Tr; AT5G11325.1.
DR   EnsemblGenomes-Tr; AT5G11400.2.
DR   EnsemblGenomes-Tr; AT5G11475.1.
DR   EnsemblGenomes-Tr; AT5G11977.1.
DR   EnsemblGenomes-Tr; AT5G12085.1.
DR   EnsemblGenomes-Tr; AT5G13205.1.
DR   EnsemblGenomes-Tr; AT5G13220.2.
DR   EnsemblGenomes-Tr; AT5G13220.3.
DR   EnsemblGenomes-Tr; AT5G13225.1.
DR   EnsemblGenomes-Tr; AT5G13290.1.
DR   EnsemblGenomes-Tr; AT5G13290.3.
DR   EnsemblGenomes-Tr; AT5G13475.1.
DR   EnsemblGenomes-Tr; AT5G13485.1.
DR   EnsemblGenomes-Tr; AT5G13548.1.
DR   EnsemblGenomes-Tr; AT5G13570.2.
DR   EnsemblGenomes-Tr; AT5G13655.1.
DR   EnsemblGenomes-Tr; AT5G13750.2.
DR   EnsemblGenomes-Tr; AT5G13750.3.
DR   EnsemblGenomes-Tr; AT5G13845.1.
DR   EnsemblGenomes-Tr; AT5G13887.1.
DR   EnsemblGenomes-Tr; AT5G14035.1.
DR   EnsemblGenomes-Tr; AT5G14220.2.
DR   EnsemblGenomes-Tr; AT5G14495.1.
DR   EnsemblGenomes-Tr; AT5G14545.1.
DR   EnsemblGenomes-Tr; AT5G14565.1.
DR   EnsemblGenomes-Tr; AT5G14810.1.
DR   EnsemblGenomes-Tr; AT5G14830.1.
DR   EnsemblGenomes-Tr; AT5G14840.1.
DR   EnsemblGenomes-Tr; AT5G14930.1.
DR   EnsemblGenomes-Tr; AT5G15022.1.
DR   EnsemblGenomes-Tr; AT5G15175.1.
DR   EnsemblGenomes-Tr; AT5G15546.1.
DR   EnsemblGenomes-Tr; AT5G15730.1.
DR   EnsemblGenomes-Tr; AT5G15805.1.
DR   EnsemblGenomes-Tr; AT5G15815.1.
DR   EnsemblGenomes-Tr; AT5G15833.1.
DR   EnsemblGenomes-Tr; AT5G15840.2.
DR   EnsemblGenomes-Tr; AT5G15845.1.
DR   EnsemblGenomes-Tr; AT5G15860.2.
DR   EnsemblGenomes-Tr; AT5G15990.1.
DR   EnsemblGenomes-Tr; AT5G15995.1.
DR   EnsemblGenomes-Tr; AT5G16235.1.
DR   EnsemblGenomes-Tr; AT5G16336.1.
DR   EnsemblGenomes-Tr; AT5G16375.1.
DR   EnsemblGenomes-Tr; AT5G16505.1.
DR   EnsemblGenomes-Tr; AT5G16505.2.
DR   EnsemblGenomes-Tr; AT5G16540.2.
DR   EnsemblGenomes-Tr; AT5G16540.3.
DR   EnsemblGenomes-Tr; AT5G17125.1.
DR   EnsemblGenomes-Tr; AT5G17725.1.
DR   EnsemblGenomes-Tr; AT5G18005.1.
DR   EnsemblGenomes-Tr; AT5G18015.1.
DR   EnsemblGenomes-Tr; AT5G18085.1.
DR   EnsemblGenomes-Tr; AT5G18100.2.
DR   EnsemblGenomes-Tr; AT5G18202.1.
DR   EnsemblGenomes-Tr; AT5G18245.1.
DR   EnsemblGenomes-Tr; AT5G18255.1.
DR   EnsemblGenomes-Tr; AT5G18255.2.
DR   EnsemblGenomes-Tr; AT5G18255.3.
DR   EnsemblGenomes-Tr; AT5G18400.1.
DR   EnsemblGenomes-Tr; AT5G18410.1.
DR   EnsemblGenomes-Tr; AT5G18633.1.
DR   EnsemblGenomes-Tr; AT5G18755.1.
DR   EnsemblGenomes-Tr; AT5G18830.2.
DR   EnsemblGenomes-Tr; AT5G19000.2.
DR   EnsemblGenomes-Tr; AT5G19015.1.
DR   EnsemblGenomes-Tr; AT5G19095.1.
DR   EnsemblGenomes-Tr; AT5G19097.1.
DR   EnsemblGenomes-Tr; AT5G19165.1.
DR   EnsemblGenomes-Tr; AT5G19221.1.
DR   EnsemblGenomes-Tr; AT5G19390.4.
DR   EnsemblGenomes-Tr; AT5G19530.2.
DR   EnsemblGenomes-Tr; AT5G19910.2.
DR   EnsemblGenomes-Tr; AT5G20040.2.
DR   EnsemblGenomes-Tr; AT5G20225.1.
DR   EnsemblGenomes-Tr; AT5G20750.1.
DR   EnsemblGenomes-Tr; AT5G20760.1.
DR   EnsemblGenomes-Tr; AT5G20770.1.
DR   EnsemblGenomes-Tr; AT5G20780.1.
DR   EnsemblGenomes-Tr; AT5G20800.1.
DR   EnsemblGenomes-Tr; AT5G20852.1.
DR   EnsemblGenomes-Tr; AT5G20854.1.
DR   EnsemblGenomes-Tr; AT5G20856.1.
DR   EnsemblGenomes-Tr; AT5G20858.1.
DR   EnsemblGenomes-Tr; AT5G20880.1.
DR   EnsemblGenomes-Tr; AT5G21378.1.
DR   EnsemblGenomes-Tr; AT5G21535.1.
DR   EnsemblGenomes-Tr; AT5G22000.2.
DR   EnsemblGenomes-Tr; AT5G22030.1.
DR   EnsemblGenomes-Tr; AT5G22030.2.
DR   EnsemblGenomes-Tr; AT5G22044.1.
DR   EnsemblGenomes-Tr; AT5G22220.3.
DR   EnsemblGenomes-Tr; AT5G22315.1.
DR   EnsemblGenomes-Tr; AT5G22610.1.
DR   EnsemblGenomes-Tr; AT5G22650.2.
DR   EnsemblGenomes-Tr; AT5G22660.1.
DR   EnsemblGenomes-Tr; AT5G22720.1.
DR   EnsemblGenomes-Tr; AT5G22720.2.
DR   EnsemblGenomes-Tr; AT5G22788.1.
DR   EnsemblGenomes-Tr; AT5G22792.1.
DR   EnsemblGenomes-Tr; AT5G23065.1.
DR   EnsemblGenomes-Tr; AT5G23155.1.
DR   EnsemblGenomes-Tr; AT5G23210.4.
DR   EnsemblGenomes-Tr; AT5G23235.1.
DR   EnsemblGenomes-Tr; AT5G23405.2.
DR   EnsemblGenomes-Tr; AT5G23410.1.
DR   EnsemblGenomes-Tr; AT5G23413.1.
DR   EnsemblGenomes-Tr; AT5G23430.2.
DR   EnsemblGenomes-Tr; AT5G23665.1.
DR   EnsemblGenomes-Tr; AT5G23810.2.
DR   EnsemblGenomes-Tr; AT5G23955.1.
DR   EnsemblGenomes-Tr; AT5G23960.2.
DR   EnsemblGenomes-Tr; AT5G23990.1.
DR   EnsemblGenomes-Tr; AT5G24065.1.
DR   EnsemblGenomes-Tr; AT5G24205.1.
DR   EnsemblGenomes-Tr; AT5G24206.1.
DR   EnsemblGenomes-Tr; AT5G24557.1.
DR   EnsemblGenomes-Tr; AT5G24735.1.
DR   EnsemblGenomes-Tr; AT5G24760.2.
DR   EnsemblGenomes-Tr; AT5G24760.3.
DR   EnsemblGenomes-Tr; AT5G24775.1.
DR   EnsemblGenomes-Tr; AT5G24825.1.
DR   EnsemblGenomes-Tr; AT5G24915.1.
DR   EnsemblGenomes-Tr; AT5G25040.2.
DR   EnsemblGenomes-Tr; AT5G25045.1.
DR   EnsemblGenomes-Tr; AT5G25205.1.
DR   EnsemblGenomes-Tr; AT5G25305.1.
DR   EnsemblGenomes-Tr; AT5G25390.1.
DR   EnsemblGenomes-Tr; AT5G25451.1.
DR   EnsemblGenomes-Tr; AT5G25585.1.
DR   EnsemblGenomes-Tr; AT5G25615.1.
DR   EnsemblGenomes-Tr; AT5G25625.1.
DR   EnsemblGenomes-Tr; AT5G25955.1.
DR   EnsemblGenomes-Tr; AT5G25980.1.
DR   EnsemblGenomes-Tr; AT5G25980.3.
DR   EnsemblGenomes-Tr; AT5G26000.2.
DR   EnsemblGenomes-Tr; AT5G26015.1.
DR   EnsemblGenomes-Tr; AT5G26020.1.
DR   EnsemblGenomes-Tr; AT5G26038.1.
DR   EnsemblGenomes-Tr; AT5G26040.1.
DR   EnsemblGenomes-Tr; AT5G26146.1.
DR   EnsemblGenomes-Tr; AT5G26147.1.
DR   EnsemblGenomes-Tr; AT5G26233.1.
DR   EnsemblGenomes-Tr; AT5G26236.1.
DR   EnsemblGenomes-Tr; AT5G26283.1.
DR   EnsemblGenomes-Tr; AT5G26286.1.
DR   EnsemblGenomes-Tr; AT5G26345.1.
DR   EnsemblGenomes-Tr; AT5G26350.1.
DR   EnsemblGenomes-Tr; AT5G26582.1.
DR   EnsemblGenomes-Tr; AT5G26590.1.
DR   EnsemblGenomes-Tr; AT5G26618.1.
DR   EnsemblGenomes-Tr; AT5G26642.1.
DR   EnsemblGenomes-Tr; AT5G26742.1.
DR   EnsemblGenomes-Tr; AT5G26760.1.
DR   EnsemblGenomes-Tr; AT5G26775.1.
DR   EnsemblGenomes-Tr; AT5G26780.2.
DR   EnsemblGenomes-Tr; AT5G26780.3.
DR   EnsemblGenomes-Tr; AT5G27035.1.
DR   EnsemblGenomes-Tr; AT5G27037.1.
DR   EnsemblGenomes-Tr; AT5G27043.1.
DR   EnsemblGenomes-Tr; AT5G27095.1.
DR   EnsemblGenomes-Tr; AT5G27160.1.
DR   EnsemblGenomes-Tr; AT5G27180.1.
DR   EnsemblGenomes-Tr; AT5G27190.1.
DR   EnsemblGenomes-Tr; AT5G27250.1.
DR   EnsemblGenomes-Tr; AT5G27345.1.
DR   EnsemblGenomes-Tr; AT5G27480.1.
DR   EnsemblGenomes-Tr; AT5G27500.1.
DR   EnsemblGenomes-Tr; AT5G27505.1.
DR   EnsemblGenomes-Tr; AT5G27590.1.
DR   EnsemblGenomes-Tr; AT5G27603.1.
DR   EnsemblGenomes-Tr; AT5G27705.1.
DR   EnsemblGenomes-Tr; AT5G27715.1.
DR   EnsemblGenomes-Tr; AT5G27771.1.
DR   EnsemblGenomes-Tr; AT5G27807.1.
DR   EnsemblGenomes-Tr; AT5G27840.1.
DR   EnsemblGenomes-Tr; AT5G27845.1.
DR   EnsemblGenomes-Tr; AT5G27882.1.
DR   EnsemblGenomes-Tr; AT5G27885.1.
DR   EnsemblGenomes-Tr; AT5G27895.1.
DR   EnsemblGenomes-Tr; AT5G27900.1.
DR   EnsemblGenomes-Tr; AT5G27902.1.
DR   EnsemblGenomes-Tr; AT5G27905.1.
DR   EnsemblGenomes-Tr; AT5G27925.1.
DR   EnsemblGenomes-Tr; AT5G27927.1.
DR   EnsemblGenomes-Tr; AT5G27947.1.
DR   EnsemblGenomes-Tr; AT5G27965.1.
DR   EnsemblGenomes-Tr; AT5G28053.1.
DR   EnsemblGenomes-Tr; AT5G28056.1.
DR   EnsemblGenomes-Tr; AT5G28065.1.
DR   EnsemblGenomes-Tr; AT5G28067.1.
DR   EnsemblGenomes-Tr; AT5G28073.1.
DR   EnsemblGenomes-Tr; AT5G28076.1.
DR   EnsemblGenomes-Tr; AT5G28085.1.
DR   EnsemblGenomes-Tr; AT5G28100.1.
DR   EnsemblGenomes-Tr; AT5G28110.1.
DR   EnsemblGenomes-Tr; AT5G28120.1.
DR   EnsemblGenomes-Tr; AT5G28130.1.
DR   EnsemblGenomes-Tr; AT5G28140.1.
DR   EnsemblGenomes-Tr; AT5G28141.1.
DR   EnsemblGenomes-Tr; AT5G28143.1.
DR   EnsemblGenomes-Tr; AT5G28145.1.
DR   EnsemblGenomes-Tr; AT5G28165.1.
DR   EnsemblGenomes-Tr; AT5G28170.1.
DR   EnsemblGenomes-Tr; AT5G28173.1.
DR   EnsemblGenomes-Tr; AT5G28176.1.
DR   EnsemblGenomes-Tr; AT5G28200.1.
DR   EnsemblGenomes-Tr; AT5G28225.1.
DR   EnsemblGenomes-Tr; AT5G28230.1.
DR   EnsemblGenomes-Tr; AT5G28232.1.
DR   EnsemblGenomes-Tr; AT5G28240.1.
DR   EnsemblGenomes-Tr; AT5G28250.1.
DR   EnsemblGenomes-Tr; AT5G28253.1.
DR   EnsemblGenomes-Tr; AT5G28260.1.
DR   EnsemblGenomes-Tr; AT5G28262.1.
DR   EnsemblGenomes-Tr; AT5G28263.1.
DR   EnsemblGenomes-Tr; AT5G28266.1.
DR   EnsemblGenomes-Tr; AT5G28270.1.
DR   EnsemblGenomes-Tr; AT5G28280.1.
DR   EnsemblGenomes-Tr; AT5G28285.1.
DR   EnsemblGenomes-Tr; AT5G28287.1.
DR   EnsemblGenomes-Tr; AT5G28330.1.
DR   EnsemblGenomes-Tr; AT5G28335.1.
DR   EnsemblGenomes-Tr; AT5G28360.1.
DR   EnsemblGenomes-Tr; AT5G28405.1.
DR   EnsemblGenomes-Tr; AT5G28415.1.
DR   EnsemblGenomes-Tr; AT5G28430.1.
DR   EnsemblGenomes-Tr; AT5G28440.1.
DR   EnsemblGenomes-Tr; AT5G28464.1.
DR   EnsemblGenomes-Tr; AT5G28466.1.
DR   EnsemblGenomes-Tr; AT5G28468.1.
DR   EnsemblGenomes-Tr; AT5G28469.1.
DR   EnsemblGenomes-Tr; AT5G28480.1.
DR   EnsemblGenomes-Tr; AT5G28482.1.
DR   EnsemblGenomes-Tr; AT5G28484.1.
DR   EnsemblGenomes-Tr; AT5G28487.1.
DR   EnsemblGenomes-Tr; AT5G28495.1.
DR   EnsemblGenomes-Tr; AT5G28497.1.
DR   EnsemblGenomes-Tr; AT5G28515.1.
DR   EnsemblGenomes-Tr; AT5G28523.1.
DR   EnsemblGenomes-Tr; AT5G28524.1.
DR   EnsemblGenomes-Tr; AT5G28525.1.
DR   EnsemblGenomes-Tr; AT5G28526.1.
DR   EnsemblGenomes-Tr; AT5G28527.1.
DR   EnsemblGenomes-Tr; AT5G28535.1.
DR   EnsemblGenomes-Tr; AT5G28545.1.
DR   EnsemblGenomes-Tr; AT5G28570.1.
DR   EnsemblGenomes-Tr; AT5G28580.2.
DR   EnsemblGenomes-Tr; AT5G28593.1.
DR   EnsemblGenomes-Tr; AT5G28596.1.
DR   EnsemblGenomes-Tr; AT5G28600.1.
DR   EnsemblGenomes-Tr; AT5G28605.1.
DR   EnsemblGenomes-Tr; AT5G28622.1.
DR   EnsemblGenomes-Tr; AT5G28623.1.
DR   EnsemblGenomes-Tr; AT5G28624.1.
DR   EnsemblGenomes-Tr; AT5G28625.1.
DR   EnsemblGenomes-Tr; AT5G28626.1.
DR   EnsemblGenomes-Tr; AT5G28627.1.
DR   EnsemblGenomes-Tr; AT5G28635.1.
DR   EnsemblGenomes-Tr; AT5G28637.1.
DR   EnsemblGenomes-Tr; AT5G28641.1.
DR   EnsemblGenomes-Tr; AT5G28643.1.
DR   EnsemblGenomes-Tr; AT5G28644.1.
DR   EnsemblGenomes-Tr; AT5G28655.1.
DR   EnsemblGenomes-Tr; AT5G28662.1.
DR   EnsemblGenomes-Tr; AT5G28664.1.
DR   EnsemblGenomes-Tr; AT5G28667.1.
DR   EnsemblGenomes-Tr; AT5G28670.1.
DR   EnsemblGenomes-Tr; AT5G28671.1.
DR   EnsemblGenomes-Tr; AT5G28672.1.
DR   EnsemblGenomes-Tr; AT5G28673.1.
DR   EnsemblGenomes-Tr; AT5G28675.1.
DR   EnsemblGenomes-Tr; AT5G28692.1.
DR   EnsemblGenomes-Tr; AT5G28696.1.
DR   EnsemblGenomes-Tr; AT5G28698.1.
DR   EnsemblGenomes-Tr; AT5G28700.1.
DR   EnsemblGenomes-Tr; AT5G28710.1.
DR   EnsemblGenomes-Tr; AT5G28712.1.
DR   EnsemblGenomes-Tr; AT5G28715.1.
DR   EnsemblGenomes-Tr; AT5G28760.1.
DR   EnsemblGenomes-Tr; AT5G28765.1.
DR   EnsemblGenomes-Tr; AT5G28770.1.
DR   EnsemblGenomes-Tr; AT5G28770.3.
DR   EnsemblGenomes-Tr; AT5G28773.1.
DR   EnsemblGenomes-Tr; AT5G28776.1.
DR   EnsemblGenomes-Tr; AT5G28785.1.
DR   EnsemblGenomes-Tr; AT5G28790.1.
DR   EnsemblGenomes-Tr; AT5G28824.1.
DR   EnsemblGenomes-Tr; AT5G28826.1.
DR   EnsemblGenomes-Tr; AT5G28845.1.
DR   EnsemblGenomes-Tr; AT5G28850.1.
DR   EnsemblGenomes-Tr; AT5G28860.1.
DR   EnsemblGenomes-Tr; AT5G28865.1.
DR   EnsemblGenomes-Tr; AT5G28870.1.
DR   EnsemblGenomes-Tr; AT5G28880.1.
DR   EnsemblGenomes-Tr; AT5G28886.1.
DR   EnsemblGenomes-Tr; AT5G28888.1.
DR   EnsemblGenomes-Tr; AT5G28890.1.
DR   EnsemblGenomes-Tr; AT5G28892.1.
DR   EnsemblGenomes-Tr; AT5G28894.2.
DR   EnsemblGenomes-Tr; AT5G28897.1.
DR   EnsemblGenomes-Tr; AT5G28913.1.
DR   EnsemblGenomes-Tr; AT5G28916.1.
DR   EnsemblGenomes-Tr; AT5G28917.1.
DR   EnsemblGenomes-Tr; AT5G28923.1.
DR   EnsemblGenomes-Tr; AT5G28926.1.
DR   EnsemblGenomes-Tr; AT5G28927.1.
DR   EnsemblGenomes-Tr; AT5G28928.1.
DR   EnsemblGenomes-Tr; AT5G28929.1.
DR   EnsemblGenomes-Tr; AT5G28930.1.
DR   EnsemblGenomes-Tr; AT5G28935.1.
DR   EnsemblGenomes-Tr; AT5G28937.1.
DR   EnsemblGenomes-Tr; AT5G28940.1.
DR   EnsemblGenomes-Tr; AT5G28970.1.
DR   EnsemblGenomes-Tr; AT5G28980.1.
DR   EnsemblGenomes-Tr; AT5G28990.1.
DR   EnsemblGenomes-Tr; AT5G28993.1.
DR   EnsemblGenomes-Tr; AT5G28996.1.
DR   EnsemblGenomes-Tr; AT5G29000.1.
DR   EnsemblGenomes-Tr; AT5G29000.3.
DR   EnsemblGenomes-Tr; AT5G29000.4.
DR   EnsemblGenomes-Tr; AT5G29015.1.
DR   EnsemblGenomes-Tr; AT5G29020.1.
DR   EnsemblGenomes-Tr; AT5G29022.1.
DR   EnsemblGenomes-Tr; AT5G29024.1.
DR   EnsemblGenomes-Tr; AT5G29026.1.
DR   EnsemblGenomes-Tr; AT5G29028.1.
DR   EnsemblGenomes-Tr; AT5G29029.1.
DR   EnsemblGenomes-Tr; AT5G29030.1.
DR   EnsemblGenomes-Tr; AT5G29031.1.
DR   EnsemblGenomes-Tr; AT5G29032.1.
DR   EnsemblGenomes-Tr; AT5G29033.1.
DR   EnsemblGenomes-Tr; AT5G29034.1.
DR   EnsemblGenomes-Tr; AT5G29035.1.
DR   EnsemblGenomes-Tr; AT5G29036.1.
DR   EnsemblGenomes-Tr; AT5G29037.1.
DR   EnsemblGenomes-Tr; AT5G29040.1.
DR   EnsemblGenomes-Tr; AT5G29041.1.
DR   EnsemblGenomes-Tr; AT5G29043.1.
DR   EnsemblGenomes-Tr; AT5G29046.1.
DR   EnsemblGenomes-Tr; AT5G29053.1.
DR   EnsemblGenomes-Tr; AT5G29056.1.
DR   EnsemblGenomes-Tr; AT5G29058.1.
DR   EnsemblGenomes-Tr; AT5G29060.2.
DR   EnsemblGenomes-Tr; AT5G29075.1.
DR   EnsemblGenomes-Tr; AT5G29090.1.
DR   EnsemblGenomes-Tr; AT5G29100.1.
DR   EnsemblGenomes-Tr; AT5G29295.1.
DR   EnsemblGenomes-Tr; AT5G29337.1.
DR   EnsemblGenomes-Tr; AT5G29380.1.
DR   EnsemblGenomes-Tr; AT5G29408.1.
DR   EnsemblGenomes-Tr; AT5G29436.1.
DR   EnsemblGenomes-Tr; AT5G29465.1.
DR   EnsemblGenomes-Tr; AT5G29550.1.
DR   EnsemblGenomes-Tr; AT5G29562.1.
DR   EnsemblGenomes-Tr; AT5G29565.1.
DR   EnsemblGenomes-Tr; AT5G29568.1.
DR   EnsemblGenomes-Tr; AT5G29571.1.
DR   EnsemblGenomes-Tr; AT5G29574.1.
DR   EnsemblGenomes-Tr; AT5G29577.1.
DR   EnsemblGenomes-Tr; AT5G29580.1.
DR   EnsemblGenomes-Tr; AT5G29591.1.
DR   EnsemblGenomes-Tr; AT5G29602.1.
DR   EnsemblGenomes-Tr; AT5G29629.1.
DR   EnsemblGenomes-Tr; AT5G29635.1.
DR   EnsemblGenomes-Tr; AT5G29646.1.
DR   EnsemblGenomes-Tr; AT5G29708.1.
DR   EnsemblGenomes-Tr; AT5G29720.1.
DR   EnsemblGenomes-Tr; AT5G29762.1.
DR   EnsemblGenomes-Tr; AT5G29805.1.
DR   EnsemblGenomes-Tr; AT5G29890.2.
DR   EnsemblGenomes-Tr; AT5G29975.1.
DR   EnsemblGenomes-Tr; AT5G30060.1.
DR   EnsemblGenomes-Tr; AT5G30102.1.
DR   EnsemblGenomes-Tr; AT5G30123.1.
DR   EnsemblGenomes-Tr; AT5G30189.1.
DR   EnsemblGenomes-Tr; AT5G30207.1.
DR   EnsemblGenomes-Tr; AT5G30218.1.
DR   EnsemblGenomes-Tr; AT5G30247.1.
DR   EnsemblGenomes-Tr; AT5G30269.1.
DR   EnsemblGenomes-Tr; AT5G30276.1.
DR   EnsemblGenomes-Tr; AT5G30380.1.
DR   EnsemblGenomes-Tr; AT5G30390.1.
DR   EnsemblGenomes-Tr; AT5G30400.1.
DR   EnsemblGenomes-Tr; AT5G30406.1.
DR   EnsemblGenomes-Tr; AT5G30410.1.
DR   EnsemblGenomes-Tr; AT5G30420.1.
DR   EnsemblGenomes-Tr; AT5G30428.1.
DR   EnsemblGenomes-Tr; AT5G30440.1.
DR   EnsemblGenomes-Tr; AT5G30450.1.
DR   EnsemblGenomes-Tr; AT5G30460.1.
DR   EnsemblGenomes-Tr; AT5G30470.1.
DR   EnsemblGenomes-Tr; AT5G30480.1.
DR   EnsemblGenomes-Tr; AT5G30532.1.
DR   EnsemblGenomes-Tr; AT5G30545.1.
DR   EnsemblGenomes-Tr; AT5G30584.1.
DR   EnsemblGenomes-Tr; AT5G30628.1.
DR   EnsemblGenomes-Tr; AT5G30648.1.
DR   EnsemblGenomes-Tr; AT5G30673.1.
DR   EnsemblGenomes-Tr; AT5G30721.1.
DR   EnsemblGenomes-Tr; AT5G30762.1.
DR   EnsemblGenomes-Tr; AT5G30852.1.
DR   EnsemblGenomes-Tr; AT5G30870.1.
DR   EnsemblGenomes-Tr; AT5G30942.1.
DR   EnsemblGenomes-Tr; AT5G31032.1.
DR   EnsemblGenomes-Tr; AT5G31087.1.
DR   EnsemblGenomes-Tr; AT5G31092.1.
DR   EnsemblGenomes-Tr; AT5G31122.1.
DR   EnsemblGenomes-Tr; AT5G31212.1.
DR   EnsemblGenomes-Tr; AT5G31302.1.
DR   EnsemblGenomes-Tr; AT5G31314.1.
DR   EnsemblGenomes-Tr; AT5G31355.1.
DR   EnsemblGenomes-Tr; AT5G31496.1.
DR   EnsemblGenomes-Tr; AT5G31511.1.
DR   EnsemblGenomes-Tr; AT5G31536.1.
DR   EnsemblGenomes-Tr; AT5G31572.1.
DR   EnsemblGenomes-Tr; AT5G31637.1.
DR   EnsemblGenomes-Tr; AT5G31651.1.
DR   EnsemblGenomes-Tr; AT5G31662.1.
DR   EnsemblGenomes-Tr; AT5G31668.1.
DR   EnsemblGenomes-Tr; AT5G31685.1.
DR   EnsemblGenomes-Tr; AT5G31702.1.
DR   EnsemblGenomes-Tr; AT5G31719.1.
DR   EnsemblGenomes-Tr; AT5G31736.1.
DR   EnsemblGenomes-Tr; AT5G31752.1.
DR   EnsemblGenomes-Tr; AT5G31753.1.
DR   EnsemblGenomes-Tr; AT5G31758.1.
DR   EnsemblGenomes-Tr; AT5G31770.1.
DR   EnsemblGenomes-Tr; AT5G31778.1.
DR   EnsemblGenomes-Tr; AT5G31787.1.
DR   EnsemblGenomes-Tr; AT5G31804.1.
DR   EnsemblGenomes-Tr; AT5G31807.1.
DR   EnsemblGenomes-Tr; AT5G31821.1.
DR   EnsemblGenomes-Tr; AT5G31838.1.
DR   EnsemblGenomes-Tr; AT5G31842.1.
DR   EnsemblGenomes-Tr; AT5G31845.1.
DR   EnsemblGenomes-Tr; AT5G31855.1.
DR   EnsemblGenomes-Tr; AT5G31873.1.
DR   EnsemblGenomes-Tr; AT5G31884.1.
DR   EnsemblGenomes-Tr; AT5G31891.1.
DR   EnsemblGenomes-Tr; AT5G31905.1.
DR   EnsemblGenomes-Tr; AT5G31909.1.
DR   EnsemblGenomes-Tr; AT5G31919.1.
DR   EnsemblGenomes-Tr; AT5G31923.1.
DR   EnsemblGenomes-Tr; AT5G31927.1.
DR   EnsemblGenomes-Tr; AT5G31932.1.
DR   EnsemblGenomes-Tr; AT5G31945.1.
DR   EnsemblGenomes-Tr; AT5G31962.1.
DR   EnsemblGenomes-Tr; AT5G31963.1.
DR   EnsemblGenomes-Tr; AT5G31980.1.
DR   EnsemblGenomes-Tr; AT5G31981.1.
DR   EnsemblGenomes-Tr; AT5G31989.1.
DR   EnsemblGenomes-Tr; AT5G31999.1.
DR   EnsemblGenomes-Tr; AT5G32002.1.
DR   EnsemblGenomes-Tr; AT5G32017.1.
DR   EnsemblGenomes-Tr; AT5G32022.1.
DR   EnsemblGenomes-Tr; AT5G32035.1.
DR   EnsemblGenomes-Tr; AT5G32037.1.
DR   EnsemblGenomes-Tr; AT5G32042.1.
DR   EnsemblGenomes-Tr; AT5G32053.1.
DR   EnsemblGenomes-Tr; AT5G32060.1.
DR   EnsemblGenomes-Tr; AT5G32070.1.
DR   EnsemblGenomes-Tr; AT5G32071.1.
DR   EnsemblGenomes-Tr; AT5G32072.1.
DR   EnsemblGenomes-Tr; AT5G32082.1.
DR   EnsemblGenomes-Tr; AT5G32089.1.
DR   EnsemblGenomes-Tr; AT5G32103.1.
DR   EnsemblGenomes-Tr; AT5G32107.1.
DR   EnsemblGenomes-Tr; AT5G32112.1.
DR   EnsemblGenomes-Tr; AT5G32122.1.
DR   EnsemblGenomes-Tr; AT5G32125.1.
DR   EnsemblGenomes-Tr; AT5G32136.1.
DR   EnsemblGenomes-Tr; AT5G32143.1.
DR   EnsemblGenomes-Tr; AT5G32161.1.
DR   EnsemblGenomes-Tr; AT5G32162.1.
DR   EnsemblGenomes-Tr; AT5G32169.1.
DR   EnsemblGenomes-Tr; AT5G32179.1.
DR   EnsemblGenomes-Tr; AT5G32197.1.
DR   EnsemblGenomes-Tr; AT5G32215.1.
DR   EnsemblGenomes-Tr; AT5G32228.1.
DR   EnsemblGenomes-Tr; AT5G32241.1.
DR   EnsemblGenomes-Tr; AT5G32254.1.
DR   EnsemblGenomes-Tr; AT5G32267.1.
DR   EnsemblGenomes-Tr; AT5G32280.1.
DR   EnsemblGenomes-Tr; AT5G32293.1.
DR   EnsemblGenomes-Tr; AT5G32306.1.
DR   EnsemblGenomes-Tr; AT5G32312.1.
DR   EnsemblGenomes-Tr; AT5G32345.1.
DR   EnsemblGenomes-Tr; AT5G32358.1.
DR   EnsemblGenomes-Tr; AT5G32386.1.
DR   EnsemblGenomes-Tr; AT5G32400.2.
DR   EnsemblGenomes-Tr; AT5G32402.1.
DR   EnsemblGenomes-Tr; AT5G32404.1.
DR   EnsemblGenomes-Tr; AT5G32405.1.
DR   EnsemblGenomes-Tr; AT5G32406.1.
DR   EnsemblGenomes-Tr; AT5G32408.1.
DR   EnsemblGenomes-Tr; AT5G32410.2.
DR   EnsemblGenomes-Tr; AT5G32420.2.
DR   EnsemblGenomes-Tr; AT5G32423.1.
DR   EnsemblGenomes-Tr; AT5G32426.1.
DR   EnsemblGenomes-Tr; AT5G32430.2.
DR   EnsemblGenomes-Tr; AT5G32431.1.
DR   EnsemblGenomes-Tr; AT5G32433.1.
DR   EnsemblGenomes-Tr; AT5G32434.1.
DR   EnsemblGenomes-Tr; AT5G32436.1.
DR   EnsemblGenomes-Tr; AT5G32471.1.
DR   EnsemblGenomes-Tr; AT5G32473.1.
DR   EnsemblGenomes-Tr; AT5G32475.1.
DR   EnsemblGenomes-Tr; AT5G32481.1.
DR   EnsemblGenomes-Tr; AT5G32482.1.
DR   EnsemblGenomes-Tr; AT5G32483.1.
DR   EnsemblGenomes-Tr; AT5G32484.1.
DR   EnsemblGenomes-Tr; AT5G32485.1.
DR   EnsemblGenomes-Tr; AT5G32486.1.
DR   EnsemblGenomes-Tr; AT5G32487.1.
DR   EnsemblGenomes-Tr; AT5G32488.1.
DR   EnsemblGenomes-Tr; AT5G32489.1.
DR   EnsemblGenomes-Tr; AT5G32490.1.
DR   EnsemblGenomes-Tr; AT5G32495.1.
DR   EnsemblGenomes-Tr; AT5G32505.1.
DR   EnsemblGenomes-Tr; AT5G32510.2.
DR   EnsemblGenomes-Tr; AT5G32511.1.
DR   EnsemblGenomes-Tr; AT5G32512.1.
DR   EnsemblGenomes-Tr; AT5G32513.1.
DR   EnsemblGenomes-Tr; AT5G32514.1.
DR   EnsemblGenomes-Tr; AT5G32515.1.
DR   EnsemblGenomes-Tr; AT5G32516.1.
DR   EnsemblGenomes-Tr; AT5G32517.1.
DR   EnsemblGenomes-Tr; AT5G32518.1.
DR   EnsemblGenomes-Tr; AT5G32519.1.
DR   EnsemblGenomes-Tr; AT5G32520.1.
DR   EnsemblGenomes-Tr; AT5G32521.1.
DR   EnsemblGenomes-Tr; AT5G32522.1.
DR   EnsemblGenomes-Tr; AT5G32525.1.
DR   EnsemblGenomes-Tr; AT5G32540.1.
DR   EnsemblGenomes-Tr; AT5G32563.1.
DR   EnsemblGenomes-Tr; AT5G32566.1.
DR   EnsemblGenomes-Tr; AT5G32569.1.
DR   EnsemblGenomes-Tr; AT5G32572.1.
DR   EnsemblGenomes-Tr; AT5G32576.1.
DR   EnsemblGenomes-Tr; AT5G32580.1.
DR   EnsemblGenomes-Tr; AT5G32591.1.
DR   EnsemblGenomes-Tr; AT5G32592.1.
DR   EnsemblGenomes-Tr; AT5G32593.1.
DR   EnsemblGenomes-Tr; AT5G32594.1.
DR   EnsemblGenomes-Tr; AT5G32595.1.
DR   EnsemblGenomes-Tr; AT5G32596.1.
DR   EnsemblGenomes-Tr; AT5G32598.1.
DR   EnsemblGenomes-Tr; AT5G32600.1.
DR   EnsemblGenomes-Tr; AT5G32605.1.
DR   EnsemblGenomes-Tr; AT5G32610.1.
DR   EnsemblGenomes-Tr; AT5G32616.1.
DR   EnsemblGenomes-Tr; AT5G32620.1.
DR   EnsemblGenomes-Tr; AT5G32621.1.
DR   EnsemblGenomes-Tr; AT5G32622.1.
DR   EnsemblGenomes-Tr; AT5G32623.1.
DR   EnsemblGenomes-Tr; AT5G32624.1.
DR   EnsemblGenomes-Tr; AT5G32625.1.
DR   EnsemblGenomes-Tr; AT5G32626.1.
DR   EnsemblGenomes-Tr; AT5G32627.1.
DR   EnsemblGenomes-Tr; AT5G32628.1.
DR   EnsemblGenomes-Tr; AT5G32630.1.
DR   EnsemblGenomes-Tr; AT5G32654.1.
DR   EnsemblGenomes-Tr; AT5G32678.1.
DR   EnsemblGenomes-Tr; AT5G32690.1.
DR   EnsemblGenomes-Tr; AT5G32702.1.
DR   EnsemblGenomes-Tr; AT5G32726.1.
DR   EnsemblGenomes-Tr; AT5G32750.1.
DR   EnsemblGenomes-Tr; AT5G32775.1.
DR   EnsemblGenomes-Tr; AT5G32800.1.
DR   EnsemblGenomes-Tr; AT5G32825.1.
DR   EnsemblGenomes-Tr; AT5G32850.1.
DR   EnsemblGenomes-Tr; AT5G32875.1.
DR   EnsemblGenomes-Tr; AT5G32900.1.
DR   EnsemblGenomes-Tr; AT5G32925.1.
DR   EnsemblGenomes-Tr; AT5G32950.1.
DR   EnsemblGenomes-Tr; AT5G32975.1.
DR   EnsemblGenomes-Tr; AT5G33000.1.
DR   EnsemblGenomes-Tr; AT5G33025.1.
DR   EnsemblGenomes-Tr; AT5G33050.1.
DR   EnsemblGenomes-Tr; AT5G33070.1.
DR   EnsemblGenomes-Tr; AT5G33075.1.
DR   EnsemblGenomes-Tr; AT5G33100.1.
DR   EnsemblGenomes-Tr; AT5G33125.1.
DR   EnsemblGenomes-Tr; AT5G33150.1.
DR   EnsemblGenomes-Tr; AT5G33175.1.
DR   EnsemblGenomes-Tr; AT5G33200.1.
DR   EnsemblGenomes-Tr; AT5G33202.1.
DR   EnsemblGenomes-Tr; AT5G33204.1.
DR   EnsemblGenomes-Tr; AT5G33207.1.
DR   EnsemblGenomes-Tr; AT5G33220.1.
DR   EnsemblGenomes-Tr; AT5G33223.1.
DR   EnsemblGenomes-Tr; AT5G33226.1.
DR   EnsemblGenomes-Tr; AT5G33230.1.
DR   EnsemblGenomes-Tr; AT5G33232.1.
DR   EnsemblGenomes-Tr; AT5G33234.1.
DR   EnsemblGenomes-Tr; AT5G33237.1.
DR   EnsemblGenomes-Tr; AT5G33240.1.
DR   EnsemblGenomes-Tr; AT5G33250.1.
DR   EnsemblGenomes-Tr; AT5G33251.1.
DR   EnsemblGenomes-Tr; AT5G33252.1.
DR   EnsemblGenomes-Tr; AT5G33253.1.
DR   EnsemblGenomes-Tr; AT5G33254.1.
DR   EnsemblGenomes-Tr; AT5G33255.1.
DR   EnsemblGenomes-Tr; AT5G33256.1.
DR   EnsemblGenomes-Tr; AT5G33257.1.
DR   EnsemblGenomes-Tr; AT5G33258.1.
DR   EnsemblGenomes-Tr; AT5G33259.1.
DR   EnsemblGenomes-Tr; AT5G33260.1.
DR   EnsemblGenomes-Tr; AT5G33270.1.
DR   EnsemblGenomes-Tr; AT5G33285.1.
DR   EnsemblGenomes-Tr; AT5G33303.1.
DR   EnsemblGenomes-Tr; AT5G33306.1.
DR   EnsemblGenomes-Tr; AT5G33310.1.
DR   EnsemblGenomes-Tr; AT5G33315.1.
DR   EnsemblGenomes-Tr; AT5G33350.1.
DR   EnsemblGenomes-Tr; AT5G33360.1.
DR   EnsemblGenomes-Tr; AT5G33365.1.
DR   EnsemblGenomes-Tr; AT5G33370.2.
DR   EnsemblGenomes-Tr; AT5G33380.1.
DR   EnsemblGenomes-Tr; AT5G33381.1.
DR   EnsemblGenomes-Tr; AT5G33382.1.
DR   EnsemblGenomes-Tr; AT5G33383.1.
DR   EnsemblGenomes-Tr; AT5G33384.1.
DR   EnsemblGenomes-Tr; AT5G33385.1.
DR   EnsemblGenomes-Tr; AT5G33386.1.
DR   EnsemblGenomes-Tr; AT5G33387.1.
DR   EnsemblGenomes-Tr; AT5G33388.1.
DR   EnsemblGenomes-Tr; AT5G33389.1.
DR   EnsemblGenomes-Tr; AT5G33391.1.
DR   EnsemblGenomes-Tr; AT5G33392.1.
DR   EnsemblGenomes-Tr; AT5G33395.1.
DR   EnsemblGenomes-Tr; AT5G33398.1.
DR   EnsemblGenomes-Tr; AT5G33399.1.
DR   EnsemblGenomes-Tr; AT5G33400.1.
DR   EnsemblGenomes-Tr; AT5G33402.1.
DR   EnsemblGenomes-Tr; AT5G33404.1.
DR   EnsemblGenomes-Tr; AT5G33405.1.
DR   EnsemblGenomes-Tr; AT5G33410.1.
DR   EnsemblGenomes-Tr; AT5G33415.1.
DR   EnsemblGenomes-Tr; AT5G33420.1.
DR   EnsemblGenomes-Tr; AT5G33422.1.
DR   EnsemblGenomes-Tr; AT5G33424.1.
DR   EnsemblGenomes-Tr; AT5G33427.1.
DR   EnsemblGenomes-Tr; AT5G33428.1.
DR   EnsemblGenomes-Tr; AT5G33431.1.
DR   EnsemblGenomes-Tr; AT5G33432.1.
DR   EnsemblGenomes-Tr; AT5G33433.1.
DR   EnsemblGenomes-Tr; AT5G33434.1.
DR   EnsemblGenomes-Tr; AT5G33436.1.
DR   EnsemblGenomes-Tr; AT5G33438.1.
DR   EnsemblGenomes-Tr; AT5G33439.1.
DR   EnsemblGenomes-Tr; AT5G33441.1.
DR   EnsemblGenomes-Tr; AT5G33442.1.
DR   EnsemblGenomes-Tr; AT5G33533.1.
DR   EnsemblGenomes-Tr; AT5G33624.1.
DR   EnsemblGenomes-Tr; AT5G33715.1.
DR   EnsemblGenomes-Tr; AT5G33990.1.
DR   EnsemblGenomes-Tr; AT5G34082.1.
DR   EnsemblGenomes-Tr; AT5G34174.1.
DR   EnsemblGenomes-Tr; AT5G34266.1.
DR   EnsemblGenomes-Tr; AT5G34358.1.
DR   EnsemblGenomes-Tr; AT5G34376.1.
DR   EnsemblGenomes-Tr; AT5G34394.1.
DR   EnsemblGenomes-Tr; AT5G34412.1.
DR   EnsemblGenomes-Tr; AT5G34431.1.
DR   EnsemblGenomes-Tr; AT5G34450.1.
DR   EnsemblGenomes-Tr; AT5G34460.1.
DR   EnsemblGenomes-Tr; AT5G34480.1.
DR   EnsemblGenomes-Tr; AT5G34500.1.
DR   EnsemblGenomes-Tr; AT5G34520.1.
DR   EnsemblGenomes-Tr; AT5G34540.1.
DR   EnsemblGenomes-Tr; AT5G34560.1.
DR   EnsemblGenomes-Tr; AT5G34602.1.
DR   EnsemblGenomes-Tr; AT5G34623.1.
DR   EnsemblGenomes-Tr; AT5G34644.1.
DR   EnsemblGenomes-Tr; AT5G34665.1.
DR   EnsemblGenomes-Tr; AT5G34686.1.
DR   EnsemblGenomes-Tr; AT5G34696.1.
DR   EnsemblGenomes-Tr; AT5G34707.1.
DR   EnsemblGenomes-Tr; AT5G34728.1.
DR   EnsemblGenomes-Tr; AT5G34749.1.
DR   EnsemblGenomes-Tr; AT5G34770.1.
DR   EnsemblGenomes-Tr; AT5G34790.1.
DR   EnsemblGenomes-Tr; AT5G34795.1.
DR   EnsemblGenomes-Tr; AT5G34800.1.
DR   EnsemblGenomes-Tr; AT5G34810.1.
DR   EnsemblGenomes-Tr; AT5G34820.1.
DR   EnsemblGenomes-Tr; AT5G34825.1.
DR   EnsemblGenomes-Tr; AT5G34831.1.
DR   EnsemblGenomes-Tr; AT5G34832.1.
DR   EnsemblGenomes-Tr; AT5G34833.1.
DR   EnsemblGenomes-Tr; AT5G34834.1.
DR   EnsemblGenomes-Tr; AT5G34835.1.
DR   EnsemblGenomes-Tr; AT5G34836.1.
DR   EnsemblGenomes-Tr; AT5G34837.1.
DR   EnsemblGenomes-Tr; AT5G34838.1.
DR   EnsemblGenomes-Tr; AT5G34839.1.
DR   EnsemblGenomes-Tr; AT5G34840.1.
DR   EnsemblGenomes-Tr; AT5G34841.1.
DR   EnsemblGenomes-Tr; AT5G34842.1.
DR   EnsemblGenomes-Tr; AT5G34843.1.
DR   EnsemblGenomes-Tr; AT5G34844.1.
DR   EnsemblGenomes-Tr; AT5G34845.1.
DR   EnsemblGenomes-Tr; AT5G34846.1.
DR   EnsemblGenomes-Tr; AT5G34847.1.
DR   EnsemblGenomes-Tr; AT5G34848.1.
DR   EnsemblGenomes-Tr; AT5G34849.1.
DR   EnsemblGenomes-Tr; AT5G34851.1.
DR   EnsemblGenomes-Tr; AT5G34852.1.
DR   EnsemblGenomes-Tr; AT5G34853.1.
DR   EnsemblGenomes-Tr; AT5G34854.1.
DR   EnsemblGenomes-Tr; AT5G34855.1.
DR   EnsemblGenomes-Tr; AT5G34856.1.
DR   EnsemblGenomes-Tr; AT5G34857.1.
DR   EnsemblGenomes-Tr; AT5G34858.1.
DR   EnsemblGenomes-Tr; AT5G34859.1.
DR   EnsemblGenomes-Tr; AT5G34860.1.
DR   EnsemblGenomes-Tr; AT5G34861.1.
DR   EnsemblGenomes-Tr; AT5G34862.1.
DR   EnsemblGenomes-Tr; AT5G34863.1.
DR   EnsemblGenomes-Tr; AT5G34864.1.
DR   EnsemblGenomes-Tr; AT5G34865.1.
DR   EnsemblGenomes-Tr; AT5G34866.1.
DR   EnsemblGenomes-Tr; AT5G34867.1.
DR   EnsemblGenomes-Tr; AT5G34868.1.
DR   EnsemblGenomes-Tr; AT5G34871.1.
DR   EnsemblGenomes-Tr; AT5G34880.1.
DR   EnsemblGenomes-Tr; AT5G34890.1.
DR   EnsemblGenomes-Tr; AT5G34895.1.
DR   EnsemblGenomes-Tr; AT5G34900.1.
DR   EnsemblGenomes-Tr; AT5G34903.1.
DR   EnsemblGenomes-Tr; AT5G34910.1.
DR   EnsemblGenomes-Tr; AT5G34920.1.
DR   EnsemblGenomes-Tr; AT5G34925.1.
DR   EnsemblGenomes-Tr; AT5G34945.1.
DR   EnsemblGenomes-Tr; AT5G34950.1.
DR   EnsemblGenomes-Tr; AT5G34960.1.
DR   EnsemblGenomes-Tr; AT5G34965.1.
DR   EnsemblGenomes-Tr; AT5G34970.1.
DR   EnsemblGenomes-Tr; AT5G34980.1.
DR   EnsemblGenomes-Tr; AT5G34985.1.
DR   EnsemblGenomes-Tr; AT5G34990.1.
DR   EnsemblGenomes-Tr; AT5G35000.1.
DR   EnsemblGenomes-Tr; AT5G35010.1.
DR   EnsemblGenomes-Tr; AT5G35020.1.
DR   EnsemblGenomes-Tr; AT5G35021.1.
DR   EnsemblGenomes-Tr; AT5G35023.1.
DR   EnsemblGenomes-Tr; AT5G35025.1.
DR   EnsemblGenomes-Tr; AT5G35030.1.
DR   EnsemblGenomes-Tr; AT5G35035.1.
DR   EnsemblGenomes-Tr; AT5G35040.1.
DR   EnsemblGenomes-Tr; AT5G35045.1.
DR   EnsemblGenomes-Tr; AT5G35046.1.
DR   EnsemblGenomes-Tr; AT5G35048.1.
DR   EnsemblGenomes-Tr; AT5G35052.1.
DR   EnsemblGenomes-Tr; AT5G35057.1.
DR   EnsemblGenomes-Tr; AT5G35061.1.
DR   EnsemblGenomes-Tr; AT5G35065.1.
DR   EnsemblGenomes-Tr; AT5G35070.2.
DR   EnsemblGenomes-Tr; AT5G35073.1.
DR   EnsemblGenomes-Tr; AT5G35076.1.
DR   EnsemblGenomes-Tr; AT5G35111.1.
DR   EnsemblGenomes-Tr; AT5G35113.1.
DR   EnsemblGenomes-Tr; AT5G35116.1.
DR   EnsemblGenomes-Tr; AT5G35118.1.
DR   EnsemblGenomes-Tr; AT5G35130.1.
DR   EnsemblGenomes-Tr; AT5G35140.1.
DR   EnsemblGenomes-Tr; AT5G35142.1.
DR   EnsemblGenomes-Tr; AT5G35145.1.
DR   EnsemblGenomes-Tr; AT5G35146.1.
DR   EnsemblGenomes-Tr; AT5G35148.1.
DR   EnsemblGenomes-Tr; AT5G35150.1.
DR   EnsemblGenomes-Tr; AT5G35205.1.
DR   EnsemblGenomes-Tr; AT5G35207.1.
DR   EnsemblGenomes-Tr; AT5G35240.1.
DR   EnsemblGenomes-Tr; AT5G35250.1.
DR   EnsemblGenomes-Tr; AT5G35260.1.
DR   EnsemblGenomes-Tr; AT5G35270.1.
DR   EnsemblGenomes-Tr; AT5G35280.1.
DR   EnsemblGenomes-Tr; AT5G35310.2.
DR   EnsemblGenomes-Tr; AT5G35331.1.
DR   EnsemblGenomes-Tr; AT5G35332.1.
DR   EnsemblGenomes-Tr; AT5G35334.1.
DR   EnsemblGenomes-Tr; AT5G35336.1.
DR   EnsemblGenomes-Tr; AT5G35337.1.
DR   EnsemblGenomes-Tr; AT5G35339.1.
DR   EnsemblGenomes-Tr; AT5G35340.1.
DR   EnsemblGenomes-Tr; AT5G35341.1.
DR   EnsemblGenomes-Tr; AT5G35344.1.
DR   EnsemblGenomes-Tr; AT5G35348.1.
DR   EnsemblGenomes-Tr; AT5G35353.1.
DR   EnsemblGenomes-Tr; AT5G35354.1.
DR   EnsemblGenomes-Tr; AT5G35356.1.
DR   EnsemblGenomes-Tr; AT5G35407.1.
DR   EnsemblGenomes-Tr; AT5G35413.1.
DR   EnsemblGenomes-Tr; AT5G35416.1.
DR   EnsemblGenomes-Tr; AT5G35420.1.
DR   EnsemblGenomes-Tr; AT5G35425.1.
DR   EnsemblGenomes-Tr; AT5G35495.1.
DR   EnsemblGenomes-Tr; AT5G35535.1.
DR   EnsemblGenomes-Tr; AT5G35555.1.
DR   EnsemblGenomes-Tr; AT5G35575.1.
DR   EnsemblGenomes-Tr; AT5G35601.1.
DR   EnsemblGenomes-Tr; AT5G35602.1.
DR   EnsemblGenomes-Tr; AT5G35605.1.
DR   EnsemblGenomes-Tr; AT5G35606.1.
DR   EnsemblGenomes-Tr; AT5G35607.1.
DR   EnsemblGenomes-Tr; AT5G35608.1.
DR   EnsemblGenomes-Tr; AT5G35615.1.
DR   EnsemblGenomes-Tr; AT5G35620.2.
DR   EnsemblGenomes-Tr; AT5G35643.1.
DR   EnsemblGenomes-Tr; AT5G35646.1.
DR   EnsemblGenomes-Tr; AT5G35650.1.
DR   EnsemblGenomes-Tr; AT5G35655.1.
DR   EnsemblGenomes-Tr; AT5G35657.1.
DR   EnsemblGenomes-Tr; AT5G35710.1.
DR   EnsemblGenomes-Tr; AT5G35720.1.
DR   EnsemblGenomes-Tr; AT5G35725.1.
DR   EnsemblGenomes-Tr; AT5G35736.1.
DR   EnsemblGenomes-Tr; AT5G35738.1.
DR   EnsemblGenomes-Tr; AT5G35756.1.
DR   EnsemblGenomes-Tr; AT5G35775.1.
DR   EnsemblGenomes-Tr; AT5G35777.1.
DR   EnsemblGenomes-Tr; AT5G35780.1.
DR   EnsemblGenomes-Tr; AT5G35791.1.
DR   EnsemblGenomes-Tr; AT5G35792.1.
DR   EnsemblGenomes-Tr; AT5G35794.1.
DR   EnsemblGenomes-Tr; AT5G35796.1.
DR   EnsemblGenomes-Tr; AT5G35798.1.
DR   EnsemblGenomes-Tr; AT5G35800.1.
DR   EnsemblGenomes-Tr; AT5G35802.1.
DR   EnsemblGenomes-Tr; AT5G35805.1.
DR   EnsemblGenomes-Tr; AT5G35820.1.
DR   EnsemblGenomes-Tr; AT5G35860.1.
DR   EnsemblGenomes-Tr; AT5G35880.1.
DR   EnsemblGenomes-Tr; AT5G35912.1.
DR   EnsemblGenomes-Tr; AT5G35914.1.
DR   EnsemblGenomes-Tr; AT5G35915.1.
DR   EnsemblGenomes-Tr; AT5G35917.1.
DR   EnsemblGenomes-Tr; AT5G35918.1.
DR   EnsemblGenomes-Tr; AT5G35923.1.
DR   EnsemblGenomes-Tr; AT5G35932.1.
DR   EnsemblGenomes-Tr; AT5G35935.1.
DR   EnsemblGenomes-Tr; AT5G35965.1.
DR   EnsemblGenomes-Tr; AT5G36002.1.
DR   EnsemblGenomes-Tr; AT5G36002.2.
DR   EnsemblGenomes-Tr; AT5G36005.1.
DR   EnsemblGenomes-Tr; AT5G36010.1.
DR   EnsemblGenomes-Tr; AT5G36015.1.
DR   EnsemblGenomes-Tr; AT5G36020.1.
DR   EnsemblGenomes-Tr; AT5G36030.1.
DR   EnsemblGenomes-Tr; AT5G36035.1.
DR   EnsemblGenomes-Tr; AT5G36040.1.
DR   EnsemblGenomes-Tr; AT5G36050.1.
DR   EnsemblGenomes-Tr; AT5G36060.1.
DR   EnsemblGenomes-Tr; AT5G36070.1.
DR   EnsemblGenomes-Tr; AT5G36075.1.
DR   EnsemblGenomes-Tr; AT5G36090.1.
DR   EnsemblGenomes-Tr; AT5G36125.1.
DR   EnsemblGenomes-Tr; AT5G36185.1.
DR   EnsemblGenomes-Tr; AT5G36223.1.
DR   EnsemblGenomes-Tr; AT5G36226.1.
DR   EnsemblGenomes-Tr; AT5G36270.1.
DR   EnsemblGenomes-Tr; AT5G36275.1.
DR   EnsemblGenomes-Tr; AT5G36293.1.
DR   EnsemblGenomes-Tr; AT5G36296.1.
DR   EnsemblGenomes-Tr; AT5G36297.1.
DR   EnsemblGenomes-Tr; AT5G36300.1.
DR   EnsemblGenomes-Tr; AT5G36510.1.
DR   EnsemblGenomes-Tr; AT5G36530.1.
DR   EnsemblGenomes-Tr; AT5G36650.1.
DR   EnsemblGenomes-Tr; AT5G36655.1.
DR   EnsemblGenomes-Tr; AT5G36660.1.
DR   EnsemblGenomes-Tr; AT5G36685.1.
DR   EnsemblGenomes-Tr; AT5G36700.3.
DR   EnsemblGenomes-Tr; AT5G36732.1.
DR   EnsemblGenomes-Tr; AT5G36734.1.
DR   EnsemblGenomes-Tr; AT5G36736.1.
DR   EnsemblGenomes-Tr; AT5G36737.1.
DR   EnsemblGenomes-Tr; AT5G36775.1.
DR   EnsemblGenomes-Tr; AT5G36825.1.
DR   EnsemblGenomes-Tr; AT5G36830.1.
DR   EnsemblGenomes-Tr; AT5G36840.1.
DR   EnsemblGenomes-Tr; AT5G36850.1.
DR   EnsemblGenomes-Tr; AT5G36860.1.
DR   EnsemblGenomes-Tr; AT5G36880.1.
DR   EnsemblGenomes-Tr; AT5G36890.2.
DR   EnsemblGenomes-Tr; AT5G36903.1.
DR   EnsemblGenomes-Tr; AT5G36904.1.
DR   EnsemblGenomes-Tr; AT5G36905.1.
DR   EnsemblGenomes-Tr; AT5G36935.1.
DR   EnsemblGenomes-Tr; AT5G36937.1.
DR   EnsemblGenomes-Tr; AT5G36990.1.
DR   EnsemblGenomes-Tr; AT5G37017.1.
DR   EnsemblGenomes-Tr; AT5G37072.1.
DR   EnsemblGenomes-Tr; AT5G37080.1.
DR   EnsemblGenomes-Tr; AT5G37090.1.
DR   EnsemblGenomes-Tr; AT5G37100.1.
DR   EnsemblGenomes-Tr; AT5G37110.1.
DR   EnsemblGenomes-Tr; AT5G37120.1.
DR   EnsemblGenomes-Tr; AT5G37125.1.
DR   EnsemblGenomes-Tr; AT5G37145.1.
DR   EnsemblGenomes-Tr; AT5G37175.1.
DR   EnsemblGenomes-Tr; AT5G37330.1.
DR   EnsemblGenomes-Tr; AT5G37352.1.
DR   EnsemblGenomes-Tr; AT5G37381.1.
DR   EnsemblGenomes-Tr; AT5G37383.1.
DR   EnsemblGenomes-Tr; AT5G37385.1.
DR   EnsemblGenomes-Tr; AT5G37390.1.
DR   EnsemblGenomes-Tr; AT5G37442.1.
DR   EnsemblGenomes-Tr; AT5G37445.1.
DR   EnsemblGenomes-Tr; AT5G37450.1.
DR   EnsemblGenomes-Tr; AT5G37476.1.
DR   EnsemblGenomes-Tr; AT5G37485.1.
DR   EnsemblGenomes-Tr; AT5G37660.1.
DR   EnsemblGenomes-Tr; AT5G37665.1.
DR   EnsemblGenomes-Tr; AT5G37732.1.
DR   EnsemblGenomes-Tr; AT5G37795.1.
DR   EnsemblGenomes-Tr; AT5G37872.1.
DR   EnsemblGenomes-Tr; AT5G37875.1.
DR   EnsemblGenomes-Tr; AT5G37880.1.
DR   EnsemblGenomes-Tr; AT5G38005.1.
DR   EnsemblGenomes-Tr; AT5G38035.1.
DR   EnsemblGenomes-Tr; AT5G38037.1.
DR   EnsemblGenomes-Tr; AT5G38096.1.
DR   EnsemblGenomes-Tr; AT5G38100.2.
DR   EnsemblGenomes-Tr; AT5G38155.1.
DR   EnsemblGenomes-Tr; AT5G38192.1.
DR   EnsemblGenomes-Tr; AT5G38212.1.
DR   EnsemblGenomes-Tr; AT5G38230.1.
DR   EnsemblGenomes-Tr; AT5G38275.1.
DR   EnsemblGenomes-Tr; AT5G38285.1.
DR   EnsemblGenomes-Tr; AT5G38365.1.
DR   EnsemblGenomes-Tr; AT5G38383.1.
DR   EnsemblGenomes-Tr; AT5G38393.1.
DR   EnsemblGenomes-Tr; AT5G38437.1.
DR   EnsemblGenomes-Tr; AT5G38590.1.
DR   EnsemblGenomes-Tr; AT5G38595.1.
DR   EnsemblGenomes-Tr; AT5G38705.1.
DR   EnsemblGenomes-Tr; AT5G38810.1.
DR   EnsemblGenomes-Tr; AT5G38870.1.
DR   EnsemblGenomes-Tr; AT5G38905.1.
DR   EnsemblGenomes-Tr; AT5G38970.2.
DR   EnsemblGenomes-Tr; AT5G38970.3.
DR   EnsemblGenomes-Tr; AT5G38975.1.
DR   EnsemblGenomes-Tr; AT5G39060.1.
DR   EnsemblGenomes-Tr; AT5G39070.1.
DR   EnsemblGenomes-Tr; AT5G39095.1.
DR   EnsemblGenomes-Tr; AT5G39100.1.
DR   EnsemblGenomes-Tr; AT5G39155.1.
DR   EnsemblGenomes-Tr; AT5G39185.1.
DR   EnsemblGenomes-Tr; AT5G39205.1.
DR   EnsemblGenomes-Tr; AT5G39245.1.
DR   EnsemblGenomes-Tr; AT5G39473.1.
DR   EnsemblGenomes-Tr; AT5G39532.1.
DR   EnsemblGenomes-Tr; AT5G39533.1.
DR   EnsemblGenomes-Tr; AT5G39535.1.
DR   EnsemblGenomes-Tr; AT5G39635.1.
DR   EnsemblGenomes-Tr; AT5G39693.1.
DR   EnsemblGenomes-Tr; AT5G39861.1.
DR   EnsemblGenomes-Tr; AT5G39862.1.
DR   EnsemblGenomes-Tr; AT5G39863.1.
DR   EnsemblGenomes-Tr; AT5G39895.1.
DR   EnsemblGenomes-Tr; AT5G39955.1.
DR   EnsemblGenomes-Tr; AT5G39995.1.
DR   EnsemblGenomes-Tr; AT5G40110.1.
DR   EnsemblGenomes-Tr; AT5G40130.1.
DR   EnsemblGenomes-Tr; AT5G40212.1.
DR   EnsemblGenomes-Tr; AT5G40260.2.
DR   EnsemblGenomes-Tr; AT5G40275.1.
DR   EnsemblGenomes-Tr; AT5G40316.1.
DR   EnsemblGenomes-Tr; AT5G40348.1.
DR   EnsemblGenomes-Tr; AT5G40348.2.
DR   EnsemblGenomes-Tr; AT5G40384.1.
DR   EnsemblGenomes-Tr; AT5G40395.1.
DR   EnsemblGenomes-Tr; AT5G40545.1.
DR   EnsemblGenomes-Tr; AT5G40605.1.
DR   EnsemblGenomes-Tr; AT5G40780.2.
DR   EnsemblGenomes-Tr; AT5G40840.1.
DR   EnsemblGenomes-Tr; AT5G40920.1.
DR   EnsemblGenomes-Tr; AT5G40942.1.
DR   EnsemblGenomes-Tr; AT5G40945.1.
DR   EnsemblGenomes-Tr; AT5G41265.1.
DR   EnsemblGenomes-Tr; AT5G41471.1.
DR   EnsemblGenomes-Tr; AT5G41491.1.
DR   EnsemblGenomes-Tr; AT5G41494.1.
DR   EnsemblGenomes-Tr; AT5G41505.1.
DR   EnsemblGenomes-Tr; AT5G41605.1.
DR   EnsemblGenomes-Tr; AT5G41610.2.
DR   EnsemblGenomes-Tr; AT5G41612.1.
DR   EnsemblGenomes-Tr; AT5G41663.1.
DR   EnsemblGenomes-Tr; AT5G41675.1.
DR   EnsemblGenomes-Tr; AT5G41680.2.
DR   EnsemblGenomes-Tr; AT5G41700.4.
DR   EnsemblGenomes-Tr; AT5G41710.1.
DR   EnsemblGenomes-Tr; AT5G41755.1.
DR   EnsemblGenomes-Tr; AT5G41835.1.
DR   EnsemblGenomes-Tr; AT5G41905.1.
DR   EnsemblGenomes-Tr; AT5G42080.2.
DR   EnsemblGenomes-Tr; AT5G42092.1.
DR   EnsemblGenomes-Tr; AT5G42265.1.
DR   EnsemblGenomes-Tr; AT5G42323.1.
DR   EnsemblGenomes-Tr; AT5G42445.1.
DR   EnsemblGenomes-Tr; AT5G42505.1.
DR   EnsemblGenomes-Tr; AT5G42565.1.
DR   EnsemblGenomes-Tr; AT5G42568.1.
DR   EnsemblGenomes-Tr; AT5G42630.2.
DR   EnsemblGenomes-Tr; AT5G42645.1.
DR   EnsemblGenomes-Tr; AT5G42677.1.
DR   EnsemblGenomes-Tr; AT5G42730.1.
DR   EnsemblGenomes-Tr; AT5G43015.1.
DR   EnsemblGenomes-Tr; AT5G43035.1.
DR   EnsemblGenomes-Tr; AT5G43065.1.
DR   EnsemblGenomes-Tr; AT5G43105.1.
DR   EnsemblGenomes-Tr; AT5G43196.1.
DR   EnsemblGenomes-Tr; AT5G43380.2.
DR   EnsemblGenomes-Tr; AT5G43380.3.
DR   EnsemblGenomes-Tr; AT5G43403.1.
DR   EnsemblGenomes-Tr; AT5G43405.1.
DR   EnsemblGenomes-Tr; AT5G43415.1.
DR   EnsemblGenomes-Tr; AT5G43440.2.
DR   EnsemblGenomes-Tr; AT5G43455.1.
DR   EnsemblGenomes-Tr; AT5G43500.2.
DR   EnsemblGenomes-Tr; AT5G43516.1.
DR   EnsemblGenomes-Tr; AT5G43535.1.
DR   EnsemblGenomes-Tr; AT5G43603.1.
DR   EnsemblGenomes-Tr; AT5G43725.1.
DR   EnsemblGenomes-Tr; AT5G43725.2.
DR   EnsemblGenomes-Tr; AT5G43800.1.
DR   EnsemblGenomes-Tr; AT5G44120.2.
DR   EnsemblGenomes-Tr; AT5G44255.1.
DR   EnsemblGenomes-Tr; AT5G44283.1.
DR   EnsemblGenomes-Tr; AT5G44286.1.
DR   EnsemblGenomes-Tr; AT5G44313.1.
DR   EnsemblGenomes-Tr; AT5G44375.1.
DR   EnsemblGenomes-Tr; AT5G44415.1.
DR   EnsemblGenomes-Tr; AT5G44416.1.
DR   EnsemblGenomes-Tr; AT5G44417.1.
DR   EnsemblGenomes-Tr; AT5G44418.1.
DR   EnsemblGenomes-Tr; AT5G44490.1.
DR   EnsemblGenomes-Tr; AT5G44555.1.
DR   EnsemblGenomes-Tr; AT5G44560.2.
DR   EnsemblGenomes-Tr; AT5G44562.1.
DR   EnsemblGenomes-Tr; AT5G44569.1.
DR   EnsemblGenomes-Tr; AT5G44705.1.
DR   EnsemblGenomes-Tr; AT5G44740.1.
DR   EnsemblGenomes-Tr; AT5G44750.1.
DR   EnsemblGenomes-Tr; AT5G44875.1.
DR   EnsemblGenomes-Tr; AT5G44880.1.
DR   EnsemblGenomes-Tr; AT5G44890.1.
DR   EnsemblGenomes-Tr; AT5G44925.1.
DR   EnsemblGenomes-Tr; AT5G45082.1.
DR   EnsemblGenomes-Tr; AT5G45085.1.
DR   EnsemblGenomes-Tr; AT5G45105.1.
DR   EnsemblGenomes-Tr; AT5G45116.1.
DR   EnsemblGenomes-Tr; AT5G45260.2.
DR   EnsemblGenomes-Tr; AT5G45276.1.
DR   EnsemblGenomes-Tr; AT5G45300.2.
DR   EnsemblGenomes-Tr; AT5G45307.1.
DR   EnsemblGenomes-Tr; AT5G45340.2.
DR   EnsemblGenomes-Tr; AT5G45370.1.
DR   EnsemblGenomes-Tr; AT5G45370.3.
DR   EnsemblGenomes-Tr; AT5G45472.1.
DR   EnsemblGenomes-Tr; AT5G45475.1.
DR   EnsemblGenomes-Tr; AT5G45576.1.
DR   EnsemblGenomes-Tr; AT5G45595.1.
DR   EnsemblGenomes-Tr; AT5G45605.1.
DR   EnsemblGenomes-Tr; AT5G45715.1.
DR   EnsemblGenomes-Tr; AT5G45745.1.
DR   EnsemblGenomes-Tr; AT5G45775.1.
DR   EnsemblGenomes-Tr; AT5G45840.1.
DR   EnsemblGenomes-Tr; AT5G45905.1.
DR   EnsemblGenomes-Tr; AT5G45940.2.
DR   EnsemblGenomes-Tr; AT5G46105.1.
DR   EnsemblGenomes-Tr; AT5G46120.1.
DR   EnsemblGenomes-Tr; AT5G46195.1.
DR   EnsemblGenomes-Tr; AT5G46290.2.
DR   EnsemblGenomes-Tr; AT5G46315.1.
DR   EnsemblGenomes-Tr; AT5G46325.1.
DR   EnsemblGenomes-Tr; AT5G46360.2.
DR   EnsemblGenomes-Tr; AT5G46595.1.
DR   EnsemblGenomes-Tr; AT5G46610.2.
DR   EnsemblGenomes-Tr; AT5G46610.3.
DR   EnsemblGenomes-Tr; AT5G46645.1.
DR   EnsemblGenomes-Tr; AT5G46665.1.
DR   EnsemblGenomes-Tr; AT5G46845.1.
DR   EnsemblGenomes-Tr; AT5G46875.1.
DR   EnsemblGenomes-Tr; AT5G47225.1.
DR   EnsemblGenomes-Tr; AT5G47445.1.
DR   EnsemblGenomes-Tr; AT5G47670.2.
DR   EnsemblGenomes-Tr; AT5G47720.1.
DR   EnsemblGenomes-Tr; AT5G47720.3.
DR   EnsemblGenomes-Tr; AT5G47815.1.
DR   EnsemblGenomes-Tr; AT5G47818.1.
DR   EnsemblGenomes-Tr; AT5G48010.1.
DR   EnsemblGenomes-Tr; AT5G48110.1.
DR   EnsemblGenomes-Tr; AT5G48230.1.
DR   EnsemblGenomes-Tr; AT5G48400.1.
DR   EnsemblGenomes-Tr; AT5G48412.1.
DR   EnsemblGenomes-Tr; AT5G48465.1.
DR   EnsemblGenomes-Tr; AT5G48675.1.
DR   EnsemblGenomes-Tr; AT5G48720.1.
DR   EnsemblGenomes-Tr; AT5G48775.1.
DR   EnsemblGenomes-Tr; AT5G48835.1.
DR   EnsemblGenomes-Tr; AT5G48965.1.
DR   EnsemblGenomes-Tr; AT5G49000.1.
DR   EnsemblGenomes-Tr; AT5G49020.2.
DR   EnsemblGenomes-Tr; AT5G49080.1.
DR   EnsemblGenomes-Tr; AT5G49090.1.
DR   EnsemblGenomes-Tr; AT5G49138.1.
DR   EnsemblGenomes-Tr; AT5G49152.1.
DR   EnsemblGenomes-Tr; AT5G49152.2.
DR   EnsemblGenomes-Tr; AT5G49301.1.
DR   EnsemblGenomes-Tr; AT5G49435.1.
DR   EnsemblGenomes-Tr; AT5G49465.1.
DR   EnsemblGenomes-Tr; AT5G49615.1.
DR   EnsemblGenomes-Tr; AT5G49743.1.
DR   EnsemblGenomes-Tr; AT5G49746.1.
DR   EnsemblGenomes-Tr; AT5G49790.1.
DR   EnsemblGenomes-Tr; AT5G49940.2.
DR   EnsemblGenomes-Tr; AT5G49970.2.
DR   EnsemblGenomes-Tr; AT5G50020.2.
DR   EnsemblGenomes-Tr; AT5G50111.1.
DR   EnsemblGenomes-Tr; AT5G50190.1.
DR   EnsemblGenomes-Tr; AT5G50270.1.
DR   EnsemblGenomes-Tr; AT5G50315.1.
DR   EnsemblGenomes-Tr; AT5G50430.3.
DR   EnsemblGenomes-Tr; AT5G50580.1.
DR   EnsemblGenomes-Tr; AT5G50680.2.
DR   EnsemblGenomes-Tr; AT5G50715.1.
DR   EnsemblGenomes-Tr; AT5G50717.1.
DR   EnsemblGenomes-Tr; AT5G50805.1.
DR   EnsemblGenomes-Tr; AT5G50995.1.
DR   EnsemblGenomes-Tr; AT5G51055.1.
DR   EnsemblGenomes-Tr; AT5G51174.1.
DR   EnsemblGenomes-Tr; AT5G51320.1.
DR   EnsemblGenomes-Tr; AT5G51370.1.
DR   EnsemblGenomes-Tr; AT5G51980.1.
DR   EnsemblGenomes-Tr; AT5G52055.1.
DR   EnsemblGenomes-Tr; AT5G52065.1.
DR   EnsemblGenomes-Tr; AT5G52067.1.
DR   EnsemblGenomes-Tr; AT5G52145.1.
DR   EnsemblGenomes-Tr; AT5G52272.1.
DR   EnsemblGenomes-Tr; AT5G52355.1.
DR   EnsemblGenomes-Tr; AT5G52415.1.
DR   EnsemblGenomes-Tr; AT5G52470.2.
DR   EnsemblGenomes-Tr; AT5G52471.1.
DR   EnsemblGenomes-Tr; AT5G52495.1.
DR   EnsemblGenomes-Tr; AT5G52570.2.
DR   EnsemblGenomes-Tr; AT5G52797.1.
DR   EnsemblGenomes-Tr; AT5G52815.1.
DR   EnsemblGenomes-Tr; AT5G53048.1.
DR   EnsemblGenomes-Tr; AT5G53135.1.
DR   EnsemblGenomes-Tr; AT5G53340.2.
DR   EnsemblGenomes-Tr; AT5G53360.1.
DR   EnsemblGenomes-Tr; AT5G53487.1.
DR   EnsemblGenomes-Tr; AT5G53490.2.
DR   EnsemblGenomes-Tr; AT5G53640.1.
DR   EnsemblGenomes-Tr; AT5G53775.1.
DR   EnsemblGenomes-Tr; AT5G53815.1.
DR   EnsemblGenomes-Tr; AT5G53902.1.
DR   EnsemblGenomes-Tr; AT5G54045.1.
DR   EnsemblGenomes-Tr; AT5G54064.2.
DR   EnsemblGenomes-Tr; AT5G54075.1.
DR   EnsemblGenomes-Tr; AT5G54190.2.
DR   EnsemblGenomes-Tr; AT5G54203.1.
DR   EnsemblGenomes-Tr; AT5G54206.1.
DR   EnsemblGenomes-Tr; AT5G54365.1.
DR   EnsemblGenomes-Tr; AT5G54375.1.
DR   EnsemblGenomes-Tr; AT5G54569.1.
DR   EnsemblGenomes-Tr; AT5G54661.1.
DR   EnsemblGenomes-Tr; AT5G54865.1.
DR   EnsemblGenomes-Tr; AT5G55045.1.
DR   EnsemblGenomes-Tr; AT5G55055.1.
DR   EnsemblGenomes-Tr; AT5G55130.2.
DR   EnsemblGenomes-Tr; AT5G55250.2.
DR   EnsemblGenomes-Tr; AT5G55420.1.
DR   EnsemblGenomes-Tr; AT5G55505.1.
DR   EnsemblGenomes-Tr; AT5G55835.1.
DR   EnsemblGenomes-Tr; AT5G55855.1.
DR   EnsemblGenomes-Tr; AT5G55875.1.
DR   EnsemblGenomes-Tr; AT5G55896.1.
DR   EnsemblGenomes-Tr; AT5G56061.1.
DR   EnsemblGenomes-Tr; AT5G56180.2.
DR   EnsemblGenomes-Tr; AT5G56365.1.
DR   EnsemblGenomes-Tr; AT5G56367.1.
DR   EnsemblGenomes-Tr; AT5G56544.1.
DR   EnsemblGenomes-Tr; AT5G56560.1.
DR   EnsemblGenomes-Tr; AT5G56600.2.
DR   EnsemblGenomes-Tr; AT5G56605.1.
DR   EnsemblGenomes-Tr; AT5G56700.1.
DR   EnsemblGenomes-Tr; AT5G56745.1.
DR   EnsemblGenomes-Tr; AT5G56747.1.
DR   EnsemblGenomes-Tr; AT5G56795.1.
DR   EnsemblGenomes-Tr; AT5G56830.1.
DR   EnsemblGenomes-Tr; AT5G56975.1.
DR   EnsemblGenomes-Tr; AT5G57050.2.
DR   EnsemblGenomes-Tr; AT5G57126.1.
DR   EnsemblGenomes-Tr; AT5G57150.2.
DR   EnsemblGenomes-Tr; AT5G57150.3.
DR   EnsemblGenomes-Tr; AT5G57735.1.
DR   EnsemblGenomes-Tr; AT5G57885.1.
DR   EnsemblGenomes-Tr; AT5G57930.2.
DR   EnsemblGenomes-Tr; AT5G57940.3.
DR   EnsemblGenomes-Tr; AT5G58160.1.
DR   EnsemblGenomes-Tr; AT5G58220.2.
DR   EnsemblGenomes-Tr; AT5G58465.1.
DR   EnsemblGenomes-Tr; AT5G58495.1.
DR   EnsemblGenomes-Tr; AT5G58595.1.
DR   EnsemblGenomes-Tr; AT5G58790.3.
DR   EnsemblGenomes-Tr; AT5G58810.1.
DR   EnsemblGenomes-Tr; AT5G58970.2.
DR   EnsemblGenomes-Tr; AT5G59055.1.
DR   EnsemblGenomes-Tr; AT5G59270.1.
DR   EnsemblGenomes-Tr; AT5G59385.1.
DR   EnsemblGenomes-Tr; AT5G59395.1.
DR   EnsemblGenomes-Tr; AT5G59430.3.
DR   EnsemblGenomes-Tr; AT5G59430.4.
DR   EnsemblGenomes-Tr; AT5G59470.2.
DR   EnsemblGenomes-Tr; AT5G59505.1.
DR   EnsemblGenomes-Tr; AT5G59540.2.
DR   EnsemblGenomes-Tr; AT5G59620.1.
DR   EnsemblGenomes-Tr; AT5G59630.1.
DR   EnsemblGenomes-Tr; AT5G59640.1.
DR   EnsemblGenomes-Tr; AT5G59662.1.
DR   EnsemblGenomes-Tr; AT5G59732.1.
DR   EnsemblGenomes-Tr; AT5G59780.1.
DR   EnsemblGenomes-Tr; AT5G59780.2.
DR   EnsemblGenomes-Tr; AT5G59890.2.
DR   EnsemblGenomes-Tr; AT5G59945.1.
DR   EnsemblGenomes-Tr; AT5G60022.1.
DR   EnsemblGenomes-Tr; AT5G60130.2.
DR   EnsemblGenomes-Tr; AT5G60285.1.
DR   EnsemblGenomes-Tr; AT5G60300.1.
DR   EnsemblGenomes-Tr; AT5G60300.2.
DR   EnsemblGenomes-Tr; AT5G60408.1.
DR   EnsemblGenomes-Tr; AT5G60410.1.
DR   EnsemblGenomes-Tr; AT5G60410.3.
DR   EnsemblGenomes-Tr; AT5G60600.2.
DR   EnsemblGenomes-Tr; AT5G60810.2.
DR   EnsemblGenomes-Tr; AT5G60900.1.
DR   EnsemblGenomes-Tr; AT5G60963.1.
DR   EnsemblGenomes-Tr; AT5G60966.1.
DR   EnsemblGenomes-Tr; AT5G60978.1.
DR   EnsemblGenomes-Tr; AT5G61270.2.
DR   EnsemblGenomes-Tr; AT5G61345.1.
DR   EnsemblGenomes-Tr; AT5G61420.1.
DR   EnsemblGenomes-Tr; AT5G61445.1.
DR   EnsemblGenomes-Tr; AT5G61455.1.
DR   EnsemblGenomes-Tr; AT5G61530.2.
DR   EnsemblGenomes-Tr; AT5G61540.2.
DR   EnsemblGenomes-Tr; AT5G61540.3.
DR   EnsemblGenomes-Tr; AT5G61580.2.
DR   EnsemblGenomes-Tr; AT5G61700.1.
DR   EnsemblGenomes-Tr; AT5G61740.1.
DR   EnsemblGenomes-Tr; AT5G61835.1.
DR   EnsemblGenomes-Tr; AT5G62100.1.
DR   EnsemblGenomes-Tr; AT5G62162.1.
DR   EnsemblGenomes-Tr; AT5G62290.2.
DR   EnsemblGenomes-Tr; AT5G62520.2.
DR   EnsemblGenomes-Tr; AT5G62800.1.
DR   EnsemblGenomes-Tr; AT5G62848.1.
DR   EnsemblGenomes-Tr; AT5G63120.1.
DR   EnsemblGenomes-Tr; AT5G63145.1.
DR   EnsemblGenomes-Tr; AT5G63195.1.
DR   EnsemblGenomes-Tr; AT5G63320.2.
DR   EnsemblGenomes-Tr; AT5G63320.3.
DR   EnsemblGenomes-Tr; AT5G63715.1.
DR   EnsemblGenomes-Tr; AT5G63870.3.
DR   EnsemblGenomes-Tr; AT5G63890.1.
DR   EnsemblGenomes-Tr; AT5G63941.1.
DR   EnsemblGenomes-Tr; AT5G64080.2.
DR   EnsemblGenomes-Tr; AT5G64330.2.
DR   EnsemblGenomes-Tr; AT5G64342.1.
DR   EnsemblGenomes-Tr; AT5G64501.1.
DR   EnsemblGenomes-Tr; AT5G64505.1.
DR   EnsemblGenomes-Tr; AT5G64520.3.
DR   EnsemblGenomes-Tr; AT5G64560.2.
DR   EnsemblGenomes-Tr; AT5G64572.1.
DR   EnsemblGenomes-Tr; AT5G64630.1.
DR   EnsemblGenomes-Tr; AT5G64680.1.
DR   EnsemblGenomes-Tr; AT5G64680.2.
DR   EnsemblGenomes-Tr; AT5G64685.1.
DR   EnsemblGenomes-Tr; AT5G64735.1.
DR   EnsemblGenomes-Tr; AT5G64855.1.
DR   EnsemblGenomes-Tr; AT5G65000.2.
DR   EnsemblGenomes-Tr; AT5G65010.2.
DR   EnsemblGenomes-Tr; AT5G65015.1.
DR   EnsemblGenomes-Tr; AT5G65080.2.
DR   EnsemblGenomes-Tr; AT5G65305.1.
DR   EnsemblGenomes-Tr; AT5G65430.2.
DR   EnsemblGenomes-Tr; AT5G65445.1.
DR   EnsemblGenomes-Tr; AT5G65500.1.
DR   EnsemblGenomes-Tr; AT5G65535.1.
DR   EnsemblGenomes-Tr; AT5G65575.1.
DR   EnsemblGenomes-Tr; AT5G65615.1.
DR   EnsemblGenomes-Tr; AT5G65640.2.
DR   EnsemblGenomes-Tr; AT5G65676.1.
DR   EnsemblGenomes-Tr; AT5G65930.1.
DR   EnsemblGenomes-Tr; AT5G65940.2.
DR   EnsemblGenomes-Tr; AT5G65940.3.
DR   EnsemblGenomes-Tr; AT5G66045.1.
DR   EnsemblGenomes-Tr; AT5G66055.2.
DR   EnsemblGenomes-Tr; AT5G66210.4.
DR   EnsemblGenomes-Tr; AT5G66220.1.
DR   EnsemblGenomes-Tr; AT5G66455.1.
DR   EnsemblGenomes-Tr; AT5G66510.2.
DR   EnsemblGenomes-Tr; AT5G66535.1.
DR   EnsemblGenomes-Tr; AT5G66558.1.
DR   EnsemblGenomes-Tr; AT5G66562.1.
DR   EnsemblGenomes-Tr; AT5G66564.1.
DR   EnsemblGenomes-Tr; AT5G66567.1.
DR   EnsemblGenomes-Tr; AT5G66568.1.
DR   EnsemblGenomes-Tr; AT5G66720.2.
DR   EnsemblGenomes-Tr; AT5G66755.1.
DR   EnsemblGenomes-Tr; AT5G66817.1.
DR   EnsemblGenomes-Tr; AT5G67030.2.
DR   EnsemblGenomes-Tr; AT5G67110.2.
DR   EnsemblGenomes-Tr; AT5G67110.3.
DR   EnsemblGenomes-Tr; AT5G67380.2.
DR   EnsemblGenomes-Tr; AT5G67455.1.
DR   EnsemblGenomes-Tr; AT5G67488.1.
DR   EuropePMC; PMC3984084; 24728280.
DR   EuropePMC; PMC4768703; 26925343.
DR   EuropePMC; PMC6220446; 30400807.
DR   GOA; F2Q9V4.
DR   GOA; F4K1J4.
DR   GOA; F4K5W8.
DR   GOA; O04953.
DR   GOA; O65403.
DR   GOA; P0DN92.
DR   GOA; P0DN93.
DR   GOA; P0DN96.
DR   GOA; P0DN97.
DR   GOA; P93655.
DR   GOA; Q1G373.
DR   GOA; Q2V352.
DR   GOA; Q3E6S8.
DR   GOA; Q4VP07.
DR   GOA; Q500Z2.
DR   GOA; Q5E913.
DR   GOA; Q683D7.
DR   GOA; Q84MB5.
DR   GOA; Q9FF41.
DR   GOA; Q9FG59.
DR   GOA; Q9FI27.
DR   GOA; Q9FJ04.
DR   GOA; Q9FK91.
DR   GOA; Q9LU47.
DR   GOA; Q9M020.
DR   GOA; Q9M041.
DR   GOA; Q9XH06.
DR   GOA; X5JB51.
DR   InterPro; IPR000358; RNR_small_fam.
DR   InterPro; IPR001229; Jacalin-like_lectin_dom.
DR   InterPro; IPR001252; Malate_DH_AS.
DR   InterPro; IPR001557; L-lactate/malate_DH.
DR   InterPro; IPR001940; Peptidase_S1C.
DR   InterPro; IPR003169; GYF.
DR   InterPro; IPR003613; Ubox_domain.
DR   InterPro; IPR004102; Poly(ADP-ribose)pol_reg_dom.
DR   InterPro; IPR004815; Lon_bac/euk-typ.
DR   InterPro; IPR005508; DUF313.
DR   InterPro; IPR008268; Peptidase_S16_AS.
DR   InterPro; IPR008893; WGR_domain.
DR   InterPro; IPR011249; Metalloenz_LuxS/M16.
DR   InterPro; IPR011274; Malate_DH_NAD-dep_euk.
DR   InterPro; IPR021827; Nup186/Nup192/Nup205.
DR   InterPro; IPR022764; Peptidase_S54_rhomboid_dom.
DR   InterPro; IPR030182; PUP_plant.
DR   InterPro; IPR030475; RNR_small_AS.
DR   InterPro; IPR032566; Znf-C2HE.
DR   InterPro; IPR033250; CEP.
DR   InterPro; IPR033909; RNR_small.
DR   InterPro; IPR035445; GYF-like_dom_sf.
DR   InterPro; IPR035952; Rhomboid-like_sf.
DR   InterPro; IPR036188; FAD/NAD-bd_sf.
DR   InterPro; IPR036616; Poly(ADP-ribose)pol_reg_dom_sf.
DR   InterPro; IPR036930; WGR_dom_sf.
DR   InterPro; IPR038943; PLDrp1-like.
DR   RFAM; RF00001; 5S_rRNA.
DR   RFAM; RF00003; U1.
DR   RFAM; RF00004; U2.
DR   RFAM; RF00005; tRNA.
DR   RFAM; RF00015; U4.
DR   RFAM; RF00020; U5.
DR   RFAM; RF00026; U6.
DR   RFAM; RF00046; snoR30.
DR   RFAM; RF00054; SNORD25.
DR   RFAM; RF00067; SNORD15.
DR   RFAM; RF00069; SNORD24.
DR   RFAM; RF00073; mir-156.
DR   RFAM; RF00075; mir-166.
DR   RFAM; RF00097; snoR71.
DR   RFAM; RF00145; snoZ105.
DR   RFAM; RF00147; SNORD34.
DR   RFAM; RF00149; snoZ103.
DR   RFAM; RF00200; snoZ199.
DR   RFAM; RF00204; snoR12.
DR   RFAM; RF00206; U54.
DR   RFAM; RF00213; snoR38.
DR   RFAM; RF00218; SNORD46.
DR   RFAM; RF00247; mir-160.
DR   RFAM; RF00267; snoR64.
DR   RFAM; RF00304; snoZ279_R105_R108.
DR   RFAM; RF00316; snoR43.
DR   RFAM; RF00323; snoR79.
DR   RFAM; RF00332; snoZ266.
DR   RFAM; RF00339; snoR60.
DR   RFAM; RF00348; snoR9_plant.
DR   RFAM; RF00353; snoR31_Z110_Z27.
DR   RFAM; RF00356; snoR32_R81.
DR   RFAM; RF00357; snoR44_J54.
DR   RFAM; RF00360; snoZ107_R87.
DR   RFAM; RF00445; mir-399.
DR   RFAM; RF00452; mir-172.
DR   RFAM; RF00482; snoF1_F2.
DR   RFAM; RF00548; U11.
DR   RFAM; RF00619; U6atac.
DR   RFAM; RF00638; MIR159.
DR   RFAM; RF00643; MIR171_1.
DR   RFAM; RF00645; MIR169_2.
DR   RFAM; RF00647; MIR164.
DR   RFAM; RF00648; MIR396.
DR   RFAM; RF00677; MIR168.
DR   RFAM; RF00689; MIR390.
DR   RFAM; RF00695; MIR398.
DR   RFAM; RF00742; MIR162_2.
DR   RFAM; RF00768; MIR405.
DR   RFAM; RF00893; MIR854.
DR   RFAM; RF01213; snoR103.
DR   RFAM; RF01219; snoR100.
DR   RFAM; RF01220; snoR104.
DR   RFAM; RF01230; snoR77.
DR   RFAM; RF01236; snoU19.
DR   RFAM; RF01281; snoR35.
DR   RFAM; RF01284; snoR8a.
DR   RFAM; RF01288; snoR31.
DR   RFAM; RF01426; snoR126.
DR   RFAM; RF01427; snoR127.
DR   RFAM; RF01847; Plant_U3.
DR   RFAM; RF01855; Plant_SRP.
DR   TAIR; 1000429427; AT5G52495.
DR   TAIR; 1000429428; AT5G52355.
DR   TAIR; 1000429429; AT5G48835.
DR   TAIR; 1000429430; AT5G44705.
DR   TAIR; 1000429432; AT5G37795.
DR   TAIR; 1000429433; AT5G41265.
DR   TAIR; 1000429434; AT5G53902.
DR   TAIR; 1000429435; AT5G05985.
DR   TAIR; 1000429436; AT5G05945.
DR   TAIR; 1000429438; AT5G59055.
DR   TAIR; 1000429440; AT5G06125.
DR   TAIR; 1000429441; AT5G48675.
DR   TAIR; 1000429442; AT5G38905.
DR   TAIR; 1000429444; AT5G55045.
DR   TAIR; 1000429445; AT5G55055.
DR   TAIR; 1000429446; AT5G02815.
DR   TAIR; 1000429447; AT5G15175.
DR   TAIR; 1000429448; AT5G52815.
DR   TAIR; 1000429459; AT5G59385.
DR   TAIR; 1000429460; AT5G59395.
DR   TAIR; 1000429461; AT5G11325.
DR   TAIR; 1000429462; AT5G11225.
DR   TAIR; 1000429477; AT5G20856.
DR   TAIR; 1000429478; AT5G20858.
DR   TAIR; 1000429480; AT5G20854.
DR   TAIR; 1000429481; AT5G20852.
DR   TAIR; 1000429483; AT5G14495.
DR   TAIR; 1000429484; AT5G09655.
DR   TAIR; 1000429485; AT5G09585.
DR   TAIR; 1000429486; AT5G09755.
DR   TAIR; 1000429487; AT5G03745.
DR   TAIR; 1000429488; AT5G03705.
DR   TAIR; 1000429489; AT5G11475.
DR   TAIR; 1000429490; AT5G60285.
DR   TAIR; 1000429492; AT5G15815.
DR   TAIR; 1000429493; AT5G15805.
DR   TAIR; 1000429495; AT5G21378.
DR   TAIR; 1000429501; AT5G03452.
DR   TAIR; 1000429502; AT5G03445.
DR   TAIR; 1000429505; AT5G10525.
DR   TAIR; 1000429506; AT5G10455.
DR   TAIR; 1000429507; AT5G46595.
DR   TAIR; 1000430111; AT5G50995.
DR   TAIR; 1000430112; AT5G51055.
DR   TAIR; 1000430114; AT5G50805.
DR   TAIR; 1000430115; AT5G49435.
DR   TAIR; 1000430116; AT5G43535.
DR   TAIR; 1000430117; AT5G44283.
DR   TAIR; 1000430118; AT5G44375.
DR   TAIR; 1000430119; AT5G13845.
DR   TAIR; 1000430120; AT5G14035.
DR   TAIR; 1000430121; AT5G54865.
DR   TAIR; 1000430122; AT5G07625.
DR   TAIR; 1000430123; AT5G07675.
DR   TAIR; 1000430124; AT5G41675.
DR   TAIR; 1000430125; AT5G41605.
DR   TAIR; 1000430126; AT5G56365.
DR   TAIR; 1000430127; AT5G46105.
DR   TAIR; 1000430128; AT5G18005.
DR   TAIR; 1000430129; AT5G18015.
DR   TAIR; 1000430130; AT5G18085.
DR   TAIR; 1000430132; AT5G54375.
DR   TAIR; 1000430133; AT5G54365.
DR   TAIR; 1000430134; AT5G03775.
DR   TAIR; 1000430135; AT5G61445.
DR   TAIR; 1000430136; AT5G61345.
DR   TAIR; 1000430137; AT5G61455.
DR   TAIR; 1000430138; AT5G56975.
DR   TAIR; 1000430139; AT5G56745.
DR   TAIR; 1000430140; AT5G35605.
DR   TAIR; 1000430141; AT5G48465.
DR   TAIR; 1000430143; AT5G05795.
DR   TAIR; 1000430144; AT5G54075.
DR   TAIR; 1000430146; AT5G40945.
DR   TAIR; 1000430147; AT5G59945.
DR   TAIR; 1000430150; AT5G40545.
DR   TAIR; 1000430152; AT5G06685.
DR   TAIR; 1000430153; AT5G46325.
DR   TAIR; 1000430154; AT5G46315.
DR   TAIR; 1000430155; AT5G40395.
DR   TAIR; 1000430156; AT5G58495.
DR   TAIR; 1000430157; AT5G16375.
DR   TAIR; 1000430159; AT5G23665.
DR   TAIR; 1000430160; AT5G45745.
DR   TAIR; 1000430161; AT5G45715.
DR   TAIR; 1000430162; AT5G60963.
DR   TAIR; 1000430163; AT5G60966.
DR   TAIR; 1000430165; AT5G55505.
DR   TAIR; 1000430166; AT5G57885.
DR   TAIR; 1000430167; AT5G39535.
DR   TAIR; 1000430168; AT5G22315.
DR   TAIR; 1000430169; AT5G43455.
DR   TAIR; 1000430170; AT5G38155.
DR   TAIR; 1000430171; AT5G39895.
DR   TAIR; 1000430172; AT5G09975.
DR   TAIR; 1000430174; AT5G01365.
DR   TAIR; 1000430175; AT5G25625.
DR   TAIR; 1000430176; AT5G25585.
DR   TAIR; 1000430178; AT5G19095.
DR   TAIR; 1000430179; AT5G18755.
DR   TAIR; 1000430180; AT5G02435.
DR   TAIR; 1000430181; AT5G02385.
DR   TAIR; 1000430182; AT5G27715.
DR   TAIR; 1000430185; AT5G08075.
DR   TAIR; 1000430186; AT5G02505.
DR   TAIR; 1000430187; AT5G02725.
DR   TAIR; 1000430188; AT5G02615.
DR   TAIR; 1000430196; AT5G07135.
DR   TAIR; 1000430197; AT5G07315.
DR   TAIR; 1000430198; AT5G10235.
DR   TAIR; 1000430199; AT5G09345.
DR   TAIR; 1000430200; AT5G02025.
DR   TAIR; 1000430218; AT5G32017.
DR   TAIR; 1000430238; AT5G53487.
DR   TAIR; 1000629397; AT5G66535.
DR   TAIR; 1000629398; AT5G66568.
DR   TAIR; 1000629399; AT5G65535.
DR   TAIR; 1000629400; AT5G65615.
DR   TAIR; 1000629401; AT5G67455.
DR   TAIR; 1000629402; AT5G61835.
DR   TAIR; 1000629403; AT5G63145.
DR   TAIR; 1000629404; AT5G65445.
DR   TAIR; 1000629405; AT5G65305.
DR   TAIR; 1000629406; AT5G66755.
DR   TAIR; 1000629407; AT5G66817.
DR   TAIR; 1000629408; AT5G64735.
DR   TAIR; 1000629409; AT5G65015.
DR   TAIR; 1000629410; AT5G64855.
DR   TAIR; 1000629411; AT5G64505.
DR   TAIR; 1001029741; AT5G43603.
DR   TAIR; 1001029742; AT5G63715.
DR   TAIR; 1001029754; AT5G08717.
DR   TAIR; 1001029756; AT5G51174.
DR   TAIR; 1001029758; AT5G41471.
DR   TAIR; 1001029760; AT5G52471.
DR   TAIR; 1001029774; AT5G41663.
DR   TAIR; 1001029782; AT5G41905.
DR   TAIR; 1001029795; AT5G10945.
DR   TAIR; 1001029806; AT5G08712.
DR   TAIR; 1001029807; AT5G10572.
DR   TAIR; 1001029809; AT5G27807.
DR   TAIR; 1001029811; AT5G11977.
DR   TAIR; 1001029814; AT5G46845.
DR   TAIR; 1001029816; AT5G45307.
DR   TAIR; 1001029821; AT5G26147.
DR   TAIR; 1001029827; AT5G01747.
DR   TAIR; 1001029828; AT5G04275.
DR   TAIR; 1001029833; AT5G66045.
DR   TAIR; 1001029840; AT5G23065.
DR   TAIR; 131974; AT5G23410.
DR   TAIR; 132416; AT5G50190.
DR   TAIR; 135664; AT5G08210.
DR   TAIR; 1501129982; AT5G01175.
DR   TAIR; 1501129983; AT5G01215.
DR   TAIR; 1501129985; AT5G01595.
DR   TAIR; 1501129987; AT5G03668.
DR   TAIR; 1501129990; AT5G05435.
DR   TAIR; 1501129992; AT5G06865.
DR   TAIR; 1501129997; AT5G10278.
DR   TAIR; 1501129999; AT5G14545.
DR   TAIR; 1501130000; AT5G14565.
DR   TAIR; 1501130004; AT5G16235.
DR   TAIR; 1501130006; AT5G18255.
DR   TAIR; 1501130007; AT5G20225.
DR   TAIR; 1501130009; AT5G23155.
DR   TAIR; 1501130010; AT5G24205.
DR   TAIR; 1501130011; AT5G24206.
DR   TAIR; 1501130014; AT5G24735.
DR   TAIR; 1501130015; AT5G24825.
DR   TAIR; 1501130020; AT5G28262.
DR   TAIR; 1501130022; AT5G28824.
DR   TAIR; 1501130025; AT5G34871.
DR   TAIR; 1501130031; AT5G35407.
DR   TAIR; 1501130033; AT5G36002.
DR   TAIR; 1501130070; AT5G37485.
DR   TAIR; 1501130071; AT5G38005.
DR   TAIR; 1501130074; AT5G39635.
DR   TAIR; 1501130076; AT5G40348.
DR   TAIR; 1501130077; AT5G41612.
DR   TAIR; 1501130080; AT5G43403.
DR   TAIR; 1501130081; AT5G43725.
DR   TAIR; 1501130085; AT5G44562.
DR   TAIR; 1501130091; AT5G49152.
DR   TAIR; 1501130093; AT5G50717.
DR   TAIR; 1501130097; AT5G55835.
DR   TAIR; 1501130102; AT5G58465.
DR   TAIR; 1501130103; AT5G59505.
DR   TAIR; 1501130104; AT5G59732.
DR   TAIR; 1501130105; AT5G60022.
DR   TAIR; 1501130106; AT5G60408.
DR   TAIR; 1501130111; AT5G62162.
DR   TAIR; 1501130112; AT5G62848.
DR   TAIR; 1501130117; AT5G63195.
DR   TAIR; 1501130119; AT5G64572.
DR   TAIR; 1501130121; AT5G65575.
DR   TAIR; 1501130123; AT5G67488.
DR   TAIR; 1501131170; AT5G01732.
DR   TAIR; 1501131176; AT5G03285.
DR   TAIR; 1501131178; AT5G03552.
DR   TAIR; 1501131190; AT5G07322.
DR   TAIR; 1501131196; AT5G09443.
DR   TAIR; 1501131216; AT5G13887.
DR   TAIR; 1501131225; AT5G15833.
DR   TAIR; 1501131226; AT5G15845.
DR   TAIR; 1501131239; AT5G18245.
DR   TAIR; 1501131245; AT5G19221.
DR   TAIR; 1501131253; AT5G22788.
DR   TAIR; 1501131266; AT5G26038.
DR   TAIR; 1501131268; AT5G26146.
DR   TAIR; 1501131295; AT5G33439.
DR   TAIR; 1501131317; AT5G39693.
DR   TAIR; 1501131318; AT5G40275.
DR   TAIR; 1501131319; AT5G40316.
DR   TAIR; 1501131321; AT5G40384.
DR   TAIR; 1501131359; AT5G48775.
DR   TAIR; 1501131360; AT5G49138.
DR   TAIR; 1501131363; AT5G49615.
DR   TAIR; 1501131374; AT5G52797.
DR   TAIR; 1501131376; AT5G53048.
DR   TAIR; 1501131385; AT5G54569.
DR   TAIR; 1501131396; AT5G59662.
DR   TAIR; 1501131421; AT5G66558.
DR   TAIR; 1501166015; AT5G01542.
DR   TAIR; 1501166016; AT5G02035.
DR   TAIR; 1501166017; AT5G06165.
DR   TAIR; 1501166018; AT5G07152.
DR   TAIR; 1501166021; AT5G15022.
DR   TAIR; 1501166024; AT5G33399.
DR   TAIR; 1501166025; AT5G38212.
DR   TAIR; 1501166026; AT5G42092.
DR   TAIR; 1501166027; AT5G44569.
DR   TAIR; 1501166028; AT5G45472.
DR   TAIR; 1501166029; AT5G45475.
DR   TAIR; 1501166030; AT5G48412.
DR   TAIR; 229141; AT5G66562.
DR   TAIR; 229142; AT5G66564.
DR   TAIR; 229143; AT5G66567.
DR   TAIR; 229149; AT5G44286.
DR   TAIR; 229233; AT5G58595.
DR   TAIR; 229242; AT5G13225.
DR   TAIR; 500229783; AT5G57735.
DR   UniProtKB/Swiss-Prot; C0LGU7; MDIS1_ARATH.
DR   UniProtKB/Swiss-Prot; F2Q9V4; SPH6_ARATH.
DR   UniProtKB/Swiss-Prot; F4K1J4; ATXR7_ARATH.
DR   UniProtKB/Swiss-Prot; F4K5W8; SUS5_ARATH.
DR   UniProtKB/Swiss-Prot; F4KBW6; NU205_ARATH.
DR   UniProtKB/Swiss-Prot; F4KEA4; DUF8_ARATH.
DR   UniProtKB/Swiss-Prot; O04953; PME52_ARATH.
DR   UniProtKB/Swiss-Prot; O65403; ERG13_ARATH.
DR   UniProtKB/Swiss-Prot; P0CAY4; DF134_ARATH.
DR   UniProtKB/Swiss-Prot; P0DKH2; RI2BC_ARATH.
DR   UniProtKB/Swiss-Prot; P0DN92; SPH24_ARATH.
DR   UniProtKB/Swiss-Prot; P0DN93; SPH29_ARATH.
DR   UniProtKB/Swiss-Prot; P0DN96; PCEP7_ARATH.
DR   UniProtKB/Swiss-Prot; P0DN97; PCEP8_ARATH.
DR   UniProtKB/Swiss-Prot; P93655; LONM1_ARATH.
DR   UniProtKB/Swiss-Prot; Q1G373; SPH30_ARATH.
DR   UniProtKB/Swiss-Prot; Q2V352; DF271_ARATH.
DR   UniProtKB/Swiss-Prot; Q3E6S8; DGP14_ARATH.
DR   UniProtKB/Swiss-Prot; Q4VP07; LUR16_ARATH.
DR   UniProtKB/Swiss-Prot; Q500Z2; ZDH20_ARATH.
DR   UniProtKB/Swiss-Prot; Q5E913; KN10B_ARATH.
DR   UniProtKB/Swiss-Prot; Q683D7; MAF5_ARATH.
DR   UniProtKB/Swiss-Prot; Q84MB5; RBL11_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FF41; PMI15_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FFA2; DUF9_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FFC6; GDL78_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FFF9; APC1_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FFM6; Y5578_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FFW7; JAL43_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FG59; DHAR4_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FI27; TPS20_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FIM8; SBT4A_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FIV3; SPH25_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FJ04; SPH26_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FJT9; PQQL_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FJU0; MDHC3_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FJU2; FBD37_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FK91; PARP3_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FKA5; Y5957_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FKF3; PME63_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FLL4; PUP12_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FLU7; P2B12_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FMZ4; Y5270_ARATH.
DR   UniProtKB/Swiss-Prot; Q9FYE6; BH101_ARATH.
DR   UniProtKB/Swiss-Prot; Q9LU47; PUB53_ARATH.
DR   UniProtKB/Swiss-Prot; Q9LXD4; MRS29_ARATH.
DR   UniProtKB/Swiss-Prot; Q9LYY6; FK108_ARATH.
DR   UniProtKB/Swiss-Prot; Q9LZC5; GDL73_ARATH.
DR   UniProtKB/Swiss-Prot; Q9M020; LRK63_ARATH.
DR   UniProtKB/Swiss-Prot; Q9M041; BH140_ARATH.
DR   UniProtKB/Swiss-Prot; Q9XH06; LOG9_ARATH.
DR   UniProtKB/Swiss-Prot; X5JB51; SECAB_ARATH.
FH   Key             Location/Qualifiers
FT   source          1..26975502
FT                   /organism="Arabidopsis thaliana"
FT                   /chromosome="5"
FT                   /ecotype="Columbia"
FT                   /mol_type="genomic DNA"
FT                   /db_xref="taxon:3702"
FT   gene            2..303
FT                   /locus_tag="AT5G00730"
FT   ncRNA           2..303
FT                   /locus_tag="AT5G00730"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            complement(995..5156)
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT   mRNA            complement(join(995..1225,1373..1459,1572..1646,1745..1780,
FT                   1914..2007,2105..2181,2435..2509,2748..2799,2872..2934,
FT                   3303..3383,3543..3659,3762..3802,3927..4005,4102..4258,
FT                   4335..4467,4552..4679,4765..4994))
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR187275.1,INSD:DR187260.1,INSD:BP826070.1,
FT                   INSD:ES212707.1,INSD:EH965517.1,INSD:T88327.1,
FT                   INSD:EL220721.1,INSD:EL219028.1,INSD:EH926904.1,
FT                   INSD:DR187266.1,INSD:DR187262.1,INSD:BP814352.2,
FT                   INSD:DR187267.1,INSD:DR187273.1,INSD:BU635629.1,
FT                   INSD:BP815799.1,INSD:BP847683.1,INSD:BP823082.1,
FT                   INSD:BP828812.1,INSD:DR187269.1,INSD:ES181058.1,
FT                   INSD:ES124603.1,INSD:EH956632.1,INSD:BP825768.1,
FT                   INSD:DR187272.1,INSD:BP812360.2,INSD:BP846130.1,
FT                   INSD:EH866827.1,INSD:ES052436.1,INSD:AU239579.1,
FT                   INSD:BP835033.1,INSD:ES206247.1,INSD:EL321475.1,
FT                   INSD:BP812340.1,INSD:BP821517.1,INSD:T21323.1,
FT                   INSD:DR187265.1,INSD:EL123288.1,INSD:BP575092.1,
FT                   INSD:DR187259.1,INSD:ES056933.1,INSD:AV796654.1,
FT                   INSD:BP796965.1,INSD:BP841170.1,INSD:BP800313.1,
FT                   INSD:BP823070.1,INSD:BP827398.1,INSD:EL033065.1,
FT                   INSD:DR187268.1,INSD:DR187271.1,INSD:EL166424.1,
FT                   INSD:BP826832.1,INSD:EL291281.1,INSD:BP567984.1,
FT                   INSD:EL184120.1,INSD:DR187270.1,INSD:EH912904.1,
FT                   INSD:EL093261.1,INSD:BP836409.1,INSD:BP828424.1,
FT                   INSD:BP818936.1,INSD:CF773050.1,INSD:BP815149.1,
FT                   INSD:EL995855.1,INSD:ES113294.1,INSD:ES081715.1,
FT                   INSD:EL088227.1,INSD:AV802222.1,INSD:EL002964.1,
FT                   INSD:BP800752.1,INSD:BP867737.1,INSD:EH937758.1,
FT                   INSD:ES214429.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX841661.1"
FT   mRNA            complement(join(999..1225,1337..1459,1572..1646,1745..1780,
FT                   1914..2007,2105..2181,2435..2509,2748..2799,2872..2934,
FT                   3303..3383,3543..3659,3762..3802,3927..4005,4102..4237,
FT                   4335..4467,4552..4679,4765..5061))
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT   mRNA            complement(join(1034..1459,1572..1646,1745..1780,
FT                   1914..1961,2435..2509,2748..2799,2872..2934,3303..3383,
FT                   3543..3659,3762..3802,3927..4005,4102..4258,4335..4467,
FT                   4552..4679,4765..5156))
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR187260.1,INSD:BP826070.1,INSD:BP651478.1,
FT                   INSD:ES212707.1,INSD:BP646711.1,INSD:AA650929.1,
FT                   INSD:DR187262.1,INSD:Z37634.1,INSD:BP647136.1,
FT                   INSD:BP644726.1,INSD:BP651250.1,INSD:BP815799.1,
FT                   INSD:BP847683.1,INSD:DR187269.1,INSD:ES124603.1,
FT                   INSD:BP568621.1,INSD:AV519354.1,INSD:BP825768.1,
FT                   INSD:BP812360.2,INSD:BP584701.1,INSD:AA395636.1,
FT                   INSD:BP589164.1,INSD:BP846130.1,INSD:BP617571.1,
FT                   INSD:EH866827.1,INSD:BP835033.1,INSD:ES206247.1,
FT                   INSD:BP821517.1,INSD:BP636036.1,INSD:DR187265.1,
FT                   INSD:EL123288.1,INSD:BP669855.1,INSD:BP575092.1,
FT                   INSD:BP580018.1,INSD:DR187259.1,INSD:ES056933.1,
FT                   INSD:BP796965.1,INSD:BP584957.1,INSD:BP647818.1,
FT                   INSD:BP827398.1,INSD:EL033065.1,INSD:BP596440.1,
FT                   INSD:DR187268.1,INSD:BP655610.1,INSD:BP593388.1,
FT                   INSD:DR187271.1,INSD:BP826832.1,INSD:BP579382.1,
FT                   INSD:EL093261.1,INSD:EH912904.1,INSD:BP570833.1,
FT                   INSD:CF773050.1,INSD:EL995855.1,INSD:ES113294.1,
FT                   INSD:BP800752.1,INSD:BP867737.1,INSD:ES214429.1,
FT                   INSD:AU230908.1,INSD:DR187275.1,INSD:EH965517.1,
FT                   INSD:EL220721.1,INSD:AU230514.1,INSD:EL219028.1,
FT                   INSD:BP575248.1,INSD:EG492058.1,INSD:DR187266.1,
FT                   INSD:BP814352.2,INSD:BP660278.1,INSD:DR187267.1,
FT                   INSD:DR187273.1,INSD:BU635629.1,INSD:BP823082.1,
FT                   INSD:BP828812.1,INSD:ES181058.1,INSD:EH956632.1,
FT                   INSD:DR187272.1,INSD:ES052436.1,INSD:AU239579.1,
FT                   INSD:BP812340.1,INSD:EL321475.1,INSD:DR376054.1,
FT                   INSD:BP576423.1,INSD:T21323.1,INSD:BP570885.1,
FT                   INSD:BP639794.1,INSD:ES065956.1,INSD:BP841170.1,
FT                   INSD:BP800313.1,INSD:BP823070.1,INSD:EL166424.1,
FT                   INSD:EL291281.1,INSD:BP567984.1,INSD:EL184120.1,
FT                   INSD:BP581973.1,INSD:BP597853.1,INSD:DR187270.1,
FT                   INSD:BP836409.1,INSD:DR378517.1,INSD:BP828424.1,
FT                   INSD:BP818936.1,INSD:ES029939.1,INSD:AV783961.1,
FT                   INSD:BP627961.1,INSD:BP815149.1,INSD:BP653553.1,
FT                   INSD:BP616535.1,INSD:ES081715.1,INSD:EL088227.1,
FT                   INSD:DR211921.1,INSD:BP581797.1,INSD:ES009815.1,
FT                   INSD:AV810411.1,INSD:BP568863.1,INSD:EH937758.1,
FT                   INSD:BP596113.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK175954.1,INSD:AK175870.1,INSD:AK176023.1,
FT                   INSD:AK175670.1,INSD:AK176242.1,INSD:AK175634.1,
FT                   INSD:AK175582.1,INSD:AK175776.1,INSD:AK175802.1,
FT                   INSD:BX841661.1,INSD:AK175790.1,INSD:AK176336.1,
FT                   INSD:AK118711.1,INSD:AK176647.1,INSD:AK175920.1,
FT                   INSD:AK176058.1,INSD:AK176164.1,INSD:AK175953.1,
FT                   INSD:AK175380.1,INSD:AK176250.1,INSD:AK176507.1,
FT                   INSD:AK118368.1,INSD:AK176004.1,INSD:AK176009.1,
FT                   INSD:BX830051.1,INSD:AK175538.1,INSD:AK176260.1,
FT                   INSD:AK176032.1,INSD:AK176045.1,INSD:AK175763.1"
FT   mRNA            complement(join(1279..1646,1745..1780,1914..1961,
FT                   2435..2509,2748..2799,2872..2934,3303..3383,3543..3659,
FT                   3762..3802,3927..4005,4102..4258,4335..4467,4552..4679,
FT                   4765..5043))
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX841661.1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR187275.1,INSD:BP569895.1,INSD:DR187260.1,
FT                   INSD:BP826070.1,INSD:ES212707.1,INSD:EH965517.1,
FT                   INSD:EL220721.1,INSD:EL219028.1,INSD:AA650929.1,
FT                   INSD:EG492058.1,INSD:AV530507.1,INSD:DR187266.1,
FT                   INSD:DR187262.1,INSD:BP814352.2,INSD:DR187267.1,
FT                   INSD:DR187273.1,INSD:Z37634.1,INSD:BP815799.1,
FT                   INSD:BP847683.1,INSD:BP823082.1,INSD:BP828812.1,
FT                   INSD:DR187269.1,INSD:ES181058.1,INSD:ES124603.1,
FT                   INSD:EH956632.1,INSD:BP825768.1,INSD:DR187272.1,
FT                   INSD:AA395636.1,INSD:BP846130.1,INSD:ES052436.1,
FT                   INSD:EH866827.1,INSD:AU239579.1,INSD:BP835033.1,
FT                   INSD:ES206247.1,INSD:EL321475.1,INSD:BP812340.1,
FT                   INSD:BP821517.1,INSD:T21323.1,INSD:DR187265.1,
FT                   INSD:EL123288.1,INSD:BP575092.1,INSD:DR187259.1,
FT                   INSD:ES056933.1,INSD:ES065956.1,INSD:BP796965.1,
FT                   INSD:BP841170.1,INSD:BP800313.1,INSD:BP823070.1,
FT                   INSD:BP827398.1,INSD:EL033065.1,INSD:DR187268.1,
FT                   INSD:BP593388.1,INSD:DR187271.1,INSD:BP826832.1,
FT                   INSD:EL291281.1,INSD:BP567984.1,INSD:DR187270.1,
FT                   INSD:EH912904.1,INSD:EL093261.1,INSD:BP836409.1,
FT                   INSD:BP828424.1,INSD:ES029939.1,INSD:BP818936.1,
FT                   INSD:AV783961.1,INSD:CF773050.1,INSD:BP815149.1,
FT                   INSD:EL995855.1,INSD:ES113294.1,INSD:ES081715.1,
FT                   INSD:EL088227.1,INSD:BP800752.1,INSD:ES009815.1,
FT                   INSD:BP867737.1,INSD:ES214429.1,INSD:EH937758.1"
FT   mRNA            complement(join(1279..1459,1572..1646,1745..1780,
FT                   1914..2007,2105..2181,2435..2509,2748..2799,2872..2934,
FT                   3303..3383,3543..3659,3762..3802,3927..4005,4102..4258,
FT                   4335..4467,4552..4679,4765..4994))
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT   CDS_pept        complement(join(1388..1459,1572..1646,1745..1780,
FT                   1914..2007,2105..2181,2435..2509,2748..2799,2872..2934,
FT                   3303..3383,3543..3659,3762..3802,3927..4005,4102..4237,
FT                   4335..4467,4552..4679,4765..4924))
FT                   /codon_start=1
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT                   /note="EXPRESSED IN: 23 plant structures; EXPRESSED DURING:
FT                   14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD
FT                   (InterPro:IPR009038)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01010"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01010.4"
FT                   /db_xref="InterPro:IPR009038"
FT                   /db_xref="InterPro:IPR036598"
FT                   /db_xref="UniProtKB/TrEMBL:F4K7W4"
FT                   /protein_id="AED90285.1"
FT                   APVVEPDPEPEPLN"
FT   CDS_pept        complement(join(1388..1459,1572..1646,1745..1780,
FT                   1914..1961,2435..2509,2748..2799,2872..2934,3303..3383,
FT                   3543..3659,3762..3802,3927..4005,4102..4258,4335..4467,
FT                   4552..4679,4765..4924))
FT                   /codon_start=1
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT                   /note="CONTAINS InterPro DOMAIN/s: GOLD
FT                   (InterPro:IPR009038); Has 172 Blast hits to 172 proteins in
FT                   43 species: Archae - 0; Bacteria - 0; Metazoa - 95; Fungi -
FT                   0; Plants - 63; Viruses - 0; Other Eukaryotes - 14 (source:
FT                   NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01010"
FT                   /db_xref="InterPro:IPR009038"
FT                   /db_xref="InterPro:IPR036598"
FT                   /db_xref="UniProtKB/TrEMBL:Q8GSG8"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR187260.1,INSD:BP826070.1,INSD:BP651478.1,
FT                   INSD:ES212707.1,INSD:BP646711.1,INSD:AA650929.1,
FT                   INSD:DR187262.1,INSD:Z37634.1,INSD:BP647136.1,
FT                   INSD:BP644726.1,INSD:BP651250.1,INSD:BP815799.1,
FT                   INSD:BP847683.1,INSD:DR187269.1,INSD:ES124603.1,
FT                   INSD:BP568621.1,INSD:AV519354.1,INSD:BP825768.1,
FT                   INSD:BP812360.2,INSD:BP584701.1,INSD:AA395636.1,
FT                   INSD:BP589164.1,INSD:BP846130.1,INSD:BP617571.1,
FT                   INSD:EH866827.1,INSD:BP835033.1,INSD:ES206247.1,
FT                   INSD:BP821517.1,INSD:BP636036.1,INSD:DR187265.1,
FT                   INSD:EL123288.1,INSD:BP669855.1,INSD:BP575092.1,
FT                   INSD:BP580018.1,INSD:DR187259.1,INSD:ES056933.1,
FT                   INSD:BP796965.1,INSD:BP584957.1,INSD:BP647818.1,
FT                   INSD:BP827398.1,INSD:EL033065.1,INSD:BP596440.1,
FT                   INSD:DR187268.1,INSD:BP655610.1,INSD:BP593388.1,
FT                   INSD:DR187271.1,INSD:BP826832.1,INSD:BP579382.1,
FT                   INSD:EL093261.1,INSD:EH912904.1,INSD:BP570833.1,
FT                   INSD:CF773050.1,INSD:EL995855.1,INSD:ES113294.1,
FT                   INSD:BP800752.1,INSD:BP867737.1,INSD:ES214429.1,
FT                   INSD:AU230908.1,INSD:DR187275.1,INSD:EH965517.1,
FT                   INSD:EL220721.1,INSD:AU230514.1,INSD:EL219028.1,
FT                   INSD:BP575248.1,INSD:EG492058.1,INSD:DR187266.1,
FT                   INSD:BP814352.2,INSD:BP660278.1,INSD:DR187267.1,
FT                   INSD:DR187273.1,INSD:BU635629.1,INSD:BP823082.1,
FT                   INSD:BP828812.1,INSD:ES181058.1,INSD:EH956632.1,
FT                   INSD:DR187272.1,INSD:ES052436.1,INSD:AU239579.1,
FT                   INSD:BP812340.1,INSD:EL321475.1,INSD:DR376054.1,
FT                   INSD:BP576423.1,INSD:T21323.1,INSD:BP570885.1,
FT                   INSD:BP639794.1,INSD:ES065956.1,INSD:BP841170.1,
FT                   INSD:BP800313.1,INSD:BP823070.1,INSD:EL166424.1,
FT                   INSD:EL291281.1,INSD:BP567984.1,INSD:EL184120.1,
FT                   INSD:BP581973.1,INSD:BP597853.1,INSD:DR187270.1,
FT                   INSD:BP836409.1,INSD:DR378517.1,INSD:BP828424.1,
FT                   INSD:BP818936.1,INSD:ES029939.1,INSD:AV783961.1,
FT                   INSD:BP627961.1,INSD:BP815149.1,INSD:BP653553.1,
FT                   INSD:BP616535.1,INSD:ES081715.1,INSD:EL088227.1,
FT                   INSD:DR211921.1,INSD:BP581797.1,INSD:ES009815.1,
FT                   INSD:AV810411.1,INSD:BP568863.1,INSD:EH937758.1,
FT                   INSD:BP596113.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK175954.1,INSD:AK175870.1,INSD:AK176023.1,
FT                   INSD:AK175670.1,INSD:AK176242.1,INSD:AK175634.1,
FT                   INSD:AK175582.1,INSD:AK175776.1,INSD:AK175802.1,
FT                   INSD:BX841661.1,INSD:AK175790.1,INSD:AK176336.1,
FT                   INSD:AK118711.1,INSD:AK176647.1,INSD:AK175920.1,
FT                   INSD:AK176058.1,INSD:AK176164.1,INSD:AK175953.1,
FT                   INSD:AK175380.1,INSD:AK176250.1,INSD:AK176507.1,
FT                   INSD:AK118368.1,INSD:AK176004.1,INSD:AK176009.1,
FT                   INSD:BX830051.1,INSD:AK175538.1,INSD:AK176260.1,
FT                   INSD:AK176032.1,INSD:AK176045.1,INSD:AK175763.1"
FT                   /protein_id="AED90282.1"
FT   CDS_pept        complement(join(1388..1459,1572..1646,1745..1780,
FT                   1914..2007,2105..2181,2435..2509,2748..2799,2872..2934,
FT                   3303..3383,3543..3659,3762..3802,3927..4005,4102..4258,
FT                   4335..4467,4552..4679,4765..4924))
FT                   /codon_start=1
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01010"
FT                   /db_xref="InterPro:IPR009038"
FT                   /db_xref="InterPro:IPR036598"
FT                   /db_xref="UniProtKB/TrEMBL:F4K7W6"
FT                   /protein_id="ANM68742.1"
FT   CDS_pept        complement(join(1388..1459,1572..1646,1745..1780,
FT                   1914..2007,2105..2181,2435..2509,2748..2799,2872..2934,
FT                   3303..3383,3543..3659,3762..3802,3927..4005,4102..4258,
FT                   4335..4467,4552..4679,4765..4924))
FT                   /codon_start=1
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT                   /note="EXPRESSED IN: 23 plant structures; EXPRESSED DURING:
FT                   14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD
FT                   (InterPro:IPR009038); Has 85 Blast hits to 85 proteins in
FT                   21 species: Archae - 0; Bacteria - 0; Metazoa - 20; Fungi -
FT                   0; Plants - 62; Viruses - 0; Other Eukaryotes - 3 (source:
FT                   NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01010.2"
FT                   /db_xref="InterPro:IPR009038"
FT                   /db_xref="InterPro:IPR036598"
FT                   /db_xref="UniProtKB/TrEMBL:F4K7W6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR187275.1,INSD:BP569895.1,INSD:DR187260.1,
FT                   INSD:BP826070.1,INSD:ES212707.1,INSD:EH965517.1,
FT                   INSD:EL220721.1,INSD:EL219028.1,INSD:AA650929.1,
FT                   INSD:EG492058.1,INSD:AV530507.1,INSD:DR187266.1,
FT                   INSD:DR187262.1,INSD:BP814352.2,INSD:DR187267.1,
FT                   INSD:DR187273.1,INSD:Z37634.1,INSD:BP815799.1,
FT                   INSD:BP847683.1,INSD:BP823082.1,INSD:BP828812.1,
FT                   INSD:DR187269.1,INSD:ES181058.1,INSD:ES124603.1,
FT                   INSD:EH956632.1,INSD:BP825768.1,INSD:DR187272.1,
FT                   INSD:AA395636.1,INSD:BP846130.1,INSD:ES052436.1,
FT                   INSD:EH866827.1,INSD:AU239579.1,INSD:BP835033.1,
FT                   INSD:ES206247.1,INSD:EL321475.1,INSD:BP812340.1,
FT                   INSD:BP821517.1,INSD:T21323.1,INSD:DR187265.1,
FT                   INSD:EL123288.1,INSD:BP575092.1,INSD:DR187259.1,
FT                   INSD:ES056933.1,INSD:ES065956.1,INSD:BP796965.1,
FT                   INSD:BP841170.1,INSD:BP800313.1,INSD:BP823070.1,
FT                   INSD:BP827398.1,INSD:EL033065.1,INSD:DR187268.1,
FT                   INSD:BP593388.1,INSD:DR187271.1,INSD:BP826832.1,
FT                   INSD:EL291281.1,INSD:BP567984.1,INSD:DR187270.1,
FT                   INSD:EH912904.1,INSD:EL093261.1,INSD:BP836409.1,
FT                   INSD:BP828424.1,INSD:ES029939.1,INSD:BP818936.1,
FT                   INSD:AV783961.1,INSD:CF773050.1,INSD:BP815149.1,
FT                   INSD:EL995855.1,INSD:ES113294.1,INSD:ES081715.1,
FT                   INSD:EL088227.1,INSD:BP800752.1,INSD:ES009815.1,
FT                   INSD:BP867737.1,INSD:ES214429.1,INSD:EH937758.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX841661.1"
FT                   /protein_id="AED90283.1"
FT   CDS_pept        complement(join(1527..1646,1745..1780,1914..1961,
FT                   2435..2509,2748..2799,2872..2934,3303..3383,3543..3659,
FT                   3762..3802,3927..4005,4102..4258,4335..4467,4552..4679,
FT                   4765..4924))
FT                   /codon_start=1
FT                   /gene_synonym="TOPTELOMERE.1"
FT                   /gene_synonym="TOPTELOMERE_1"
FT                   /locus_tag="AT5G01010"
FT                   /product="retinal-binding protein"
FT                   /note="EXPRESSED IN: 23 plant structures; EXPRESSED DURING:
FT                   14 growth stages; CONTAINS InterPro DOMAIN/s: GOLD
FT                   (InterPro:IPR009038); Has 76 Blast hits to 76 proteins in
FT                   20 species: Archae - 0; Bacteria - 0; Metazoa - 11; Fungi -
FT                   0; Plants - 62; Viruses - 0; Other Eukaryotes - 3 (source:
FT                   NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01010"
FT                   /db_xref="InterPro:IPR009038"
FT                   /db_xref="InterPro:IPR036598"
FT                   /db_xref="UniProtKB/TrEMBL:C0Z286"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR187275.1,INSD:DR187260.1,INSD:BP826070.1,
FT                   INSD:ES212707.1,INSD:EH965517.1,INSD:T88327.1,
FT                   INSD:EL220721.1,INSD:EL219028.1,INSD:EH926904.1,
FT                   INSD:DR187266.1,INSD:DR187262.1,INSD:BP814352.2,
FT                   INSD:DR187267.1,INSD:DR187273.1,INSD:BU635629.1,
FT                   INSD:BP815799.1,INSD:BP847683.1,INSD:BP823082.1,
FT                   INSD:BP828812.1,INSD:DR187269.1,INSD:ES181058.1,
FT                   INSD:ES124603.1,INSD:EH956632.1,INSD:BP825768.1,
FT                   INSD:DR187272.1,INSD:BP812360.2,INSD:BP846130.1,
FT                   INSD:EH866827.1,INSD:ES052436.1,INSD:AU239579.1,
FT                   INSD:BP835033.1,INSD:ES206247.1,INSD:EL321475.1,
FT                   INSD:BP812340.1,INSD:BP821517.1,INSD:T21323.1,
FT                   INSD:DR187265.1,INSD:EL123288.1,INSD:BP575092.1,
FT                   INSD:DR187259.1,INSD:ES056933.1,INSD:AV796654.1,
FT                   INSD:BP796965.1,INSD:BP841170.1,INSD:BP800313.1,
FT                   INSD:BP823070.1,INSD:BP827398.1,INSD:EL033065.1,
FT                   INSD:DR187268.1,INSD:DR187271.1,INSD:EL166424.1,
FT                   INSD:BP826832.1,INSD:EL291281.1,INSD:BP567984.1,
FT                   INSD:EL184120.1,INSD:DR187270.1,INSD:EH912904.1,
FT                   INSD:EL093261.1,INSD:BP836409.1,INSD:BP828424.1,
FT                   INSD:BP818936.1,INSD:CF773050.1,INSD:BP815149.1,
FT                   INSD:EL995855.1,INSD:ES113294.1,INSD:ES081715.1,
FT                   INSD:EL088227.1,INSD:AV802222.1,INSD:EL002964.1,
FT                   INSD:BP800752.1,INSD:BP867737.1,INSD:EH937758.1,
FT                   INSD:ES214429.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX841661.1"
FT                   /protein_id="AED90284.1"
FT   gene            complement(5256..5907)
FT                   /locus_tag="AT5G01015"
FT   mRNA            complement(join(5256..5576,5697..5907))
FT                   /locus_tag="AT5G01015"
FT                   /product="transmembrane protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR279885.1,INSD:DR279889.1,INSD:DR279890.1,
FT                   INSD:DR279892.1,INSD:EL185242.1,INSD:EH915082.1,
FT                   INSD:EH906100.1,INSD:EL138832.1,INSD:EL061886.1,
FT                   INSD:EH806402.1,INSD:DR374946.1,INSD:DR279886.1,
FT                   INSD:DR279891.1,INSD:DR279884.1,INSD:DR279881.1,
FT                   INSD:DR279883.1,INSD:EL041638.1,INSD:DR279887.1,
FT                   INSD:DR279888.1,INSD:DR279882.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT024551.1,INSD:BX833982.1,INSD:BX833637.1,
FT                   INSD:AY087164.1"
FT   CDS_pept        complement(join(5335..5576,5697..5769))
FT                   /codon_start=1
FT                   /locus_tag="AT5G01015"
FT                   /product="transmembrane protein"
FT                   /note="unknown protein; FUNCTIONS IN: molecular_function
FT                   unknown; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: endomembrane system; EXPRESSED IN: 23 plant structures;
FT                   EXPRESSED DURING: 13 growth stages; BEST Arabidopsis
FT                   thaliana protein match is: unknown protein
FT                   (TAIR:AT1G65295.1); Has 30201 Blast hits to 17322 proteins
FT                   in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
FT                   17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
FT                   Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01015.1"
FT                   /db_xref="GOA:Q8LBK1"
FT                   /db_xref="UniProtKB/TrEMBL:Q8LBK1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR279885.1,INSD:DR279889.1,INSD:DR279890.1,
FT                   INSD:DR279892.1,INSD:EL185242.1,INSD:EH915082.1,
FT                   INSD:EH906100.1,INSD:EL138832.1,INSD:EL061886.1,
FT                   INSD:EH806402.1,INSD:DR374946.1,INSD:DR279886.1,
FT                   INSD:DR279891.1,INSD:DR279884.1,INSD:DR279881.1,
FT                   INSD:DR279883.1,INSD:EL041638.1,INSD:DR279887.1,
FT                   INSD:DR279888.1,INSD:DR279882.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT024551.1,INSD:BX833982.1,INSD:BX833637.1,
FT                   INSD:AY087164.1"
FT                   /protein_id="AED90286.1"
FT                   "
FT   gene            5339..5593
FT                   /locus_tag="AT5G01017"
FT   mRNA            5339..5593
FT                   /locus_tag="AT5G01017"
FT                   /product="hypothetical protein"
FT   CDS_pept        5339..5593
FT                   /codon_start=1
FT                   /locus_tag="AT5G01017"
FT                   /product="hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01017"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BAW4"
FT                   /protein_id="ANM68741.1"
FT   mRNA            complement(join(5367..5576,5687..5801))
FT                   /locus_tag="AT5G01015"
FT                   /product="transmembrane protein"
FT   CDS_pept        complement(join(5516..5576,5687..5769))
FT                   /codon_start=1
FT                   /locus_tag="AT5G01015"
FT                   /product="transmembrane protein"
FT                   /note="unknown protein; FUNCTIONS IN: molecular_function
FT                   unknown; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: endomembrane system; EXPRESSED IN: 23 plant structures;
FT                   EXPRESSED DURING: 13 growth stages."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01015"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01015.2"
FT                   /db_xref="GOA:F4K7W9"
FT                   /db_xref="UniProtKB/TrEMBL:F4K7W9"
FT                   /protein_id="AED90287.1"
FT                   GV"
FT   gene            complement(5917..8467)
FT                   /gene_synonym="F7J8.5"
FT                   /gene_synonym="F7J8_5"
FT                   /locus_tag="AT5G01020"
FT   mRNA            complement(join(5917..6790,7212..7335,7440..7576,
FT                   7705..8139,8216..8467))
FT                   /gene_synonym="F7J8.5"
FT                   /gene_synonym="F7J8_5"
FT                   /locus_tag="AT5G01020"
FT                   /product="Protein kinase superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV542668.1,INSD:DR367882.1,INSD:EL166751.1,
FT                   INSD:AJ609355.1,INSD:BP604386.1,INSD:ES201609.1,
FT                   INSD:EH846774.1,INSD:EL064159.1,INSD:EL164792.1,
FT                   INSD:AV816823.1,INSD:DR384217.1,INSD:EL077815.1,
FT                   INSD:AV797668.1,INSD:AV542256.1,INSD:BP791525.1,
FT                   INSD:AV811734.1,INSD:EH968086.1,INSD:DR367880.1,
FT                   INSD:EL082000.1,INSD:BP595609.1,INSD:BP632365.1,
FT                   INSD:ES102947.1,INSD:EL986414.1,INSD:BP622018.1,
FT                   INSD:BP588566.1,INSD:BP782136.1,INSD:ES022685.1,
FT                   INSD:ES092126.1,INSD:BP842708.1,INSD:EH976832.1,
FT                   INSD:ES066402.1,INSD:AV802485.1,INSD:EH836279.1,
FT                   INSD:ES157759.1,INSD:EH800126.1,INSD:EH851418.1,
FT                   INSD:CK120262.1,INSD:AV796565.1,INSD:EL155280.1,
FT                   INSD:EL005719.1,INSD:AV548064.1,INSD:EL324324.1,
FT                   INSD:ES003251.1,INSD:BE524804.1,INSD:BP585141.1,
FT                   INSD:AV550934.1,INSD:EL122246.1,INSD:EH953542.1,
FT                   INSD:ES153720.1,INSD:BP639299.1,INSD:EL079478.1,
FT                   INSD:EL033061.1,INSD:BP590578.1,INSD:AU238791.1,
FT                   INSD:EL164496.1,INSD:EH861276.1,INSD:ES072473.1,
FT                   INSD:EL270504.1,INSD:DR367879.1,INSD:BP787589.1,
FT                   INSD:BP637739.1,INSD:EH978602.1,INSD:EH912905.1,
FT                   INSD:ES058180.1,INSD:ES192104.1,INSD:BP848471.1,
FT                   INSD:EL253453.1,INSD:EH861733.1,INSD:CD534902.1,
FT                   INSD:ES172155.1,INSD:BP779449.1,INSD:EG490591.1,
FT                   INSD:CB262176.1,INSD:BP830687.1,INSD:ES045525.1,
FT                   INSD:EG449293.1,INSD:AB015116.1,INSD:BP833138.1,
FT                   INSD:EL029423.1,INSD:AV543230.1,INSD:EH847199.1,
FT                   INSD:EH835634.1,INSD:AV538629.1,INSD:EH984307.1,
FT                   INSD:BP784060.1,INSD:EL166811.1,INSD:BP664332.1,
FT                   INSD:EL321014.1,INSD:EL999290.1,INSD:EL197413.1,
FT                   INSD:DR367881.1,INSD:EL982126.1,INSD:AV546210.1,
FT                   INSD:AV535079.1,INSD:AA042233.1,INSD:AV537963.1,
FT                   INSD:BP791271.1,INSD:ES140772.1,INSD:EL085367.1,
FT                   INSD:EG449294.1,INSD:ES154156.1,INSD:CK119614.1,
FT                   INSD:BU635172.1,INSD:BP784902.1,INSD:EH875908.1,
FT                   INSD:AV531031.1,INSD:BP842769.1,INSD:BP594979.1,
FT                   INSD:AV558877.1,INSD:DR367878.1,INSD:EH895128.1,
FT                   INSD:BP635372.1,INSD:BP605875.1,INSD:ES125260.1,
FT                   INSD:AI992536.1,INSD:EL176246.1,INSD:ES154423.1,
FT                   INSD:EH989465.1,INSD:EH908113.1,INSD:BP860122.1,
FT                   INSD:EH797563.1,INSD:DR367877.1,INSD:EL112964.1,
FT                   INSD:EH900171.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831068.1,INSD:BX832571.1,INSD:AK117952.1"
FT   CDS_pept        complement(join(6309..6790,7212..7335,7440..7576,
FT                   7705..8139,8216..8270))
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.5"
FT                   /gene_synonym="F7J8_5"
FT                   /locus_tag="AT5G01020"
FT                   /product="Protein kinase superfamily protein"
FT                   /note="Protein kinase superfamily protein; FUNCTIONS IN:
FT                   protein serine/threonine kinase activity, protein kinase
FT                   activity, kinase activity, ATP binding; INVOLVED IN:
FT                   protein amino acid phosphorylation, N-terminal protein
FT                   myristoylation; LOCATED IN: plasma membrane; EXPRESSED IN:
FT                   22 plant structures; EXPRESSED DURING: 13 growth stages;
FT                   CONTAINS InterPro DOMAIN/s: Protein kinase, ATP binding
FT                   site (InterPro:IPR017441), Protein kinase, catalytic domain
FT                   (InterPro:IPR000719), Serine/threonine-protein kinase-like
FT                   domain (InterPro:IPR017442), Protein kinase-like domain
FT                   (InterPro:IPR011009), Serine/threonine-protein kinase,
FT                   active site (InterPro:IPR008271); BEST Arabidopsis thaliana
FT                   protein match is: Protein kinase superfamily protein
FT                   (TAIR:AT2G05940.1); Has 117465 Blast hits to 116000
FT                   proteins in 4235 species: Archae - 97; Bacteria - 13843;
FT                   Metazoa - 43298; Fungi - 9750; Plants - 33095; Viruses -
FT                   372; Other Eukaryotes - 17010 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01020"
FT                   /db_xref="GOA:Q8GXZ3"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8GXZ3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV542668.1,INSD:DR367882.1,INSD:EL166751.1,
FT                   INSD:AJ609355.1,INSD:BP604386.1,INSD:ES201609.1,
FT                   INSD:EH846774.1,INSD:EL064159.1,INSD:EL164792.1,
FT                   INSD:AV816823.1,INSD:DR384217.1,INSD:EL077815.1,
FT                   INSD:AV797668.1,INSD:AV542256.1,INSD:BP791525.1,
FT                   INSD:AV811734.1,INSD:EH968086.1,INSD:DR367880.1,
FT                   INSD:EL082000.1,INSD:BP595609.1,INSD:BP632365.1,
FT                   INSD:ES102947.1,INSD:EL986414.1,INSD:BP622018.1,
FT                   INSD:BP588566.1,INSD:BP782136.1,INSD:ES022685.1,
FT                   INSD:ES092126.1,INSD:BP842708.1,INSD:EH976832.1,
FT                   INSD:ES066402.1,INSD:AV802485.1,INSD:EH836279.1,
FT                   INSD:ES157759.1,INSD:EH800126.1,INSD:EH851418.1,
FT                   INSD:CK120262.1,INSD:AV796565.1,INSD:EL155280.1,
FT                   INSD:EL005719.1,INSD:AV548064.1,INSD:EL324324.1,
FT                   INSD:ES003251.1,INSD:BE524804.1,INSD:BP585141.1,
FT                   INSD:AV550934.1,INSD:EL122246.1,INSD:EH953542.1,
FT                   INSD:ES153720.1,INSD:BP639299.1,INSD:EL079478.1,
FT                   INSD:EL033061.1,INSD:BP590578.1,INSD:AU238791.1,
FT                   INSD:EL164496.1,INSD:EH861276.1,INSD:ES072473.1,
FT                   INSD:EL270504.1,INSD:DR367879.1,INSD:BP787589.1,
FT                   INSD:BP637739.1,INSD:EH978602.1,INSD:EH912905.1,
FT                   INSD:ES058180.1,INSD:ES192104.1,INSD:BP848471.1,
FT                   INSD:EL253453.1,INSD:EH861733.1,INSD:CD534902.1,
FT                   INSD:ES172155.1,INSD:BP779449.1,INSD:EG490591.1,
FT                   INSD:CB262176.1,INSD:BP830687.1,INSD:ES045525.1,
FT                   INSD:EG449293.1,INSD:AB015116.1,INSD:BP833138.1,
FT                   INSD:EL029423.1,INSD:AV543230.1,INSD:EH847199.1,
FT                   INSD:EH835634.1,INSD:AV538629.1,INSD:EH984307.1,
FT                   INSD:BP784060.1,INSD:EL166811.1,INSD:BP664332.1,
FT                   INSD:EL321014.1,INSD:EL999290.1,INSD:EL197413.1,
FT                   INSD:DR367881.1,INSD:EL982126.1,INSD:AV546210.1,
FT                   INSD:AV535079.1,INSD:AA042233.1,INSD:AV537963.1,
FT                   INSD:BP791271.1,INSD:ES140772.1,INSD:EL085367.1,
FT                   INSD:EG449294.1,INSD:ES154156.1,INSD:CK119614.1,
FT                   INSD:BU635172.1,INSD:BP784902.1,INSD:EH875908.1,
FT                   INSD:AV531031.1,INSD:BP842769.1,INSD:BP594979.1,
FT                   INSD:AV558877.1,INSD:DR367878.1,INSD:EH895128.1,
FT                   INSD:BP635372.1,INSD:BP605875.1,INSD:ES125260.1,
FT                   INSD:AI992536.1,INSD:EL176246.1,INSD:ES154423.1,
FT                   INSD:EH989465.1,INSD:EH908113.1,INSD:BP860122.1,
FT                   INSD:EH797563.1,INSD:DR367877.1,INSD:EL112964.1,
FT                   INSD:EH900171.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831068.1,INSD:BX832571.1,INSD:AK117952.1"
FT                   /protein_id="AED90288.1"
FT                   SPGGPAACRVR"
FT   gene            9780..13235
FT                   /gene_synonym="F7J8.10"
FT                   /gene_synonym="F7J8_10"
FT                   /locus_tag="AT5G01030"
FT   mRNA            join(9780..10172,10574..12665,12797..13235)
FT                   /gene_synonym="F7J8.10"
FT                   /gene_synonym="F7J8_10"
FT                   /locus_tag="AT5G01030"
FT                   /product="enolase, putative (DUF3527)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP628641.1,INSD:AV784392.1,INSD:EG507809.1,
FT                   INSD:AV539116.1,INSD:EL096876.1,INSD:EG510072.1,
FT                   INSD:DR366772.1,INSD:BG459331.1,INSD:AV522932.1,
FT                   INSD:EG510074.1,INSD:AV551489.1,INSD:EG507815.1,
FT                   INSD:BP605912.1,INSD:AV823430.1,INSD:BP616094.1,
FT                   INSD:AV547029.1,INSD:EG510066.1,INSD:AV548054.1,
FT                   INSD:BP616398.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831094.1,INSD:BT002362.1,INSD:AY096641.1"
FT   mRNA            join(9780..10172,10620..12665,12797..13235)
FT                   /gene_synonym="F7J8.10"
FT                   /gene_synonym="F7J8_10"
FT                   /locus_tag="AT5G01030"
FT                   /product="enolase, putative (DUF3527)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP628641.1,INSD:DR366778.1,INSD:AV528484.1,
FT                   INSD:AV539116.1,INSD:EL096876.1,INSD:EG510072.1,
FT                   INSD:DR366772.1,INSD:BG459331.1,INSD:EG510074.1,
FT                   INSD:DR366777.1,INSD:DR366773.1,INSD:AV522932.1,
FT                   INSD:BP605912.1,INSD:DR366774.1,INSD:AV547029.1,
FT                   INSD:BP616398.1,INSD:AV784392.1,INSD:EG507809.1,
FT                   INSD:DR366775.1,INSD:DR366776.1,INSD:AV551489.1,
FT                   INSD:EG507815.1,INSD:F14175.1,INSD:BP616094.1,
FT                   INSD:EG510066.1,INSD:AV548054.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831094.1,INSD:BT002362.1"
FT   mRNA            join(9869..12665,12797..13003)
FT                   /gene_synonym="F7J8.10"
FT                   /gene_synonym="F7J8_10"
FT                   /locus_tag="AT5G01030"
FT                   /product="enolase, putative (DUF3527)"
FT   CDS_pept        join(10638..12665,12797..13003)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.10"
FT                   /gene_synonym="F7J8_10"
FT                   /locus_tag="AT5G01030"
FT                   /product="enolase, putative (DUF3527)"
FT                   /db_xref="GOA:Q9LFD3"
FT                   /db_xref="InterPro:IPR021916"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFD3"
FT                   /protein_id="ANM68624.1"
FT   CDS_pept        join(10638..12665,12797..13003)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.10"
FT                   /gene_synonym="F7J8_10"
FT                   /locus_tag="AT5G01030"
FT                   /product="enolase, putative (DUF3527)"
FT                   /note="Protein of unknown function (DUF3527); FUNCTIONS IN:
FT                   molecular_function unknown; INVOLVED IN: biological_process
FT                   unknown; LOCATED IN: cellular_component unknown; EXPRESSED
FT                   IN: 24 plant structures; EXPRESSED DURING: 13 growth
FT                   stages; CONTAINS InterPro DOMAIN/s: Protein of unknown
FT                   function DUF3527 (InterPro:IPR021916); BEST Arabidopsis
FT                   thaliana protein match is: Protein of unknown function
FT                   (DUF3527) (TAIR:AT2G37930.1); Has 1807 Blast hits to 1807
FT                   proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa
FT                   - 736; Fungi - 347; Plants - 385; Viruses - 0; Other
FT                   Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LFD3"
FT                   /db_xref="InterPro:IPR021916"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFD3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP628641.1,INSD:AV784392.1,INSD:EG507809.1,
FT                   INSD:AV539116.1,INSD:EL096876.1,INSD:EG510072.1,
FT                   INSD:DR366772.1,INSD:BG459331.1,INSD:AV522932.1,
FT                   INSD:EG510074.1,INSD:AV551489.1,INSD:EG507815.1,
FT                   INSD:BP605912.1,INSD:AV823430.1,INSD:BP616094.1,
FT                   INSD:AV547029.1,INSD:EG510066.1,INSD:AV548054.1,
FT                   INSD:BP616398.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831094.1,INSD:BT002362.1,INSD:AY096641.1"
FT                   /protein_id="AED90289.1"
FT   CDS_pept        join(10638..12665,12797..13003)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.10"
FT                   /gene_synonym="F7J8_10"
FT                   /locus_tag="AT5G01030"
FT                   /product="enolase, putative (DUF3527)"
FT                   /note="Protein of unknown function (DUF3527); FUNCTIONS IN:
FT                   molecular_function unknown; INVOLVED IN: biological_process
FT                   unknown; LOCATED IN: cellular_component unknown; EXPRESSED
FT                   IN: 24 plant structures; EXPRESSED DURING: 13 growth
FT                   stages; CONTAINS InterPro DOMAIN/s: Protein of unknown
FT                   function DUF3527 (InterPro:IPR021916); BEST Arabidopsis
FT                   thaliana protein match is: Protein of unknown function
FT                   (DUF3527) (TAIR:AT2G37930.1); Has 286 Blast hits to 251
FT                   proteins in 78 species: Archae - 0; Bacteria - 81; Metazoa
FT                   - 28; Fungi - 27; Plants - 128; Viruses - 0; Other
FT                   Eukaryotes - 22 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01030"
FT                   /db_xref="GOA:Q9LFD3"
FT                   /db_xref="InterPro:IPR021916"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFD3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP628641.1,INSD:DR366778.1,INSD:AV528484.1,
FT                   INSD:AV539116.1,INSD:EL096876.1,INSD:EG510072.1,
FT                   INSD:DR366772.1,INSD:BG459331.1,INSD:EG510074.1,
FT                   INSD:DR366777.1,INSD:DR366773.1,INSD:AV522932.1,
FT                   INSD:BP605912.1,INSD:DR366774.1,INSD:AV547029.1,
FT                   INSD:BP616398.1,INSD:AV784392.1,INSD:EG507809.1,
FT                   INSD:DR366775.1,INSD:DR366776.1,INSD:AV551489.1,
FT                   INSD:EG507815.1,INSD:F14175.1,INSD:BP616094.1,
FT                   INSD:EG510066.1,INSD:AV548054.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831094.1,INSD:BT002362.1"
FT                   /protein_id="AED90290.1"
FT   gene            complement(13128..16236)
FT                   /gene="LAC8"
FT                   /gene_synonym="F7J8.20"
FT                   /gene_synonym="F7J8_20"
FT                   /gene_synonym="laccase 8"
FT                   /locus_tag="AT5G01040"
FT                   /note="putative laccase, knockout mutant showed early
FT                   flowering"
FT   mRNA            complement(join(13128..13578,13703..14665,14764..14874,
FT                   15191..15435,15579..15730,16044..16236))
FT                   /gene="LAC8"
FT                   /gene_synonym="F7J8.20"
FT                   /gene_synonym="F7J8_20"
FT                   /gene_synonym="laccase 8"
FT                   /locus_tag="AT5G01040"
FT                   /product="laccase 8"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP628641.1,INSD:AV545019.1,INSD:EG510082.1,
FT                   INSD:BE525703.1,INSD:CB252826.1,INSD:AV539116.1,
FT                   INSD:EG510046.1,INSD:AV551119.1,INSD:AV544086.1,
FT                   INSD:EG510072.1,INSD:EG510080.1,INSD:EG510074.1,
FT                   INSD:EG510079.1,INSD:BP810741.1,INSD:AV553978.1,
FT                   INSD:BP605912.1,INSD:EG476895.1,INSD:AV553631.1,
FT                   INSD:EG510060.1,INSD:EG510048.1,INSD:AV548944.1,
FT                   INSD:EG476952.1,INSD:EL190154.1,INSD:BP616398.1,
FT                   INSD:AV784392.1,INSD:EG507809.1,INSD:AV542740.1,
FT                   INSD:EG510090.1,INSD:EL013148.1,INSD:EG426485.1,
FT                   INSD:BP801383.1,INSD:EG507815.1,INSD:BP616094.1,
FT                   INSD:AU229348.1,INSD:AV543742.1,INSD:EG507800.1,
FT                   INSD:EG510062.1,INSD:EG440606.1,INSD:EG510066.1,
FT                   INSD:AV548054.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832359.1,INSD:BX832175.1"
FT   CDS_pept        complement(join(13394..13578,13703..14665,14764..14874,
FT                   15191..15435,15579..15730,16044..16142))
FT                   /codon_start=1
FT                   /gene="LAC8"
FT                   /gene_synonym="F7J8.20"
FT                   /gene_synonym="F7J8_20"
FT                   /gene_synonym="laccase 8"
FT                   /locus_tag="AT5G01040"
FT                   /product="laccase 8"
FT                   /note="laccase 8 (LAC8); FUNCTIONS IN: laccase activity;
FT                   INVOLVED IN: vegetative to reproductive phase transition of
FT                   meristem, response to copper ion; LOCATED IN: endomembrane
FT                   system, apoplast; EXPRESSED IN: fruit, root, flower;
FT                   CONTAINS InterPro DOMAIN/s: Multicopper oxidase, type 2
FT                   (InterPro:IPR011706), Multicopper oxidase, type 3
FT                   (InterPro:IPR011707), Laccase (InterPro:IPR017761),
FT                   Cupredoxin (InterPro:IPR008972), Multicopper oxidase, type
FT                   1 (InterPro:IPR001117); BEST Arabidopsis thaliana protein
FT                   match is: Laccase/Diphenol oxidase family protein
FT                   (TAIR:AT5G01050.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LFD2"
FT                   /db_xref="InterPro:IPR001117"
FT                   /db_xref="InterPro:IPR008972"
FT                   /db_xref="InterPro:IPR011706"
FT                   /db_xref="InterPro:IPR011707"
FT                   /db_xref="InterPro:IPR017761"
FT                   /db_xref="InterPro:IPR034285"
FT                   /db_xref="InterPro:IPR034288"
FT                   /db_xref="InterPro:IPR034289"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFD2"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP628641.1,INSD:AV545019.1,INSD:EG510082.1,
FT                   INSD:BE525703.1,INSD:CB252826.1,INSD:AV539116.1,
FT                   INSD:EG510046.1,INSD:AV551119.1,INSD:AV544086.1,
FT                   INSD:EG510072.1,INSD:EG510080.1,INSD:EG510074.1,
FT                   INSD:EG510079.1,INSD:BP810741.1,INSD:AV553978.1,
FT                   INSD:BP605912.1,INSD:EG476895.1,INSD:AV553631.1,
FT                   INSD:EG510060.1,INSD:EG510048.1,INSD:AV548944.1,
FT                   INSD:EG476952.1,INSD:EL190154.1,INSD:BP616398.1,
FT                   INSD:AV784392.1,INSD:EG507809.1,INSD:AV542740.1,
FT                   INSD:EG510090.1,INSD:EL013148.1,INSD:EG426485.1,
FT                   INSD:BP801383.1,INSD:EG507815.1,INSD:BP616094.1,
FT                   INSD:AU229348.1,INSD:AV543742.1,INSD:EG507800.1,
FT                   INSD:EG510062.1,INSD:EG440606.1,INSD:EG510066.1,
FT                   INSD:AV548054.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832359.1,INSD:BX832175.1"
FT                   /protein_id="AED90291.1"
FT                   TTNIDLSY"
FT   gene            complement(18086..20887)
FT                   /gene_synonym="F7J8.30"
FT                   /gene_synonym="F7J8_30"
FT                   /gene_synonym="LAC9"
FT                   /locus_tag="AT5G01050"
FT                   /note="putative laccase, a member of laccase family of
FT                   genes (17 members in Arabidopsis)."
FT   mRNA            complement(join(18086..18393,18481..19449,19570..19680,
FT                   19970..20214,20358..20509,20714..20887))
FT                   /gene_synonym="F7J8.30"
FT                   /gene_synonym="F7J8_30"
FT                   /gene_synonym="LAC9"
FT                   /locus_tag="AT5G01050"
FT                   /product="Laccase/Diphenol oxidase family protein"
FT                   /inference="similar to RNA sequence, EST:INSD:AV548905.1"
FT   CDS_pept        complement(join(18209..18393,18481..19449,19570..19680,
FT                   19970..20214,20358..20509,20714..20812))
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.30"
FT                   /gene_synonym="F7J8_30"
FT                   /gene_synonym="LAC9"
FT                   /locus_tag="AT5G01050"
FT                   /product="Laccase/Diphenol oxidase family protein"
FT                   /note="Laccase/Diphenol oxidase family protein; FUNCTIONS
FT                   IN: laccase activity; INVOLVED IN: oxidation reduction,
FT                   lignin catabolic process; LOCATED IN: endomembrane system,
FT                   apoplast; EXPRESSED IN: root, flower; CONTAINS InterPro
FT                   DOMAIN/s: Multicopper oxidase, type 3 (InterPro:IPR011707),
FT                   Laccase (InterPro:IPR017761), Multicopper oxidase, type 2
FT                   (InterPro:IPR011706), Cupredoxin (InterPro:IPR008972),
FT                   Multicopper oxidase, type 1 (InterPro:IPR001117); BEST
FT                   Arabidopsis thaliana protein match is: laccase 8
FT                   (TAIR:AT5G01040.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LFD1"
FT                   /db_xref="InterPro:IPR001117"
FT                   /db_xref="InterPro:IPR008972"
FT                   /db_xref="InterPro:IPR011706"
FT                   /db_xref="InterPro:IPR011707"
FT                   /db_xref="InterPro:IPR017761"
FT                   /db_xref="InterPro:IPR034285"
FT                   /db_xref="InterPro:IPR034288"
FT                   /db_xref="InterPro:IPR034289"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFD1"
FT                   /inference="similar to RNA sequence, EST:INSD:AV548905.1"
FT                   /protein_id="AED90292.1"
FT                   SRTTNVDMSY"
FT   gene            22684..24934
FT                   /gene="BSK10"
FT                   /gene_synonym="brassinosteroid-signaling kinase 10"
FT                   /gene_synonym="F7J8.40"
FT                   /gene_synonym="F7J8_40"
FT                   /locus_tag="AT5G01060"
FT   mRNA            join(22684..23271,23359..23492,23580..23771,23858..24079,
FT                   24181..24336,24412..24525,24617..24928)
FT                   /gene="BSK10"
FT                   /gene_synonym="brassinosteroid-signaling kinase 10"
FT                   /gene_synonym="F7J8.40"
FT                   /gene_synonym="F7J8_40"
FT                   /locus_tag="AT5G01060"
FT                   /product="kinase with tetratricopeptide repeat
FT                   domain-containing protein"
FT   mRNA            join(22684..23054,23136..23271,23359..23492,23580..23771,
FT                   23858..24336,24412..24525,24617..24928)
FT                   /gene="BSK10"
FT                   /gene_synonym="brassinosteroid-signaling kinase 10"
FT                   /gene_synonym="F7J8.40"
FT                   /gene_synonym="F7J8_40"
FT                   /locus_tag="AT5G01060"
FT                   /product="kinase with tetratricopeptide repeat
FT                   domain-containing protein"
FT   mRNA            join(22686..23054,23136..23271,23359..23492,23580..23771,
FT                   23858..24079,24181..24336,24412..24525,24617..24934)
FT                   /gene="BSK10"
FT                   /gene_synonym="brassinosteroid-signaling kinase 10"
FT                   /gene_synonym="F7J8.40"
FT                   /gene_synonym="F7J8_40"
FT                   /locus_tag="AT5G01060"
FT                   /product="kinase with tetratricopeptide repeat
FT                   domain-containing protein"
FT   CDS_pept        join(22740..23054,23136..23271,23359..23492,23580..23771,
FT                   23858..24079,24181..24336,24412..24525,24617..24847)
FT                   /codon_start=1
FT                   /gene="BSK10"
FT                   /gene_synonym="F7J8.40"
FT                   /gene_synonym="F7J8_40"
FT                   /gene_synonym="brassinosteroid-signaling kinase 10"
FT                   /locus_tag="AT5G01060"
FT                   /product="kinase with tetratricopeptide repeat
FT                   domain-containing protein"
FT                   /note="Protein kinase protein with tetratricopeptide repeat
FT                   domain; FUNCTIONS IN: binding, protein kinase activity,
FT                   kinase activity, ATP binding; INVOLVED IN: protein amino
FT                   acid phosphorylation, N-terminal protein myristoylation;
FT                   LOCATED IN: cellular_component unknown; EXPRESSED IN:
FT                   petal, cotyledon, root; EXPRESSED DURING: petal
FT                   differentiation and expansion stage; CONTAINS InterPro
FT                   DOMAIN/s: Tetratricopeptide-like helical
FT                   (InterPro:IPR011990), Protein kinase, catalytic domain
FT                   (InterPro:IPR000719), Serine-threonine/tyrosine-protein
FT                   kinase (InterPro:IPR001245), Protein kinase-like domain
FT                   (InterPro:IPR011009); BEST Arabidopsis thaliana protein
FT                   match is: Protein kinase protein with tetratricopeptide
FT                   repeat domain (TAIR:AT3G09240.1); Has 1807 Blast hits to
FT                   1807 proteins in 277 species: Archae - 0; Bacteria - 0;
FT                   Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
FT                   Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LFD0"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFD0"
FT                   /protein_id="AED90293.1"
FT   CDS_pept        join(22740..23054,23136..23271,23359..23492,23580..23771,
FT                   23858..24130)
FT                   /codon_start=1
FT                   /gene="BSK10"
FT                   /gene_synonym="brassinosteroid-signaling kinase 10"
FT                   /gene_synonym="F7J8.40"
FT                   /gene_synonym="F7J8_40"
FT                   /locus_tag="AT5G01060"
FT                   /product="kinase with tetratricopeptide repeat
FT                   domain-containing protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01060"
FT                   /db_xref="GOA:A0A1P8BE32"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BE32"
FT                   /protein_id="ANM69869.1"
FT                   YSRIKNSLS"
FT   CDS_pept        join(23175..23271,23359..23492,23580..23771,23858..24079,
FT                   24181..24336,24412..24525,24617..24847)
FT                   /codon_start=1
FT                   /gene="BSK10"
FT                   /gene_synonym="brassinosteroid-signaling kinase 10"
FT                   /gene_synonym="F7J8.40"
FT                   /gene_synonym="F7J8_40"
FT                   /locus_tag="AT5G01060"
FT                   /product="kinase with tetratricopeptide repeat
FT                   domain-containing protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01060"
FT                   /db_xref="GOA:A0A1P8BE40"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BE40"
FT                   /protein_id="ANM69868.1"
FT   gene            complement(25012..25908)
FT                   /gene_synonym="F7J8.50"
FT                   /gene_synonym="F7J8_50"
FT                   /locus_tag="AT5G01070"
FT   mRNA            complement(join(25012..25343,25429..25908))
FT                   /gene_synonym="F7J8.50"
FT                   /gene_synonym="F7J8_50"
FT                   /locus_tag="AT5G01070"
FT                   /product="RING/FYVE/PHD zinc finger superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT024791.1,INSD:DQ059128.1"
FT   CDS_pept        complement(join(25094..25343,25429..25799))
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.50"
FT                   /gene_synonym="F7J8_50"
FT                   /locus_tag="AT5G01070"
FT                   /product="RING/FYVE/PHD zinc finger superfamily protein"
FT                   /note="RING/FYVE/PHD zinc finger superfamily protein;
FT                   FUNCTIONS IN: zinc ion binding; CONTAINS InterPro DOMAIN/s:
FT                   Zinc finger, C3HC4 RING-type (InterPro:IPR018957), Zinc
FT                   finger, RING-CH-type (InterPro:IPR011016); BEST Arabidopsis
FT                   thaliana protein match is: RING/FYVE/PHD zinc finger
FT                   superfamily protein (TAIR:AT2G37950.1); Has 1807 Blast hits
FT                   to 1807 proteins in 277 species: Archae - 0; Bacteria - 0;
FT                   Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
FT                   Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:F4K7X7"
FT                   /db_xref="InterPro:IPR011016"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR033275"
FT                   /db_xref="UniProtKB/TrEMBL:F4K7X7"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT024791.1,INSD:DQ059128.1"
FT                   /protein_id="AED90294.2"
FT   gene            complement(26848..27504)
FT                   /locus_tag="AT5G01075"
FT   mRNA            complement(join(26848..27267,27351..27504))
FT                   /locus_tag="AT5G01075"
FT                   /product="Glycosyl hydrolase family 35 protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL111903.1,INSD:EL065227.1,INSD:BP562893.2,
FT                   INSD:DR315685.1,INSD:DR370183.1,INSD:AU227960.1,
FT                   INSD:DR315680.1,INSD:DR315684.1,INSD:DR315682.1,
FT                   INSD:DR315686.1,INSD:DR376369.1,INSD:DR315687.1,
FT                   INSD:DR315681.1,INSD:DR315683.1,INSD:EL122470.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT026404.1,INSD:BT004244.1,INSD:BT020286.1,
FT                   INSD:AY085186.1"
FT   CDS_pept        complement(join(27095..27267,27351..27423))
FT                   /codon_start=1
FT                   /locus_tag="AT5G01075"
FT                   /product="Glycosyl hydrolase family 35 protein"
FT                   /note="Glycosyl hydrolase family 35 protein; FUNCTIONS IN:
FT                   hydrolase activity, hydrolyzing O-glycosyl compounds;
FT                   INVOLVED IN: carbohydrate metabolic process; LOCATED IN:
FT                   endomembrane system; EXPRESSED IN: 19 plant structures;
FT                   EXPRESSED DURING: 13 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Glycoside hydrolase, family 35
FT                   (InterPro:IPR001944); Has 30201 Blast hits to 17322
FT                   proteins in 780 species: Archae - 12; Bacteria - 1396;
FT                   Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
FT                   Other Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01075"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01075.1"
FT                   /db_xref="GOA:Q8LEW6"
FT                   /db_xref="UniProtKB/TrEMBL:Q8LEW6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL111903.1,INSD:EL065227.1,INSD:BP562893.2,
FT                   INSD:DR315685.1,INSD:DR370183.1,INSD:AU227960.1,
FT                   INSD:DR315680.1,INSD:DR315684.1,INSD:DR315682.1,
FT                   INSD:DR315686.1,INSD:DR376369.1,INSD:DR315687.1,
FT                   INSD:DR315681.1,INSD:DR315683.1,INSD:EL122470.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT026404.1,INSD:BT004244.1,INSD:BT020286.1,
FT                   INSD:AY085186.1"
FT                   /protein_id="AED90296.1"
FT   gene            complement(28532..29086)
FT                   /gene_synonym="F7J8.60"
FT                   /gene_synonym="F7J8_60"
FT                   /locus_tag="AT5G01080"
FT   mRNA            complement(28532..29086)
FT                   /gene_synonym="F7J8.60"
FT                   /gene_synonym="F7J8_60"
FT                   /locus_tag="AT5G01080"
FT                   /product="Beta-galactosidase related protein"
FT                   /inference="similar to RNA sequence, EST:INSD:ES063959.1"
FT   CDS_pept        complement(28532..29086)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.60"
FT                   /gene_synonym="F7J8_60"
FT                   /locus_tag="AT5G01080"
FT                   /product="Beta-galactosidase related protein"
FT                   /note="Beta-galactosidase related protein; FUNCTIONS IN:
FT                   hydrolase activity, hydrolyzing O-glycosyl compounds;
FT                   INVOLVED IN: carbohydrate metabolic process; CONTAINS
FT                   InterPro DOMAIN/s: Glycoside hydrolase, family 35
FT                   (InterPro:IPR001944); BEST Arabidopsis thaliana protein
FT                   match is: Beta-galactosidase related protein
FT                   (TAIR:AT5G35760.1); Has 30201 Blast hits to 17322 proteins
FT                   in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
FT                   17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
FT                   Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01080"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01080.1"
FT                   /db_xref="GOA:F4K7X9"
FT                   /db_xref="UniProtKB/TrEMBL:F4K7X9"
FT                   /inference="similar to RNA sequence, EST:INSD:ES063959.1"
FT                   /protein_id="AED90297.1"
FT   gene            complement(30097..30877)
FT                   /locus_tag="AT5G00325"
FT   misc_RNA        complement(join(30097..30402,30760..30877))
FT                   /locus_tag="AT5G00325"
FT                   /note="novel transcribed region; AT5G00325.1"
FT   gene            32780..34376
FT                   /gene_synonym="F7J8.70"
FT                   /gene_synonym="F7J8_70"
FT                   /locus_tag="AT5G01090"
FT   mRNA            32780..34376
FT                   /gene_synonym="F7J8.70"
FT                   /gene_synonym="F7J8_70"
FT                   /locus_tag="AT5G01090"
FT                   /product="Concanavalin A-like lectin family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CB259122.1,INSD:EL254872.1,INSD:ES181783.1,
FT                   INSD:EL999500.1,INSD:BP779861.1,INSD:ES102589.1,
FT                   INSD:ES059209.1,INSD:AU227487.1,INSD:EL115606.1,
FT                   INSD:ES060963.1,INSD:ES194348.1,INSD:EL138001.1,
FT                   INSD:ES095586.1,INSD:ES130862.1,INSD:CB259782.1,
FT                   INSD:BP659977.1,INSD:EH968387.1,INSD:ES171696.1,
FT                   INSD:EL200584.1,INSD:BP661371.1,INSD:BP593608.1,
FT                   INSD:AU236536.1,INSD:ES110178.1,INSD:ES009620.1,
FT                   INSD:EL200793.1,INSD:ES214075.1,INSD:DR376811.1,
FT                   INSD:AV557596.1,INSD:ES050811.1,INSD:EH798333.1,
FT                   INSD:BP860691.1,INSD:EL246126.1,INSD:T45244.1,
FT                   INSD:ES181749.1,INSD:EH854912.1,INSD:EH910126.1,
FT                   INSD:F13962.1,INSD:BP841481.1,INSD:BP640127.1,
FT                   INSD:ES176887.1,INSD:ES094966.1,INSD:ES089834.1,
FT                   INSD:F14046.1,INSD:EL985127.1,INSD:EL970808.1,
FT                   INSD:EL098094.1,INSD:AV534557.1,INSD:EH814314.1,
FT                   INSD:EL105261.1,INSD:ES097721.1,INSD:ES191355.1,
FT                   INSD:ES151590.1,INSD:DR231932.1,INSD:T45690.1,
FT                   INSD:EL010969.1,INSD:BP829595.1,INSD:EL160234.1,
FT                   INSD:EL992313.1,INSD:EL312062.1,INSD:ES041377.1,
FT                   INSD:ES038430.1,INSD:BP827058.1,INSD:DR231933.1,
FT                   INSD:ES108134.1,INSD:EG439761.1,INSD:BP588343.1,
FT                   INSD:BP821480.1,INSD:ES074194.1,INSD:EH983067.1,
FT                   INSD:EL267397.1,INSD:EH802366.1,INSD:ES018470.1,
FT                   INSD:EL984625.1,INSD:ES093387.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832720.1,INSD:AY088097.1,INSD:BX832388.1,
FT                   INSD:BX832299.1,INSD:AK228471.1,INSD:BX829725.1"
FT   CDS_pept        33055..34116
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.70"
FT                   /gene_synonym="F7J8_70"
FT                   /locus_tag="AT5G01090"
FT                   /product="Concanavalin A-like lectin family protein"
FT                   /note="Concanavalin A-like lectin family protein; FUNCTIONS
FT                   IN: carbohydrate binding, binding; INVOLVED IN:
FT                   biological_process unknown; LOCATED IN: endomembrane
FT                   system; EXPRESSED IN: 22 plant structures; EXPRESSED
FT                   DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
FT                   Legume lectin, beta chain (InterPro:IPR001220),
FT                   Concanavalin A-like lectin/glucanase, subgroup
FT                   (InterPro:IPR013320), Concanavalin A-like lectin/glucanase
FT                   (InterPro:IPR008985); BEST Arabidopsis thaliana protein
FT                   match is: Concanavalin A-like lectin family protein
FT                   (TAIR:AT3G09190.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LFC7"
FT                   /db_xref="InterPro:IPR001220"
FT                   /db_xref="InterPro:IPR013320"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFC7"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CB259122.1,INSD:EL254872.1,INSD:ES181783.1,
FT                   INSD:EL999500.1,INSD:BP779861.1,INSD:ES102589.1,
FT                   INSD:ES059209.1,INSD:AU227487.1,INSD:EL115606.1,
FT                   INSD:ES060963.1,INSD:ES194348.1,INSD:EL138001.1,
FT                   INSD:ES095586.1,INSD:ES130862.1,INSD:CB259782.1,
FT                   INSD:BP659977.1,INSD:EH968387.1,INSD:ES171696.1,
FT                   INSD:EL200584.1,INSD:BP661371.1,INSD:BP593608.1,
FT                   INSD:AU236536.1,INSD:ES110178.1,INSD:ES009620.1,
FT                   INSD:EL200793.1,INSD:ES214075.1,INSD:DR376811.1,
FT                   INSD:AV557596.1,INSD:ES050811.1,INSD:EH798333.1,
FT                   INSD:BP860691.1,INSD:EL246126.1,INSD:T45244.1,
FT                   INSD:ES181749.1,INSD:EH854912.1,INSD:EH910126.1,
FT                   INSD:F13962.1,INSD:BP841481.1,INSD:BP640127.1,
FT                   INSD:ES176887.1,INSD:ES094966.1,INSD:ES089834.1,
FT                   INSD:F14046.1,INSD:EL985127.1,INSD:EL970808.1,
FT                   INSD:EL098094.1,INSD:AV534557.1,INSD:EH814314.1,
FT                   INSD:EL105261.1,INSD:ES097721.1,INSD:ES191355.1,
FT                   INSD:ES151590.1,INSD:DR231932.1,INSD:T45690.1,
FT                   INSD:EL010969.1,INSD:BP829595.1,INSD:EL160234.1,
FT                   INSD:EL992313.1,INSD:EL312062.1,INSD:ES041377.1,
FT                   INSD:ES038430.1,INSD:BP827058.1,INSD:DR231933.1,
FT                   INSD:ES108134.1,INSD:EG439761.1,INSD:BP588343.1,
FT                   INSD:BP821480.1,INSD:ES074194.1,INSD:EH983067.1,
FT                   INSD:EL267397.1,INSD:EH802366.1,INSD:ES018470.1,
FT                   INSD:EL984625.1,INSD:ES093387.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832720.1,INSD:AY088097.1,INSD:BX832388.1,
FT                   INSD:BX832299.1,INSD:AK228471.1,INSD:BX829725.1"
FT                   /protein_id="AED90298.1"
FT                   TKADVVVEEEVKK"
FT   gene            complement(34538..37999)
FT                   /gene="FRB1"
FT                   /gene_synonym="F7J8.80"
FT                   /gene_synonym="F7J8_80"
FT                   /gene_synonym="FRIABLE 1"
FT                   /locus_tag="AT5G01100"
FT   mRNA            complement(join(34538..35133,35219..35695,35787..36019,
FT                   36122..36254,36327..36415,36497..36567,36656..36725,
FT                   37196..37999))
FT                   /gene="FRB1"
FT                   /gene_synonym="F7J8.80"
FT                   /gene_synonym="F7J8_80"
FT                   /gene_synonym="FRIABLE 1"
FT                   /locus_tag="AT5G01100"
FT                   /product="O-fucosyltransferase family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP577816.1,INSD:AU226934.1,INSD:BP574125.1,
FT                   INSD:EG503413.1,INSD:ES189896.1,INSD:ES193829.1,
FT                   INSD:EG496316.1,INSD:EL193772.1,INSD:BP803799.1,
FT                   INSD:EG503412.1,INSD:AU236118.1,INSD:BP581712.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT046173.1,INSD:AK228227.1,INSD:BX832511.1"
FT   CDS_pept        complement(join(34872..35133,35219..35695,35787..36019,
FT                   36122..36254,36327..36415,36497..36567,36656..36725,
FT                   37196..37756))
FT                   /codon_start=1
FT                   /gene="FRB1"
FT                   /gene_synonym="F7J8.80"
FT                   /gene_synonym="F7J8_80"
FT                   /gene_synonym="FRIABLE 1"
FT                   /locus_tag="AT5G01100"
FT                   /product="O-fucosyltransferase family protein"
FT                   /note="O-fucosyltransferase family protein; CONTAINS
FT                   InterPro DOMAIN/s: GDP-fucose protein O-fucosyltransferase
FT                   (InterPro:IPR019378); BEST Arabidopsis thaliana protein
FT                   match is: O-fucosyltransferase family protein
FT                   (TAIR:AT3G54100.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LFC6"
FT                   /db_xref="InterPro:IPR019378"
FT                   /db_xref="InterPro:IPR024709"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFC6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP577816.1,INSD:AU226934.1,INSD:BP574125.1,
FT                   INSD:EG503413.1,INSD:ES189896.1,INSD:ES193829.1,
FT                   INSD:EG496316.1,INSD:EL193772.1,INSD:BP803799.1,
FT                   INSD:EG503412.1,INSD:AU236118.1,INSD:BP581712.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT046173.1,INSD:AK228227.1,INSD:BX832511.1"
FT                   /protein_id="AED90299.1"
FT   gene            40704..41104
FT                   /locus_tag="AT5G00735"
FT   ncRNA           40704..41104
FT                   /locus_tag="AT5G00735"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            complement(40858..41104)
FT                   /locus_tag="AT5G00740"
FT   ncRNA           complement(40858..41104)
FT                   /locus_tag="AT5G00740"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            complement(41768..44512)
FT                   /gene_synonym="F7J8.90"
FT                   /gene_synonym="F7J8_90"
FT                   /locus_tag="AT5G01110"
FT   mRNA            complement(41768..44512)
FT                   /gene_synonym="F7J8.90"
FT                   /gene_synonym="F7J8_90"
FT                   /locus_tag="AT5G01110"
FT                   /product="Tetratricopeptide repeat (TPR)-like superfamily
FT                   protein"
FT   mRNA            complement(41768..44375)
FT                   /gene_synonym="F7J8.90"
FT                   /gene_synonym="F7J8_90"
FT                   /locus_tag="AT5G01110"
FT                   /product="Tetratricopeptide repeat (TPR)-like superfamily
FT                   protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU227497.1,INSD:AU236546.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK228473.1,INSD:BT005783.1"
FT   CDS_pept        complement(42114..44387)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.90"
FT                   /gene_synonym="F7J8_90"
FT                   /locus_tag="AT5G01110"
FT                   /product="Tetratricopeptide repeat (TPR)-like superfamily
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01110"
FT                   /db_xref="InterPro:IPR002885"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BGD3"
FT                   /protein_id="ANM70669.1"
FT                   DDKF"
FT   CDS_pept        complement(42114..44303)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.90"
FT                   /gene_synonym="F7J8_90"
FT                   /locus_tag="AT5G01110"
FT                   /product="Tetratricopeptide repeat (TPR)-like superfamily
FT                   protein"
FT                   /note="Tetratricopeptide repeat (TPR)-like superfamily
FT                   protein; LOCATED IN: chloroplast; CONTAINS InterPro
FT                   DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885);
FT                   BEST Arabidopsis thaliana protein match is:
FT                   Pentatricopeptide repeat (PPR-like) superfamily protein
FT                   (TAIR:AT1G05670.2); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01110"
FT                   /db_xref="InterPro:IPR002885"
FT                   /db_xref="InterPro:IPR011990"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFC5"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU227497.1,INSD:AU236546.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK228473.1,INSD:BT005783.1"
FT                   /protein_id="AED90300.1"
FT   gene            44810..47206
FT                   /gene_synonym="F7J8.100"
FT                   /gene_synonym="F7J8_100"
FT                   /locus_tag="AT5G01120"
FT   mRNA            join(44810..44896,45281..45928,46012..46761,46852..47206)
FT                   /gene_synonym="F7J8.100"
FT                   /gene_synonym="F7J8_100"
FT                   /locus_tag="AT5G01120"
FT                   /product="hypothetical protein (DUF674)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG448915.1,INSD:EG448885.1,INSD:EG448928.1,
FT                   INSD:EG448920.1,INSD:EG448918.1,INSD:EG448914.1,
FT                   INSD:EG448916.1,INSD:EG448884.1,INSD:EG448927.1,
FT                   INSD:EG448917.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AY735669.1"
FT   CDS_pept        join(45281..45928,46012..46761,46852..46986)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.100"
FT                   /gene_synonym="F7J8_100"
FT                   /locus_tag="AT5G01120"
FT                   /product="hypothetical protein (DUF674)"
FT                   /note="Protein of unknown function (DUF674); CONTAINS
FT                   InterPro DOMAIN/s: Protein of unknown function DUF674
FT                   (InterPro:IPR007750); BEST Arabidopsis thaliana protein
FT                   match is: Protein of unknown function (DUF674)
FT                   (TAIR:AT5G43240.3); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01120"
FT                   /db_xref="InterPro:IPR007750"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFC4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG448915.1,INSD:EG448885.1,INSD:EG448928.1,
FT                   INSD:EG448920.1,INSD:EG448918.1,INSD:EG448914.1,
FT                   INSD:EG448916.1,INSD:EG448884.1,INSD:EG448927.1,
FT                   INSD:EG448917.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AY735669.1"
FT                   /protein_id="AED90301.1"
FT   gene            47570..49512
FT                   /gene_synonym="F7J8.110"
FT                   /gene_synonym="F7J8_110"
FT                   /locus_tag="AT5G01130"
FT   mRNA            join(47570..48253,48355..49005,49079..49199,49283..49512)
FT                   /gene_synonym="F7J8.110"
FT                   /gene_synonym="F7J8_110"
FT                   /locus_tag="AT5G01130"
FT                   /product="hypothetical protein (DUF674)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG492395.1,INSD:EG524343.1,INSD:EG523695.1,
FT                   INSD:EG523704.1,INSD:EG523703.1,INSD:EG492399.1,
FT                   INSD:EG492400.1,INSD:EG524354.1,INSD:EG524346.1,
FT                   INSD:EG524352.1,INSD:EG524340.1,INSD:EG523699.1,
FT                   INSD:EG429963.1,INSD:EG523697.1,INSD:EG492397.1,
FT                   INSD:EG492402.1,INSD:EG524338.1,INSD:EG492398.1,
FT                   INSD:EG492403.1,INSD:EG524357.1,INSD:EG523694.1,
FT                   INSD:EG523696.1,INSD:EG523691.1,INSD:EG524341.1,
FT                   INSD:EG523693.1,INSD:EG524339.1,INSD:EG524355.1,
FT                   INSD:EG523692.1,INSD:EG523643.1,INSD:EG524353.1,
FT                   INSD:EG492394.1,INSD:EG524342.1,INSD:EG524347.1,
FT                   INSD:EG492393.1,INSD:EG492401.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:DQ653258.1"
FT   CDS_pept        join(47642..48253,48355..49005,49079..49174)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.110"
FT                   /gene_synonym="F7J8_110"
FT                   /locus_tag="AT5G01130"
FT                   /product="hypothetical protein (DUF674)"
FT                   /note="Protein of unknown function (DUF674); CONTAINS
FT                   InterPro DOMAIN/s: Protein of unknown function DUF674
FT                   (InterPro:IPR007750); BEST Arabidopsis thaliana protein
FT                   match is: Protein of unknown function (DUF674)
FT                   (TAIR:AT5G01150.1); Has 30201 Blast hits to 17322 proteins
FT                   in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
FT                   17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
FT                   Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01130"
FT                   /db_xref="InterPro:IPR007750"
FT                   /db_xref="UniProtKB/TrEMBL:F4K7Y4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG492395.1,INSD:EG524343.1,INSD:EG523695.1,
FT                   INSD:EG523704.1,INSD:EG523703.1,INSD:EG492399.1,
FT                   INSD:EG492400.1,INSD:EG524354.1,INSD:EG524346.1,
FT                   INSD:EG524352.1,INSD:EG524340.1,INSD:EG523699.1,
FT                   INSD:EG429963.1,INSD:EG523697.1,INSD:EG492397.1,
FT                   INSD:EG492402.1,INSD:EG524338.1,INSD:EG492398.1,
FT                   INSD:EG492403.1,INSD:EG524357.1,INSD:EG523694.1,
FT                   INSD:EG523696.1,INSD:EG523691.1,INSD:EG524341.1,
FT                   INSD:EG523693.1,INSD:EG524339.1,INSD:EG524355.1,
FT                   INSD:EG523692.1,INSD:EG523643.1,INSD:EG524353.1,
FT                   INSD:EG492394.1,INSD:EG524342.1,INSD:EG524347.1,
FT                   INSD:EG492393.1,INSD:EG492401.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:DQ653258.1"
FT                   /protein_id="AED90302.1"
FT   gene            49891..51437
FT                   /gene_synonym="F7J8.120"
FT                   /gene_synonym="F7J8_120"
FT                   /locus_tag="AT5G01140"
FT   mRNA            join(49891..49975,50024..51222,51300..51437)
FT                   /gene_synonym="F7J8.120"
FT                   /gene_synonym="F7J8_120"
FT                   /locus_tag="AT5G01140"
FT                   /product="hypothetical protein (DUF674)"
FT   CDS_pept        join(49891..49975,50024..51222,51300..51437)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.120"
FT                   /gene_synonym="F7J8_120"
FT                   /locus_tag="AT5G01140"
FT                   /product="hypothetical protein (DUF674)"
FT                   /note="Protein of unknown function (DUF674); CONTAINS
FT                   InterPro DOMAIN/s: Protein of unknown function DUF674
FT                   (InterPro:IPR007750); BEST Arabidopsis thaliana protein
FT                   match is: Protein of unknown function (DUF674)
FT                   (TAIR:AT5G01150.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="InterPro:IPR007750"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFC2"
FT                   /protein_id="AED90303.1"
FT                   NVSWNPVSKKPKVET"
FT   gene            51975..53817
FT                   /gene_synonym="F7J8.130"
FT                   /gene_synonym="F7J8_130"
FT                   /locus_tag="AT5G01150"
FT   mRNA            join(51975..52623,52708..53439,53512..53817)
FT                   /gene_synonym="F7J8.130"
FT                   /gene_synonym="F7J8_130"
FT                   /locus_tag="AT5G01150"
FT                   /product="hypothetical protein (DUF674)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG523726.1,INSD:EG523718.1,INSD:EG523729.1,
FT                   INSD:EG469454.1,INSD:EG523720.1,INSD:EG523730.1,
FT                   INSD:EG523724.1,INSD:EG523701.1,INSD:EG523721.1,
FT                   INSD:EG523731.1,INSD:EG523728.1,INSD:EG523702.1,
FT                   INSD:EG523723.1,INSD:EG523719.1,INSD:EG469453.1,
FT                   INSD:EG523727.1,INSD:EG523725.1"
FT   CDS_pept        join(51988..52623,52708..53439,53512..53649)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.130"
FT                   /gene_synonym="F7J8_130"
FT                   /locus_tag="AT5G01150"
FT                   /product="hypothetical protein (DUF674)"
FT                   /note="Protein of unknown function (DUF674); CONTAINS
FT                   InterPro DOMAIN/s: Protein of unknown function DUF674
FT                   (InterPro:IPR007750); BEST Arabidopsis thaliana protein
FT                   match is: Protein of unknown function (DUF674)
FT                   (TAIR:AT5G01130.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01150"
FT                   /db_xref="GOA:Q9LFC1"
FT                   /db_xref="InterPro:IPR007750"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFC1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG523726.1,INSD:EG523718.1,INSD:EG523729.1,
FT                   INSD:EG469454.1,INSD:EG523720.1,INSD:EG523730.1,
FT                   INSD:EG523724.1,INSD:EG523701.1,INSD:EG523721.1,
FT                   INSD:EG523731.1,INSD:EG523728.1,INSD:EG523702.1,
FT                   INSD:EG523723.1,INSD:EG523719.1,INSD:EG469453.1,
FT                   INSD:EG523727.1,INSD:EG523725.1"
FT                   /protein_id="AED90304.1"
FT   gene            53856..56052
FT                   /gene_synonym="F7J8.140"
FT                   /gene_synonym="F7J8_140"
FT                   /locus_tag="AT5G01160"
FT   mRNA            join(53856..54534,54657..54715,54959..56052)
FT                   /gene_synonym="F7J8.140"
FT                   /gene_synonym="F7J8_140"
FT                   /locus_tag="AT5G01160"
FT                   /product="RING/U-box superfamily protein"
FT   mRNA            join(53856..54196,54275..54534,54657..54715,54959..56052)
FT                   /gene_synonym="F7J8.140"
FT                   /gene_synonym="F7J8_140"
FT                   /locus_tag="AT5G01160"
FT                   /product="RING/U-box superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP805131.1,INSD:BP616482.1,INSD:ES178989.1,
FT                   INSD:ES147662.1,INSD:DR379092.1,INSD:AI997976.1,
FT                   INSD:DR282566.1,INSD:BP627307.1,INSD:EH941360.1,
FT                   INSD:AV803039.1,INSD:ES146960.1,INSD:EL282499.1,
FT                   INSD:DR282564.1,INSD:BP626024.1,INSD:EL988141.1,
FT                   INSD:BP630593.1,INSD:EL978033.1,INSD:AV557121.1,
FT                   INSD:AV818919.1,INSD:ES131828.1,INSD:DR282561.1,
FT                   INSD:CB074347.1,INSD:DR282562.1,INSD:BP806571.1,
FT                   INSD:AV543449.1,INSD:EL167348.1,INSD:EL240692.1,
FT                   INSD:BP636377.1,INSD:EH966507.1,INSD:BP625721.1,
FT                   INSD:ES155236.1,INSD:BP604314.1,INSD:DR282567.1,
FT                   INSD:BP627814.1,INSD:N37320.1,INSD:AV439570.1,
FT                   INSD:EH919038.1,INSD:AV556858.1,INSD:EL997994.1,
FT                   INSD:DR282565.1,INSD:DR282563.1,INSD:EH811312.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830977.1,INSD:AY084366.1,INSD:AK227241.1,
FT                   INSD:BT024744.1,INSD:BX829595.1,INSD:BX830386.1,
FT                   INSD:BX831145.1,INSD:BX831309.1,INSD:BX833520.1,
FT                   INSD:BX831546.1"
FT   CDS_pept        join(54280..54534,54657..54715,54959..55727)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.140"
FT                   /gene_synonym="F7J8_140"
FT                   /locus_tag="AT5G01160"
FT                   /product="RING/U-box superfamily protein"
FT                   /db_xref="GOA:Q9LFC0"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="InterPro:IPR040380"
FT                   /db_xref="InterPro:IPR040383"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFC0"
FT                   /protein_id="ANM69516.1"
FT   CDS_pept        join(54280..54534,54657..54715,54959..55727)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.140"
FT                   /gene_synonym="F7J8_140"
FT                   /locus_tag="AT5G01160"
FT                   /product="RING/U-box superfamily protein"
FT                   /note="RING/U-box superfamily protein; FUNCTIONS IN: zinc
FT                   ion binding; INVOLVED IN: biological_process unknown;
FT                   LOCATED IN: intracellular; EXPRESSED IN: 24 plant
FT                   structures; EXPRESSED DURING: 15 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Zinc finger, C2H2-like
FT                   (InterPro:IPR015880), Zinc finger, RING-type, conserved
FT                   site (InterPro:IPR017907), Zinc finger, RING-type
FT                   (InterPro:IPR001841), Zinc finger, C2H2-type
FT                   (InterPro:IPR007087); Has 1807 Blast hits to 1807 proteins
FT                   in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
FT                   Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
FT                   339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LFC0"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="InterPro:IPR040380"
FT                   /db_xref="InterPro:IPR040383"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFC0"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP805131.1,INSD:BP616482.1,INSD:ES178989.1,
FT                   INSD:ES147662.1,INSD:DR379092.1,INSD:AI997976.1,
FT                   INSD:DR282566.1,INSD:BP627307.1,INSD:EH941360.1,
FT                   INSD:AV803039.1,INSD:ES146960.1,INSD:EL282499.1,
FT                   INSD:DR282564.1,INSD:BP626024.1,INSD:EL988141.1,
FT                   INSD:BP630593.1,INSD:EL978033.1,INSD:AV557121.1,
FT                   INSD:AV818919.1,INSD:ES131828.1,INSD:DR282561.1,
FT                   INSD:CB074347.1,INSD:DR282562.1,INSD:BP806571.1,
FT                   INSD:AV543449.1,INSD:EL167348.1,INSD:EL240692.1,
FT                   INSD:BP636377.1,INSD:EH966507.1,INSD:BP625721.1,
FT                   INSD:ES155236.1,INSD:BP604314.1,INSD:DR282567.1,
FT                   INSD:BP627814.1,INSD:N37320.1,INSD:AV439570.1,
FT                   INSD:EH919038.1,INSD:AV556858.1,INSD:EL997994.1,
FT                   INSD:DR282565.1,INSD:DR282563.1,INSD:EH811312.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830977.1,INSD:AY084366.1,INSD:AK227241.1,
FT                   INSD:BT024744.1,INSD:BX829595.1,INSD:BX830386.1,
FT                   INSD:BX831145.1,INSD:BX831309.1,INSD:BX833520.1,
FT                   INSD:BX831546.1"
FT                   /protein_id="AED90305.1"
FT   gene            58011..60136
FT                   /gene_synonym="F7J8.150"
FT                   /gene_synonym="F7J8_150"
FT                   /locus_tag="AT5G01170"
FT   mRNA            58011..60136
FT                   /gene_synonym="F7J8.150"
FT                   /gene_synonym="F7J8_150"
FT                   /locus_tag="AT5G01170"
FT                   /product="hypothetical protein (DUF740)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR236106.1,INSD:ES163573.1,INSD:AU227549.1,
FT                   INSD:DR369859.1,INSD:DR199830.1,INSD:AU236596.1,
FT                   INSD:DR383575.1,INSD:DR369948.1,INSD:DR350065.1,
FT                   INSD:DR383601.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT004217.1,INSD:BT015922.1"
FT   CDS_pept        58315..60021
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.150"
FT                   /gene_synonym="F7J8_150"
FT                   /locus_tag="AT5G01170"
FT                   /product="hypothetical protein (DUF740)"
FT                   /note="Protein of unknown function (DUF740); CONTAINS
FT                   InterPro DOMAIN/s: Protein of unknown function DUF740
FT                   (InterPro:IPR008004); BEST Arabidopsis thaliana protein
FT                   match is: Protein of unknown function (DUF740)
FT                   (TAIR:AT3G09070.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01170"
FT                   /db_xref="GOA:Q9LFB9"
FT                   /db_xref="InterPro:IPR008004"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFB9"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR236106.1,INSD:ES163573.1,INSD:AU227549.1,
FT                   INSD:DR369859.1,INSD:DR199830.1,INSD:AU236596.1,
FT                   INSD:DR383575.1,INSD:DR369948.1,INSD:DR350065.1,
FT                   INSD:DR383601.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT004217.1,INSD:BT015922.1"
FT                   /protein_id="AED90306.1"
FT   gene            60208..61214
FT                   /locus_tag="AT5G01175"
FT                   /note="Natural antisense transcript overlaps with
FT                   AT5G01180; Potential natural antisense gene, locus overlaps
FT                   with AT5G01180"
FT   ncRNA           60208..61214
FT                   /locus_tag="AT5G01175"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   ncRNA           join(60208..60437,60917..61214)
FT                   /locus_tag="AT5G01175"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            complement(61017..63936)
FT                   /gene="PTR5"
FT                   /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
FT                   /gene_synonym="AtNPF8.2"
FT                   /gene_synonym="ATPTR5"
FT                   /gene_synonym="F7J8.160"
FT                   /gene_synonym="F7J8_160"
FT                   /gene_synonym="NPF8.2"
FT                   /gene_synonym="NRT1/ PTR family 8.2"
FT                   /gene_synonym="peptide transporter 5"
FT                   /locus_tag="AT5G01180"
FT                   /note="Encodes a dipeptide transporter expressed in pollen
FT                   and ovules during early seed development. GFP-tagged PTR5
FT                   localizes to the plasma membrane."
FT   mRNA            complement(join(61017..62091,62166..62716,62818..63035,
FT                   63132..63274,63781..63936))
FT                   /gene="PTR5"
FT                   /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
FT                   /gene_synonym="AtNPF8.2"
FT                   /gene_synonym="ATPTR5"
FT                   /gene_synonym="F7J8.160"
FT                   /gene_synonym="F7J8_160"
FT                   /gene_synonym="NPF8.2"
FT                   /gene_synonym="NRT1/ PTR family 8.2"
FT                   /gene_synonym="peptide transporter 5"
FT                   /locus_tag="AT5G01180"
FT                   /product="peptide transporter 5"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP862584.1,INSD:EL996193.1,INSD:EL294392.1,
FT                   INSD:ES069438.1,INSD:ES040631.1,INSD:ES176495.1,
FT                   INSD:AU236426.1,INSD:AU227341.1,INSD:ES053274.1,
FT                   INSD:AV565600.1,INSD:ES210068.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830286.1,INSD:BT005728.1,INSD:BX829379.1,
FT                   INSD:AK228435.1"
FT   mRNA            complement(join(61257..62091,62166..62716,62818..63035,
FT                   63132..63313,63781..63936))
FT                   /gene="PTR5"
FT                   /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
FT                   /gene_synonym="AtNPF8.2"
FT                   /gene_synonym="ATPTR5"
FT                   /gene_synonym="F7J8.160"
FT                   /gene_synonym="F7J8_160"
FT                   /gene_synonym="NPF8.2"
FT                   /gene_synonym="NRT1/ PTR family 8.2"
FT                   /gene_synonym="peptide transporter 5"
FT                   /locus_tag="AT5G01180"
FT                   /product="peptide transporter 5"
FT   mRNA            complement(join(61257..62091,62166..62716,62818..63035,
FT                   63132..63305,63781..63929))
FT                   /gene="PTR5"
FT                   /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
FT                   /gene_synonym="AtNPF8.2"
FT                   /gene_synonym="ATPTR5"
FT                   /gene_synonym="F7J8.160"
FT                   /gene_synonym="F7J8_160"
FT                   /gene_synonym="NPF8.2"
FT                   /gene_synonym="NRT1/ PTR family 8.2"
FT                   /gene_synonym="peptide transporter 5"
FT                   /locus_tag="AT5G01180"
FT                   /product="peptide transporter 5"
FT   CDS_pept        complement(join(61257..62091,62166..62716,62818..63035,
FT                   63132..63240))
FT                   /codon_start=1
FT                   /gene="PTR5"
FT                   /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
FT                   /gene_synonym="AtNPF8.2"
FT                   /gene_synonym="ATPTR5"
FT                   /gene_synonym="F7J8.160"
FT                   /gene_synonym="F7J8_160"
FT                   /gene_synonym="NPF8.2"
FT                   /gene_synonym="NRT1/ PTR family 8.2"
FT                   /gene_synonym="peptide transporter 5"
FT                   /locus_tag="AT5G01180"
FT                   /product="peptide transporter 5"
FT                   /db_xref="GOA:Q9LFB8"
FT                   /db_xref="InterPro:IPR000109"
FT                   /db_xref="InterPro:IPR018456"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFB8"
FT                   /protein_id="ANM69606.1"
FT   CDS_pept        complement(join(61257..62091,62166..62716,62818..63035,
FT                   63132..63240))
FT                   /codon_start=1
FT                   /gene="PTR5"
FT                   /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
FT                   /gene_synonym="AtNPF8.2"
FT                   /gene_synonym="ATPTR5"
FT                   /gene_synonym="F7J8.160"
FT                   /gene_synonym="F7J8_160"
FT                   /gene_synonym="NPF8.2"
FT                   /gene_synonym="NRT1/ PTR family 8.2"
FT                   /gene_synonym="peptide transporter 5"
FT                   /locus_tag="AT5G01180"
FT                   /product="peptide transporter 5"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01180"
FT                   /db_xref="GOA:Q9LFB8"
FT                   /db_xref="InterPro:IPR000109"
FT                   /db_xref="InterPro:IPR018456"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFB8"
FT                   /protein_id="ANM69607.1"
FT   CDS_pept        complement(join(61257..62091,62166..62716,62818..63035,
FT                   63132..63240))
FT                   /codon_start=1
FT                   /gene="PTR5"
FT                   /gene_synonym="ARABIDOPSIS THALIANA PEPTIDE TRANSPORTER 5"
FT                   /gene_synonym="ATPTR5"
FT                   /gene_synonym="F7J8.160"
FT                   /gene_synonym="F7J8_160"
FT                   /gene_synonym="peptide transporter 5"
FT                   /gene_synonym="AtNPF8.2"
FT                   /gene_synonym="NPF8.2"
FT                   /gene_synonym="NRT1/ PTR family 8.2"
FT                   /locus_tag="AT5G01180"
FT                   /product="peptide transporter 5"
FT                   /note="peptide transporter 5 (PTR5); CONTAINS InterPro
FT                   DOMAIN/s: PTR2 family proton/oligopeptide symporter,
FT                   conserved site (InterPro:IPR018456), Oligopeptide
FT                   transporter (InterPro:IPR000109), Major facilitator
FT                   superfamily, general substrate transporter
FT                   (InterPro:IPR016196); BEST Arabidopsis thaliana protein
FT                   match is: peptide transporter 1 (TAIR:AT3G54140.1); Has
FT                   1807 Blast hits to 1807 proteins in 277 species: Archae -
FT                   0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LFB8"
FT                   /db_xref="InterPro:IPR000109"
FT                   /db_xref="InterPro:IPR018456"
FT                   /db_xref="InterPro:IPR020846"
FT                   /db_xref="InterPro:IPR036259"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFB8"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP862584.1,INSD:EL996193.1,INSD:EL294392.1,
FT                   INSD:ES069438.1,INSD:ES040631.1,INSD:ES176495.1,
FT                   INSD:AU236426.1,INSD:AU227341.1,INSD:ES053274.1,
FT                   INSD:AV565600.1,INSD:ES210068.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830286.1,INSD:BT005728.1,INSD:BX829379.1,
FT                   INSD:AK228435.1"
FT                   /protein_id="AED90307.1"
FT   gene            complement(65275..69924)
FT                   /pseudo
FT                   /locus_tag="AT5G01185"
FT   mRNA            complement(<65275..>69924)
FT                   /pseudo
FT                   /locus_tag="AT5G01185"
FT                   /product="hypothetical protein"
FT   gene            72292..74769
FT                   /gene="LAC10"
FT                   /gene_synonym="F7J8.170"
FT                   /gene_synonym="F7J8_170"
FT                   /gene_synonym="laccase 10"
FT                   /locus_tag="AT5G01190"
FT                   /note="putative laccase, a member of laccase family of
FT                   genes (17 members in Arabidopsis)."
FT   mRNA            join(72292..72481,72617..72768,72859..73103,73194..73322,
FT                   73434..74363,74482..74769)
FT                   /gene="LAC10"
FT                   /gene_synonym="F7J8.170"
FT                   /gene_synonym="F7J8_170"
FT                   /gene_synonym="laccase 10"
FT                   /locus_tag="AT5G01190"
FT                   /product="laccase 10"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV562238.1,INSD:BP787187.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BT014855.1"
FT   mRNA            join(72292..72481,72659..72768,72859..73103,73194..73322,
FT                   73434..74363,74482..74769)
FT                   /gene="LAC10"
FT                   /gene_synonym="F7J8.170"
FT                   /gene_synonym="F7J8_170"
FT                   /gene_synonym="laccase 10"
FT                   /locus_tag="AT5G01190"
FT                   /product="laccase 10"
FT   CDS_pept        join(72392..72481,72617..72768,72859..73103,73194..73322,
FT                   73434..74363,74482..74612)
FT                   /codon_start=1
FT                   /gene="LAC10"
FT                   /gene_synonym="F7J8.170"
FT                   /gene_synonym="F7J8_170"
FT                   /gene_synonym="laccase 10"
FT                   /locus_tag="AT5G01190"
FT                   /product="laccase 10"
FT                   /note="laccase 10 (LAC10); FUNCTIONS IN: laccase activity;
FT                   INVOLVED IN: oxidation reduction, lignin catabolic process;
FT                   LOCATED IN: endomembrane system, apoplast; EXPRESSED IN: 9
FT                   plant structures; EXPRESSED DURING: petal differentiation
FT                   and expansion stage; CONTAINS InterPro DOMAIN/s:
FT                   Multicopper oxidase, type 3 (InterPro:IPR011707), Laccase
FT                   (InterPro:IPR017761), Multicopper oxidase, type 2
FT                   (InterPro:IPR011706), Cupredoxin (InterPro:IPR008972),
FT                   Multicopper oxidase, copper-binding site
FT                   (InterPro:IPR002355), Multicopper oxidase, type 1
FT                   (InterPro:IPR001117); BEST Arabidopsis thaliana protein
FT                   match is: Laccase/Diphenol oxidase family protein
FT                   (TAIR:AT2G38080.1); Has 9531 Blast hits to 8327 proteins in
FT                   1383 species: Archae - 24; Bacteria - 3756; Metazoa - 439;
FT                   Fungi - 3375; Plants - 1571; Viruses - 0; Other Eukaryotes
FT                   - 366 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q6ID18"
FT                   /db_xref="InterPro:IPR001117"
FT                   /db_xref="InterPro:IPR002355"
FT                   /db_xref="InterPro:IPR008972"
FT                   /db_xref="InterPro:IPR011706"
FT                   /db_xref="InterPro:IPR011707"
FT                   /db_xref="InterPro:IPR017761"
FT                   /db_xref="InterPro:IPR033138"
FT                   /db_xref="InterPro:IPR034285"
FT                   /db_xref="InterPro:IPR034288"
FT                   /db_xref="InterPro:IPR034289"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q6ID18"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV562238.1,INSD:BP787187.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BT014855.1"
FT                   /protein_id="AED90308.1"
FT   CDS_pept        join(72392..72481,72659..72768,72859..73103,73194..73322,
FT                   73434..74363,74482..74612)
FT                   /codon_start=1
FT                   /gene="LAC10"
FT                   /gene_synonym="F7J8.170"
FT                   /gene_synonym="F7J8_170"
FT                   /gene_synonym="laccase 10"
FT                   /locus_tag="AT5G01190"
FT                   /product="laccase 10"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01190"
FT                   /db_xref="GOA:A0A1R7T3A1"
FT                   /db_xref="InterPro:IPR001117"
FT                   /db_xref="InterPro:IPR002355"
FT                   /db_xref="InterPro:IPR008972"
FT                   /db_xref="InterPro:IPR011706"
FT                   /db_xref="InterPro:IPR011707"
FT                   /db_xref="InterPro:IPR017761"
FT                   /db_xref="InterPro:IPR033138"
FT                   /db_xref="InterPro:IPR034285"
FT                   /db_xref="InterPro:IPR034288"
FT                   /db_xref="InterPro:IPR034289"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1R7T3A1"
FT                   /protein_id="ANM71095.1"
FT   gene            76872..78543
FT                   /gene_synonym="F7J8.180"
FT                   /gene_synonym="F7J8_180"
FT                   /locus_tag="AT5G01200"
FT   mRNA            join(76872..77576,77952..78543)
FT                   /gene_synonym="F7J8.180"
FT                   /gene_synonym="F7J8_180"
FT                   /locus_tag="AT5G01200"
FT                   /product="Duplicated homeodomain-like superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV562130.1,INSD:ES169273.1,INSD:AV559299.1,
FT                   INSD:DR749785.1,INSD:DR749786.1,INSD:ES056308.1,
FT                   INSD:AV441418.1,INSD:EL991022.1,INSD:AA597360.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AY519530.1"
FT   CDS_pept        join(77116..77576,77952..78294)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.180"
FT                   /gene_synonym="F7J8_180"
FT                   /locus_tag="AT5G01200"
FT                   /product="Duplicated homeodomain-like superfamily protein"
FT                   /note="Duplicated homeodomain-like superfamily protein;
FT                   CONTAINS InterPro DOMAIN/s: Molecular chaperone, heat shock
FT                   protein, Hsp40, DnaJ (InterPro:IPR015609), SANT, eukarya
FT                   (InterPro:IPR017884), Myb-like DNA-binding domain, SHAQKYF
FT                   class (InterPro:IPR006447), SANT, DNA-binding
FT                   (InterPro:IPR001005), Myb, DNA-binding
FT                   (InterPro:IPR014778), Homeodomain-like
FT                   (InterPro:IPR009057), HTH transcriptional regulator,
FT                   Myb-type, DNA-binding (InterPro:IPR017930); BEST
FT                   Arabidopsis thaliana protein match is: Duplicated
FT                   homeodomain-like superfamily protein (TAIR:AT2G38090.1);
FT                   Has 1807 Blast hits to 1807 proteins in 277 species: Archae
FT                   - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants -
FT                   385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01200"
FT                   /db_xref="GOA:Q9LFB6"
FT                   /db_xref="InterPro:IPR001005"
FT                   /db_xref="InterPro:IPR006447"
FT                   /db_xref="InterPro:IPR009057"
FT                   /db_xref="InterPro:IPR017884"
FT                   /db_xref="InterPro:IPR017930"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFB6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV562130.1,INSD:ES169273.1,INSD:AV559299.1,
FT                   INSD:DR749785.1,INSD:DR749786.1,INSD:ES056308.1,
FT                   INSD:AV441418.1,INSD:EL991022.1,INSD:AA597360.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AY519530.1"
FT                   /protein_id="AED90309.1"
FT   gene            complement(84466..86258)
FT                   /locus_tag="AT5G01215"
FT                   /note="Natural antisense transcript overlaps with
FT                   AT5G01210; Potential natural antisense gene, locus overlaps
FT                   with AT5G01210"
FT   ncRNA           complement(join(84466..85261,85357..86258))
FT                   /locus_tag="AT5G01215"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   ncRNA           complement(84466..86258)
FT                   /locus_tag="AT5G01215"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            84474..86275
FT                   /gene_synonym="F7J8.190"
FT                   /gene_synonym="F7J8_190"
FT                   /locus_tag="AT5G01210"
FT   mRNA            84474..86275
FT                   /gene_synonym="F7J8.190"
FT                   /gene_synonym="F7J8_190"
FT                   /locus_tag="AT5G01210"
FT                   /product="HXXXD-type acyl-transferase family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV802611.1,INSD:EH861324.1,INSD:BP846622.1,
FT                   INSD:EL142230.1,INSD:BP810310.1,INSD:EL286263.1,
FT                   INSD:EL180315.1,INSD:EL026361.1,INSD:EG446944.1,
FT                   INSD:BP616221.1,INSD:EL203761.1,INSD:EL289267.1,
FT                   INSD:AV549757.1,INSD:BP597645.1,INSD:BE038811.1,
FT                   INSD:EH851838.1,INSD:EL029540.1,INSD:EH843524.1,
FT                   INSD:EG520327.1,INSD:EH880521.1,INSD:DR277441.1,
FT                   INSD:ES083467.1,INSD:EL120956.1,INSD:EL044455.1,
FT                   INSD:EL061977.1,INSD:AV815496.1,INSD:BP576300.1,
FT                   INSD:EH940334.1,INSD:EL038872.1,INSD:BP585479.1,
FT                   INSD:AV441577.1,INSD:AU231413.1,INSD:BP810930.1,
FT                   INSD:EL119588.1,INSD:EH845182.1,INSD:EH931147.1,
FT                   INSD:EG496360.1,INSD:EL023629.1,INSD:AV831217.1,
FT                   INSD:DR277439.1,INSD:EH973394.1,INSD:CB257290.1,
FT                   INSD:CF651460.1,INSD:CB185631.1,INSD:AV439866.1,
FT                   INSD:EL161364.1,INSD:AV525248.1,INSD:BP617184.1,
FT                   INSD:EL000466.1,INSD:CF651461.1,INSD:BP810889.1,
FT                   INSD:AI992711.1,INSD:EL251207.1,INSD:R64951.1,
FT                   INSD:EL275218.1,INSD:EL108295.1,INSD:DR277440.1,
FT                   INSD:EL010267.1,INSD:AV534126.1,INSD:EL216601.1,
FT                   INSD:EH798532.1,INSD:EH873268.1,INSD:Z34199.1,
FT                   INSD:EL057253.1,INSD:EL044255.1,INSD:EG520326.1,
FT                   INSD:AV814945.1,INSD:ES016673.1,INSD:EH959985.1,
FT                   INSD:EL203084.1,INSD:BP620245.1,INSD:EH864522.1,
FT                   INSD:AV518442.1,INSD:EL328936.1,INSD:AV539490.1,
FT                   INSD:EL230105.1,INSD:EL285901.1,INSD:EH830017.1,
FT                   INSD:EL288604.1,INSD:AV525044.1,INSD:BP853597.1,
FT                   INSD:AV548595.1,INSD:BP616519.1,INSD:EL056563.1,
FT                   INSD:EL341663.1,INSD:AV518287.1,INSD:EL125351.1,
FT                   INSD:EH873745.1,INSD:ES126423.1,INSD:DR277444.1,
FT                   INSD:N95993.1,INSD:BP572016.1,INSD:EL078817.1,
FT                   INSD:EL228634.1,INSD:EH945221.1,INSD:ES123246.1,
FT                   INSD:EH835220.1,INSD:EH836812.1,INSD:BP807445.1,
FT                   INSD:EL313180.1,INSD:EL260835.1,INSD:BP621142.1,
FT                   INSD:BP586074.1,INSD:AV828731.1,INSD:EH982768.1,
FT                   INSD:BP671901.1,INSD:EL335605.1,INSD:BP822633.1,
FT                   INSD:BP569061.1,INSD:EH970548.1,INSD:DR277445.1,
FT                   INSD:EL233748.1,INSD:T41686.1,INSD:EH833701.1,
FT                   INSD:DR277443.1,INSD:DR277442.1,INSD:EL044308.1,
FT                   INSD:EL004625.1,INSD:BP602937.1,INSD:EL094217.1,
FT                   INSD:AV803113.1,INSD:ES061240.1,INSD:W43665.1,
FT                   INSD:Z34616.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830368.1,INSD:AY090321.1,INSD:BX832518.1,
FT                   INSD:AK227159.1,INSD:AY056412.1,INSD:BX830266.1"
FT   CDS_pept        84554..85981
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.190"
FT                   /gene_synonym="F7J8_190"
FT                   /locus_tag="AT5G01210"
FT                   /product="HXXXD-type acyl-transferase family protein"
FT                   /note="HXXXD-type acyl-transferase family protein;
FT                   FUNCTIONS IN: transferase activity, transferring acyl
FT                   groups other than amino-acyl groups, transferase activity;
FT                   INVOLVED IN: biological_process unknown; LOCATED IN:
FT                   cellular_component unknown; EXPRESSED IN: 22 plant
FT                   structures; EXPRESSED DURING: 13 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Transferase (InterPro:IPR003480); BEST
FT                   Arabidopsis thaliana protein match is: HXXXD-type
FT                   acyl-transferase family protein (TAIR:AT2G39980.1); Has
FT                   1807 Blast hits to 1807 proteins in 277 species: Archae -
FT                   0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01210"
FT                   /db_xref="GOA:Q9LFB5"
FT                   /db_xref="InterPro:IPR003480"
FT                   /db_xref="InterPro:IPR023213"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFB5"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV802611.1,INSD:EH861324.1,INSD:BP846622.1,
FT                   INSD:EL142230.1,INSD:BP810310.1,INSD:EL286263.1,
FT                   INSD:EL180315.1,INSD:EL026361.1,INSD:EG446944.1,
FT                   INSD:BP616221.1,INSD:EL203761.1,INSD:EL289267.1,
FT                   INSD:AV549757.1,INSD:BP597645.1,INSD:BE038811.1,
FT                   INSD:EH851838.1,INSD:EL029540.1,INSD:EH843524.1,
FT                   INSD:EG520327.1,INSD:EH880521.1,INSD:DR277441.1,
FT                   INSD:ES083467.1,INSD:EL120956.1,INSD:EL044455.1,
FT                   INSD:EL061977.1,INSD:AV815496.1,INSD:BP576300.1,
FT                   INSD:EH940334.1,INSD:EL038872.1,INSD:BP585479.1,
FT                   INSD:AV441577.1,INSD:AU231413.1,INSD:BP810930.1,
FT                   INSD:EL119588.1,INSD:EH845182.1,INSD:EH931147.1,
FT                   INSD:EG496360.1,INSD:EL023629.1,INSD:AV831217.1,
FT                   INSD:DR277439.1,INSD:EH973394.1,INSD:CB257290.1,
FT                   INSD:CF651460.1,INSD:CB185631.1,INSD:AV439866.1,
FT                   INSD:EL161364.1,INSD:AV525248.1,INSD:BP617184.1,
FT                   INSD:EL000466.1,INSD:CF651461.1,INSD:BP810889.1,
FT                   INSD:AI992711.1,INSD:EL251207.1,INSD:R64951.1,
FT                   INSD:EL275218.1,INSD:EL108295.1,INSD:DR277440.1,
FT                   INSD:EL010267.1,INSD:AV534126.1,INSD:EL216601.1,
FT                   INSD:EH798532.1,INSD:EH873268.1,INSD:Z34199.1,
FT                   INSD:EL057253.1,INSD:EL044255.1,INSD:EG520326.1,
FT                   INSD:AV814945.1,INSD:ES016673.1,INSD:EH959985.1,
FT                   INSD:EL203084.1,INSD:BP620245.1,INSD:EH864522.1,
FT                   INSD:AV518442.1,INSD:EL328936.1,INSD:AV539490.1,
FT                   INSD:EL230105.1,INSD:EL285901.1,INSD:EH830017.1,
FT                   INSD:EL288604.1,INSD:AV525044.1,INSD:BP853597.1,
FT                   INSD:AV548595.1,INSD:BP616519.1,INSD:EL056563.1,
FT                   INSD:EL341663.1,INSD:AV518287.1,INSD:EL125351.1,
FT                   INSD:EH873745.1,INSD:ES126423.1,INSD:DR277444.1,
FT                   INSD:N95993.1,INSD:BP572016.1,INSD:EL078817.1,
FT                   INSD:EL228634.1,INSD:EH945221.1,INSD:ES123246.1,
FT                   INSD:EH835220.1,INSD:EH836812.1,INSD:BP807445.1,
FT                   INSD:EL313180.1,INSD:EL260835.1,INSD:BP621142.1,
FT                   INSD:BP586074.1,INSD:AV828731.1,INSD:EH982768.1,
FT                   INSD:BP671901.1,INSD:EL335605.1,INSD:BP822633.1,
FT                   INSD:BP569061.1,INSD:EH970548.1,INSD:DR277445.1,
FT                   INSD:EL233748.1,INSD:T41686.1,INSD:EH833701.1,
FT                   INSD:DR277443.1,INSD:DR277442.1,INSD:EL044308.1,
FT                   INSD:EL004625.1,INSD:BP602937.1,INSD:EL094217.1,
FT                   INSD:AV803113.1,INSD:ES061240.1,INSD:W43665.1,
FT                   INSD:Z34616.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830368.1,INSD:AY090321.1,INSD:BX832518.1,
FT                   INSD:AK227159.1,INSD:AY056412.1,INSD:BX830266.1"
FT                   /protein_id="AED90310.1"
FT                   ENDAEFMQYVSEVTYDC"
FT   gene            complement(86543..90117)
FT                   /gene="SQD2"
FT                   /gene_synonym="F7J8.200"
FT                   /gene_synonym="F7J8_200"
FT                   /gene_synonym="SULFOLIPID SYNTHASE"
FT                   /gene_synonym="sulfoquinovosyldiacylglycerol 2"
FT                   /locus_tag="AT5G01220"
FT                   /note="involved in sulfolipid biosynthesis"
FT   mRNA            complement(join(86543..87182,87268..87630,87724..87780,
FT                   87858..87935,88027..88114,88204..88287,88388..88443,
FT                   88525..88598,88701..88818,88892..88962,89103..89169,
FT                   89539..90063))
FT                   /gene="SQD2"
FT                   /gene_synonym="F7J8.200"
FT                   /gene_synonym="F7J8_200"
FT                   /gene_synonym="SULFOLIPID SYNTHASE"
FT                   /gene_synonym="sulfoquinovosyldiacylglycerol 2"
FT                   /locus_tag="AT5G01220"
FT                   /product="sulfoquinovosyldiacylglycerol 2"
FT   mRNA            complement(join(86548..87182,87414..87630,87724..87780,
FT                   87858..87935,88027..88114,88204..88287,88388..88443,
FT                   88525..88598,88701..88818,88892..88962,89103..89169,
FT                   89539..90117))
FT                   /gene="SQD2"
FT                   /gene_synonym="F7J8.200"
FT                   /gene_synonym="F7J8_200"
FT                   /gene_synonym="SULFOLIPID SYNTHASE"
FT                   /gene_synonym="sulfoquinovosyldiacylglycerol 2"
FT                   /locus_tag="AT5G01220"
FT                   /product="sulfoquinovosyldiacylglycerol 2"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES088950.1,INSD:EL123674.1,INSD:ES100266.1,
FT                   INSD:AI999595.1,INSD:EG496269.1,INSD:EL073620.1,
FT                   INSD:EL275023.1,INSD:BP805010.1,INSD:BP847142.1,
FT                   INSD:ES113947.1,INSD:AV540845.1,INSD:EG496268.1,
FT                   INSD:EH907656.1,INSD:EG451757.1,INSD:AV784670.1,
FT                   INSD:EL122192.1,INSD:ES184102.1,INSD:EG451765.1,
FT                   INSD:ES114807.1,INSD:EL277212.1,INSD:BP791225.1,
FT                   INSD:EL203802.1,INSD:EG451746.1,INSD:EL172067.1,
FT                   INSD:EG473715.1,INSD:CD530520.1,INSD:AV811076.1,
FT                   INSD:EG451747.1,INSD:EL022787.1,INSD:EL252269.1,
FT                   INSD:EL019868.1,INSD:EL169646.1,INSD:AV823662.1,
FT                   INSD:BG459186.1,INSD:EG451763.1,INSD:DR353265.1,
FT                   INSD:AA651177.1,INSD:EL264514.1,INSD:EL027254.1,
FT                   INSD:ES059394.1,INSD:CD532372.1,INSD:EH796489.1,
FT                   INSD:EG451758.1,INSD:CB259028.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF454354.1,INSD:BT005796.1,INSD:AY045961.2,
FT                   INSD:BX830044.1"
FT   CDS_pept        complement(join(86907..87182,87414..87630,87724..87780,
FT                   87858..87935,88027..88114,88204..88287,88388..88443,
FT                   88525..88598,88701..88818,88892..88962,89103..89169,
FT                   89539..89885))
FT                   /codon_start=1
FT                   /gene="SQD2"
FT                   /gene_synonym="F7J8.200"
FT                   /gene_synonym="F7J8_200"
FT                   /gene_synonym="SULFOLIPID SYNTHASE"
FT                   /gene_synonym="sulfoquinovosyldiacylglycerol 2"
FT                   /locus_tag="AT5G01220"
FT                   /product="sulfoquinovosyldiacylglycerol 2"
FT                   /note="sulfoquinovosyldiacylglycerol 2 (SQD2); FUNCTIONS
FT                   IN: UDP-glycosyltransferase activity,
FT                   UDP-sulfoquinovose:DAG sulfoquinovosyltransferase activity,
FT                   transferase activity, transferring glycosyl groups;
FT                   INVOLVED IN: cellular response to phosphate starvation,
FT                   sulfolipid biosynthetic process, glycolipid biosynthetic
FT                   process; LOCATED IN: chloroplast, chloroplast envelope;
FT                   EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13
FT                   growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl
FT                   transferase, group 1 (InterPro:IPR001296); BEST Arabidopsis
FT                   thaliana protein match is: UDP-Glycosyltransferase
FT                   superfamily protein (TAIR:AT5G59070.1); Has 35941 Blast
FT                   hits to 35876 proteins in 3155 species: Archae - 1250;
FT                   Bacteria - 26211; Metazoa - 142; Fungi - 236; Plants -
FT                   1690; Viruses - 2; Other Eukaryotes - 6410 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01220"
FT                   /db_xref="GOA:Q8S4F6"
FT                   /db_xref="InterPro:IPR001296"
FT                   /db_xref="InterPro:IPR028098"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8S4F6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES088950.1,INSD:EL123674.1,INSD:ES100266.1,
FT                   INSD:AI999595.1,INSD:EG496269.1,INSD:EL073620.1,
FT                   INSD:EL275023.1,INSD:BP805010.1,INSD:BP847142.1,
FT                   INSD:ES113947.1,INSD:AV540845.1,INSD:EG496268.1,
FT                   INSD:EH907656.1,INSD:EG451757.1,INSD:AV784670.1,
FT                   INSD:EL122192.1,INSD:ES184102.1,INSD:EG451765.1,
FT                   INSD:ES114807.1,INSD:EL277212.1,INSD:BP791225.1,
FT                   INSD:EL203802.1,INSD:EG451746.1,INSD:EL172067.1,
FT                   INSD:EG473715.1,INSD:CD530520.1,INSD:AV811076.1,
FT                   INSD:EG451747.1,INSD:EL022787.1,INSD:EL252269.1,
FT                   INSD:EL019868.1,INSD:EL169646.1,INSD:AV823662.1,
FT                   INSD:BG459186.1,INSD:EG451763.1,INSD:DR353265.1,
FT                   INSD:AA651177.1,INSD:EL264514.1,INSD:EL027254.1,
FT                   INSD:ES059394.1,INSD:CD532372.1,INSD:EH796489.1,
FT                   INSD:EG451758.1,INSD:CB259028.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF454354.1,INSD:BT005796.1,INSD:AY045961.2,
FT                   INSD:BX830044.1"
FT                   /protein_id="AED90311.1"
FT   CDS_pept        complement(join(87369..87630,87724..87780,87858..87935,
FT                   88027..88114,88204..88287,88388..88443,88525..88598,
FT                   88701..88818,88892..88962,89103..89169,89539..89885))
FT                   /codon_start=1
FT                   /gene="SQD2"
FT                   /gene_synonym="F7J8.200"
FT                   /gene_synonym="F7J8_200"
FT                   /gene_synonym="SULFOLIPID SYNTHASE"
FT                   /gene_synonym="sulfoquinovosyldiacylglycerol 2"
FT                   /locus_tag="AT5G01220"
FT                   /product="sulfoquinovosyldiacylglycerol 2"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01220"
FT                   /db_xref="InterPro:IPR028098"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BCW3"
FT                   /protein_id="ANM69427.1"
FT   gene            91786..92438
FT                   /locus_tag="AT5G01225"
FT   mRNA            91786..92438
FT                   /locus_tag="AT5G01225"
FT                   /product="josephin-like protein"
FT   gene            complement(91838..95701)
FT                   /gene_synonym="F7J8.210"
FT                   /gene_synonym="F7J8_210"
FT                   /locus_tag="AT5G01230"
FT   mRNA            complement(join(91838..93009,93289..93396,93521..93584,
FT                   93734..93826,93949..94001,94086..94146,94264..94372,
FT                   94482..94531,94948..94997,95155..95248,95354..95411,
FT                   95582..95701))
FT                   /gene_synonym="F7J8.210"
FT                   /gene_synonym="F7J8_210"
FT                   /locus_tag="AT5G01230"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES095525.1,INSD:DR376531.1,INSD:ES019084.1,
FT                   INSD:ES195894.1,INSD:DR340117.1,INSD:AV782172.1,
FT                   INSD:ES006860.1,INSD:ES112689.1,INSD:AV821653.1,
FT                   INSD:ES011037.1,INSD:ES093155.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AY050853.1"
FT   CDS_pept        91920..92324
FT                   /codon_start=1
FT                   /locus_tag="AT5G01225"
FT                   /product="josephin-like protein"
FT                   /note="unknown protein; BEST Arabidopsis thaliana protein
FT                   match is: unknown protein (TAIR:AT3G09032.1); Has 30201
FT                   Blast hits to 17322 proteins in 780 species: Archae - 12;
FT                   Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants -
FT                   5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01225"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01225.1"
FT                   /db_xref="GOA:Q3E9N0"
FT                   /db_xref="UniProtKB/TrEMBL:Q3E9N0"
FT                   /protein_id="AED90312.1"
FT   mRNA            complement(join(92601..93009,93289..93396,93521..93584,
FT                   93734..93826,93949..94146,94264..94372,94482..94708,
FT                   94948..94997,95155..95248,95354..95411,95582..95686))
FT                   /gene_synonym="F7J8.210"
FT                   /gene_synonym="F7J8_210"
FT                   /locus_tag="AT5G01230"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR376531.1,INSD:DR340118.1,INSD:ES195894.1,
FT                   INSD:DR340117.1,INSD:AV782172.1,INSD:ES006860.1,
FT                   INSD:ES112689.1,INSD:ES077788.1,INSD:BP864121.1,
FT                   INSD:ES093155.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BT002330.1"
FT   CDS_pept        complement(join(92789..93009,93289..93396,93521..93584,
FT                   93734..93826,93949..94001,94086..94146,94264..94372,
FT                   94482..94531,94948..94997,95155..95248,95354..95380))
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.210"
FT                   /gene_synonym="F7J8_210"
FT                   /locus_tag="AT5G01230"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /note="S-adenosyl-L-methionine-dependent methyltransferases
FT                   superfamily protein; FUNCTIONS IN: methyltransferase
FT                   activity, nucleic acid binding; INVOLVED IN: methylation,
FT                   rRNA methylation; LOCATED IN: cellular_component unknown;
FT                   EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13
FT                   growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal RNA
FT                   methyltransferase J (InterPro:IPR015507), Ribosomal RNA
FT                   methyltransferase RrmJ/FtsJ (InterPro:IPR002877); BEST
FT                   Arabidopsis thaliana protein match is: FtsJ-like
FT                   methyltransferase family protein (TAIR:AT4G25730.1); Has
FT                   5711 Blast hits to 5669 proteins in 1418 species: Archae -
FT                   154; Bacteria - 2315; Metazoa - 596; Fungi - 413; Plants -
FT                   124; Viruses - 65; Other Eukaryotes - 2044 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01230"
FT                   /db_xref="GOA:Q8GUN8"
FT                   /db_xref="InterPro:IPR002877"
FT                   /db_xref="InterPro:IPR015507"
FT                   /db_xref="InterPro:IPR028590"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q8GUN8"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR376531.1,INSD:DR340118.1,INSD:ES195894.1,
FT                   INSD:DR340117.1,INSD:AV782172.1,INSD:ES006860.1,
FT                   INSD:ES112689.1,INSD:ES077788.1,INSD:BP864121.1,
FT                   INSD:ES093155.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BT002330.1"
FT                   /protein_id="AED90314.1"
FT   CDS_pept        complement(join(94694..94708,94948..94997,95155..95248,
FT                   95354..95380))
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.210"
FT                   /gene_synonym="F7J8_210"
FT                   /locus_tag="AT5G01230"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /note="S-adenosyl-L-methionine-dependent methyltransferases
FT                   superfamily protein; FUNCTIONS IN: methyltransferase
FT                   activity, nucleic acid binding; INVOLVED IN: methylation,
FT                   rRNA methylation; LOCATED IN: cellular_component unknown;
FT                   EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13
FT                   growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal RNA
FT                   methyltransferase J (InterPro:IPR015507), Ribosomal RNA
FT                   methyltransferase RrmJ/FtsJ (InterPro:IPR002877); BEST
FT                   Arabidopsis thaliana protein match is: FtsJ-like
FT                   methyltransferase family protein (TAIR:AT4G25730.1); Has
FT                   30201 Blast hits to 17322 proteins in 780 species: Archae -
FT                   12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants
FT                   - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01230"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01230.2"
FT                   /db_xref="GOA:F4K7Z6"
FT                   /db_xref="InterPro:IPR002877"
FT                   /db_xref="InterPro:IPR028590"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:F4K7Z6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES095525.1,INSD:DR376531.1,INSD:ES019084.1,
FT                   INSD:ES195894.1,INSD:DR340117.1,INSD:AV782172.1,
FT                   INSD:ES006860.1,INSD:ES112689.1,INSD:AV821653.1,
FT                   INSD:ES011037.1,INSD:ES093155.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AY050853.1"
FT                   /protein_id="AED90313.1"
FT                   VDLCAAPGSWSQSGRS"
FT   gene            complement(97161..97436)
FT                   /locus_tag="AT5G00745"
FT   ncRNA           complement(97161..97436)
FT                   /locus_tag="AT5G00745"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            97536..101835
FT                   /gene="LAX1"
FT                   /gene_synonym="F7J8.220"
FT                   /gene_synonym="F7J8_220"
FT                   /gene_synonym="like AUXIN RESISTANT 1"
FT                   /locus_tag="AT5G01240"
FT                   /note="Encodes LAX1 (LIKE AUXIN RESISTANT), a member of the
FT                   AUX1 LAX family of auxin influx carriers. Required for the
FT                   establishment of embryonic root cell organization."
FT   mRNA            join(97536..98088,98215..98419,98615..98803,98931..99043,
FT                   99176..99359,99441..99538,100118..100325,100634..100891,
FT                   101269..101835)
FT                   /gene="LAX1"
FT                   /gene_synonym="F7J8.220"
FT                   /gene_synonym="F7J8_220"
FT                   /gene_synonym="like AUXIN RESISTANT 1"
FT                   /locus_tag="AT5G01240"
FT                   /product="like AUXIN RESISTANT 1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP787325.1,INSD:BP825250.1,INSD:BP844502.1,
FT                   INSD:AV786500.1,INSD:BP780173.1,INSD:EH860636.1,
FT                   INSD:EH878879.1,INSD:EL083575.1,INSD:DR283805.1,
FT                   INSD:BP664740.1,INSD:EL112096.1,INSD:AV821463.1,
FT                   INSD:EL239235.1,INSD:BP855385.1,INSD:BP591839.1,
FT                   INSD:BP654245.1,INSD:BP664825.1,INSD:EH972697.1,
FT                   INSD:EL155919.1,INSD:BP819900.1,INSD:BP804266.1,
FT                   INSD:BP647266.1,INSD:AV790258.1,INSD:EL063314.1,
FT                   INSD:EL022068.1,INSD:EL240342.1,INSD:EL283994.1,
FT                   INSD:BP843961.1,INSD:EH835424.1,INSD:CF773448.1,
FT                   INSD:EH846141.1,INSD:EL072648.1,INSD:BP779699.1,
FT                   INSD:BP862111.1,INSD:EL163876.1,INSD:EL215878.1,
FT                   INSD:EL170376.1,INSD:EH819666.1,INSD:BP615918.1,
FT                   INSD:EH984785.1,INSD:BP856806.1,INSD:DR283806.1,
FT                   INSD:EL187318.1,INSD:BP644678.1,INSD:AV526808.1,
FT                   INSD:BP665586.1,INSD:BP587397.1,INSD:DR376289.1,
FT                   INSD:BP868011.1,INSD:EL261982.1,INSD:EL165075.1,
FT                   INSD:EH804336.1,INSD:BP638154.1,INSD:BP659331.1,
FT                   INSD:EL014164.1,INSD:EL155882.1,INSD:BP816398.1,
FT                   INSD:BP792310.1,INSD:EH984893.1,INSD:EL253395.1,
FT                   INSD:DR363559.1,INSD:AV781921.1,INSD:EG493607.1,
FT                   INSD:BP862271.1,INSD:EL106371.1,INSD:EH938681.1,
FT                   INSD:EL150053.1,INSD:BP857703.1,INSD:EL134083.1,
FT                   INSD:EL078195.1,INSD:EH922564.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830652.1,INSD:BX831209.1,INSD:AJ249442.1,
FT                   INSD:BX830611.1"
FT   CDS_pept        join(98228..98419,98615..98803,98931..99043,99176..99359,
FT                   99441..99538,100118..100325,100634..100891,101269..101493)
FT                   /codon_start=1
FT                   /gene="LAX1"
FT                   /gene_synonym="F7J8.220"
FT                   /gene_synonym="F7J8_220"
FT                   /gene_synonym="like AUXIN RESISTANT 1"
FT                   /locus_tag="AT5G01240"
FT                   /product="like AUXIN RESISTANT 1"
FT                   /note="like AUXIN RESISTANT 1 (LAX1); CONTAINS InterPro
FT                   DOMAIN/s: Amino acid transporter, transmembrane
FT                   (InterPro:IPR013057); BEST Arabidopsis thaliana protein
FT                   match is: Transmembrane amino acid transporter family
FT                   protein (TAIR:AT2G38120.1); Has 1807 Blast hits to 1807
FT                   proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa
FT                   - 736; Fungi - 347; Plants - 385; Viruses - 0; Other
FT                   Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01240"
FT                   /db_xref="GOA:Q9LFB2"
FT                   /db_xref="InterPro:IPR013057"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LFB2"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP787325.1,INSD:BP825250.1,INSD:BP844502.1,
FT                   INSD:AV786500.1,INSD:BP780173.1,INSD:EH860636.1,
FT                   INSD:EH878879.1,INSD:EL083575.1,INSD:DR283805.1,
FT                   INSD:BP664740.1,INSD:EL112096.1,INSD:AV821463.1,
FT                   INSD:EL239235.1,INSD:BP855385.1,INSD:BP591839.1,
FT                   INSD:BP654245.1,INSD:BP664825.1,INSD:EH972697.1,
FT                   INSD:EL155919.1,INSD:BP819900.1,INSD:BP804266.1,
FT                   INSD:BP647266.1,INSD:AV790258.1,INSD:EL063314.1,
FT                   INSD:EL022068.1,INSD:EL240342.1,INSD:EL283994.1,
FT                   INSD:BP843961.1,INSD:EH835424.1,INSD:CF773448.1,
FT                   INSD:EH846141.1,INSD:EL072648.1,INSD:BP779699.1,
FT                   INSD:BP862111.1,INSD:EL163876.1,INSD:EL215878.1,
FT                   INSD:EL170376.1,INSD:EH819666.1,INSD:BP615918.1,
FT                   INSD:EH984785.1,INSD:BP856806.1,INSD:DR283806.1,
FT                   INSD:EL187318.1,INSD:BP644678.1,INSD:AV526808.1,
FT                   INSD:BP665586.1,INSD:BP587397.1,INSD:DR376289.1,
FT                   INSD:BP868011.1,INSD:EL261982.1,INSD:EL165075.1,
FT                   INSD:EH804336.1,INSD:BP638154.1,INSD:BP659331.1,
FT                   INSD:EL014164.1,INSD:EL155882.1,INSD:BP816398.1,
FT                   INSD:BP792310.1,INSD:EH984893.1,INSD:EL253395.1,
FT                   INSD:DR363559.1,INSD:AV781921.1,INSD:EG493607.1,
FT                   INSD:BP862271.1,INSD:EL106371.1,INSD:EH938681.1,
FT                   INSD:EL150053.1,INSD:BP857703.1,INSD:EL134083.1,
FT                   INSD:EL078195.1,INSD:EH922564.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830652.1,INSD:BX831209.1,INSD:AJ249442.1,
FT                   INSD:BX830611.1"
FT                   /protein_id="AED90315.1"
FT   mRNA            join(98533..98803,98931..99043,99176..99359,99441..99538,
FT                   100118..100325,100634..100891,101269..101835)
FT                   /gene="LAX1"
FT                   /gene_synonym="F7J8.220"
FT                   /gene_synonym="F7J8_220"
FT                   /gene_synonym="like AUXIN RESISTANT 1"
FT                   /locus_tag="AT5G01240"
FT                   /product="like AUXIN RESISTANT 1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP787325.1,INSD:AV786500.1,INSD:BP780173.1,
FT                   INSD:EH860636.1,INSD:EH878879.1,INSD:EL083575.1,
FT                   INSD:BP664740.1,INSD:BP591839.1,INSD:BP654245.1,
FT                   INSD:BP664825.1,INSD:EH972697.1,INSD:BP647266.1,
FT                   INSD:AV790258.1,INSD:EL063314.1,INSD:EL022068.1,
FT                   INSD:EL240342.1,INSD:EL283994.1,INSD:EH835424.1,
FT                   INSD:CF773448.1,INSD:EH846141.1,INSD:EL072648.1,
FT                   INSD:BP779699.1,INSD:EL163876.1,INSD:EL215878.1,
FT                   INSD:EL170376.1,INSD:BP615918.1,INSD:EH984785.1,
FT                   INSD:EL187318.1,INSD:BP644678.1,INSD:BP587397.1,
FT                   INSD:BP665586.1,INSD:EL165075.1,INSD:EH804336.1,
FT                   INSD:BP638154.1,INSD:EL155882.1,INSD:EL014164.1,
FT                   INSD:BP659331.1,INSD:EH984893.1,INSD:BP792310.1,
FT                   INSD:DR363559.1,INSD:AV781921.1,INSD:EG493607.1,
FT                   INSD:EL106371.1,INSD:EH938681.1,INSD:EL150053.1,
FT                   INSD:EL134083.1,INSD:EL078195.1,INSD:EH922564.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830786.1,INSD:BX830611.1"
FT   CDS_pept        join(98663..98803,98931..99043,99176..99359,99441..99538,
FT                   100118..100325,100634..100891,101269..101493)
FT                   /codon_start=1
FT                   /gene="LAX1"
FT                   /gene_synonym="F7J8.220"
FT                   /gene_synonym="F7J8_220"
FT                   /gene_synonym="like AUXIN RESISTANT 1"
FT                   /locus_tag="AT5G01240"
FT                   /product="like AUXIN RESISTANT 1"
FT                   /note="like AUXIN RESISTANT 1 (LAX1); FUNCTIONS IN:
FT                   transporter activity; INVOLVED IN: amino acid transport,
FT                   root cap development; LOCATED IN: endomembrane system,
FT                   membrane; EXPRESSED IN: 20 plant structures; EXPRESSED
FT                   DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Amino
FT                   acid transporter, transmembrane (InterPro:IPR013057); BEST
FT                   Arabidopsis thaliana protein match is: Transmembrane amino
FT                   acid transporter family protein (TAIR:AT2G38120.1); Has
FT                   35333 Blast hits to 34131 proteins in 2444 species: Archae
FT                   - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991; Plants
FT                   - 531; Viruses - 0; Other Eukaryotes - 9610 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01240"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01240.2"
FT                   /db_xref="GOA:F4K7Z8"
FT                   /db_xref="InterPro:IPR013057"
FT                   /db_xref="UniProtKB/TrEMBL:F4K7Z8"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP787325.1,INSD:AV786500.1,INSD:BP780173.1,
FT                   INSD:EH860636.1,INSD:EH878879.1,INSD:EL083575.1,
FT                   INSD:BP664740.1,INSD:BP591839.1,INSD:BP654245.1,
FT                   INSD:BP664825.1,INSD:EH972697.1,INSD:BP647266.1,
FT                   INSD:AV790258.1,INSD:EL063314.1,INSD:EL022068.1,
FT                   INSD:EL240342.1,INSD:EL283994.1,INSD:EH835424.1,
FT                   INSD:CF773448.1,INSD:EH846141.1,INSD:EL072648.1,
FT                   INSD:BP779699.1,INSD:EL163876.1,INSD:EL215878.1,
FT                   INSD:EL170376.1,INSD:BP615918.1,INSD:EH984785.1,
FT                   INSD:EL187318.1,INSD:BP644678.1,INSD:BP587397.1,
FT                   INSD:BP665586.1,INSD:EL165075.1,INSD:EH804336.1,
FT                   INSD:BP638154.1,INSD:EL155882.1,INSD:EL014164.1,
FT                   INSD:BP659331.1,INSD:EH984893.1,INSD:BP792310.1,
FT                   INSD:DR363559.1,INSD:AV781921.1,INSD:EG493607.1,
FT                   INSD:EL106371.1,INSD:EH938681.1,INSD:EL150053.1,
FT                   INSD:EL134083.1,INSD:EL078195.1,INSD:EH922564.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX830786.1,INSD:BX830611.1"
FT                   /protein_id="AED90316.1"
FT                   IAAGAHHRR"
FT   gene            complement(102176..103770)
FT                   /gene_synonym="F7J8.230"
FT                   /gene_synonym="F7J8_230"
FT                   /locus_tag="AT5G01250"
FT   mRNA            complement(102176..103770)
FT                   /gene_synonym="F7J8.230"
FT                   /gene_synonym="F7J8_230"
FT                   /locus_tag="AT5G01250"
FT                   /product="alpha 1,4-glycosyltransferase family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AA721858.1,INSD:AU237937.1,INSD:AU229051.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832384.1,INSD:BT015324.1,INSD:BX832585.1,
FT                   INSD:AK229418.1"
FT   CDS_pept        complement(102370..103593)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.230"
FT                   /gene_synonym="F7J8_230"
FT                   /locus_tag="AT5G01250"
FT                   /product="alpha 1,4-glycosyltransferase family protein"
FT                   /note="alpha 1,4-glycosyltransferase family protein;
FT                   FUNCTIONS IN: transferase activity, transferring glycosyl
FT                   groups, transferase activity; INVOLVED IN:
FT                   biological_process unknown; LOCATED IN: Golgi stack;
FT                   CONTAINS InterPro DOMAIN/s: Alpha 1,4-glycosyltransferase
FT                   conserved region (InterPro:IPR007652), Glycosyltransferase,
FT                   DXD sugar-binding region (InterPro:IPR007577); BEST
FT                   Arabidopsis thaliana protein match is: alpha
FT                   1,4-glycosyltransferase family protein (TAIR:AT3G09020.1);
FT                   Has 1807 Blast hits to 1807 proteins in 277 species: Archae
FT                   - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants -
FT                   385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01250"
FT                   /db_xref="GOA:Q9LFB1"
FT                   /db_xref="InterPro:IPR007577"
FT                   /db_xref="InterPro:IPR007652"
FT                   /db_xref="InterPro:IPR029044"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFB1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AA721858.1,INSD:AU237937.1,INSD:AU229051.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832384.1,INSD:BT015324.1,INSD:BX832585.1,
FT                   INSD:AK229418.1"
FT                   /protein_id="AED90317.1"
FT                   CEISSVSS"
FT   gene            105268..107454
FT                   /gene_synonym="F7J8.240"
FT                   /gene_synonym="F7J8_240"
FT                   /locus_tag="AT5G01260"
FT   mRNA            join(105268..105582,105697..105888,105976..106476,
FT                   106797..107454)
FT                   /gene_synonym="F7J8.240"
FT                   /gene_synonym="F7J8_240"
FT                   /locus_tag="AT5G01260"
FT                   /product="Carbohydrate-binding-like fold"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL320757.1,INSD:EH991409.1,INSD:CB261918.1,
FT                   INSD:AV829512.1,INSD:AV806583.1,INSD:ES174875.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY143857.1,INSD:AY057624.1"
FT   mRNA            join(105268..105582,105697..105888,105976..106453,
FT                   106797..107454)
FT                   /gene_synonym="F7J8.240"
FT                   /gene_synonym="F7J8_240"
FT                   /locus_tag="AT5G01260"
FT                   /product="Carbohydrate-binding-like fold"
FT   mRNA            join(105282..105582,105697..105888,105976..107405)
FT                   /gene_synonym="F7J8.240"
FT                   /gene_synonym="F7J8_240"
FT                   /locus_tag="AT5G01260"
FT                   /product="Carbohydrate-binding-like fold"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL320757.1,INSD:EH991409.1,INSD:ES157460.1,
FT                   INSD:AV829512.1,INSD:AV806583.1,INSD:EH990665.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX830930.1"
FT   CDS_pept        join(105367..105582,105697..105888,105976..106476,
FT                   106797..107045)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.240"
FT                   /gene_synonym="F7J8_240"
FT                   /locus_tag="AT5G01260"
FT                   /product="Carbohydrate-binding-like fold"
FT                   /note="Carbohydrate-binding-like fold; FUNCTIONS IN:
FT                   carbohydrate binding, catalytic activity; INVOLVED IN:
FT                   carbohydrate metabolic process; LOCATED IN:
FT                   cellular_component unknown; EXPRESSED IN: 21 plant
FT                   structures; EXPRESSED DURING: 13 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Immunoglobulin-like fold
FT                   (InterPro:IPR013783), Carbohydrate-binding-like fold
FT                   (InterPro:IPR013784), Glycoside hydrolase,
FT                   carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis
FT                   thaliana protein match is: catalytics;carbohydrate
FT                   kinases;phosphoglucan, water dikinases (TAIR:AT5G26570.1);
FT                   Has 35333 Blast hits to 34131 proteins in 2444 species:
FT                   Archae - 798; Bacteria - 22429; Metazoa - 974; Fungi - 991;
FT                   Plants - 531; Viruses - 0; Other Eukaryotes - 9610 (source:
FT                   NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01260"
FT                   /db_xref="GOA:Q9LFB0"
FT                   /db_xref="InterPro:IPR002044"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR013784"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFB0"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL320757.1,INSD:EH991409.1,INSD:ES157460.1,
FT                   INSD:AV829512.1,INSD:AV806583.1,INSD:EH990665.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX830930.1"
FT                   /protein_id="AED90318.1"
FT   CDS_pept        join(105367..105582,105697..105888,105976..106453,
FT                   106797..106804)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.240"
FT                   /gene_synonym="F7J8_240"
FT                   /locus_tag="AT5G01260"
FT                   /product="Carbohydrate-binding-like fold"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01260"
FT                   /db_xref="GOA:A0A1P8BC56"
FT                   /db_xref="InterPro:IPR002044"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR013784"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BC56"
FT                   /protein_id="ANM69171.1"
FT                   LSDLDNEQVEVINEGR"
FT   CDS_pept        join(105367..105582,105697..105888,105976..106488)
FT                   /codon_start=1
FT                   /gene_synonym="F7J8.240"
FT                   /gene_synonym="F7J8_240"
FT                   /locus_tag="AT5G01260"
FT                   /product="Carbohydrate-binding-like fold"
FT                   /note="Carbohydrate-binding-like fold; FUNCTIONS IN:
FT                   carbohydrate binding, catalytic activity; INVOLVED IN:
FT                   carbohydrate metabolic process; LOCATED IN:
FT                   cellular_component unknown; EXPRESSED IN: 21 plant
FT                   structures; EXPRESSED DURING: 13 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Immunoglobulin-like fold
FT                   (InterPro:IPR013783), Carbohydrate-binding-like fold
FT                   (InterPro:IPR013784), Glycoside hydrolase,
FT                   carbohydrate-binding (InterPro:IPR002044); BEST Arabidopsis
FT                   thaliana protein match is: catalytics;carbohydrate
FT                   kinases;phosphoglucan, water dikinases (TAIR:AT5G26570.1);
FT                   Has 30201 Blast hits to 17322 proteins in 780 species:
FT                   Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi -
FT                   3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01260"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01260.1"
FT                   /db_xref="GOA:Q93ZD1"
FT                   /db_xref="InterPro:IPR002044"
FT                   /db_xref="InterPro:IPR013783"
FT                   /db_xref="InterPro:IPR013784"
FT                   /db_xref="UniProtKB/TrEMBL:Q93ZD1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL320757.1,INSD:EH991409.1,INSD:CB261918.1,
FT                   INSD:AV829512.1,INSD:AV806583.1,INSD:ES174875.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY143857.1,INSD:AY057624.1"
FT                   /protein_id="AED90319.1"
FT   gene            complement(107547..112324)
FT                   /gene="CPL2"
FT                   /gene_synonym="ATCPL2"
FT                   /gene_synonym="carboxyl-terminal domain (ctd)
FT                   phosphatase-like 2"
FT                   /gene_synonym="F7J8.250"
FT                   /gene_synonym="F7J8_250"
FT                   /locus_tag="AT5G01270"
FT                   /note="Encodes CPL2, a carboxyl-terminal domain (CTD)
FT                   phosphatase that dephosphorylates CTD Ser5-PO4 of the RNA
FT                   polymerase II complex. Regulates plant growth, stress and
FT                   auxin responses."
FT   mRNA            complement(join(107547..108311,108451..108547,
FT                   108636..108689,108768..108901,109159..109210,
FT                   109285..109595,109705..109837,109954..110046,
FT                   110133..110238,110330..110400,110497..110654,
FT                   110932..111142,111308..111778,111871..112324))
FT                   /gene="CPL2"
FT                   /gene_synonym="ATCPL2"
FT                   /gene_synonym="carboxyl-terminal domain (ctd)
FT                   phosphatase-like 2"
FT                   /gene_synonym="F7J8.250"
FT                   /gene_synonym="F7J8_250"
FT                   /locus_tag="AT5G01270"
FT                   /product="carboxyl-terminal domain (ctd) phosphatase-like
FT                   2"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL067243.1,INSD:T41710.1,INSD:EH873920.1,
FT                   INSD:AV529275.1,INSD:AV530190.1,INSD:AV523337.1,
FT                   INSD:AV523573.1,INSD:EH865680.1,INSD:EL150676.1,
FT                   INSD:ES146811.1,INSD:EL299957.1,INSD:AV524301.1,
FT                   INSD:ES076522.1,INSD:BP800652.1,INSD:ES124882.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AK221220.1"
FT   mRNA            complement(join(107646..107958,108167..108311,
FT                   108451..108547,108636..108689,108768..108901,
FT                   109159..109210,109285..109595,109705..109837,
FT                   109954..110046,110133..110238,110330..110400,
FT                   110497..110654,110932..111142,111308..111778,
FT                   111871..112311))
FT                   /gene="CPL2"
FT                   /gene_synonym="ATCPL2"
FT                   /gene_synonym="carboxyl-terminal domain (ctd)
FT                   phosphatase-like 2"
FT                   /gene_synonym="F7J8.250"
FT                   /gene_synonym="F7J8_250"
FT                   /locus_tag="AT5G01270"
FT                   /product="carboxyl-terminal domain (ctd) phosphatase-like
FT                   2"
FT   CDS_pept        complement(join(107943..107958,108167..108311,
FT                   108451..108547,108636..108689,108768..108901,
FT                   109159..109210,109285..109595,109705..109837,
FT                   109954..110046,110133..110238,110330..110400,
FT                   110497..110654,110932..111142,111308..111778,
FT                   111871..112143))
FT                   /codon_start=1
FT                   /gene="CPL2"
FT                   /gene_synonym="ATCPL2"
FT                   /gene_synonym="carboxyl-terminal domain (ctd)
FT                   phosphatase-like 2"
FT                   /gene_synonym="F7J8.250"
FT                   /gene_synonym="F7J8_250"
FT                   /locus_tag="AT5G01270"
FT                   /product="carboxyl-terminal domain (ctd) phosphatase-like
FT                   2"
FT                   /note="carboxyl-terminal domain (ctd) phosphatase-like 2
FT                   (CPL2); FUNCTIONS IN: double-stranded RNA binding,
FT                   phosphatase activity; INVOLVED IN: response to auxin
FT                   stimulus, response to osmotic stress, developmental growth;
FT                   LOCATED IN: intracellular; EXPRESSED IN: 25 plant
FT                   structures; EXPRESSED DURING: 14 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Double-stranded RNA-binding
FT                   (InterPro:IPR001159), Double-stranded RNA-binding-like
FT                   (InterPro:IPR014720), NLI interacting factor
FT                   (InterPro:IPR004274); BEST Arabidopsis thaliana protein
FT                   match is: C-terminal domain phosphatase-like 1
FT                   (TAIR:AT4G21670.1)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01270"
FT                   /db_xref="GOA:F4K802"
FT                   /db_xref="InterPro:IPR004274"
FT                   /db_xref="InterPro:IPR014720"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="InterPro:IPR039189"
FT                   /db_xref="UniProtKB/TrEMBL:F4K802"
FT                   /protein_id="AED90321.1"
FT   CDS_pept        complement(join(108163..108311,108451..108547,
FT                   108636..108689,108768..108901,109159..109210,
FT                   109285..109595,109705..109837,109954..110046,
FT                   110133..110238,110330..110400,110497..110654,
FT                   110932..111142,111308..111778,111871..112143))
FT                   /codon_start=1
FT                   /gene="CPL2"
FT                   /gene_synonym="ATCPL2"
FT                   /gene_synonym="carboxyl-terminal domain (ctd)
FT                   phosphatase-like 2"
FT                   /gene_synonym="F7J8.250"
FT                   /gene_synonym="F7J8_250"
FT                   /locus_tag="AT5G01270"
FT                   /product="carboxyl-terminal domain (ctd) phosphatase-like
FT                   2"
FT                   /note="carboxyl-terminal domain (ctd) phosphatase-like 2
FT                   (CPL2); FUNCTIONS IN: double-stranded RNA binding,
FT                   phosphatase activity; INVOLVED IN: response to auxin
FT                   stimulus, response to osmotic stress, developmental growth;
FT                   LOCATED IN: intracellular; EXPRESSED IN: 25 plant
FT                   structures; EXPRESSED DURING: 14 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Double-stranded RNA-binding
FT                   (InterPro:IPR001159), Double-stranded RNA-binding-like
FT                   (InterPro:IPR014720), NLI interacting factor
FT                   (InterPro:IPR004274); BEST Arabidopsis thaliana protein
FT                   match is: C-terminal domain phosphatase-like 1
FT                   (TAIR:AT4G21670.1); Has 234 Blast hits to 223 proteins in
FT                   82 species: Archae - 0; Bacteria - 8; Metazoa - 40; Fungi -
FT                   61; Plants - 110; Viruses - 0; Other Eukaryotes - 15
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01270"
FT                   /db_xref="GOA:Q5YDB5"
FT                   /db_xref="InterPro:IPR004274"
FT                   /db_xref="InterPro:IPR014720"
FT                   /db_xref="InterPro:IPR036412"
FT                   /db_xref="InterPro:IPR039189"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q5YDB5"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL067243.1,INSD:T41710.1,INSD:EH873920.1,
FT                   INSD:AV529275.1,INSD:AV530190.1,INSD:AV523337.1,
FT                   INSD:AV523573.1,INSD:EH865680.1,INSD:EL150676.1,
FT                   INSD:ES146811.1,INSD:EL299957.1,INSD:AV524301.1,
FT                   INSD:ES076522.1,INSD:BP800652.1,INSD:ES124882.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AK221220.1"
FT                   /protein_id="AED90320.1"
FT                   SNKGLEEEAPKENISEL"
FT   gene            complement(113921..116411)
FT                   /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
FT                   /gene_synonym="BPP3"
FT                   /gene_synonym="T10O8.1"
FT                   /locus_tag="AT5G01280"
FT                   /note="Encodes a microtubule-associated protein."
FT   mRNA            complement(join(113921..114373,114465..115487,
FT                   115604..115691,116155..116306))
FT                   /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
FT                   /gene_synonym="BPP3"
FT                   /gene_synonym="T10O8.1"
FT                   /locus_tag="AT5G01280"
FT                   /product="GPI-anchored protein"
FT   mRNA            complement(join(113921..115487,115604..115691,
FT                   116155..116306))
FT                   /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
FT                   /gene_synonym="BPP3"
FT                   /gene_synonym="T10O8.1"
FT                   /locus_tag="AT5G01280"
FT                   /product="GPI-anchored protein"
FT   mRNA            complement(join(113999..114373,114465..115487,
FT                   115604..115691,116155..116266,116344..116411))
FT                   /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
FT                   /gene_synonym="BPP3"
FT                   /gene_synonym="T10O8.1"
FT                   /locus_tag="AT5G01280"
FT                   /product="GPI-anchored protein"
FT                   /inference="similar to RNA sequence, EST:INSD:T12964.1"
FT   CDS_pept        complement(join(114185..114373,114465..115487,
FT                   115604..115691,116155..116266,116344..116386))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.1"
FT                   /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
FT                   /gene_synonym="BPP3"
FT                   /locus_tag="AT5G01280"
FT                   /product="GPI-anchored protein"
FT                   /note="BEST Arabidopsis thaliana protein match is:
FT                   proline-rich family protein (TAIR:AT3G09000.1); Has 1807
FT                   Blast hits to 1807 proteins in 277 species: Archae - 0;
FT                   Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01280"
FT                   /db_xref="UniProtKB/TrEMBL:F4K804"
FT                   /inference="similar to RNA sequence, EST:INSD:T12964.1"
FT                   /protein_id="AED90322.2"
FT   CDS_pept        complement(join(114185..114373,114465..115487,
FT                   115604..115691,116155..116237))
FT                   /codon_start=1
FT                   /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
FT                   /gene_synonym="BPP3"
FT                   /gene_synonym="T10O8.1"
FT                   /locus_tag="AT5G01280"
FT                   /product="GPI-anchored protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01280"
FT                   /db_xref="GOA:Q9LFA8"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LFA8"
FT                   /protein_id="ANM68341.1"
FT                   CS"
FT   CDS_pept        complement(join(114456..115487,115604..115691,
FT                   116155..116237))
FT                   /codon_start=1
FT                   /gene_synonym="BASIC PROLINE-RICH PROTEIN3"
FT                   /gene_synonym="BPP3"
FT                   /gene_synonym="T10O8.1"
FT                   /locus_tag="AT5G01280"
FT                   /product="GPI-anchored protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01280"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8B9S1"
FT                   /protein_id="ANM68342.1"
FT                   R"
FT   gene            117297..121569
FT                   /gene_synonym="T10O8.2"
FT                   /locus_tag="AT5G01290"
FT   mRNA            join(117297..117618,117742..117859,117933..118084,
FT                   118160..118243,118330..118392,118522..118656,
FT                   118749..118955,119355..119474,119697..119746,
FT                   119877..120039,120120..120260,120426..120533,
FT                   120615..120713,120864..121172,121267..121569)
FT                   /gene_synonym="T10O8.2"
FT                   /locus_tag="AT5G01290"
FT                   /product="mRNA capping enzyme family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:Z17627.1,INSD:AV798196.1,INSD:BP563844.1,
FT                   INSD:DR355246.1,INSD:BP591967.1,INSD:BP588577.1,
FT                   INSD:AV786438.1,INSD:EL171779.1,INSD:BP797965.1,
FT                   INSD:BP834070.1,INSD:BP824094.1,INSD:EH939563.1,
FT                   INSD:BP568835.1,INSD:EL131410.1,INSD:BP571238.1,
FT                   INSD:BP586097.1,INSD:AV822021.1,INSD:BP616965.1,
FT                   INSD:BP833437.1,INSD:BE526500.1,INSD:BP612120.1,
FT                   INSD:AV782639.1,INSD:BP575137.1,INSD:ES160931.1,
FT                   INSD:AV824508.1,INSD:BP565862.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT000440.1,INSD:BT001162.1"
FT   CDS_pept        join(117520..117618,117742..117859,117933..118084,
FT                   118160..118243,118330..118392,118522..118656,
FT                   118749..118955,119355..119474,119697..119746,
FT                   119877..120039,120120..120260,120426..120533,
FT                   120615..120713,120864..121172,121267..121392)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.2"
FT                   /locus_tag="AT5G01290"
FT                   /product="mRNA capping enzyme family protein"
FT                   /note="mRNA capping enzyme family protein; FUNCTIONS IN:
FT                   phosphatase activity, protein tyrosine phosphatase
FT                   activity, protein tyrosine/serine/threonine phosphatase
FT                   activity, mRNA guanylyltransferase activity, polynucleotide
FT                   5'-phosphatase activity; INVOLVED IN: protein amino acid
FT                   dephosphorylation, mRNA processing, mRNA capping,
FT                   dephosphorylation; LOCATED IN: nucleus; EXPRESSED IN: 24
FT                   plant structures; EXPRESSED DURING: 15 growth stages;
FT                   CONTAINS InterPro DOMAIN/s: Nucleic acid-binding, OB-fold
FT                   (InterPro:IPR012340), Dual-specific/protein-tyrosine
FT                   phosphatase, conserved region (InterPro:IPR000387), mRNA
FT                   capping enzyme (InterPro:IPR001339), mRNA capping enzyme,
FT                   bifunctional (InterPro:IPR017074), Protein-tyrosine
FT                   phosphatase, active site (InterPro:IPR016130), Nucleic
FT                   acid-binding, OB-fold-like (InterPro:IPR016027), Dual
FT                   specificity phosphatase, catalytic domain
FT                   (InterPro:IPR000340), mRNA capping enzyme, C-terminal
FT                   (InterPro:IPR013846); BEST Arabidopsis thaliana protein
FT                   match is: mRNA capping enzyme family protein
FT                   (TAIR:AT3G09100.2); Has 888 Blast hits to 860 proteins in
FT                   246 species: Archae - 0; Bacteria - 2; Metazoa - 276; Fungi
FT                   - 241; Plants - 79; Viruses - 71; Other Eukaryotes - 219
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01290"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01290.1"
FT                   /db_xref="GOA:Q8GSD7"
FT                   /db_xref="InterPro:IPR000340"
FT                   /db_xref="InterPro:IPR000387"
FT                   /db_xref="InterPro:IPR001339"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR013846"
FT                   /db_xref="InterPro:IPR016130"
FT                   /db_xref="InterPro:IPR017074"
FT                   /db_xref="InterPro:IPR029021"
FT                   /db_xref="UniProtKB/TrEMBL:Q8GSD7"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:Z17627.1,INSD:AV798196.1,INSD:BP563844.1,
FT                   INSD:DR355246.1,INSD:BP591967.1,INSD:BP588577.1,
FT                   INSD:AV786438.1,INSD:EL171779.1,INSD:BP797965.1,
FT                   INSD:BP834070.1,INSD:BP824094.1,INSD:EH939563.1,
FT                   INSD:BP568835.1,INSD:EL131410.1,INSD:BP571238.1,
FT                   INSD:BP586097.1,INSD:AV822021.1,INSD:BP616965.1,
FT                   INSD:BP833437.1,INSD:BE526500.1,INSD:BP612120.1,
FT                   INSD:AV782639.1,INSD:BP575137.1,INSD:ES160931.1,
FT                   INSD:AV824508.1,INSD:BP565862.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT000440.1,INSD:BT001162.1"
FT                   /protein_id="AED90323.1"
FT   gene            complement(121483..122525)
FT                   /gene_synonym="T10O8.10"
FT                   /gene_synonym="T10O8_10"
FT                   /locus_tag="AT5G01300"
FT   mRNA            complement(join(121483..121717,121817..122111,
FT                   122330..122525))
FT                   /gene_synonym="T10O8.10"
FT                   /gene_synonym="T10O8_10"
FT                   /locus_tag="AT5G01300"
FT                   /product="PEBP (phosphatidylethanolamine-binding protein)
FT                   family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP825736.1,INSD:Z17627.1,INSD:AV798196.1,
FT                   INSD:BP563844.1,INSD:BP591967.1,INSD:BP588577.1,
FT                   INSD:AV786438.1,INSD:BP815018.1,INSD:BP568835.1,
FT                   INSD:Z17689.1,INSD:BP571238.1,INSD:BP823076.1,
FT                   INSD:BP616965.1,INSD:BP648514.1,INSD:BP612120.1,
FT                   INSD:AV782639.1,INSD:BP575137.1,INSD:ES160931.1,
FT                   INSD:AV824508.1,INSD:BP565862.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX833357.1,INSD:BX833686.1,INSD:BX833214.1,
FT                   INSD:AY065369.1,INSD:AY096477.1"
FT   mRNA            complement(join(121537..121717,121817..122507))
FT                   /gene_synonym="T10O8.10"
FT                   /gene_synonym="T10O8_10"
FT                   /locus_tag="AT5G01300"
FT                   /product="PEBP (phosphatidylethanolamine-binding protein)
FT                   family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP817557.1,INSD:BP568835.1,INSD:Z17627.1,
FT                   INSD:BP571238.1,INSD:BP586097.1,INSD:BP648514.1,
FT                   INSD:BP616965.1,INSD:BP819245.1,INSD:BP563844.1,
FT                   INSD:BP591967.1,INSD:BP588577.1,INSD:AV786438.1,
FT                   INSD:AV782639.1,INSD:BP575137.1,INSD:BP565862.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX833298.1"
FT   CDS_pept        complement(join(121643..121717,121817..122111,
FT                   122330..122448))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.10"
FT                   /gene_synonym="T10O8_10"
FT                   /locus_tag="AT5G01300"
FT                   /product="PEBP (phosphatidylethanolamine-binding protein)
FT                   family protein"
FT                   /note="PEBP (phosphatidylethanolamine-binding protein)
FT                   family protein; FUNCTIONS IN: phosphatidylethanolamine
FT                   binding; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: cellular_component unknown; EXPRESSED IN: 7 plant
FT                   structures; EXPRESSED DURING: LP.04 four leaves visible, 4
FT                   anthesis, 4 leaf senescence stage, petal differentiation
FT                   and expansion stage, LP.08 eight leaves visible; CONTAINS
FT                   InterPro DOMAIN/s: YbhB/YbcL (InterPro:IPR005247),
FT                   Phosphatidylethanolamine-binding protein PEBP
FT                   (InterPro:IPR008914); Has 1807 Blast hits to 1807 proteins
FT                   in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
FT                   Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
FT                   339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M042"
FT                   /db_xref="InterPro:IPR005247"
FT                   /db_xref="InterPro:IPR008914"
FT                   /db_xref="InterPro:IPR036610"
FT                   /db_xref="UniProtKB/TrEMBL:Q9M042"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP825736.1,INSD:Z17627.1,INSD:AV798196.1,
FT                   INSD:BP563844.1,INSD:BP591967.1,INSD:BP588577.1,
FT                   INSD:AV786438.1,INSD:BP815018.1,INSD:BP568835.1,
FT                   INSD:Z17689.1,INSD:BP571238.1,INSD:BP823076.1,
FT                   INSD:BP616965.1,INSD:BP648514.1,INSD:BP612120.1,
FT                   INSD:AV782639.1,INSD:BP575137.1,INSD:ES160931.1,
FT                   INSD:AV824508.1,INSD:BP565862.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX833357.1,INSD:BX833686.1,INSD:BX833214.1,
FT                   INSD:AY065369.1,INSD:AY096477.1"
FT                   /protein_id="AED90324.1"
FT   CDS_pept        complement(join(121643..121717,121817..122128))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.10"
FT                   /gene_synonym="T10O8_10"
FT                   /locus_tag="AT5G01300"
FT                   /product="PEBP (phosphatidylethanolamine-binding protein)
FT                   family protein"
FT                   /note="PEBP (phosphatidylethanolamine-binding protein)
FT                   family protein; FUNCTIONS IN: phosphatidylethanolamine
FT                   binding; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: cellular_component unknown; EXPRESSED IN: 7 plant
FT                   structures; EXPRESSED DURING: LP.04 four leaves visible, 4
FT                   anthesis, 4 leaf senescence stage, petal differentiation
FT                   and expansion stage, LP.08 eight leaves visible; CONTAINS
FT                   InterPro DOMAIN/s: YbhB/YbcL (InterPro:IPR005247),
FT                   Phosphatidylethanolamine-binding protein PEBP
FT                   (InterPro:IPR008914); Has 30201 Blast hits to 17322
FT                   proteins in 780 species: Archae - 12; Bacteria - 1396;
FT                   Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
FT                   Other Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01300"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01300.2"
FT                   /db_xref="InterPro:IPR005247"
FT                   /db_xref="InterPro:IPR008914"
FT                   /db_xref="InterPro:IPR036610"
FT                   /db_xref="UniProtKB/TrEMBL:B3H785"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP817557.1,INSD:BP568835.1,INSD:Z17627.1,
FT                   INSD:BP571238.1,INSD:BP586097.1,INSD:BP648514.1,
FT                   INSD:BP616965.1,INSD:BP819245.1,INSD:BP563844.1,
FT                   INSD:BP591967.1,INSD:BP588577.1,INSD:AV786438.1,
FT                   INSD:AV782639.1,INSD:BP575137.1,INSD:BP565862.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX833298.1"
FT                   /protein_id="AED90325.1"
FT   mRNA            complement(join(121729..121737,121817..122111,
FT                   122330..122525))
FT                   /gene_synonym="T10O8.10"
FT                   /gene_synonym="T10O8_10"
FT                   /locus_tag="AT5G01300"
FT                   /product="PEBP (phosphatidylethanolamine-binding protein)
FT                   family protein"
FT   CDS_pept        complement(join(121729..121737,121817..122111,
FT                   122330..122448))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.10"
FT                   /gene_synonym="T10O8_10"
FT                   /locus_tag="AT5G01300"
FT                   /product="PEBP (phosphatidylethanolamine-binding protein)
FT                   family protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01300"
FT                   /db_xref="InterPro:IPR005247"
FT                   /db_xref="InterPro:IPR008914"
FT                   /db_xref="InterPro:IPR036610"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BD35"
FT                   /protein_id="ANM69512.1"
FT   gene            125304..125819
FT                   /locus_tag="AT5G01305"
FT   mRNA            125304..125819
FT                   /locus_tag="AT5G01305"
FT                   /product="transcription factor bHLH140-like protein"
FT   CDS_pept        125304..125819
FT                   /codon_start=1
FT                   /locus_tag="AT5G01305"
FT                   /product="transcription factor bHLH140-like protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01305"
FT                   /db_xref="GOA:A0A178UDM7"
FT                   /db_xref="InterPro:IPR011598"
FT                   /db_xref="InterPro:IPR024097"
FT                   /db_xref="InterPro:IPR036638"
FT                   /db_xref="UniProtKB/TrEMBL:A0A178UDM7"
FT                   /protein_id="ANM69513.1"
FT                   DEQERDSS"
FT   gene            126204..129150
FT                   /gene="APTX"
FT                   /gene_synonym="APRATAXIN-like"
FT                   /gene_synonym="T10O8.20"
FT                   /gene_synonym="T10O8_20"
FT                   /locus_tag="AT5G01310"
FT                   /note="Encodes a protein that has adenylylsulfate
FT                   sulfohydrolase activity (E.C. in vitro. This locus
FT                   has been split into two based on data presented in
FT                   PMID:22372440. The first annotated exon of the existing
FT                   AT5G01310.1 model (TAIR10) with part of the first intron
FT                   becomes a new locus AT5G01305 (encodes a bHLH proteins
FT                   ROX1). The 3' part retains the original locus name:
FT                   AT5G01310 (encodes APTX)."
FT   mRNA            join(126204..126502,126668..127539,127617..128214,
FT                   128300..128470,128643..129150)
FT                   /gene="APTX"
FT                   /gene_synonym="APRATAXIN-like"
FT                   /gene_synonym="T10O8.20"
FT                   /gene_synonym="T10O8_20"
FT                   /locus_tag="AT5G01310"
FT                   /product="APRATAXIN-like protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL019604.1,INSD:EH947045.1,INSD:ES105740.1,
FT                   INSD:ES082029.1,INSD:EH948278.1,INSD:BP788122.1,
FT                   INSD:EL248113.1,INSD:EL300374.1,INSD:EL251986.1"
FT   CDS_pept        join(126329..126502,126668..127539,127617..128214,
FT                   128300..128470,128643..128960)
FT                   /codon_start=1
FT                   /gene="APTX"
FT                   /gene_synonym="APRATAXIN-like"
FT                   /gene_synonym="T10O8.20"
FT                   /gene_synonym="T10O8_20"
FT                   /locus_tag="AT5G01310"
FT                   /product="APRATAXIN-like protein"
FT                   /note="APRATAXIN-like (APTX); FUNCTIONS IN:
FT                   adenylylsulfatase activity, sequence-specific DNA binding
FT                   transcription factor activity; INVOLVED IN: sulfur
FT                   metabolic process, purine ribonucleotide metabolic process,
FT                   regulation of transcription; LOCATED IN: intracellular,
FT                   nucleus, chloroplast; EXPRESSED IN: 11 plant structures;
FT                   EXPRESSED DURING: 4 anthesis, C globular stage, petal
FT                   differentiation and expansion stage, E expanded cotyledon
FT                   stage, D bilateral stage; CONTAINS InterPro DOMAIN/s: Zinc
FT                   finger, C2H2-like (InterPro:IPR015880), Appr-1-p processing
FT                   (InterPro:IPR002589), Histidine triad (HIT) protein
FT                   (InterPro:IPR001310), Helix-loop-helix DNA-binding domain
FT                   (InterPro:IPR001092), Histidine triad motif
FT                   (InterPro:IPR011151), Helix-loop-helix DNA-binding
FT                   (InterPro:IPR011598), Histidine triad-like motif
FT                   (InterPro:IPR011146), Histidine triad, conserved site
FT                   (InterPro:IPR019808); BEST Arabidopsis thaliana protein
FT                   match is: basic helix-loop-helix (bHLH) DNA-binding
FT                   superfamily protein (TAIR:AT3G21330.1); Has 1807 Blast hits
FT                   to 1807 proteins in 277 species: Archae - 0; Bacteria - 0;
FT                   Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
FT                   Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:A0A2H1ZE58"
FT                   /db_xref="InterPro:IPR002589"
FT                   /db_xref="InterPro:IPR011146"
FT                   /db_xref="InterPro:IPR019808"
FT                   /db_xref="InterPro:IPR027417"
FT                   /db_xref="InterPro:IPR032566"
FT                   /db_xref="InterPro:IPR036265"
FT                   /db_xref="UniProtKB/TrEMBL:A0A2H1ZE58"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL019604.1,INSD:EH947045.1,INSD:ES105740.1,
FT                   INSD:ES082029.1,INSD:EH948278.1,INSD:BP788122.1,
FT                   INSD:EL248113.1,INSD:EL300374.1,INSD:EL251986.1"
FT                   /protein_id="AED90326.2"
FT                   PDHLLQNNRLVARAET"
FT   gene            complement(129263..131687)
FT                   /gene_synonym="T10O8.30"
FT                   /gene_synonym="T10O8_30"
FT                   /locus_tag="AT5G01320"
FT   mRNA            complement(join(129263..129654,129722..130028,
FT                   130129..130779,130857..131020,131107..131687))
FT                   /gene_synonym="T10O8.30"
FT                   /gene_synonym="T10O8_30"
FT                   /locus_tag="AT5G01320"
FT                   /product="Thiamine pyrophosphate dependent pyruvate
FT                   decarboxylase family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU236252.1,INSD:AU227094.1,INSD:BP575331.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BT004248.1"
FT   CDS_pept        complement(join(129484..129654,129722..130028,
FT                   130129..130779,130857..131020,131107..131625))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.30"
FT                   /gene_synonym="T10O8_30"
FT                   /locus_tag="AT5G01320"
FT                   /product="Thiamine pyrophosphate dependent pyruvate
FT                   decarboxylase family protein"
FT                   /note="Thiamine pyrophosphate dependent pyruvate
FT                   decarboxylase family protein; FUNCTIONS IN: in 6 functions;
FT                   LOCATED IN: cellular_component unknown; CONTAINS InterPro
FT                   DOMAIN/s: TPP-binding enzyme, conserved site
FT                   (InterPro:IPR000399), Thiamine pyrophosphate enzyme,
FT                   central domain (InterPro:IPR012000), Pyruvate
FT                   decarboxylase/indolepyruvate decarboxylase
FT                   (InterPro:IPR012110), Thiamine pyrophosphate enzyme,
FT                   N-terminal TPP-binding domain (InterPro:IPR012001),
FT                   Thiamine pyrophosphate enzyme, C-terminal TPP-binding
FT                   (InterPro:IPR011766); BEST Arabidopsis thaliana protein
FT                   match is: Thiamine pyrophosphate dependent pyruvate
FT                   decarboxylase family protein (TAIR:AT4G33070.1); Has 1807
FT                   Blast hits to 1807 proteins in 277 species: Archae - 0;
FT                   Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M040"
FT                   /db_xref="InterPro:IPR000399"
FT                   /db_xref="InterPro:IPR011766"
FT                   /db_xref="InterPro:IPR012000"
FT                   /db_xref="InterPro:IPR012001"
FT                   /db_xref="InterPro:IPR012110"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="InterPro:IPR029061"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M040"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU236252.1,INSD:AU227094.1,INSD:BP575331.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BT004248.1"
FT                   /protein_id="AED90327.1"
FT   gene            complement(132264..134920)
FT                   /gene="PDC3"
FT                   /gene_synonym="pyruvate decarboxylase-3"
FT                   /gene_synonym="PYRUVATE DECARBOXYLASE-3"
FT                   /gene_synonym="T10O8.40"
FT                   /gene_synonym="T10O8_40"
FT                   /locus_tag="AT5G01330"
FT                   /note="pyruvate decarboxylase"
FT   mRNA            complement(join(132264..132708,132790..133096,
FT                   133369..134019,134093..134256,134322..134920))
FT                   /gene="PDC3"
FT                   /gene_synonym="pyruvate decarboxylase-3"
FT                   /gene_synonym="PYRUVATE DECARBOXYLASE-3"
FT                   /gene_synonym="T10O8.40"
FT                   /gene_synonym="T10O8_40"
FT                   /locus_tag="AT5G01330"
FT                   /product="pyruvate decarboxylase-3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CK121737.1,INSD:BP800589.1,INSD:AU235633.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK227701.1,INSD:BT006455.1"
FT   CDS_pept        complement(join(132538..132708,132790..133096,
FT                   133369..134019,134093..134256,134322..134807))
FT                   /codon_start=1
FT                   /gene="PDC3"
FT                   /gene_synonym="pyruvate decarboxylase-3"
FT                   /gene_synonym="PYRUVATE DECARBOXYLASE-3"
FT                   /gene_synonym="T10O8.40"
FT                   /gene_synonym="T10O8_40"
FT                   /locus_tag="AT5G01330"
FT                   /product="pyruvate decarboxylase-3"
FT                   /note="pyruvate decarboxylase-3 (PDC3); FUNCTIONS IN: in 6
FT                   functions; CONTAINS InterPro DOMAIN/s: TPP-binding enzyme,
FT                   conserved site (InterPro:IPR000399), Thiamine pyrophosphate
FT                   enzyme, central domain (InterPro:IPR012000), Pyruvate
FT                   decarboxylase/indolepyruvate decarboxylase
FT                   (InterPro:IPR012110), Thiamine pyrophosphate enzyme,
FT                   N-terminal TPP-binding domain (InterPro:IPR012001),
FT                   Thiamine pyrophosphate enzyme, C-terminal TPP-binding
FT                   (InterPro:IPR011766); BEST Arabidopsis thaliana protein
FT                   match is: Thiamine pyrophosphate dependent pyruvate
FT                   decarboxylase family protein (TAIR:AT5G01320.1); Has 1807
FT                   Blast hits to 1807 proteins in 277 species: Archae - 0;
FT                   Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M039"
FT                   /db_xref="InterPro:IPR000399"
FT                   /db_xref="InterPro:IPR011766"
FT                   /db_xref="InterPro:IPR012000"
FT                   /db_xref="InterPro:IPR012001"
FT                   /db_xref="InterPro:IPR012110"
FT                   /db_xref="InterPro:IPR029035"
FT                   /db_xref="InterPro:IPR029061"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M039"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CK121737.1,INSD:BP800589.1,INSD:AU235633.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK227701.1,INSD:BT006455.1"
FT                   /protein_id="AED90328.1"
FT                   WGSRVSAANGRPPNPQ"
FT   gene            135831..141287
FT                   /pseudo
FT                   /locus_tag="AT5G01335"
FT   mRNA            <135831..>141287
FT                   /pseudo
FT                   /locus_tag="AT5G01335"
FT                   /product="hypothetical protein"
FT   gene            complement(142346..142489)
FT                   /locus_tag="AT5G00750"
FT                   /note="snoR144"
FT   ncRNA           complement(142346..142489)
FT                   /locus_tag="AT5G00750"
FT                   /product="other RNA"
FT                   /ncRNA_class="snoRNA"
FT   gene            complement(142551..142633)
FT                   /locus_tag="AT5G00755"
FT                   /note="U46-2"
FT   ncRNA           complement(142551..142633)
FT                   /locus_tag="AT5G00755"
FT                   /product="other RNA"
FT                   /ncRNA_class="snoRNA"
FT   gene            complement(143055..144863)
FT                   /gene="mSFC1"
FT                   /gene_synonym="AtmSFC1"
FT                   /gene_synonym="mitochondrial succinate-fumarate carrier 1"
FT                   /gene_synonym="T10O8.50"
FT                   /gene_synonym="T10O8_50"
FT                   /locus_tag="AT5G01340"
FT   mRNA            complement(join(143055..143779,144172..144863))
FT                   /gene="mSFC1"
FT                   /gene_synonym="AtmSFC1"
FT                   /gene_synonym="mitochondrial succinate-fumarate carrier 1"
FT                   /gene_synonym="T10O8.50"
FT                   /gene_synonym="T10O8_50"
FT                   /locus_tag="AT5G01340"
FT                   /product="Mitochondrial substrate carrier family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV824691.1,INSD:BP613840.1,INSD:BE525332.1,
FT                   INSD:AV787271.1,INSD:BP573641.1,INSD:BP578014.1,
FT                   INSD:DR376063.1,INSD:BP861137.1,INSD:BP581523.1,
FT                   INSD:BE529162.1,INSD:BP617797.1,INSD:BP575310.1,
FT                   INSD:BP574822.1,INSD:BP573328.1,INSD:BP800796.1,
FT                   INSD:DR229198.1,INSD:BP577372.1,INSD:DR229196.1,
FT                   INSD:BP567232.1,INSD:EL184388.1,INSD:BP802625.1,
FT                   INSD:AV530956.1,INSD:DR229195.1,INSD:BP576104.1,
FT                   INSD:DR229194.1,INSD:DR229197.1,INSD:DR229199.1,
FT                   INSD:EL308005.1,INSD:BP849972.1,INSD:AV556481.1,
FT                   INSD:BP804700.1,INSD:ES045272.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY052716.1,INSD:AY098957.1,INSD:BX833134.1,
FT                   INSD:AY087702.1"
FT   CDS_pept        complement(join(143240..143779,144172..144561))
FT                   /codon_start=1
FT                   /gene="mSFC1"
FT                   /gene_synonym="T10O8.50"
FT                   /gene_synonym="T10O8_50"
FT                   /gene_synonym="AtmSFC1"
FT                   /gene_synonym="mitochondrial succinate-fumarate carrier 1"
FT                   /locus_tag="AT5G01340"
FT                   /product="Mitochondrial substrate carrier family protein"
FT                   /note="Mitochondrial substrate carrier family protein;
FT                   FUNCTIONS IN: transporter activity, binding; INVOLVED IN:
FT                   transport, mitochondrial transport, transmembrane
FT                   transport; LOCATED IN: mitochondrial inner membrane,
FT                   membrane; EXPRESSED IN: 23 plant structures; EXPRESSED
FT                   DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s:
FT                   Mitochondrial substrate carrier (InterPro:IPR001993),
FT                   Mitochondrial substrate/solute carrier
FT                   (InterPro:IPR018108), Adenine nucleotide translocator 1
FT                   (InterPro:IPR002113); BEST Arabidopsis thaliana protein
FT                   match is: Mitochondrial substrate carrier family protein
FT                   (TAIR:AT2G37890.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M038"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="InterPro:IPR040062"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M038"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV824691.1,INSD:BP613840.1,INSD:BE525332.1,
FT                   INSD:AV787271.1,INSD:BP573641.1,INSD:BP578014.1,
FT                   INSD:DR376063.1,INSD:BP861137.1,INSD:BP581523.1,
FT                   INSD:BE529162.1,INSD:BP617797.1,INSD:BP575310.1,
FT                   INSD:BP574822.1,INSD:BP573328.1,INSD:BP800796.1,
FT                   INSD:DR229198.1,INSD:BP577372.1,INSD:DR229196.1,
FT                   INSD:BP567232.1,INSD:EL184388.1,INSD:BP802625.1,
FT                   INSD:AV530956.1,INSD:DR229195.1,INSD:BP576104.1,
FT                   INSD:DR229194.1,INSD:DR229197.1,INSD:DR229199.1,
FT                   INSD:EL308005.1,INSD:BP849972.1,INSD:AV556481.1,
FT                   INSD:BP804700.1,INSD:ES045272.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY052716.1,INSD:AY098957.1,INSD:BX833134.1,
FT                   INSD:AY087702.1"
FT                   /protein_id="AED90329.1"
FT   gene            complement(145387..147356)
FT                   /gene_synonym="T10O8.60"
FT                   /gene_synonym="T10O8_60"
FT                   /locus_tag="AT5G01350"
FT   mRNA            complement(join(145387..145882,145970..146028,
FT                   146117..146178,146832..146923,147114..147356))
FT                   /gene_synonym="T10O8.60"
FT                   /gene_synonym="T10O8_60"
FT                   /locus_tag="AT5G01350"
FT                   /product="UvrABC system C protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP842704.1,INSD:EH796554.1,INSD:ES148942.1,
FT                   INSD:T21390.1,INSD:BP613777.1,INSD:DR199789.1,
FT                   INSD:BP574685.1,INSD:EG430136.1,INSD:DR199782.1,
FT                   INSD:EL194481.1,INSD:EG494940.1,INSD:EL341518.1,
FT                   INSD:DR375615.1,INSD:ES146583.1,INSD:BP627499.1,
FT                   INSD:EL970753.1,INSD:BP841177.1,INSD:ES009944.1,
FT                   INSD:ES097092.1,INSD:ES077643.1,INSD:ES203913.1,
FT                   INSD:EL991741.1,INSD:ES193884.1,INSD:ES012011.1,
FT                   INSD:EL113839.1,INSD:ES127152.1,INSD:ES147740.1,
FT                   INSD:BP589826.1,INSD:ES021255.1,INSD:DR199787.1,
FT                   INSD:ES028242.1,INSD:BP858269.1,INSD:EH963010.1,
FT                   INSD:AV793434.1,INSD:ES046655.1,INSD:ES115193.1,
FT                   INSD:DR199791.1,INSD:BP635442.1,INSD:ES145319.1,
FT                   INSD:AV822102.2,INSD:EH925386.1,INSD:EH995020.1,
FT                   INSD:DR199786.1,INSD:BP851171.1,INSD:EL334695.1,
FT                   INSD:EL082891.1,INSD:EL140182.1,INSD:DR199783.1,
FT                   INSD:DR199792.1,INSD:ES084584.1,INSD:DR199790.1,
FT                   INSD:BP804354.1,INSD:AV782748.1,INSD:AV831682.1,
FT                   INSD:EH839570.1,INSD:EL988881.1,INSD:ES075529.1,
FT                   INSD:DR199794.1,INSD:AV809378.1,INSD:AV817384.1,
FT                   INSD:EL107638.1,INSD:BP849626.1,INSD:AV534832.1,
FT                   INSD:EH804134.1,INSD:BP659264.1,INSD:AV815392.1,
FT                   INSD:ES098056.1,INSD:EL129205.1,INSD:BP669402.1,
FT                   INSD:ES160848.1,INSD:ES149992.1,INSD:ES142317.1,
FT                   INSD:DR199780.1,INSD:BP868979.1,INSD:BP624367.1,
FT                   INSD:ES047204.1,INSD:DR199781.1,INSD:ES206827.1,
FT                   INSD:EL086476.1,INSD:BP579116.1,INSD:ES185303.1,
FT                   INSD:ES094329.1,INSD:ES077166.1,INSD:BP852700.1,
FT                   INSD:BP851547.1,INSD:ES198685.1,INSD:EL311357.1,
FT                   INSD:EL985019.1,INSD:AV826059.1,INSD:BP596951.1,
FT                   INSD:EL996756.1,INSD:BP668341.1,INSD:BP847308.1,
FT                   INSD:ES041357.1,INSD:ES127858.1,INSD:DR199785.1,
FT                   INSD:BP623999.1,INSD:ES024267.1,INSD:ES182581.1,
FT                   INSD:ES076680.1,INSD:BP806614.1,INSD:CD529673.1,
FT                   INSD:DR199795.1,INSD:AV803805.1,INSD:DR199788.1,
FT                   INSD:ES178346.1,INSD:BP628012.1,INSD:AV808324.1,
FT                   INSD:ES179053.1,INSD:AV790569.1,INSD:BP854146.1,
FT                   INSD:BP623772.1,INSD:EG430135.1,INSD:AV785554.1,
FT                   INSD:EG444549.1,INSD:DR199793.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF375457.1,INSD:AY060544.1,INSD:AK230394.1,
FT                   INSD:AY087482.1,INSD:BX831974.1,INSD:AY045661.1"
FT   CDS_pept        complement(join(145865..145882,145970..146028,
FT                   146117..146178,146832..146911))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.60"
FT                   /gene_synonym="T10O8_60"
FT                   /locus_tag="AT5G01350"
FT                   /product="UvrABC system C protein"
FT                   /note="unknown protein; FUNCTIONS IN: molecular_function
FT                   unknown; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: endomembrane system; EXPRESSED IN: 24 plant structures;
FT                   EXPRESSED DURING: 15 growth stages; Has 30201 Blast hits to
FT                   17322 proteins in 780 species: Archae - 12; Bacteria -
FT                   1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses
FT                   - 0; Other Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01350"
FT                   /db_xref="GOA:Q93W37"
FT                   /db_xref="UniProtKB/TrEMBL:Q93W37"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP842704.1,INSD:EH796554.1,INSD:ES148942.1,
FT                   INSD:T21390.1,INSD:BP613777.1,INSD:DR199789.1,
FT                   INSD:BP574685.1,INSD:EG430136.1,INSD:DR199782.1,
FT                   INSD:EL194481.1,INSD:EG494940.1,INSD:EL341518.1,
FT                   INSD:DR375615.1,INSD:ES146583.1,INSD:BP627499.1,
FT                   INSD:EL970753.1,INSD:BP841177.1,INSD:ES009944.1,
FT                   INSD:ES097092.1,INSD:ES077643.1,INSD:ES203913.1,
FT                   INSD:EL991741.1,INSD:ES193884.1,INSD:ES012011.1,
FT                   INSD:EL113839.1,INSD:ES127152.1,INSD:ES147740.1,
FT                   INSD:BP589826.1,INSD:ES021255.1,INSD:DR199787.1,
FT                   INSD:ES028242.1,INSD:BP858269.1,INSD:EH963010.1,
FT                   INSD:AV793434.1,INSD:ES046655.1,INSD:ES115193.1,
FT                   INSD:DR199791.1,INSD:BP635442.1,INSD:ES145319.1,
FT                   INSD:AV822102.2,INSD:EH925386.1,INSD:EH995020.1,
FT                   INSD:DR199786.1,INSD:BP851171.1,INSD:EL334695.1,
FT                   INSD:EL082891.1,INSD:EL140182.1,INSD:DR199783.1,
FT                   INSD:DR199792.1,INSD:ES084584.1,INSD:DR199790.1,
FT                   INSD:BP804354.1,INSD:AV782748.1,INSD:AV831682.1,
FT                   INSD:EH839570.1,INSD:EL988881.1,INSD:ES075529.1,
FT                   INSD:DR199794.1,INSD:AV809378.1,INSD:AV817384.1,
FT                   INSD:EL107638.1,INSD:BP849626.1,INSD:AV534832.1,
FT                   INSD:EH804134.1,INSD:BP659264.1,INSD:AV815392.1,
FT                   INSD:ES098056.1,INSD:EL129205.1,INSD:BP669402.1,
FT                   INSD:ES160848.1,INSD:ES149992.1,INSD:ES142317.1,
FT                   INSD:DR199780.1,INSD:BP868979.1,INSD:BP624367.1,
FT                   INSD:ES047204.1,INSD:DR199781.1,INSD:ES206827.1,
FT                   INSD:EL086476.1,INSD:BP579116.1,INSD:ES185303.1,
FT                   INSD:ES094329.1,INSD:ES077166.1,INSD:BP852700.1,
FT                   INSD:BP851547.1,INSD:ES198685.1,INSD:EL311357.1,
FT                   INSD:EL985019.1,INSD:AV826059.1,INSD:BP596951.1,
FT                   INSD:EL996756.1,INSD:BP668341.1,INSD:BP847308.1,
FT                   INSD:ES041357.1,INSD:ES127858.1,INSD:DR199785.1,
FT                   INSD:BP623999.1,INSD:ES024267.1,INSD:ES182581.1,
FT                   INSD:ES076680.1,INSD:BP806614.1,INSD:CD529673.1,
FT                   INSD:DR199795.1,INSD:AV803805.1,INSD:DR199788.1,
FT                   INSD:ES178346.1,INSD:BP628012.1,INSD:AV808324.1,
FT                   INSD:ES179053.1,INSD:AV790569.1,INSD:BP854146.1,
FT                   INSD:BP623772.1,INSD:EG430135.1,INSD:AV785554.1,
FT                   INSD:EG444549.1,INSD:DR199793.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF375457.1,INSD:AY060544.1,INSD:AK230394.1,
FT                   INSD:AY087482.1,INSD:BX831974.1,INSD:AY045661.1"
FT                   /protein_id="AED90330.1"
FT   gene            complement(146303..146377)
FT                   /locus_tag="AT5G00760"
FT                   /note="snoR119"
FT   ncRNA           complement(146303..146377)
FT                   /locus_tag="AT5G00760"
FT                   /product="other RNA"
FT                   /ncRNA_class="snoRNA"
FT   gene            complement(146623..146741)
FT                   /locus_tag="AT5G00765"
FT                   /note="AtsnoR112"
FT   ncRNA           complement(146623..146741)
FT                   /locus_tag="AT5G00765"
FT                   /product="other RNA"
FT                   /ncRNA_class="snoRNA"
FT   gene            complement(147416..149495)
FT                   /gene="TBL3"
FT                   /gene_synonym="T10O8.70"
FT                   /gene_synonym="T10O8_70"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
FT                   /locus_tag="AT5G01360"
FT                   /note="Encodes a member of the TBL (TRICHOME
FT                   BIREFRINGENCE-LIKE) gene family containing a plant-specific
FT                   DUF231 (domain of unknown function) domain. TBL gene family
FT                   has 46 members, two of which (TBR/AT5G06700 and
FT                   TBL3/AT5G01360) have been shown to be involved in the
FT                   synthesis and deposition of secondary wall cellulose,
FT                   presumably by influencing the esterification state of
FT                   pectic polymers. A nomenclature for this gene family has
FT                   been proposed (Volker Bischoff & Wolf Scheible, 2010,
FT                   personal communication)."
FT   mRNA            complement(join(147416..147941,148018..148376,
FT                   148502..148673,148764..149004,149118..149495))
FT                   /gene="TBL3"
FT                   /gene_synonym="T10O8.70"
FT                   /gene_synonym="T10O8_70"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
FT                   /locus_tag="AT5G01360"
FT                   /product="trichome birefringence-like protein (DUF828)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU235894.1,INSD:DR249278.1,INSD:AU226666.1,
FT                   INSD:DR381102.1,INSD:BP566284.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY085483.1,INSD:AK227978.1"
FT   mRNA            complement(join(147417..147941,148018..148376,
FT                   148502..148673,148764..149435))
FT                   /gene="TBL3"
FT                   /gene_synonym="T10O8.70"
FT                   /gene_synonym="T10O8_70"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
FT                   /locus_tag="AT5G01360"
FT                   /product="trichome birefringence-like protein (DUF828)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU235894.1,INSD:DR249278.1,INSD:BP797316.1"
FT   CDS_pept        complement(join(147608..147941,148018..148376,
FT                   148502..148673,148764..149004,149118..149316))
FT                   /codon_start=1
FT                   /gene="TBL3"
FT                   /gene_synonym="T10O8.70"
FT                   /gene_synonym="T10O8_70"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
FT                   /locus_tag="AT5G01360"
FT                   /product="trichome birefringence-like protein (DUF828)"
FT                   InterPro DOMAIN/s: Protein of unknown function DUF231,
FT                   plant (InterPro:IPR004253); BEST Arabidopsis thaliana
FT                   protein match is: Plant protein of unknown function
FT                   (DUF828) (TAIR:AT3G55990.1); Has 30201 Blast hits to 17322
FT                   proteins in 780 species: Archae - 12; Bacteria - 1396;
FT                   Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
FT                   Other Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01360"
FT                   /db_xref="GOA:Q8LED3"
FT                   /db_xref="InterPro:IPR025846"
FT                   /db_xref="InterPro:IPR026057"
FT                   /db_xref="InterPro:IPR029962"
FT                   /db_xref="InterPro:IPR029972"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8LED3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU235894.1,INSD:DR249278.1,INSD:AU226666.1,
FT                   INSD:DR381102.1,INSD:BP566284.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY085483.1,INSD:AK227978.1"
FT                   /protein_id="AED90331.1"
FT   CDS_pept        complement(join(147608..147941,148018..148376,
FT                   148502..148673,148764..149035))
FT                   /codon_start=1
FT                   /gene="TBL3"
FT                   /gene_synonym="T10O8.70"
FT                   /gene_synonym="T10O8_70"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 3"
FT                   /locus_tag="AT5G01360"
FT                   /product="trichome birefringence-like protein (DUF828)"
FT                   InterPro DOMAIN/s: Protein of unknown function DUF231,
FT                   plant (InterPro:IPR004253); BEST Arabidopsis thaliana
FT                   protein match is: Plant protein of unknown function
FT                   (DUF828) (TAIR:AT3G55990.1); Has 1290 Blast hits to 1278
FT                   proteins in 29 species: Archae - 0; Bacteria - 0; Metazoa -
FT                   3; Fungi - 2; Plants - 1285; Viruses - 0; Other Eukaryotes
FT                   - 0 (source: NCBI BLink)."
FT                   /db_xref="InterPro:IPR025846"
FT                   /db_xref="InterPro:IPR026057"
FT                   /db_xref="InterPro:IPR029962"
FT                   /db_xref="InterPro:IPR029972"
FT                   /db_xref="UniProtKB/TrEMBL:A0A2H1ZE45"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU235894.1,INSD:DR249278.1,INSD:BP797316.1"
FT                   /protein_id="AED90332.2"
FT   gene            complement(150355..150427)
FT                   /gene_synonym="67571.TRNA-ALA-1"
FT                   /locus_tag="AT5G01365"
FT   tRNA            complement(150355..150427)
FT                   /gene_synonym="67571.TRNA-ALA-1"
FT                   /locus_tag="AT5G01365"
FT                   /product="tRNA-Ala"
FT                   /note="pre-tRNA-tRNA-Ala (anticodon: AGC)"
FT   gene            152446..154467
FT                   /gene="ACI1"
FT                   /gene_synonym="ALC-interacting protein 1"
FT                   /gene_synonym="T10O8.80"
FT                   /gene_synonym="T10O8_80"
FT                   /gene_synonym="TON1 Recruiting Motif 29"
FT                   /gene_synonym="TRM29"
FT                   /locus_tag="AT5G01370"
FT                   /note="Nuclear protein with a lysine-rich domain and a
FT                   C-terminal serine-rich domain. Interacts with Alcatraz
FT                   (ALC). ACI1 is mainly expressed in the vascular system.
FT                   Involved in cell separation during fruit dehiscence."
FT   mRNA            join(152446..153523,153961..154467)
FT                   /gene="ACI1"
FT                   /gene_synonym="ALC-interacting protein 1"
FT                   /gene_synonym="T10O8.80"
FT                   /gene_synonym="T10O8_80"
FT                   /gene_synonym="TON1 Recruiting Motif 29"
FT                   /gene_synonym="TRM29"
FT                   /locus_tag="AT5G01370"
FT                   /product="ALC-interacting protein 1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG501526.1,INSD:DR297132.1,INSD:ES031379.1,
FT                   INSD:EG501536.1,INSD:EL159890.1,INSD:EG501527.1,
FT                   INSD:EG456881.1,INSD:DR355559.1,INSD:ES100852.1,
FT                   INSD:EH848113.1,INSD:EG456880.1,INSD:ES086872.1,
FT                   INSD:DR382153.1,INSD:EL016085.1,INSD:ES145943.1,
FT                   INSD:EG501537.1,INSD:ES139644.1,INSD:DR380950.1,
FT                   INSD:EL126278.1,INSD:ES012991.1,INSD:EL991033.1,
FT                   INSD:EH870662.1,INSD:DR381859.1,INSD:EH823594.1,
FT                   INSD:DR355560.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX829513.1,INSD:BT030028.1"
FT   CDS_pept        join(152575..153523,153961..154295)
FT                   /codon_start=1
FT                   /gene="ACI1"
FT                   /gene_synonym="ALC-interacting protein 1"
FT                   /gene_synonym="T10O8.80"
FT                   /gene_synonym="T10O8_80"
FT                   /gene_synonym="TON1 Recruiting Motif 29"
FT                   /gene_synonym="TRM29"
FT                   /locus_tag="AT5G01370"
FT                   /product="ALC-interacting protein 1"
FT                   /note="ALC-interacting protein 1 (ACI1); Has 1807 Blast
FT                   hits to 1807 proteins in 277 species: Archae - 0; Bacteria
FT                   - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
FT                   Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M035"
FT                   /db_xref="UniProtKB/TrEMBL:Q9M035"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG501526.1,INSD:DR297132.1,INSD:ES031379.1,
FT                   INSD:EG501536.1,INSD:EL159890.1,INSD:EG501527.1,
FT                   INSD:EG456881.1,INSD:DR355559.1,INSD:ES100852.1,
FT                   INSD:EH848113.1,INSD:EG456880.1,INSD:ES086872.1,
FT                   INSD:DR382153.1,INSD:EL016085.1,INSD:ES145943.1,
FT                   INSD:EG501537.1,INSD:ES139644.1,INSD:DR380950.1,
FT                   INSD:EL126278.1,INSD:ES012991.1,INSD:EL991033.1,
FT                   INSD:EH870662.1,INSD:DR381859.1,INSD:EH823594.1,
FT                   INSD:DR355560.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX829513.1,INSD:BT030028.1"
FT                   /protein_id="AED90333.1"
FT   gene            complement(155610..157601)
FT                   /gene_synonym="T10O8.90"
FT                   /gene_synonym="T10O8_90"
FT                   /locus_tag="AT5G01380"
FT   mRNA            complement(join(155610..156419,157116..157601))
FT                   /gene_synonym="T10O8.90"
FT                   /gene_synonym="T10O8_90"
FT                   /locus_tag="AT5G01380"
FT                   /product="Homeodomain-like superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV554251.1,INSD:DR369042.1,INSD:EG461216.1,
FT                   INSD:CB254283.1,INSD:AV545513.1,INSD:CB254566.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT028926.1,INSD:AY271677.1"
FT   CDS_pept        complement(join(155784..156419,157116..157451))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.90"
FT                   /gene_synonym="T10O8_90"
FT                   /locus_tag="AT5G01380"
FT                   /product="Homeodomain-like superfamily protein"
FT                   /note="Homeodomain-like superfamily protein; CONTAINS
FT                   InterPro DOMAIN/s: SANT, DNA-binding (InterPro:IPR001005),
FT                   MYB-like (InterPro:IPR017877); BEST Arabidopsis thaliana
FT                   protein match is: Homeodomain-like superfamily protein
FT                   (TAIR:AT2G38250.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01380"
FT                   /db_xref="GOA:Q9SDW0"
FT                   /db_xref="InterPro:IPR001005"
FT                   /db_xref="InterPro:IPR017877"
FT                   /db_xref="InterPro:IPR027759"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9SDW0"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV554251.1,INSD:DR369042.1,INSD:EG461216.1,
FT                   INSD:CB254283.1,INSD:AV545513.1,INSD:CB254566.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT028926.1,INSD:AY271677.1"
FT                   /protein_id="AED90334.1"
FT   gene            complement(160158..162354)
FT                   /gene_synonym="T10O8.100"
FT                   /gene_synonym="T10O8_100"
FT                   /locus_tag="AT5G01390"
FT   mRNA            complement(join(160158..160938,161546..161949,
FT                   162035..162340))
FT                   /gene_synonym="T10O8.100"
FT                   /gene_synonym="T10O8_100"
FT                   /locus_tag="AT5G01390"
FT                   /product="DNAJ heat shock family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP860877.1,INSD:BP852792.1,INSD:EH967560.1,
FT                   INSD:DR285423.1,INSD:DR285420.1,INSD:ES142308.1,
FT                   INSD:ES213088.1,INSD:AV562937.1,INSD:EH912646.1,
FT                   INSD:DR285421.1,INSD:EL232018.1,INSD:DR379770.1,
FT                   INSD:DR285422.1,INSD:EH852437.1,INSD:ES113248.1,
FT                   INSD:AU231248.1,INSD:EL151690.1,INSD:N95992.1,
FT                   INSD:ES205994.1,INSD:EL333624.1,INSD:EH848080.1,
FT                   INSD:ES038958.1,INSD:BP662376.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY084667.1,INSD:BT005582.1,INSD:BX831653.1,
FT                   INSD:AK119010.1"
FT   mRNA            complement(join(160173..161949,162035..162354))
FT                   /gene_synonym="T10O8.100"
FT                   /gene_synonym="T10O8_100"
FT                   /locus_tag="AT5G01390"
FT                   /product="DNAJ heat shock family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR285421.1,INSD:EL232018.1,INSD:DR285422.1,
FT                   INSD:EH852437.1,INSD:ES113248.1,INSD:AU231248.1,
FT                   INSD:BP860877.1,INSD:BP852792.1,INSD:EL151690.1,
FT                   INSD:EH967560.1,INSD:DR285423.1,INSD:DR285420.1,
FT                   INSD:ES069071.1,INSD:EH848080.1,INSD:EL333624.1,
FT                   INSD:AV562937.1,INSD:ES038958.1,INSD:EH912646.1"
FT   mRNA            complement(join(160264..160735,160853..160938,
FT                   161720..161949,162035..162299))
FT                   /gene_synonym="T10O8.100"
FT                   /gene_synonym="T10O8_100"
FT                   /locus_tag="AT5G01390"
FT                   /product="DNAJ heat shock family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR285421.1,INSD:EL232018.1,INSD:EH852437.1,
FT                   INSD:AU231248.1,INSD:BP860877.1,INSD:BP852792.1,
FT                   INSD:EL151690.1,INSD:EH967560.1,INSD:DR285420.1,
FT                   INSD:ES069071.1,INSD:EH848080.1,INSD:EL333624.1,
FT                   INSD:AV562937.1,INSD:EH912646.1,INSD:EH849612.1"
FT   mRNA            complement(join(160264..160938,161720..161949,
FT                   162035..162299))
FT                   /gene_synonym="T10O8.100"
FT                   /gene_synonym="T10O8_100"
FT                   /locus_tag="AT5G01390"
FT                   /product="DNAJ heat shock family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR285421.1,INSD:EL232018.1,INSD:EH852437.1,
FT                   INSD:AU231248.1,INSD:BP852792.1,INSD:BP860877.1,
FT                   INSD:EL151690.1,INSD:EH967560.1,INSD:N95992.1,
FT                   INSD:DR285420.1,INSD:ES142308.1,INSD:EH848080.1,
FT                   INSD:EL333624.1,INSD:ES205994.1,INSD:ES213088.1,
FT                   INSD:AV562937.1,INSD:BP662376.1,INSD:EH912646.1,
FT                   INSD:EH849612.1"
FT   CDS_pept        complement(join(160500..160735,160853..160938,
FT                   161720..161949,162035..162199))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.100"
FT                   /gene_synonym="T10O8_100"
FT                   /locus_tag="AT5G01390"
FT                   /product="DNAJ heat shock family protein"
FT                   /note="DNAJ heat shock family protein; FUNCTIONS IN:
FT                   unfolded protein binding, heat shock protein binding;
FT                   INVOLVED IN: protein folding; LOCATED IN:
FT                   cellular_component unknown; EXPRESSED IN: 24 plant
FT                   structures; EXPRESSED DURING: 15 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Molecular chaperone, heat shock protein,
FT                   Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ
FT                   peptide-binding (InterPro:IPR008971), Chaperone DnaJ,
FT                   C-terminal (InterPro:IPR002939), Heat shock protein DnaJ,
FT                   N-terminal (InterPro:IPR001623), Heat shock protein DnaJ,
FT                   conserved site (InterPro:IPR018253); BEST Arabidopsis
FT                   thaliana protein match is: DNAJ heat shock family protein
FT                   (TAIR:AT3G08910.1); Has 27199 Blast hits to 26228 proteins
FT                   in 3366 species: Archae - 181; Bacteria - 10265; Metazoa -
FT                   4962; Fungi - 2544; Plants - 3099; Viruses - 15; Other
FT                   Eukaryotes - 6133 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01390"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01390.3"
FT                   /db_xref="GOA:F4K9C8"
FT                   /db_xref="InterPro:IPR001623"
FT                   /db_xref="InterPro:IPR002939"
FT                   /db_xref="InterPro:IPR008971"
FT                   /db_xref="InterPro:IPR018253"
FT                   /db_xref="InterPro:IPR036869"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9C8"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR285421.1,INSD:EL232018.1,INSD:EH852437.1,
FT                   INSD:AU231248.1,INSD:BP860877.1,INSD:BP852792.1,
FT                   INSD:EL151690.1,INSD:EH967560.1,INSD:DR285420.1,
FT                   INSD:ES069071.1,INSD:EH848080.1,INSD:EL333624.1,
FT                   INSD:AV562937.1,INSD:EH912646.1,INSD:EH849612.1"
FT                   /protein_id="AED90337.1"
FT                   KLTTEQKSGIKRMLSP"
FT   CDS_pept        complement(join(160500..160938,161720..161949,
FT                   162035..162199))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.100"
FT                   /gene_synonym="T10O8_100"
FT                   /locus_tag="AT5G01390"
FT                   /product="DNAJ heat shock family protein"
FT                   /note="DNAJ heat shock family protein; FUNCTIONS IN:
FT                   unfolded protein binding, heat shock protein binding;
FT                   INVOLVED IN: protein folding; LOCATED IN:
FT                   cellular_component unknown; EXPRESSED IN: 24 plant
FT                   structures; EXPRESSED DURING: 15 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Molecular chaperone, heat shock protein,
FT                   Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ
FT                   peptide-binding (InterPro:IPR008971), Chaperone DnaJ,
FT                   C-terminal (InterPro:IPR002939), Heat shock protein DnaJ,
FT                   N-terminal (InterPro:IPR001623), Heat shock protein DnaJ
FT                   (InterPro:IPR003095), Heat shock protein DnaJ, conserved
FT                   site (InterPro:IPR018253); BEST Arabidopsis thaliana
FT                   protein match is: DNAJ heat shock family protein
FT                   (TAIR:AT3G08910.1); Has 30201 Blast hits to 17322 proteins
FT                   in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
FT                   17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
FT                   Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01390"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01390.2"
FT                   /db_xref="GOA:B3H6P7"
FT                   /db_xref="InterPro:IPR001623"
FT                   /db_xref="InterPro:IPR002939"
FT                   /db_xref="InterPro:IPR008971"
FT                   /db_xref="InterPro:IPR018253"
FT                   /db_xref="InterPro:IPR036869"
FT                   /db_xref="UniProtKB/TrEMBL:B3H6P7"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR285421.1,INSD:EL232018.1,INSD:EH852437.1,
FT                   INSD:AU231248.1,INSD:BP852792.1,INSD:BP860877.1,
FT                   INSD:EL151690.1,INSD:EH967560.1,INSD:N95992.1,
FT                   INSD:DR285420.1,INSD:ES142308.1,INSD:EH848080.1,
FT                   INSD:EL333624.1,INSD:ES205994.1,INSD:ES213088.1,
FT                   INSD:AV562937.1,INSD:BP662376.1,INSD:EH912646.1,
FT                   INSD:EH849612.1"
FT                   /protein_id="AED90336.1"
FT   CDS_pept        complement(join(160500..160938,161546..161949,
FT                   162035..162199))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.100"
FT                   /gene_synonym="T10O8_100"
FT                   /locus_tag="AT5G01390"
FT                   /product="DNAJ heat shock family protein"
FT                   /note="DNAJ heat shock family protein; FUNCTIONS IN:
FT                   unfolded protein binding, heat shock protein binding;
FT                   INVOLVED IN: protein folding; LOCATED IN:
FT                   cellular_component unknown; EXPRESSED IN: 24 plant
FT                   structures; EXPRESSED DURING: 15 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Molecular chaperone, heat shock protein,
FT                   Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ
FT                   peptide-binding (InterPro:IPR008971), Chaperone DnaJ,
FT                   C-terminal (InterPro:IPR002939), Heat shock protein DnaJ,
FT                   N-terminal (InterPro:IPR001623), Heat shock protein DnaJ
FT                   (InterPro:IPR003095), Heat shock protein DnaJ, conserved
FT                   site (InterPro:IPR018253); BEST Arabidopsis thaliana
FT                   protein match is: DNAJ heat shock family protein
FT                   (TAIR:AT3G08910.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M034"
FT                   /db_xref="InterPro:IPR001623"
FT                   /db_xref="InterPro:IPR002939"
FT                   /db_xref="InterPro:IPR008971"
FT                   /db_xref="InterPro:IPR018253"
FT                   /db_xref="InterPro:IPR036869"
FT                   /db_xref="UniProtKB/TrEMBL:Q9M034"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP860877.1,INSD:BP852792.1,INSD:EH967560.1,
FT                   INSD:DR285423.1,INSD:DR285420.1,INSD:ES142308.1,
FT                   INSD:ES213088.1,INSD:AV562937.1,INSD:EH912646.1,
FT                   INSD:DR285421.1,INSD:EL232018.1,INSD:DR379770.1,
FT                   INSD:DR285422.1,INSD:EH852437.1,INSD:ES113248.1,
FT                   INSD:AU231248.1,INSD:EL151690.1,INSD:N95992.1,
FT                   INSD:ES205994.1,INSD:EL333624.1,INSD:EH848080.1,
FT                   INSD:ES038958.1,INSD:BP662376.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY084667.1,INSD:BT005582.1,INSD:BX831653.1,
FT                   INSD:AK119010.1"
FT                   /protein_id="AED90335.1"
FT   CDS_pept        complement(join(161413..161949,162035..162199))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.100"
FT                   /gene_synonym="T10O8_100"
FT                   /locus_tag="AT5G01390"
FT                   /product="DNAJ heat shock family protein"
FT                   /note="DNAJ heat shock family protein; FUNCTIONS IN:
FT                   unfolded protein binding, heat shock protein binding;
FT                   INVOLVED IN: protein folding; LOCATED IN:
FT                   cellular_component unknown; EXPRESSED IN: 24 plant
FT                   structures; EXPRESSED DURING: 15 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Molecular chaperone, heat shock protein,
FT                   Hsp40, DnaJ (InterPro:IPR015609), HSP40/DnaJ
FT                   peptide-binding (InterPro:IPR008971), Chaperone DnaJ,
FT                   C-terminal (InterPro:IPR002939), Heat shock protein DnaJ,
FT                   N-terminal (InterPro:IPR001623), Heat shock protein DnaJ
FT                   (InterPro:IPR003095), Heat shock protein DnaJ, conserved
FT                   site (InterPro:IPR018253); BEST Arabidopsis thaliana
FT                   protein match is: DNAJ heat shock family protein
FT                   (TAIR:AT3G08910.1); Has 26610 Blast hits to 26386 proteins
FT                   in 3381 species: Archae - 182; Bacteria - 10306; Metazoa -
FT                   4695; Fungi - 2459; Plants - 2906; Viruses - 15; Other
FT                   Eukaryotes - 6047 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01390"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01390.4"
FT                   /db_xref="InterPro:IPR001623"
FT                   /db_xref="InterPro:IPR018253"
FT                   /db_xref="InterPro:IPR036869"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9D0"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR285421.1,INSD:EL232018.1,INSD:DR285422.1,
FT                   INSD:EH852437.1,INSD:ES113248.1,INSD:AU231248.1,
FT                   INSD:BP860877.1,INSD:BP852792.1,INSD:EL151690.1,
FT                   INSD:EH967560.1,INSD:DR285423.1,INSD:DR285420.1,
FT                   INSD:ES069071.1,INSD:EH848080.1,INSD:EL333624.1,
FT                   INSD:AV562937.1,INSD:ES038958.1,INSD:EH912646.1"
FT                   /protein_id="AED90338.2"
FT                   FCGVWFQMFSL"
FT   gene            complement(162522..171302)
FT                   /gene="ESP4"
FT                   /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
FT                   /gene_synonym="T10O8.110"
FT                   /gene_synonym="T10O8_110"
FT                   /locus_tag="AT5G01400"
FT                   /note="Encodes a Symplekin/Pta1 homologue which would have
FT                   the potential to interact with either ESP1 or AtCstF64."
FT   mRNA            complement(join(162522..163505,163615..163718,
FT                   163809..163892,163996..164040,164121..164192,
FT                   164295..164375,164517..164612,164685..164759,
FT                   164845..164892,164996..165079,165167..165274,
FT                   165352..165414,165520..165669,165790..165888,
FT                   165970..166017,166265..166507,166582..166698,
FT                   166988..167056,167391..167936,168051..168605,
FT                   168711..168836,169035..169206,169645..169813,
FT                   169924..170174,170284..170443,170870..171263))
FT                   /gene="ESP4"
FT                   /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
FT                   /gene_synonym="T10O8.110"
FT                   /gene_synonym="T10O8_110"
FT                   /locus_tag="AT5G01400"
FT                   /product="HEAT repeat-containing protein"
FT   mRNA            complement(join(162550..163505,163615..163718,
FT                   163809..163892,163996..164040,164121..164192,
FT                   164295..164375,164517..164612,164685..164759,
FT                   164845..164892,164996..165079,165167..165274,
FT                   165352..165414,165520..165669,165790..165888,
FT                   165970..166017,166265..166507,166582..166698,
FT                   166988..167056,167391..167936,168051..168605,
FT                   168711..168836,169035..169206,169645..169813,
FT                   169924..169999,170082..170174,170284..170443,
FT                   170870..171302))
FT                   /gene="ESP4"
FT                   /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
FT                   /gene_synonym="T10O8.110"
FT                   /gene_synonym="T10O8_110"
FT                   /locus_tag="AT5G01400"
FT                   /product="HEAT repeat-containing protein"
FT   mRNA            complement(join(162550..163505,163615..163718,
FT                   163809..163892,163996..164040,164121..164192,
FT                   164295..164375,164517..164612,164685..164759,
FT                   164845..164892,164996..165079,165167..165274,
FT                   165352..165385,165470..165669,165790..165888,
FT                   165970..166017,166265..166507,166582..166698,
FT                   166988..167056,167391..167936,168051..168605,
FT                   168711..168830,169035..169206,169645..169813,
FT                   169924..169999,170082..170174,170284..170443,
FT                   170870..171072))
FT                   /gene="ESP4"
FT                   /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
FT                   /gene_synonym="T10O8.110"
FT                   /gene_synonym="T10O8_110"
FT                   /locus_tag="AT5G01400"
FT                   /product="HEAT repeat-containing protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES071419.1,INSD:ES072101.1,INSD:EH859230.1,
FT                   INSD:EH825985.1,INSD:AV545988.1,INSD:AV529152.1,
FT                   INSD:AV546483.1,INSD:DR383177.1,INSD:DR275772.1,
FT                   INSD:DR275773.1,INSD:T45463.1,INSD:AA394514.1,
FT                   INSD:ES017155.1,INSD:AV539512.1"
FT   CDS_pept        complement(join(162803..163505,163615..163718,
FT                   163809..163892,163996..164040,164121..164192,
FT                   164295..164375,164517..164612,164685..164759,
FT                   164845..164892,164996..165079,165167..165274,
FT                   165352..165414,165520..165669,165790..165888,
FT                   165970..166017,166265..166507,166582..166698,
FT                   166988..167056,167391..167936,168051..168605,
FT                   168711..168836,169035..169206,169645..169813,
FT                   169924..169999,170082..170174,170284..170443,
FT                   170870..171084))
FT                   /codon_start=1
FT                   /gene="ESP4"
FT                   /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
FT                   /gene_synonym="T10O8.110"
FT                   /gene_synonym="T10O8_110"
FT                   /locus_tag="AT5G01400"
FT                   /product="HEAT repeat-containing protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01400"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR022075"
FT                   /db_xref="InterPro:IPR032460"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8B9H4"
FT                   /protein_id="ANM68245.1"
FT                   EEEEE"
FT   CDS_pept        complement(join(162803..163505,163615..163718,
FT                   163809..163892,163996..164040,164121..164192,
FT                   164295..164375,164517..164612,164685..164759,
FT                   164845..164892,164996..165079,165167..165274,
FT                   165352..165385,165470..165669,165790..165888,
FT                   165970..166017,166265..166507,166582..166698,
FT                   166988..167056,167391..167936,168051..168605,
FT                   168711..168830,169035..169206,169645..169813,
FT                   169924..169999,170082..170174,170284..170443,
FT                   170870..171072))
FT                   /codon_start=1
FT                   /gene="ESP4"
FT                   /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
FT                   /gene_synonym="T10O8.110"
FT                   /gene_synonym="T10O8_110"
FT                   /locus_tag="AT5G01400"
FT                   /product="HEAT repeat-containing protein"
FT                   binding; INVOLVED IN: posttranscriptional gene silencing by
FT                   RNA, RNA processing; LOCATED IN: mRNA cleavage and
FT                   polyadenylation specificity factor complex; EXPRESSED IN:
FT                   23 plant structures; EXPRESSED DURING: 13 growth stages;
FT                   CONTAINS InterPro DOMAIN/s: Symplekin tight junction
FT                   protein C-terminal (InterPro:IPR022075), Armadillo-type
FT                   fold (InterPro:IPR016024), Protein of unknown function
FT                   DUF3453 (InterPro:IPR021850); BEST Arabidopsis thaliana
FT                   protein match is: unknown protein (TAIR:AT1G27595.1); Has
FT                   1807 Blast hits to 1807 proteins in 277 species: Archae -
FT                   0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M033"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR022075"
FT                   /db_xref="InterPro:IPR032460"
FT                   /db_xref="UniProtKB/TrEMBL:Q9M033"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES071419.1,INSD:ES072101.1,INSD:EH859230.1,
FT                   INSD:EH825985.1,INSD:AV545988.1,INSD:AV529152.1,
FT                   INSD:AV546483.1,INSD:DR383177.1,INSD:DR275772.1,
FT                   INSD:DR275773.1,INSD:T45463.1,INSD:AA394514.1,
FT                   INSD:ES017155.1,INSD:AV539512.1"
FT                   /protein_id="AED90339.1"
FT                   EEEEEE"
FT   CDS_pept        complement(join(162803..163505,163615..163718,
FT                   163809..163892,163996..164040,164121..164192,
FT                   164295..164375,164517..164612,164685..164759,
FT                   164845..164892,164996..165079,165167..165274,
FT                   165352..165414,165520..165669,165790..165888,
FT                   165970..166017,166265..166507,166582..166698,
FT                   166988..167056,167391..167936,168051..168605,
FT                   168711..168836,169035..169206,169645..169813,
FT                   169924..169969))
FT                   /codon_start=1
FT                   /gene="ESP4"
FT                   /gene_synonym="ENHANCED SILENCING PHENOTYPE 4"
FT                   /gene_synonym="T10O8.110"
FT                   /gene_synonym="T10O8_110"
FT                   /locus_tag="AT5G01400"
FT                   /product="HEAT repeat-containing protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01400"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR022075"
FT                   /db_xref="InterPro:IPR032460"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8B9H2"
FT                   /protein_id="ANM68244.1"
FT                   SKESSEEEEEEEEEEE"
FT   gene            complement(171889..173663)
FT                   /gene="RSR4"
FT                   1.3"
FT                   /gene_synonym="ATPDX1"
FT                   /gene_synonym="ATPDX1.3"
FT                   /gene_synonym="PDX1"
FT                   /gene_synonym="PDX1.3"
FT                   /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
FT                   /gene_synonym="REDUCED SUGAR RESPONSE 4"
FT                   /gene_synonym="T10O8.120"
FT                   /gene_synonym="T10O8_120"
FT                   /locus_tag="AT5G01410"
FT                   /note="Encodes a protein predicted to function in tandem
FT                   with PDX2 to form glutamine amidotransferase complex with
FT                   involved in vitamin B6 biosynthesis."
FT   mRNA            complement(join(171889..172086,172561..173663))
FT                   /gene="RSR4"
FT                   1.3"
FT                   /gene_synonym="ATPDX1"
FT                   /gene_synonym="ATPDX1.3"
FT                   /gene_synonym="PDX1"
FT                   /gene_synonym="PDX1.3"
FT                   /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
FT                   /gene_synonym="REDUCED SUGAR RESPONSE 4"
FT                   /gene_synonym="T10O8.120"
FT                   /gene_synonym="T10O8_120"
FT                   /locus_tag="AT5G01410"
FT                   /product="Aldolase-type TIM barrel family protein"
FT   mRNA            complement(171889..173663)
FT                   /gene="RSR4"
FT                   1.3"
FT                   /gene_synonym="ATPDX1"
FT                   /gene_synonym="ATPDX1.3"
FT                   /gene_synonym="PDX1"
FT                   /gene_synonym="PDX1.3"
FT                   /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
FT                   /gene_synonym="REDUCED SUGAR RESPONSE 4"
FT                   /gene_synonym="T10O8.120"
FT                   /gene_synonym="T10O8_120"
FT                   /locus_tag="AT5G01410"
FT                   /product="Aldolase-type TIM barrel family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR352127.1,INSD:EH871921.1,INSD:DR352160.1,
FT                   INSD:BP655325.1,INSD:DR352152.1,INSD:DR352111.1,
FT                   INSD:DR352099.1,INSD:DR352078.1,INSD:DR352126.1,
FT                   INSD:EH893878.1,INSD:EH849943.1,INSD:DR352129.1,
FT                   INSD:BP639550.1,INSD:EH922006.1,INSD:DR352121.1,
FT                   INSD:DR352130.1,INSD:BP832517.1,INSD:DR352080.1,
FT                   INSD:AV806200.1,INSD:ES100717.1,INSD:DR352159.1,
FT                   INSD:BP861855.1,INSD:EH901794.1,INSD:EL014450.1,
FT                   INSD:AV441604.1,INSD:DR352100.1,INSD:DR352083.1,
FT                   INSD:BP611672.1,INSD:EH836524.1,INSD:BP605035.1,
FT                   INSD:BP563180.1,INSD:DR352097.1,INSD:AV819953.1,
FT                   INSD:AV799969.1,INSD:AV831641.1,INSD:DR352125.1,
FT                   INSD:DR352164.1,INSD:DR352089.1,INSD:DR352144.1,
FT                   INSD:DR352110.1,INSD:DR352098.1,INSD:DR352137.1,
FT                   INSD:DR352076.1,INSD:AV534608.1,INSD:AV518959.1,
FT                   INSD:EH971941.1,INSD:DR352163.1,INSD:BP582044.1,
FT                   INSD:DR352123.1,INSD:DR352109.1,INSD:DR352128.1,
FT                   INSD:BP777823.1,INSD:DR352145.1,INSD:DR352143.1,
FT                   INSD:BP611368.1,INSD:AV549741.1,INSD:DR246985.1,
FT                   INSD:DR352094.1,INSD:AV537351.1,INSD:EL149964.1,
FT                   INSD:EH878980.1,INSD:DR352139.1,INSD:DR352102.1,
FT                   INSD:DR352077.1,INSD:DR352136.1,INSD:AV551235.1,
FT                   INSD:DR246981.1,INSD:BP593083.1,INSD:AV519278.1,
FT                   INSD:DR352124.1,INSD:BP824791.1,INSD:DR352084.1,
FT                   INSD:AV537724.1,INSD:BP623357.1,INSD:AV518173.1,
FT                   INSD:DR352131.1,INSD:EL330598.1,INSD:DR352134.1,
FT                   INSD:BP596625.1,INSD:BP838585.1,INSD:DR352118.1,
FT                   INSD:EH876328.1,INSD:DR352147.1,INSD:EH873327.1,
FT                   INSD:BP814405.1,INSD:DR246980.1,INSD:EL269098.1,
FT                   INSD:F15457.1,INSD:AV800124.1,INSD:BP565258.1,
FT                   INSD:CF652052.1,INSD:DR352086.1,INSD:BP650338.1,
FT                   INSD:CK117561.1,INSD:BP657959.1,INSD:AV439561.2,
FT                   INSD:DR352074.1,INSD:EL149568.1,INSD:DR352085.1,
FT                   INSD:DR352171.1,INSD:BP570729.1,INSD:EL166336.1,
FT                   INSD:BP649440.1,INSD:BP595613.1,INSD:DR352156.1,
FT                   INSD:DR352106.1,INSD:EL228642.1,INSD:DR352119.1,
FT                   INSD:EH916734.1,INSD:BP585718.1,INSD:EL288508.1,
FT                   INSD:ES097500.1,INSD:DR352170.1,INSD:AV549151.1,
FT                   INSD:EG453633.1,INSD:EG453635.1,INSD:BP642883.1,
FT                   INSD:EL986677.1,INSD:DR352117.1,INSD:DR352172.1,
FT                   INSD:EL280199.1,INSD:BP588289.1,INSD:EH961795.1,
FT                   INSD:AV519115.1,INSD:DR352155.1,INSD:AV800331.1,
FT                   INSD:CK120606.1,INSD:EL131840.1,INSD:DR352161.1,
FT                   INSD:DR352148.1,INSD:EH991607.1,INSD:DR246984.1,
FT                   INSD:AV813143.1,INSD:DR352113.1,INSD:DR246979.1,
FT                   INSD:BP839043.1,INSD:DR352114.1,INSD:EL039470.1,
FT                   INSD:BP633123.1,INSD:EL303183.1,INSD:DR352116.1,
FT                   INSD:BG459232.1,INSD:BP634389.1,INSD:BP798881.1,
FT                   INSD:DR352135.1,INSD:BP644212.1,INSD:EL286442.1,
FT                   INSD:EG453594.1,INSD:DR352112.1,INSD:AV525804.1,
FT                   INSD:DR352138.1,INSD:ES037658.1,INSD:EL317491.1,
FT                   INSD:F15381.1,INSD:DR352154.1,INSD:EH888298.1,
FT                   INSD:AV830477.1,INSD:DR352088.1,INSD:AV817251.1,
FT                   INSD:EL292881.1,INSD:DR373301.1,INSD:BP615848.1,
FT                   INSD:BP621788.1,INSD:DR352108.1,INSD:DR352149.1,
FT                   INSD:AV809265.1,INSD:BP795107.1,INSD:N38597.1,
FT                   INSD:DR352115.1,INSD:DR352087.1,INSD:AV534914.1,
FT                   INSD:BP853022.1,INSD:DR352079.1,INSD:DR352092.1,
FT                   INSD:AV811905.1,INSD:DR352104.1,INSD:BP639863.1,
FT                   INSD:DR352103.1,INSD:BP856523.2,INSD:EH861138.1,
FT                   INSD:BP818588.1,INSD:DR352141.1,INSD:AV800376.1,
FT                   INSD:BP831166.1,INSD:AI997563.1,INSD:BP805266.1,
FT                   INSD:DR352090.1,INSD:BP632713.1,INSD:DR352151.1,
FT                   INSD:F15247.1,INSD:AV524884.1,INSD:DR352166.1,
FT                   INSD:EH881726.1,INSD:EL149694.1,INSD:DR352162.1,
FT                   INSD:DR352174.1,INSD:DR352132.1,INSD:DR352169.1,
FT                   INSD:DR352093.1,INSD:EL168412.1,INSD:DR352150.1,
FT                   INSD:ES012709.1,INSD:DR352167.1,INSD:DR352120.1,
FT                   INSD:EH951509.1,INSD:DR352140.1,INSD:DR352081.1,
FT                   INSD:BP561800.2,INSD:DR352095.1,INSD:T04208.1,
FT                   INSD:DR352091.1,INSD:EH952364.1,INSD:AV549902.1,
FT                   INSD:BP652418.1,INSD:DR352173.1,INSD:EL224229.1,
FT                   INSD:DR246982.1,INSD:DR377761.1,INSD:DR352096.1,
FT                   INSD:BP612159.1,INSD:EL029992.1,INSD:DR352158.1,
FT                   INSD:EL186957.1,INSD:BP628804.1,INSD:DR352133.1,
FT                   INSD:EL132789.1,INSD:DR352101.1,INSD:ES085090.1,
FT                   INSD:DR352168.1,INSD:BP859218.1,INSD:EL049731.1,
FT                   INSD:BP844811.1,INSD:BP624382.1,INSD:DR352122.1,
FT                   INSD:EL977870.1,INSD:BP817063.1,INSD:DR352107.1,
FT                   INSD:BP856743.1,INSD:DR352075.1,INSD:EH860820.1,
FT                   INSD:EG462001.1,INSD:EL112942.1,INSD:EL032099.1,
FT                   INSD:DR352142.1,INSD:DR352082.1,INSD:BP834782.1,
FT                   INSD:EG453598.1,INSD:BP817179.1,INSD:BP619656.1,
FT                   INSD:DR352073.1,INSD:DR352105.1,INSD:AV538882.1,
FT                   INSD:AV536100.1,INSD:BP591526.1,INSD:CK121366.1,
FT                   INSD:DR352153.1,INSD:EL042620.1,INSD:AV808254.1,
FT                   INSD:EL059373.1,INSD:BP858599.1,INSD:EL325357.1,
FT                   INSD:EG462002.1,INSD:BP833855.2,INSD:ES186221.1,
FT                   INSD:BP824957.1,INSD:EL277639.1,INSD:AV524794.1,
FT                   INSD:DR352165.1,INSD:EH918575.1,INSD:EH933626.1,
FT                   INSD:DR352157.1,INSD:BP625236.1,INSD:AV560993.1,
FT                   INSD:EL253219.1,INSD:AU036594.1,INSD:DR352146.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF446352.1,INSD:AF428298.1,INSD:AY972813.1,
FT                   INSD:BX830996.1,INSD:BX831741.1,INSD:BX833592.1,
FT                   INSD:AK227197.1,INSD:BX831631.1,INSD:AY097428.1,
FT                   INSD:AY088650.1"
FT   CDS_pept        complement(172576..173505)
FT                   /codon_start=1
FT                   /gene="RSR4"
FT                   1.3"
FT                   /gene_synonym="ATPDX1"
FT                   /gene_synonym="ATPDX1.3"
FT                   /gene_synonym="PDX1"
FT                   /gene_synonym="PDX1.3"
FT                   /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
FT                   /gene_synonym="REDUCED SUGAR RESPONSE 4"
FT                   /gene_synonym="T10O8.120"
FT                   /gene_synonym="T10O8_120"
FT                   /locus_tag="AT5G01410"
FT                   /product="Aldolase-type TIM barrel family protein"
FT                   /db_xref="GOA:Q8L940"
FT                   /db_xref="InterPro:IPR001852"
FT                   /db_xref="InterPro:IPR011060"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR033755"
FT                   /db_xref="PDB:5K2Z"
FT                   /db_xref="PDB:5K3V"
FT                   /db_xref="PDB:5LNR"
FT                   /db_xref="PDB:5LNS"
FT                   /db_xref="PDB:5LNU"
FT                   /db_xref="PDB:5LNV"
FT                   /db_xref="PDB:5LNW"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8L940"
FT                   /protein_id="ANM69812.1"
FT   CDS_pept        complement(172576..173505)
FT                   /codon_start=1
FT                   /gene="RSR4"
FT                   1.3"
FT                   /gene_synonym="ATPDX1"
FT                   /gene_synonym="ATPDX1.3"
FT                   /gene_synonym="PDX1"
FT                   /gene_synonym="PDX1.3"
FT                   /gene_synonym="PYRIDOXINE BIOSYNTHESIS 1.3"
FT                   /gene_synonym="REDUCED SUGAR RESPONSE 4"
FT                   /gene_synonym="T10O8.120"
FT                   /gene_synonym="T10O8_120"
FT                   /locus_tag="AT5G01410"
FT                   /product="Aldolase-type TIM barrel family protein"
FT                   /note="REDUCED SUGAR RESPONSE 4 (RSR4); FUNCTIONS IN:
FT                   protein homodimerization activity, protein
FT                   heterodimerization activity; INVOLVED IN: in 12 processes;
FT                   LOCATED IN: cytosol, endomembrane system, plasma membrane;
FT                   EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15
FT                   growth stages; CONTAINS InterPro DOMAIN/s: Vitamin B6
FT                   biosynthesis protein (InterPro:IPR001852),
FT                   Ribulose-phosphate binding barrel (InterPro:IPR011060);
FT                   BEST Arabidopsis thaliana protein match is: pyridoxine
FT                   biosynthesis 1.1 (TAIR:AT2G38230.1); Has 1807 Blast hits to
FT                   1807 proteins in 277 species: Archae - 0; Bacteria - 0;
FT                   Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
FT                   Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01410"
FT                   /db_xref="GOA:Q8L940"
FT                   /db_xref="InterPro:IPR001852"
FT                   /db_xref="InterPro:IPR011060"
FT                   /db_xref="InterPro:IPR013785"
FT                   /db_xref="InterPro:IPR033755"
FT                   /db_xref="PDB:5K2Z"
FT                   /db_xref="PDB:5K3V"
FT                   /db_xref="PDB:5LNR"
FT                   /db_xref="PDB:5LNS"
FT                   /db_xref="PDB:5LNU"
FT                   /db_xref="PDB:5LNV"
FT                   /db_xref="PDB:5LNW"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8L940"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR352127.1,INSD:EH871921.1,INSD:DR352160.1,
FT                   INSD:BP655325.1,INSD:DR352152.1,INSD:DR352111.1,
FT                   INSD:DR352099.1,INSD:DR352078.1,INSD:DR352126.1,
FT                   INSD:EH893878.1,INSD:EH849943.1,INSD:DR352129.1,
FT                   INSD:BP639550.1,INSD:EH922006.1,INSD:DR352121.1,
FT                   INSD:DR352130.1,INSD:BP832517.1,INSD:DR352080.1,
FT                   INSD:AV806200.1,INSD:ES100717.1,INSD:DR352159.1,
FT                   INSD:BP861855.1,INSD:EH901794.1,INSD:EL014450.1,
FT                   INSD:AV441604.1,INSD:DR352100.1,INSD:DR352083.1,
FT                   INSD:BP611672.1,INSD:EH836524.1,INSD:BP605035.1,
FT                   INSD:BP563180.1,INSD:DR352097.1,INSD:AV819953.1,
FT                   INSD:AV799969.1,INSD:AV831641.1,INSD:DR352125.1,
FT                   INSD:DR352164.1,INSD:DR352089.1,INSD:DR352144.1,
FT                   INSD:DR352110.1,INSD:DR352098.1,INSD:DR352137.1,
FT                   INSD:DR352076.1,INSD:AV534608.1,INSD:AV518959.1,
FT                   INSD:EH971941.1,INSD:DR352163.1,INSD:BP582044.1,
FT                   INSD:DR352123.1,INSD:DR352109.1,INSD:DR352128.1,
FT                   INSD:BP777823.1,INSD:DR352145.1,INSD:DR352143.1,
FT                   INSD:BP611368.1,INSD:AV549741.1,INSD:DR246985.1,
FT                   INSD:DR352094.1,INSD:AV537351.1,INSD:EL149964.1,
FT                   INSD:EH878980.1,INSD:DR352139.1,INSD:DR352102.1,
FT                   INSD:DR352077.1,INSD:DR352136.1,INSD:AV551235.1,
FT                   INSD:DR246981.1,INSD:BP593083.1,INSD:AV519278.1,
FT                   INSD:DR352124.1,INSD:BP824791.1,INSD:DR352084.1,
FT                   INSD:AV537724.1,INSD:BP623357.1,INSD:AV518173.1,
FT                   INSD:DR352131.1,INSD:EL330598.1,INSD:DR352134.1,
FT                   INSD:BP596625.1,INSD:BP838585.1,INSD:DR352118.1,
FT                   INSD:EH876328.1,INSD:DR352147.1,INSD:EH873327.1,
FT                   INSD:BP814405.1,INSD:DR246980.1,INSD:EL269098.1,
FT                   INSD:F15457.1,INSD:AV800124.1,INSD:BP565258.1,
FT                   INSD:CF652052.1,INSD:DR352086.1,INSD:BP650338.1,
FT                   INSD:CK117561.1,INSD:BP657959.1,INSD:AV439561.2,
FT                   INSD:DR352074.1,INSD:EL149568.1,INSD:DR352085.1,
FT                   INSD:DR352171.1,INSD:BP570729.1,INSD:EL166336.1,
FT                   INSD:BP649440.1,INSD:BP595613.1,INSD:DR352156.1,
FT                   INSD:DR352106.1,INSD:EL228642.1,INSD:DR352119.1,
FT                   INSD:EH916734.1,INSD:BP585718.1,INSD:EL288508.1,
FT                   INSD:ES097500.1,INSD:DR352170.1,INSD:AV549151.1,
FT                   INSD:EG453633.1,INSD:EG453635.1,INSD:BP642883.1,
FT                   INSD:EL986677.1,INSD:DR352117.1,INSD:DR352172.1,
FT                   INSD:EL280199.1,INSD:BP588289.1,INSD:EH961795.1,
FT                   INSD:AV519115.1,INSD:DR352155.1,INSD:AV800331.1,
FT                   INSD:CK120606.1,INSD:EL131840.1,INSD:DR352161.1,
FT                   INSD:DR352148.1,INSD:EH991607.1,INSD:DR246984.1,
FT                   INSD:AV813143.1,INSD:DR352113.1,INSD:DR246979.1,
FT                   INSD:BP839043.1,INSD:DR352114.1,INSD:EL039470.1,
FT                   INSD:BP633123.1,INSD:EL303183.1,INSD:DR352116.1,
FT                   INSD:BG459232.1,INSD:BP634389.1,INSD:BP798881.1,
FT                   INSD:DR352135.1,INSD:BP644212.1,INSD:EL286442.1,
FT                   INSD:EG453594.1,INSD:DR352112.1,INSD:AV525804.1,
FT                   INSD:DR352138.1,INSD:ES037658.1,INSD:EL317491.1,
FT                   INSD:F15381.1,INSD:DR352154.1,INSD:EH888298.1,
FT                   INSD:AV830477.1,INSD:DR352088.1,INSD:AV817251.1,
FT                   INSD:EL292881.1,INSD:DR373301.1,INSD:BP615848.1,
FT                   INSD:BP621788.1,INSD:DR352108.1,INSD:DR352149.1,
FT                   INSD:AV809265.1,INSD:BP795107.1,INSD:N38597.1,
FT                   INSD:DR352115.1,INSD:DR352087.1,INSD:AV534914.1,
FT                   INSD:BP853022.1,INSD:DR352079.1,INSD:DR352092.1,
FT                   INSD:AV811905.1,INSD:DR352104.1,INSD:BP639863.1,
FT                   INSD:DR352103.1,INSD:BP856523.2,INSD:EH861138.1,
FT                   INSD:BP818588.1,INSD:DR352141.1,INSD:AV800376.1,
FT                   INSD:BP831166.1,INSD:AI997563.1,INSD:BP805266.1,
FT                   INSD:DR352090.1,INSD:BP632713.1,INSD:DR352151.1,
FT                   INSD:F15247.1,INSD:AV524884.1,INSD:DR352166.1,
FT                   INSD:EH881726.1,INSD:EL149694.1,INSD:DR352162.1,
FT                   INSD:DR352174.1,INSD:DR352132.1,INSD:DR352169.1,
FT                   INSD:DR352093.1,INSD:EL168412.1,INSD:DR352150.1,
FT                   INSD:ES012709.1,INSD:DR352167.1,INSD:DR352120.1,
FT                   INSD:EH951509.1,INSD:DR352140.1,INSD:DR352081.1,
FT                   INSD:BP561800.2,INSD:DR352095.1,INSD:T04208.1,
FT                   INSD:DR352091.1,INSD:EH952364.1,INSD:AV549902.1,
FT                   INSD:BP652418.1,INSD:DR352173.1,INSD:EL224229.1,
FT                   INSD:DR246982.1,INSD:DR377761.1,INSD:DR352096.1,
FT                   INSD:BP612159.1,INSD:EL029992.1,INSD:DR352158.1,
FT                   INSD:EL186957.1,INSD:BP628804.1,INSD:DR352133.1,
FT                   INSD:EL132789.1,INSD:DR352101.1,INSD:ES085090.1,
FT                   INSD:DR352168.1,INSD:BP859218.1,INSD:EL049731.1,
FT                   INSD:BP844811.1,INSD:BP624382.1,INSD:DR352122.1,
FT                   INSD:EL977870.1,INSD:BP817063.1,INSD:DR352107.1,
FT                   INSD:BP856743.1,INSD:DR352075.1,INSD:EH860820.1,
FT                   INSD:EG462001.1,INSD:EL112942.1,INSD:EL032099.1,
FT                   INSD:DR352142.1,INSD:DR352082.1,INSD:BP834782.1,
FT                   INSD:EG453598.1,INSD:BP817179.1,INSD:BP619656.1,
FT                   INSD:DR352073.1,INSD:DR352105.1,INSD:AV538882.1,
FT                   INSD:AV536100.1,INSD:BP591526.1,INSD:CK121366.1,
FT                   INSD:DR352153.1,INSD:EL042620.1,INSD:AV808254.1,
FT                   INSD:EL059373.1,INSD:BP858599.1,INSD:EL325357.1,
FT                   INSD:EG462002.1,INSD:BP833855.2,INSD:ES186221.1,
FT                   INSD:BP824957.1,INSD:EL277639.1,INSD:AV524794.1,
FT                   INSD:DR352165.1,INSD:EH918575.1,INSD:EH933626.1,
FT                   INSD:DR352157.1,INSD:BP625236.1,INSD:AV560993.1,
FT                   INSD:EL253219.1,INSD:AU036594.1,INSD:DR352146.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF446352.1,INSD:AF428298.1,INSD:AY972813.1,
FT                   INSD:BX830996.1,INSD:BX831741.1,INSD:BX833592.1,
FT                   INSD:AK227197.1,INSD:BX831631.1,INSD:AY097428.1,
FT                   INSD:AY088650.1"
FT                   /protein_id="AED90340.1"
FT   gene            complement(174779..176269)
FT                   /gene_synonym="T10O8.130"
FT                   /gene_synonym="T10O8_130"
FT                   /locus_tag="AT5G01420"
FT   mRNA            complement(174779..176269)
FT                   /gene_synonym="T10O8.130"
FT                   /gene_synonym="T10O8_130"
FT                   /locus_tag="AT5G01420"
FT                   /product="Glutaredoxin family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP839789.1,INSD:BP639998.1,INSD:BP658010.1,
FT                   INSD:BP828460.1,INSD:BP839875.1,INSD:AU238836.1,
FT                   INSD:AU230083.1,INSD:EL051293.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT005349.1,INSD:AK117993.1"
FT   CDS_pept        complement(174886..176091)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.130"
FT                   /gene_synonym="T10O8_130"
FT                   /locus_tag="AT5G01420"
FT                   /product="Glutaredoxin family protein"
FT                   /note="Glutaredoxin family protein; FUNCTIONS IN: electron
FT                   carrier activity, protein disulfide oxidoreductase
FT                   activity; INVOLVED IN: cell redox homeostasis; CONTAINS
FT                   InterPro DOMAIN/s: Thioredoxin fold (InterPro:IPR012335),
FT                   Glutaredoxin (InterPro:IPR002109), Thioredoxin-like fold
FT                   (InterPro:IPR012336); BEST Arabidopsis thaliana protein
FT                   match is: Glutaredoxin family protein (TAIR:AT5G06470.1);
FT                   Has 1807 Blast hits to 1807 proteins in 277 species: Archae
FT                   - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants -
FT                   385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01420"
FT                   /db_xref="GOA:Q9M031"
FT                   /db_xref="InterPro:IPR002109"
FT                   /db_xref="InterPro:IPR036249"
FT                   /db_xref="UniProtKB/TrEMBL:Q9M031"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP839789.1,INSD:BP639998.1,INSD:BP658010.1,
FT                   INSD:BP828460.1,INSD:BP839875.1,INSD:AU238836.1,
FT                   INSD:AU230083.1,INSD:EL051293.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT005349.1,INSD:AK117993.1"
FT                   /protein_id="AED90341.1"
FT                   CS"
FT   gene            complement(176388..178654)
FT                   /gene_synonym="T10O8.140"
FT                   /locus_tag="AT5G01430"
FT   mRNA            complement(join(176388..176835,177094..177175,
FT                   177258..177355,177477..177557,177657..177748,
FT                   177980..178041,178448..178654))
FT                   /gene_synonym="T10O8.140"
FT                   /locus_tag="AT5G01430"
FT                   /product="Got1/Sft2-like vescicle transport protein family"
FT   mRNA            complement(join(176447..176835,177094..177175,
FT                   177258..177355,177477..177557,177657..177748,
FT                   177980..178035,178448..178623))
FT                   /gene_synonym="T10O8.140"
FT                   /locus_tag="AT5G01430"
FT                   /product="Got1/Sft2-like vescicle transport protein family"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL015564.1,INSD:DR202398.1,INSD:EL996615.1,
FT                   INSD:EG493885.1,INSD:EG510992.1,INSD:DR202393.1,
FT                   INSD:DR202392.1,INSD:BP868444.1,INSD:AI997074.1,
FT                   INSD:DR202399.1,INSD:EG510993.1,INSD:EL234465.1,
FT                   INSD:DR202397.1,INSD:EL274506.1,INSD:EL984885.1,
FT                   INSD:EL981768.1,INSD:EH802716.1,INSD:R65541.1,
FT                   INSD:ES011278.1,INSD:DR202395.1,INSD:DR202396.1,
FT                   INSD:BP792814.1,INSD:ES073775.1,INSD:ES180121.1,
FT                   INSD:AV808503.1,INSD:BP630578.1,INSD:EL312372.1,
FT                   INSD:DR202391.1,INSD:DR376757.1,INSD:N37638.1,
FT                   INSD:EH867479.1,INSD:AV791663.1,INSD:DR202390.1,
FT                   INSD:DR202394.1,INSD:AI994104.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY091202.1,INSD:AY045875.1"
FT   CDS_pept        complement(join(176797..176835,177094..177175,
FT                   177258..177355,177477..177557,177657..177748,
FT                   177980..178010))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.140"
FT                   /locus_tag="AT5G01430"
FT                   /product="Got1/Sft2-like vescicle transport protein family"
FT                   /note="Got1/Sft2-like vescicle transport protein family;
FT                   FUNCTIONS IN: molecular_function unknown; INVOLVED IN:
FT                   vesicle-mediated transport; LOCATED IN: cellular_component
FT                   unknown; CONTAINS InterPro DOMAIN/s: Vesicle transport
FT                   protein, Got1/SFT2-like (InterPro:IPR007305); BEST
FT                   Arabidopsis thaliana protein match is: Got1/Sft2-like
FT                   vescicle transport protein family (TAIR:AT3G49420.1); Has
FT                   1807 Blast hits to 1807 proteins in 277 species: Archae -
FT                   0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9SCL4"
FT                   /db_xref="InterPro:IPR007305"
FT                   /db_xref="UniProtKB/TrEMBL:Q9SCL4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL015564.1,INSD:DR202398.1,INSD:EL996615.1,
FT                   INSD:EG493885.1,INSD:EG510992.1,INSD:DR202393.1,
FT                   INSD:DR202392.1,INSD:BP868444.1,INSD:AI997074.1,
FT                   INSD:DR202399.1,INSD:EG510993.1,INSD:EL234465.1,
FT                   INSD:DR202397.1,INSD:EL274506.1,INSD:EL984885.1,
FT                   INSD:EL981768.1,INSD:EH802716.1,INSD:R65541.1,
FT                   INSD:ES011278.1,INSD:DR202395.1,INSD:DR202396.1,
FT                   INSD:BP792814.1,INSD:ES073775.1,INSD:ES180121.1,
FT                   INSD:AV808503.1,INSD:BP630578.1,INSD:EL312372.1,
FT                   INSD:DR202391.1,INSD:DR376757.1,INSD:N37638.1,
FT                   INSD:EH867479.1,INSD:AV791663.1,INSD:DR202390.1,
FT                   INSD:DR202394.1,INSD:AI994104.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY091202.1,INSD:AY045875.1"
FT                   /protein_id="AED90342.1"
FT   CDS_pept        complement(join(176797..176835,177094..177175,
FT                   177258..177355,177477..177557,177657..177748,
FT                   177980..178010))
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.140"
FT                   /locus_tag="AT5G01430"
FT                   /product="Got1/Sft2-like vescicle transport protein family"
FT                   /note="Got1/Sft2-like vescicle transport protein family;
FT                   FUNCTIONS IN: molecular_function unknown; INVOLVED IN:
FT                   vesicle-mediated transport; LOCATED IN: cellular_component
FT                   unknown; CONTAINS InterPro DOMAIN/s: Vesicle transport
FT                   protein, Got1/SFT2-like (InterPro:IPR007305); BEST
FT                   Arabidopsis thaliana protein match is: Got1/Sft2-like
FT                   vescicle transport protein family (TAIR:AT3G49420.1)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01430"
FT                   /db_xref="GOA:Q9SCL4"
FT                   /db_xref="InterPro:IPR007305"
FT                   /db_xref="UniProtKB/TrEMBL:Q9SCL4"
FT                   /protein_id="AED90343.1"
FT   gene            179822..181321
FT                   /gene_synonym="T10O8.150"
FT                   /gene_synonym="T10O8_150"
FT                   /locus_tag="AT5G01440"
FT   mRNA            join(179822..179914,179995..180098,180211..180355,
FT                   180442..180545,180713..180922,181007..181190,
FT                   181248..181321)
FT                   /gene_synonym="T10O8.150"
FT                   /gene_synonym="T10O8_150"
FT                   /locus_tag="AT5G01440"
FT                   /product="hypothetical protein"
FT   CDS_pept        join(179822..179914,179995..180098,180211..180355,
FT                   180442..180545,180713..180922,181007..181190,
FT                   181248..181283)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.150"
FT                   /gene_synonym="T10O8_150"
FT                   /locus_tag="AT5G01440"
FT                   /product="hypothetical protein"
FT                   /note="BEST Arabidopsis thaliana protein match is:
FT                   Insulinase (Peptidase family M16) family protein
FT                   (TAIR:AT1G06900.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01440"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01440.1"
FT                   /db_xref="GOA:F4K9D7"
FT                   /db_xref="InterPro:IPR011249"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9D7"
FT                   /protein_id="AED90344.1"
FT                   NESIERRSKR"
FT   gene            complement(181821..182581)
FT                   /locus_tag="AT5G01445"
FT   mRNA            complement(join(181821..182151,182239..182312,
FT                   182398..182581))
FT                   /locus_tag="AT5G01445"
FT                   /product="hypothetical protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP656584.1,INSD:EL176842.1,INSD:BP833004.1,
FT                   INSD:CD532929.1,INSD:BP812446.1,INSD:CD532933.1,
FT                   INSD:EH987864.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AK221153.1"
FT   CDS_pept        complement(join(182013..182151,182239..182312,
FT                   182398..182526))
FT                   /codon_start=1
FT                   /locus_tag="AT5G01445"
FT                   /product="hypothetical protein"
FT                   /note="unknown protein; FUNCTIONS IN: molecular_function
FT                   unknown; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: mitochondrion; Has 5 Blast hits to 5 proteins in 2
FT                   species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0;
FT                   Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01445"
FT                   /db_xref="GOA:F4K9D8"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9D8"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP656584.1,INSD:EL176842.1,INSD:BP833004.1,
FT                   INSD:CD532929.1,INSD:BP812446.1,INSD:CD532933.1,
FT                   INSD:EH987864.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AK221153.1"
FT                   /protein_id="AED90345.1"
FT                   KNLQCFIKT"
FT   gene            complement(183328..186461)
FT                   /gene="APD2"
FT                   /gene_synonym="ABERRANT POLLEN DEVELOPMENT 2"
FT                   /gene_synonym="T10O8.160"
FT                   /gene_synonym="T10O8_160"
FT                   /locus_tag="AT5G01450"
FT   mRNA            complement(join(183328..183768,183891..184194,
FT                   184298..184370,184515..184661,184819..184901,
FT                   184989..185063,185419..185512,185591..185716,
FT                   185803..185909,185995..186461))
FT                   /gene="APD2"
FT                   /gene_synonym="ABERRANT POLLEN DEVELOPMENT 2"
FT                   /gene_synonym="T10O8.160"
FT                   /gene_synonym="T10O8_160"
FT                   /locus_tag="AT5G01450"
FT                   /product="RING/U-box superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BE529281.1,INSD:ES116463.1,INSD:CF773968.1,
FT                   INSD:AV518482.1,INSD:EG512545.1,INSD:AA651416.1,
FT                   INSD:EL237213.1,INSD:AV439912.1,INSD:ES149332.1,
FT                   INSD:AU237497.1,INSD:EH867362.1,INSD:ES122109.1,
FT                   INSD:EL068859.1,INSD:AV525674.1,INSD:CF773035.1,
FT                   INSD:ES137837.1,INSD:AU228571.1,INSD:BU635166.1,
FT                   INSD:DR353056.1,INSD:AV534498.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT015052.1,INSD:BT015858.1,INSD:AK229004.1,
FT                   INSD:BX831291.1"
FT   CDS_pept        complement(join(183693..183768,183891..184194,
FT                   184298..184370,184515..184661,184819..184901,
FT                   184989..185063,185419..185512,185591..185716,
FT                   185803..185909,185995..186244))
FT                   /codon_start=1
FT                   /gene="APD2"
FT                   /gene_synonym="T10O8.160"
FT                   /gene_synonym="T10O8_160"
FT                   /gene_synonym="ABERRANT POLLEN DEVELOPMENT 2"
FT                   /locus_tag="AT5G01450"
FT                   /product="RING/U-box superfamily protein"
FT                   /note="RING/U-box superfamily protein; FUNCTIONS IN: zinc
FT                   ion binding; INVOLVED IN: biological_process unknown;
FT                   LOCATED IN: cellular_component unknown; EXPRESSED IN: 24
FT                   plant structures; EXPRESSED DURING: 11 growth stages;
FT                   CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type
FT                   (InterPro:IPR001841); BEST Arabidopsis thaliana protein
FT                   match is: RING/U-box superfamily protein
FT                   (TAIR:AT2G38185.2); Has 1494 Blast hits to 1490 proteins in
FT                   181 species: Archae - 0; Bacteria - 0; Metazoa - 838; Fungi
FT                   - 48; Plants - 298; Viruses - 88; Other Eukaryotes - 222
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q6DBH0"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR032008"
FT                   /db_xref="InterPro:IPR032010"
FT                   /db_xref="UniProtKB/TrEMBL:Q6DBH0"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BE529281.1,INSD:ES116463.1,INSD:CF773968.1,
FT                   INSD:AV518482.1,INSD:EG512545.1,INSD:AA651416.1,
FT                   INSD:EL237213.1,INSD:AV439912.1,INSD:ES149332.1,
FT                   INSD:AU237497.1,INSD:EH867362.1,INSD:ES122109.1,
FT                   INSD:EL068859.1,INSD:AV525674.1,INSD:CF773035.1,
FT                   INSD:ES137837.1,INSD:AU228571.1,INSD:BU635166.1,
FT                   INSD:DR353056.1,INSD:AV534498.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT015052.1,INSD:BT015858.1,INSD:AK229004.1,
FT                   INSD:BX831291.1"
FT                   /protein_id="AED90346.1"
FT   gene            186654..190661
FT                   /gene_synonym="T10O8.170"
FT                   /gene_synonym="T10O8_170"
FT                   /locus_tag="AT5G01460"
FT   mRNA            join(186654..187172,187270..187355,187542..187657,
FT                   187775..187885,188070..188168,188291..188413,
FT                   188695..188757,188840..188904,189004..189113,
FT                   189215..189329,189424..189489,189592..189702,
FT                   189792..189858,189961..190661)
FT                   /gene_synonym="T10O8.170"
FT                   /gene_synonym="T10O8_170"
FT                   /locus_tag="AT5G01460"
FT                   /product="LMBR1-like membrane protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP865699.1,INSD:ES115394.1,INSD:EH980055.1,
FT                   INSD:ES015089.1,INSD:W43054.1,INSD:EH805853.1,
FT                   INSD:ES079886.1,INSD:EL972956.1,INSD:EL978699.1,
FT                   INSD:BP577633.1,INSD:ES066328.1,INSD:BP777596.1,
FT                   INSD:BP580890.1,INSD:AV808958.1,INSD:ES058672.1,
FT                   INSD:AV548573.1,INSD:EL164587.1,INSD:ES021574.1,
FT                   INSD:EH989321.1,INSD:ES184047.1,INSD:AV538129.1,
FT                   INSD:EL297477.1,INSD:EL301566.1,INSD:EH906382.1,
FT                   INSD:ES059636.1,INSD:EH859368.1,INSD:ES157284.1,
FT                   INSD:EL320410.1,INSD:EL017897.1,INSD:EH850088.1,
FT                   INSD:DR362649.1,INSD:ES146401.1,INSD:AV804746.1,
FT                   INSD:EH826817.1,INSD:EL104442.1,INSD:DR269546.1,
FT                   INSD:EL222240.1,INSD:ES083719.1,INSD:EH892503.1,
FT                   INSD:BP780727.1,INSD:EL175757.1,INSD:EL170995.1,
FT                   INSD:EL134969.1,INSD:ES097719.1,INSD:AV558344.1,
FT                   INSD:AV810629.1,INSD:ES039604.1,INSD:DR383432.1,
FT                   INSD:EL249322.1,INSD:ES085915.1,INSD:BP788146.1,
FT                   INSD:EH828938.1,INSD:AI999226.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY096440.1,INSD:AY072197.1"
FT   CDS_pept        join(186823..187172,187270..187355,187542..187657,
FT                   187775..187885,188070..188168,188291..188413,
FT                   188695..188757,188840..188904,189004..189113,
FT                   189215..189329,189424..189489,189592..189702,
FT                   189792..189858,189961..190008)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.170"
FT                   /gene_synonym="T10O8_170"
FT                   /locus_tag="AT5G01460"
FT                   /product="LMBR1-like membrane protein"
FT                   /note="LMBR1-like membrane protein; CONTAINS InterPro
FT                   DOMAIN/s: LMBR1-like membrane protein, conserved region
FT                   (InterPro:IPR006876); BEST Arabidopsis thaliana protein
FT                   match is: LMBR1-like membrane protein (TAIR:AT3G08930.1);
FT                   Has 1807 Blast hits to 1807 proteins in 277 species: Archae
FT                   - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants -
FT                   385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI
FT                   BLink)."
FT                   /db_xref="GOA:Q9M028"
FT                   /db_xref="InterPro:IPR006876"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M028"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP865699.1,INSD:ES115394.1,INSD:EH980055.1,
FT                   INSD:ES015089.1,INSD:W43054.1,INSD:EH805853.1,
FT                   INSD:ES079886.1,INSD:EL972956.1,INSD:EL978699.1,
FT                   INSD:BP577633.1,INSD:ES066328.1,INSD:BP777596.1,
FT                   INSD:BP580890.1,INSD:AV808958.1,INSD:ES058672.1,
FT                   INSD:AV548573.1,INSD:EL164587.1,INSD:ES021574.1,
FT                   INSD:EH989321.1,INSD:ES184047.1,INSD:AV538129.1,
FT                   INSD:EL297477.1,INSD:EL301566.1,INSD:EH906382.1,
FT                   INSD:ES059636.1,INSD:EH859368.1,INSD:ES157284.1,
FT                   INSD:EL320410.1,INSD:EL017897.1,INSD:EH850088.1,
FT                   INSD:DR362649.1,INSD:ES146401.1,INSD:AV804746.1,
FT                   INSD:EH826817.1,INSD:EL104442.1,INSD:DR269546.1,
FT                   INSD:EL222240.1,INSD:ES083719.1,INSD:EH892503.1,
FT                   INSD:BP780727.1,INSD:EL175757.1,INSD:EL170995.1,
FT                   INSD:EL134969.1,INSD:ES097719.1,INSD:AV558344.1,
FT                   INSD:AV810629.1,INSD:ES039604.1,INSD:DR383432.1,
FT                   INSD:EL249322.1,INSD:ES085915.1,INSD:BP788146.1,
FT                   INSD:EH828938.1,INSD:AI999226.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY096440.1,INSD:AY072197.1"
FT                   /protein_id="AED90347.1"
FT   gene            190863..192793
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT   mRNA            join(190863..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192215,192296..192731)
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT   mRNA            join(190863..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192215,
FT                   192296..192731)
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT   mRNA            join(190874..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192227,
FT                   192296..192769)
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT   mRNA            join(190874..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192215,
FT                   192302..192769)
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL141324.1,INSD:BE524948.1,INSD:DR296895.1,
FT                   INSD:EL272610.1,INSD:EL289005.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT014727.1,INSD:BT015510.1"
FT   CDS_pept        join(190881..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192227,
FT                   192296..192462)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01470"
FT                   /db_xref="GOA:A0A1P8BE87"
FT                   /db_xref="InterPro:IPR019410"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BE87"
FT                   /protein_id="ANM69916.1"
FT   CDS_pept        join(190881..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192215,
FT                   192296..192462)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01470"
FT                   /db_xref="GOA:A0A1P8BE92"
FT                   /db_xref="InterPro:IPR019410"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BE92"
FT                   /protein_id="ANM69918.1"
FT   CDS_pept        join(190881..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192215,
FT                   192302..192462)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /note="S-adenosyl-L-methionine-dependent methyltransferases
FT                   superfamily protein; FUNCTIONS IN: molecular_function
FT                   unknown; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: cellular_component unknown; EXPRESSED IN: 12 plant
FT                   structures; EXPRESSED DURING: 7 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Methyltransferase-16, putative
FT                   (InterPro:IPR019410); Has 30201 Blast hits to 17322
FT                   proteins in 780 species: Archae - 12; Bacteria - 1396;
FT                   Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
FT                   Other Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01470"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01470.3"
FT                   /db_xref="GOA:B3H734"
FT                   /db_xref="InterPro:IPR019410"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:B3H734"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL141324.1,INSD:R65525.1,INSD:BE524948.1,
FT                   INSD:DR296895.1,INSD:EL272610.1,INSD:EL289005.1"
FT                   /protein_id="AED90350.2"
FT   CDS_pept        join(190881..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192134)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01470"
FT                   /db_xref="GOA:A0A1P8BEC4"
FT                   /db_xref="InterPro:IPR019410"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BEC4"
FT                   /protein_id="ANM69917.1"
FT   mRNA            join(190909..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192215,
FT                   192296..192793)
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL141324.1,INSD:R65525.1,INSD:BE524948.1,
FT                   INSD:DR296895.1,INSD:EL272610.1,INSD:EL289005.1"
FT   mRNA            join(190928..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192215,192296..192739)
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT   mRNA            join(190928..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192227,
FT                   192296..192739)
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL141324.1,INSD:BE524948.1,INSD:DR296895.1,
FT                   INSD:EL272610.1,INSD:EL289005.1,INSD:DR381642.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY086411.1,INSD:BX833040.1,INSD:BT025168.1"
FT   CDS_pept        join(190953..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192227,
FT                   192296..192462)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /note="S-adenosyl-L-methionine-dependent methyltransferases
FT                   superfamily protein; FUNCTIONS IN: molecular_function
FT                   unknown; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: cellular_component unknown; EXPRESSED IN: 12 plant
FT                   structures; EXPRESSED DURING: 7 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Methyltransferase-16, putative
FT                   (InterPro:IPR019410); Has 375 Blast hits to 375 proteins in
FT                   142 species: Archae - 2; Bacteria - 36; Metazoa - 120;
FT                   Fungi - 106; Plants - 76; Viruses - 0; Other Eukaryotes -
FT                   35 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01470"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01470.2"
FT                   /db_xref="GOA:A8MS01"
FT                   /db_xref="InterPro:IPR019410"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:A8MS01"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL141324.1,INSD:BE524948.1,INSD:DR296895.1,
FT                   INSD:EL272610.1,INSD:EL289005.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT014727.1,INSD:BT015510.1"
FT                   /protein_id="AED90349.1"
FT   CDS_pept        join(190953..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192057,192129..192215,
FT                   192296..192462)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /note="S-adenosyl-L-methionine-dependent methyltransferases
FT                   superfamily protein; CONTAINS InterPro DOMAIN/s:
FT                   Methyltransferase-16, putative (InterPro:IPR019410); Has
FT                   30201 Blast hits to 17322 proteins in 780 species: Archae -
FT                   12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants
FT                   - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01470.1"
FT                   /db_xref="GOA:Q8LCT7"
FT                   /db_xref="InterPro:IPR019410"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q8LCT7"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL141324.1,INSD:BE524948.1,INSD:DR296895.1,
FT                   INSD:EL272610.1,INSD:EL289005.1,INSD:DR381642.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY086411.1,INSD:BX833040.1,INSD:BT025168.1"
FT                   /protein_id="AED90348.1"
FT   CDS_pept        join(190953..191010,191099..191160,191465..191598,
FT                   191756..191901,191986..192134)
FT                   /codon_start=1
FT                   /gene_synonym="T10O8.180"
FT                   /gene_synonym="T10O8_180"
FT                   /locus_tag="AT5G01470"
FT                   /product="S-adenosyl-L-methionine-dependent
FT                   methyltransferases superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01470"
FT                   /db_xref="GOA:A0A1P8BE89"
FT                   /db_xref="InterPro:IPR019410"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BE89"
FT                   /protein_id="ANM69915.1"
FT   gene            192749..194805
FT                   /gene_synonym="F7A7.1"
FT                   /locus_tag="AT5G01480"
FT   mRNA            192749..194805
FT                   /gene_synonym="F7A7.1"
FT                   /locus_tag="AT5G01480"
FT                   /product="Cysteine/Histidine-rich C1 domain family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AI994631.1,INSD:AA651112.1"
FT   CDS_pept        192990..194231
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.1"
FT                   /locus_tag="AT5G01480"
FT                   /product="Cysteine/Histidine-rich C1 domain family protein"
FT                   /note="Cysteine/Histidine-rich C1 domain family protein;
FT                   FUNCTIONS IN: zinc ion binding; INVOLVED IN: intracellular
FT                   signaling pathway; LOCATED IN: cellular_component unknown;
FT                   CONTAINS InterPro DOMAIN/s: Protein kinase C-like, phorbol
FT                   ester/diacylglycerol binding (InterPro:IPR002219), DC1
FT                   (InterPro:IPR004146), Zinc finger, PHD-type
FT                   (InterPro:IPR001965), C1-like (InterPro:IPR011424); BEST
FT                   Arabidopsis thaliana protein match is:
FT                   Cysteine/Histidine-rich C1 domain family protein
FT                   (TAIR:AT2G02610.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01480"
FT                   /db_xref="GOA:Q9M026"
FT                   /db_xref="InterPro:IPR001965"
FT                   /db_xref="InterPro:IPR004146"
FT                   /db_xref="UniProtKB/TrEMBL:Q9M026"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AI994631.1,INSD:AA651112.1"
FT                   /protein_id="AED90351.1"
FT                   RYSCGFRCMCSCAV"
FT   gene            complement(194433..194823)
FT                   /locus_tag="AT5G00770"
FT   ncRNA           complement(194433..194823)
FT                   /locus_tag="AT5G00770"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            194723..194933
FT                   /locus_tag="AT5G00775"
FT   ncRNA           194723..194933
FT                   /locus_tag="AT5G00775"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            195452..198651
FT                   /gene="CAX4"
FT                   /gene_synonym="ATCAX4"
FT                   /gene_synonym="cation exchanger 4"
FT                   /gene_synonym="F7A7.10"
FT                   /gene_synonym="F7A7_10"
FT                   /locus_tag="AT5G01490"
FT                   /note="Encodes a cation/proton antiporter, a member of low
FT                   affinity calcium antiporter CAX2 family. Involved in root
FT                   development under metal stress."
FT   mRNA            join(195452..195876,195984..196051,196160..196188,
FT                   196453..196649,196782..197003,197099..197239,
FT                   197328..197444,197543..197596,197823..197939,
FT                   198024..198114,198204..198240,198462..198651)
FT                   /gene="CAX4"
FT                   /gene_synonym="ATCAX4"
FT                   /gene_synonym="cation exchanger 4"
FT                   /gene_synonym="F7A7.10"
FT                   /gene_synonym="F7A7_10"
FT                   /locus_tag="AT5G01490"
FT                   /product="cation exchanger 4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV547983.1,INSD:DR369119.1,INSD:EL045687.1"
FT   mRNA            join(195452..195876,195984..196051,196160..196188,
FT                   196453..196649,196782..197003,197099..197239,
FT                   197328..197444,197543..197596,197823..197939,
FT                   198024..198114,198204..198409)
FT                   /gene="CAX4"
FT                   /gene_synonym="ATCAX4"
FT                   /gene_synonym="cation exchanger 4"
FT                   /gene_synonym="F7A7.10"
FT                   /gene_synonym="F7A7_10"
FT                   /locus_tag="AT5G01490"
FT                   /product="cation exchanger 4"
FT   CDS_pept        join(195589..195876,195984..196051,196160..196188,
FT                   196453..196649,196782..197003,197099..197239,
FT                   197328..197444,197543..197596,197823..197939,
FT                   198024..198114,198204..198240,198462..198465)
FT                   /codon_start=1
FT                   /gene="CAX4"
FT                   /gene_synonym="ATCAX4"
FT                   /gene_synonym="cation exchanger 4"
FT                   /gene_synonym="F7A7.10"
FT                   /gene_synonym="F7A7_10"
FT                   /locus_tag="AT5G01490"
FT                   /product="cation exchanger 4"
FT                   /note="cation exchanger 4 (CAX4); CONTAINS InterPro
FT                   DOMAIN/s: Sodium/calcium exchanger membrane region
FT                   (InterPro:IPR004837), Calcium/proton exchanger superfamily
FT                   (InterPro:IPR004798), Calcium/proton exchanger
FT                   (InterPro:IPR004713); BEST Arabidopsis thaliana protein
FT                   match is: cation exchanger 1 (TAIR:AT2G38170.3); Has 3152
FT                   Blast hits to 2978 proteins in 994 species: Archae - 25;
FT                   Bacteria - 1749; Metazoa - 60; Fungi - 737; Plants - 238;
FT                   Viruses - 0; Other Eukaryotes - 343 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q945S5"
FT                   /db_xref="InterPro:IPR004713"
FT                   /db_xref="InterPro:IPR004798"
FT                   /db_xref="InterPro:IPR004837"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q945S5"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV547983.1,INSD:DR369119.1,INSD:EL045687.1"
FT                   /protein_id="AED90352.1"
FT   CDS_pept        join(195589..195876,195984..196051,196160..196188,
FT                   196453..196649,196782..197003,197099..197239,
FT                   197328..197444,197543..197596,197823..197939,
FT                   198024..198114,198204..198244)
FT                   /codon_start=1
FT                   /gene="CAX4"
FT                   /gene_synonym="ATCAX4"
FT                   /gene_synonym="cation exchanger 4"
FT                   /gene_synonym="F7A7.10"
FT                   /gene_synonym="F7A7_10"
FT                   /locus_tag="AT5G01490"
FT                   /product="cation exchanger 4"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01490"
FT                   /db_xref="GOA:Q945S5"
FT                   /db_xref="InterPro:IPR004713"
FT                   /db_xref="InterPro:IPR004798"
FT                   /db_xref="InterPro:IPR004837"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q945S5"
FT                   /protein_id="ANM69424.1"
FT   gene            198906..201586
FT                   /gene="TAAC"
FT                   /gene_synonym="F7A7.20"
FT                   /gene_synonym="F7A7_20"
FT                   /gene_synonym="thylakoid ATP/ADP carrier"
FT                   /locus_tag="AT5G01500"
FT                   /note="encodes an ATP/ADP carrier that is located to the
FT                   thylakoid membrane involved in providing ATP during
FT                   thylakoid biogenesis and turnover"
FT   mRNA            join(198906..199448,199804..199860,199958..200020,
FT                   200113..200169,200280..200363,200441..200509,
FT                   200586..200698,200783..200952,201036..201114,
FT                   201206..201586)
FT                   /gene="TAAC"
FT                   /gene_synonym="F7A7.20"
FT                   /gene_synonym="F7A7_20"
FT                   /gene_synonym="thylakoid ATP/ADP carrier"
FT                   /locus_tag="AT5G01500"
FT                   /product="thylakoid ATP/ADP carrier"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR381636.1,INSD:AV544656.1,INSD:AV526741.1,
FT                   INSD:AV784181.1,INSD:ES104469.1,INSD:AV823248.1,
FT                   INSD:DR348651.1,INSD:DR348650.1,INSD:BP785487.1,
FT                   INSD:BU634615.1,INSD:EL293347.1,INSD:ES048037.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT006336.1,INSD:BX831380.1,INSD:BX830301.1,
FT                   INSD:AY074566.1,INSD:AY086408.1,INSD:BX830063.1"
FT   CDS_pept        join(199017..199448,199804..199860,199958..200020,
FT                   200113..200169,200280..200363,200441..200509,
FT                   200586..200698,200783..200952,201036..201114,
FT                   201206..201329)
FT                   /codon_start=1
FT                   /gene="TAAC"
FT                   /gene_synonym="F7A7.20"
FT                   /gene_synonym="F7A7_20"
FT                   /gene_synonym="thylakoid ATP/ADP carrier"
FT                   /locus_tag="AT5G01500"
FT                   /product="thylakoid ATP/ADP carrier"
FT                   /note="thylakoid ATP/ADP carrier (TAAC); FUNCTIONS IN:
FT                   binding, transporter activity, ATP transmembrane
FT                   transporter activity; INVOLVED IN: photosystem II repair,
FT                   transport, photoprotection; LOCATED IN: in 7 components;
FT                   EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14
FT                   growth stages; CONTAINS InterPro DOMAIN/s: Mitochondrial
FT                   carrier protein (InterPro:IPR002067), Mitochondrial
FT                   substrate carrier (InterPro:IPR001993), Mitochondrial
FT                   substrate/solute carrier (InterPro:IPR018108); BEST
FT                   Arabidopsis thaliana protein match is: Mitochondrial
FT                   substrate carrier family protein (TAIR:AT3G51870.1); Has
FT                   1807 Blast hits to 1807 proteins in 277 species: Archae -
FT                   0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M024"
FT                   /db_xref="InterPro:IPR002067"
FT                   /db_xref="InterPro:IPR018108"
FT                   /db_xref="InterPro:IPR023395"
FT                   /db_xref="InterPro:IPR040062"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M024"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR381636.1,INSD:AV544656.1,INSD:AV526741.1,
FT                   INSD:AV784181.1,INSD:ES104469.1,INSD:AV823248.1,
FT                   INSD:DR348651.1,INSD:DR348650.1,INSD:BP785487.1,
FT                   INSD:BU634615.1,INSD:EL293347.1,INSD:ES048037.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT006336.1,INSD:BX831380.1,INSD:BX830301.1,
FT                   INSD:AY074566.1,INSD:AY086408.1,INSD:BX830063.1"
FT                   /protein_id="AED90353.1"
FT                   DDNRKKASPNTIDEQT"
FT   gene            201603..205679
FT                   /gene="RUS5"
FT                   /gene_synonym="F7A7.30"
FT                   /gene_synonym="F7A7_30"
FT                   /gene_synonym="ROOT UV-B SENSITIVE 5"
FT                   /locus_tag="AT5G01510"
FT   mRNA            join(201603..201856,201940..202002,202088..202245,
FT                   202390..202490,202609..202679,202773..202819,
FT                   202900..202978,203082..203154,203269..203358,
FT                   203458..203517,203641..203754,203839..203899,
FT                   203969..204087,204183..204275,204906..205679)
FT                   /gene="RUS5"
FT                   /gene_synonym="F7A7.30"
FT                   /gene_synonym="F7A7_30"
FT                   /gene_synonym="ROOT UV-B SENSITIVE 5"
FT                   /locus_tag="AT5G01510"
FT                   /product="root UVB sensitive protein (Protein of unknown
FT                   function, DUF647)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES069503.1,INSD:ES057259.1,INSD:BP790823.1,
FT                   INSD:EL076072.1,INSD:BP793599.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT050411.1,INSD:BX829823.1,INSD:BX830511.1"
FT   CDS_pept        join(201702..201856,201940..202002,202088..202245,
FT                   202390..202490,202609..202679,202773..202819,
FT                   202900..202978,203082..203154,203269..203358,
FT                   203458..203517,203641..203754,203839..203899,
FT                   203969..204087,204183..204275,204906..205151)
FT                   /codon_start=1
FT                   /gene="RUS5"
FT                   /gene_synonym="F7A7.30"
FT                   /gene_synonym="F7A7_30"
FT                   /gene_synonym="ROOT UV-B SENSITIVE 5"
FT                   /locus_tag="AT5G01510"
FT                   /product="root UVB sensitive protein (Protein of unknown
FT                   function, DUF647)"
FT                   /note="ROOT UV-B SENSITIVE 5 (RUS5); CONTAINS InterPro
FT                   DOMAIN/s: Protein of unknown function DUF647
FT                   (InterPro:IPR006968); BEST Arabidopsis thaliana protein
FT                   match is: Protein of unknown function, DUF647
FT                   (TAIR:AT3G45890.1); Has 426 Blast hits to 424 proteins in
FT                   125 species: Archae - 0; Bacteria - 2; Metazoa - 111; Fungi
FT                   - 69; Plants - 183; Viruses - 0; Other Eukaryotes - 61
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:B6IDH3"
FT                   /db_xref="InterPro:IPR006968"
FT                   /db_xref="UniProtKB/Swiss-Prot:B6IDH3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES069503.1,INSD:ES057259.1,INSD:BP790823.1,
FT                   INSD:EL076072.1,INSD:BP793599.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT050411.1,INSD:BX829823.1,INSD:BX830511.1"
FT                   /protein_id="AED90354.1"
FT   gene            206432..208611
FT                   /gene="AIRP2"
FT                   /gene_synonym="F7A7.40"
FT                   /gene_synonym="F7A7_40"
FT                   /gene_synonym="ABA Insensitive RING Protein 2"
FT                   /gene_synonym="AtAIRP2"
FT                   /locus_tag="AT5G01520"
FT   mRNA            join(206432..206861,207453..207603,207703..207769,
FT                   207867..208101,208170..208611)
FT                   /gene="AIRP2"
FT                   /gene_synonym="F7A7.40"
FT                   /gene_synonym="F7A7_40"
FT                   /gene_synonym="ABA Insensitive RING Protein 2"
FT                   /gene_synonym="AtAIRP2"
FT                   /locus_tag="AT5G01520"
FT                   /product="RING/U-box superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES200245.1,INSD:CB257492.1,INSD:AV557717.1,
FT                   INSD:ES024579.1,INSD:T22636.1,INSD:BP671900.1,
FT                   INSD:BP843186.1,INSD:AV826358.1,INSD:BU635339.1,
FT                   INSD:ES071674.1,INSD:AV794566.1,INSD:AA712150.1,
FT                   INSD:ES152097.1,INSD:AV564168.1,INSD:ES113693.1,
FT                   INSD:BP856644.1,INSD:BP663168.1,INSD:AV827590.1,
FT                   INSD:CK118139.1,INSD:ES004530.1,INSD:ES019253.1,
FT                   INSD:BP661628.1,INSD:EH934658.1,INSD:BP660462.1,
FT                   INSD:EL295849.1,INSD:N96366.1,INSD:T43550.1,
FT                   INSD:BP804842.1,INSD:ES089210.1,INSD:ES086864.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:DQ059129.1,INSD:AY050835.1,INSD:AY091165.1"
FT   mRNA            join(206432..206861,207453..207603,207703..207769,
FT                   207867..208101,208189..208611)
FT                   /gene="AIRP2"
FT                   /gene_synonym="F7A7.40"
FT                   /gene_synonym="F7A7_40"
FT                   /gene_synonym="ABA Insensitive RING Protein 2"
FT                   /gene_synonym="AtAIRP2"
FT                   /locus_tag="AT5G01520"
FT                   /product="RING/U-box superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES200245.1,INSD:CB257492.1,INSD:T22636.1,
FT                   INSD:ES024579.1,INSD:ES004530.1,INSD:ES019253.1,
FT                   INSD:EH934658.1,INSD:BP843186.1,INSD:AV826358.1,
FT                   INSD:BP660462.1,INSD:EL295849.1,INSD:ES071674.1,
FT                   INSD:N96366.1,INSD:T43550.1,INSD:BP804842.1,
FT                   INSD:ES152097.1,INSD:AV564168.1,INSD:ES086864.1,
FT                   INSD:ES089210.1,INSD:ES113693.1,INSD:BP856644.1,
FT                   INSD:AV827590.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF370144.1,INSD:AY056355.1"
FT   CDS_pept        join(206797..206861,207453..207603,207703..207769,
FT                   207867..208101,208189..208399)
FT                   /codon_start=1
FT                   /gene="AIRP2"
FT                   /gene_synonym="F7A7.40"
FT                   /gene_synonym="F7A7_40"
FT                   /gene_synonym="ABA Insensitive RING Protein 2"
FT                   /gene_synonym="AtAIRP2"
FT                   /locus_tag="AT5G01520"
FT                   /product="RING/U-box superfamily protein"
FT                   /note="RING/U-box superfamily protein; FUNCTIONS IN: zinc
FT                   ion binding; EXPRESSED IN: 17 plant structures; EXPRESSED
FT                   DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Zinc
FT                   finger, RING-type, conserved site (InterPro:IPR017907),
FT                   Zinc finger, RING-type (InterPro:IPR001841), Zinc finger,
FT                   C3HC4 RING-type (InterPro:IPR018957); BEST Arabidopsis
FT                   thaliana protein match is: RING/U-box superfamily protein
FT                   (TAIR:AT3G47160.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M022"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M022"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES200245.1,INSD:CB257492.1,INSD:AV557717.1,
FT                   INSD:ES024579.1,INSD:T22636.1,INSD:BP671900.1,
FT                   INSD:BP843186.1,INSD:AV826358.1,INSD:BU635339.1,
FT                   INSD:ES071674.1,INSD:AV794566.1,INSD:AA712150.1,
FT                   INSD:ES152097.1,INSD:AV564168.1,INSD:ES113693.1,
FT                   INSD:BP856644.1,INSD:BP663168.1,INSD:AV827590.1,
FT                   INSD:CK118139.1,INSD:ES004530.1,INSD:ES019253.1,
FT                   INSD:BP661628.1,INSD:EH934658.1,INSD:BP660462.1,
FT                   INSD:EL295849.1,INSD:N96366.1,INSD:T43550.1,
FT                   INSD:BP804842.1,INSD:ES089210.1,INSD:ES086864.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:DQ059129.1,INSD:AY050835.1,INSD:AY091165.1"
FT                   /protein_id="AED90356.1"
FT   CDS_pept        join(206797..206861,207453..207603,207703..207769,
FT                   207867..208101,208170)
FT                   /codon_start=1
FT                   /gene="AIRP2"
FT                   /gene_synonym="F7A7.40"
FT                   /gene_synonym="F7A7_40"
FT                   /gene_synonym="ABA Insensitive RING Protein 2"
FT                   /gene_synonym="AtAIRP2"
FT                   /locus_tag="AT5G01520"
FT                   /product="RING/U-box superfamily protein"
FT                   /note="RING/U-box superfamily protein; CONTAINS InterPro
FT                   DOMAIN/s: Zinc finger, RING-type, conserved site
FT                   (InterPro:IPR017907); BEST Arabidopsis thaliana protein
FT                   match is: RING/U-box superfamily protein
FT                   (TAIR:AT3G47160.1); Has 35333 Blast hits to 34131 proteins
FT                   in 2444 species: Archae - 798; Bacteria - 22429; Metazoa -
FT                   974; Fungi - 991; Plants - 531; Viruses - 0; Other
FT                   Eukaryotes - 9610 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01520"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01520.2"
FT                   /db_xref="GOA:Q9M022"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M022"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES200245.1,INSD:CB257492.1,INSD:T22636.1,
FT                   INSD:ES024579.1,INSD:ES004530.1,INSD:ES019253.1,
FT                   INSD:EH934658.1,INSD:BP843186.1,INSD:AV826358.1,
FT                   INSD:BP660462.1,INSD:EL295849.1,INSD:ES071674.1,
FT                   INSD:N96366.1,INSD:T43550.1,INSD:BP804842.1,
FT                   INSD:ES152097.1,INSD:AV564168.1,INSD:ES086864.1,
FT                   INSD:ES089210.1,INSD:ES113693.1,INSD:BP856644.1,
FT                   INSD:AV827590.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF370144.1,INSD:AY056355.1"
FT                   /protein_id="AED90355.1"
FT                   SMCINCYRN"
FT   gene            208866..210548
FT                   /gene="LHCB4.1"
FT                   /gene_synonym="F7A7.50"
FT                   /gene_synonym="F7A7_50"
FT                   /gene_synonym="light harvesting complex photosystem II"
FT                   /locus_tag="AT5G01530"
FT   mRNA            join(208866..209593,209881..210548)
FT                   /gene="LHCB4.1"
FT                   /gene_synonym="F7A7.50"
FT                   /gene_synonym="F7A7_50"
FT                   /gene_synonym="light harvesting complex photosystem II"
FT                   /locus_tag="AT5G01530"
FT                   /product="light harvesting complex photosystem II"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR377123.1,INSD:BP585695.1,INSD:DR242932.1,
FT                   INSD:BP795507.1,INSD:EL257427.1,INSD:EL179591.1,
FT                   INSD:BP667825.1,INSD:DR357137.1,INSD:DR357140.1,
FT                   INSD:EL097468.1,INSD:EL167333.1,INSD:BP837253.1,
FT                   INSD:CK119949.1,INSD:ES112811.1,INSD:EH860860.1,
FT                   INSD:EL149894.1,INSD:DR357171.1,INSD:BP633887.1,
FT                   INSD:EL163162.1,INSD:EH930459.1,INSD:DR357220.1,
FT                   INSD:EH916457.1,INSD:EH944811.1,INSD:EH928321.1,
FT                   INSD:EL286271.1,INSD:DR343138.1,INSD:EL183829.1,
FT                   INSD:T42932.1,INSD:BP658170.1,INSD:EL258304.1,
FT                   INSD:EH948373.1,INSD:EH913629.1,INSD:EL123537.1,
FT                   INSD:EL275160.1,INSD:BU635206.1,INSD:BP643416.1,
FT                   INSD:EH904324.1,INSD:EH931234.1,INSD:EH941269.1,
FT                   INSD:DR357022.1,INSD:BP619988.1,INSD:EL280767.1,
FT                   INSD:EL022738.1,INSD:BP844607.1,INSD:EH815098.1,
FT                   INSD:CK121044.1,INSD:BP641319.1,INSD:EL241258.1,
FT                   INSD:EL150011.1,INSD:EH930986.1,INSD:CK119394.1,
FT                   INSD:BP632607.1,INSD:EH917051.1,INSD:EH929317.1,
FT                   INSD:CD531890.1,INSD:DR240100.1,INSD:EH921612.1,
FT                   INSD:EL315250.1,INSD:BP818049.1,INSD:EL297424.1,
FT                   INSD:DR357111.1,INSD:EL037530.1,INSD:EL107446.1,
FT                   INSD:EL220510.1,INSD:BP632551.1,INSD:EL972681.1,
FT                   INSD:EH872584.1,INSD:BP607256.1,INSD:EL084703.1,
FT                   INSD:EL112033.1,INSD:EL078116.1,INSD:BP834316.1,
FT                   INSD:EL136213.1,INSD:EH877955.1,INSD:DR357184.1,
FT                   INSD:BE039496.1,INSD:BP656592.1,INSD:EH818226.1,
FT                   INSD:R90401.1,INSD:EH851426.1,INSD:H76004.1,
FT                   INSD:EH875650.1,INSD:AV806184.1,INSD:DR357016.1,
FT                   INSD:EL213496.1,INSD:H35969.1,INSD:EL189153.1,
FT                   INSD:BP635152.1,INSD:EL092692.1,INSD:EL051710.1,
FT                   INSD:EL166886.1,INSD:BP605172.1,INSD:EL203539.1,
FT                   INSD:EL123199.1,INSD:EH910719.1,INSD:BP794774.1,
FT                   INSD:BP867370.1,INSD:EH869084.1,INSD:BP595529.1,
FT                   INSD:EL161609.1,INSD:EH934912.1,INSD:EL117084.1,
FT                   INSD:EH966973.1,INSD:EH966974.1,INSD:DR357076.1,
FT                   INSD:EL316577.1,INSD:EL341701.1,INSD:EH886063.1,
FT                   INSD:EL295087.1,INSD:EL068884.1,INSD:EL125012.1,
FT                   INSD:BP624569.1,INSD:BP862511.1,INSD:BP621962.1,
FT                   INSD:EL213666.1,INSD:BP830374.1,INSD:EL254876.1,
FT                   INSD:EH992890.1,INSD:EL022165.1,INSD:EL097970.1,
FT                   INSD:EL123340.1,INSD:DR357098.1,INSD:DR357209.1,
FT                   INSD:EL264050.1,INSD:EH943136.1,INSD:BP659901.1,
FT                   INSD:BP847292.2,INSD:EL295863.1,INSD:EL145358.1,
FT                   INSD:EL037288.1,INSD:EL070638.1,INSD:EL032322.1,
FT                   INSD:EH800708.1,INSD:EL090696.1,INSD:EL303353.1,
FT                   INSD:EL158710.1,INSD:EH968182.1,INSD:EL062701.1,
FT                   INSD:EH921384.1,INSD:EH916079.1,INSD:AA720059.1,
FT                   INSD:BP785969.1,INSD:DR357031.1,INSD:BP838475.1,
FT                   INSD:EH852341.1,INSD:DR357192.1,INSD:BP636231.1,
FT                   INSD:BP845960.1,INSD:DR357021.1,INSD:EL227934.1,
FT                   INSD:AA042757.1,INSD:DR357187.1,INSD:EL071387.1,
FT                   INSD:EH982542.1,INSD:DR357064.1,INSD:EH839800.1,
FT                   INSD:DR357200.1,INSD:EL173333.1,INSD:EH877770.1,
FT                   INSD:EH821172.1,INSD:EL075837.1,INSD:DR357136.1,
FT                   INSD:EL069797.1,INSD:EL225549.1,INSD:CK121219.1,
FT                   INSD:BP778120.1,INSD:EL194682.1,INSD:BP625789.1,
FT                   INSD:EL147664.1,INSD:EL164787.1,INSD:AV829631.1,
FT                   INSD:EH863638.1,INSD:BP829922.1,INSD:EH917765.1,
FT                   INSD:BP615857.1,INSD:EH804698.1,INSD:EH877345.1,
FT                   INSD:EL014909.1,INSD:BP636449.1,INSD:DR357123.1,
FT                   INSD:EL035873.1,INSD:EL317696.1,INSD:ES194308.1,
FT                   INSD:EL296975.1,INSD:BP631149.1,INSD:DR372990.1,
FT                   INSD:DR357075.1,INSD:EH800548.1,INSD:EL316181.1,
FT                   INSD:ES020041.1,INSD:BP666910.1,INSD:EL141298.1,
FT                   INSD:ES194486.1,INSD:DR357156.1,INSD:EH978362.1,
FT                   INSD:AV799825.1,INSD:EL196887.1,INSD:EL998556.1,
FT                   INSD:BP639129.1,INSD:DR357096.1,INSD:EH951138.1,
FT                   INSD:BP829681.1,INSD:EL243016.1,INSD:BP628535.1,
FT                   INSD:EL163522.1,INSD:EL117278.1,INSD:EL012026.1,
FT                   INSD:EH892861.1,INSD:EL198319.1,INSD:EL251402.1,
FT                   INSD:EL040972.1,INSD:BP865482.1,INSD:EL080138.1,
FT                   INSD:CK119420.1,INSD:EL102692.1,INSD:EH838167.1,
FT                   INSD:EG477846.1,INSD:EL305253.1,INSD:BP594769.1,
FT                   INSD:BP666852.1,INSD:DR357049.1,INSD:AV439815.1,
FT                   INSD:EL007929.1,INSD:EH802346.1,INSD:EH955046.1,
FT                   INSD:EL310775.1,INSD:CK120707.1,INSD:T76720.1,
FT                   INSD:EL018324.1,INSD:BP827839.1,INSD:EH968219.1,
FT                   INSD:EL255762.1,INSD:EL106057.1,INSD:EH885648.1,
FT                   INSD:ES108672.1,INSD:EH934744.1,INSD:EL240744.1,
FT                   INSD:AV814878.1,INSD:BP819366.1,INSD:BP853438.1,
FT                   INSD:AV799576.1,INSD:AV797242.1,INSD:AV818522.1,
FT                   INSD:EL280333.1,INSD:EG454412.1,INSD:EL330729.1,
FT                   INSD:EH860090.1,INSD:AV801621.1,INSD:EH991928.1,
FT                   INSD:EH901229.1,INSD:EH935380.1,INSD:EH803447.1,
FT                   INSD:BP590361.1,INSD:BP589434.1,INSD:BP862937.1,
FT                   INSD:BP846335.1,INSD:DR357133.1,INSD:EL062983.1,
FT                   INSD:EL330641.1,INSD:EL034370.1,INSD:EH900747.1,
FT                   INSD:BP829508.1,INSD:EL087898.1,INSD:EL213582.1,
FT                   INSD:AV786964.1,INSD:BP850508.1,INSD:EL169882.1,
FT                   INSD:BP662608.1,INSD:CK118461.1,INSD:BP587787.1,
FT                   INSD:EH944646.1,INSD:EL170502.1,INSD:EH819904.1,
FT                   INSD:EH835298.1,INSD:DR357099.1,INSD:DR357095.1,
FT                   INSD:EH972373.1,INSD:N37691.1,INSD:N65746.1,
FT                   INSD:EH930331.1,INSD:DR357208.1,INSD:EH913497.1,
FT                   INSD:BP658834.1,INSD:DR357055.1,INSD:EL006801.1,
FT                   INSD:EL023008.1,INSD:DR343143.1,INSD:BP628233.1,
FT                   INSD:EL979800.1,INSD:BP785241.1,INSD:EH846219.1,
FT                   INSD:DR357131.1,INSD:EL134414.1,INSD:EL039318.1,
FT                   INSD:EL221136.1,INSD:BP823173.1,INSD:EH848445.1,
FT                   INSD:EL153266.1,INSD:AV803232.1,INSD:EL091047.1,
FT                   INSD:DR357230.1,INSD:BP813163.1,INSD:EL156424.1,
FT                   INSD:EL091479.1,INSD:EL268993.1,INSD:BP643376.1,
FT                   INSD:EL291380.1,INSD:EH842122.1,INSD:EL008075.1,
FT                   INSD:EL000933.1,INSD:DR357113.1,INSD:DR357086.1,
FT                   INSD:CK119031.1,INSD:EH897674.1,INSD:EL001845.1,
FT                   INSD:BP794903.1,INSD:EG508023.1,INSD:BP670241.1,
FT                   INSD:EH815418.1,INSD:EL134428.1,INSD:EH918679.1,
FT                   INSD:BP865268.1,INSD:EL276651.1,INSD:BP628078.1,
FT                   INSD:EH848316.1,INSD:AV817980.1,INSD:BP621923.1,
FT                   INSD:ES135043.1,INSD:BP671528.1,INSD:BP822123.1,
FT                   INSD:EL074863.1,INSD:DR357127.1,INSD:DR357089.1,
FT                   INSD:EL015825.1,INSD:EH844665.1,INSD:EL271653.1,
FT                   INSD:EL132301.1,INSD:EL087535.1,INSD:EL178377.1,
FT                   INSD:EL151883.1,INSD:EH799747.1,INSD:EL239065.1,
FT                   INSD:EL064761.1,INSD:EL248720.1,INSD:ES200147.1,
FT                   INSD:DR357196.1,INSD:EH857099.1,INSD:EH895940.1,
FT                   INSD:BP563662.1,INSD:EL026769.1,INSD:BP666108.1,
FT                   INSD:EH823157.1,INSD:DR357013.1,INSD:DR357083.1,
FT                   INSD:EH865711.1,INSD:BP645258.1,INSD:BP798795.1,
FT                   INSD:EH871538.1,INSD:EH877923.1,INSD:BP856760.1,
FT                   INSD:DR357235.1,INSD:EL045081.1,INSD:EH908838.1,
FT                   INSD:BP613710.1,INSD:DR357038.1,INSD:BP663336.1,
FT                   INSD:EL239339.1,INSD:CK119083.1,INSD:BP638685.1,
FT                   INSD:EL076358.1,INSD:EL096446.1,INSD:EH831531.1,
FT                   INSD:DR343144.1,INSD:DR357124.1,INSD:EL161203.1,
FT                   INSD:EL148409.1,INSD:DR357215.1,INSD:DR357117.1,
FT                   INSD:DR357081.1,INSD:EH868983.1,INSD:EL234121.1,
FT                   INSD:EH891534.1,INSD:EL135968.1,INSD:EH811187.1,
FT                   INSD:EL041523.1,INSD:EH953963.1,INSD:DR357060.1,
FT                   INSD:BP590703.1,INSD:EL199488.1,INSD:AV806230.1,
FT                   INSD:EH927465.1,INSD:EH873186.1,INSD:EH967618.1,
FT                   INSD:DR343131.1,INSD:DR357213.1,INSD:CD529081.1,
FT                   INSD:DR240103.1,INSD:BP669223.1,INSD:AV814365.1,
FT                   INSD:EL051658.1,INSD:BP818201.1,INSD:EL267112.1,
FT                   INSD:BP646501.1,INSD:EL047430.1,INSD:DR357197.1,
FT                   INSD:EH915350.1,INSD:EL177490.1,INSD:EL970191.1,
FT                   INSD:EH917221.1,INSD:EL153269.1,INSD:EL206913.1,
FT                   INSD:DR357012.1,INSD:BP785573.1,INSD:AV808452.1,
FT                   INSD:CB261128.1,INSD:DR357104.1,INSD:BP793772.1,
FT                   INSD:R30511.1,INSD:EH929964.1,INSD:DR357073.1,
FT                   INSD:BP864780.1,INSD:EL044358.1,INSD:EL295320.1,
FT                   INSD:EL310291.1,INSD:DR357129.1,INSD:DR357057.1,
FT                   INSD:DR357010.1,INSD:EL009420.1,INSD:H76565.1,
FT                   INSD:BP860619.1,INSD:DR357035.1,INSD:EL256127.1,
FT                   INSD:DR357205.1,INSD:EL121168.1,INSD:EL306287.1,
FT                   INSD:BP642651.1,INSD:EH911665.1,INSD:BP629802.1,
FT                   INSD:EH835586.1,INSD:DR343135.1,INSD:DR357174.1,
FT                   INSD:EL326449.1,INSD:EL226797.1,INSD:BP626966.1,
FT                   INSD:EL116622.1,INSD:BP650300.1,INSD:EL286914.1,
FT                   INSD:BP666506.1,INSD:DR343129.1,INSD:BP665215.1,
FT                   INSD:BP594877.1,INSD:EH802040.1,INSD:EL199263.1,
FT                   INSD:EL095333.1,INSD:EL206441.1,INSD:AV808893.1,
FT                   INSD:EH929789.1,INSD:EL072680.1,INSD:EL109498.1,
FT                   INSD:EH852632.1,INSD:BP616797.1,INSD:BP634798.1,
FT                   INSD:BE522881.1,INSD:EL277105.1,INSD:DR343136.1,
FT                   INSD:BP792953.1,INSD:EL225255.1,INSD:DR240108.1,
FT                   INSD:EH843557.1,INSD:EL337202.1,INSD:EL283577.1,
FT                   INSD:EL184450.1,INSD:EL054384.1,INSD:EL049204.1,
FT                   INSD:EL023787.1,INSD:BP624743.1,INSD:DR357240.1,
FT                   INSD:EL233303.1,INSD:AV832129.1,INSD:AV807181.1,
FT                   INSD:EG472383.1,INSD:EL321834.1,INSD:BP665096.1,
FT                   INSD:DR357180.1,INSD:EH921637.1,INSD:BP643845.1,
FT                   INSD:EH887944.1,INSD:EL006404.1,INSD:EH825972.1,
FT                   INSD:EH975600.1,INSD:EL276094.1,INSD:EL324419.1,
FT                   INSD:H37249.1,INSD:EH825515.1,INSD:DR357231.1,
FT                   INSD:EL236616.1,INSD:BP629357.1,INSD:BP851909.1,
FT                   INSD:BP624980.1,INSD:AV540401.1,INSD:BP853793.1,
FT                   INSD:BP625495.1,INSD:BP841845.1,INSD:EH801606.1,
FT                   INSD:EL137769.1,INSD:EH825128.1,INSD:EL321525.1,
FT                   INSD:BP850639.1,INSD:EL046127.1,INSD:EH825853.1,
FT                   INSD:EL141051.1,INSD:EL081946.1,INSD:EL188071.1,
FT                   INSD:BP832636.1,INSD:EL197487.1,INSD:BP852603.1,
FT                   INSD:EL083823.1,INSD:BP662107.1,INSD:DR357233.1,
FT                   INSD:EL170629.1,INSD:EL250060.1,INSD:T76626.1,
FT                   INSD:EH938362.1,INSD:EL052875.1,INSD:DR240106.1,
FT                   INSD:BP664138.1,INSD:BP865690.1,INSD:EH943327.1,
FT                   INSD:DR357088.1,INSD:BP650473.1,INSD:BP589947.1,
FT                   INSD:EL225696.1,INSD:EL260782.1,INSD:EL208894.1,
FT                   INSD:EH924059.1,INSD:BP825411.1,INSD:AV520792.1,
FT                   INSD:AV803150.1,INSD:DR357202.1,INSD:EL112542.1,
FT                   INSD:EL311110.1,INSD:EH884389.1,INSD:BP820944.1,
FT                   INSD:BP816868.1,INSD:EL975483.1,INSD:EG508048.1,
FT                   INSD:DR343127.1,INSD:EL303070.1,INSD:T45670.1,
FT                   INSD:EH969469.1,INSD:BP667010.1,INSD:AV807570.1,
FT                   INSD:BP635553.1,INSD:CB260094.1,INSD:BP633172.1,
FT                   INSD:DR357106.1,INSD:AV788594.1,INSD:BP846133.1,
FT                   INSD:BP597298.1,INSD:EH837348.1,INSD:EH863515.1,
FT                   INSD:BP626998.1,INSD:BP829798.1,INSD:BP624025.1,
FT                   INSD:EH862281.1,INSD:EL030786.1,INSD:EH927332.1,
FT                   INSD:DR357195.1,INSD:DR357130.1,INSD:BP670973.1,
FT                   INSD:EH982206.1,INSD:ES061055.1,INSD:EH867671.1,
FT                   INSD:EL067720.1,INSD:EH903017.1,INSD:BP830906.1,
FT                   INSD:BP841821.1,INSD:EL272253.1,INSD:EL319453.1,
FT                   INSD:AV819296.1,INSD:DR357170.1,INSD:EL121539.1,
FT                   INSD:EH838851.1,INSD:AV811895.1,INSD:EH965958.1,
FT                   INSD:EL195346.1,INSD:AV799844.1,INSD:BP671307.1,
FT                   INSD:DR357027.1,INSD:BP660696.1,INSD:DR357026.1,
FT                   INSD:EL277703.1,INSD:EH952387.1,INSD:EH916890.1,
FT                   INSD:BP856167.1,INSD:EL324414.1,INSD:EH799045.1,
FT                   INSD:EL245206.1,INSD:EL146290.1,INSD:BP663189.1,
FT                   INSD:EL199364.1,INSD:EH919432.1,INSD:BP667236.1,
FT                   INSD:BP638433.1,INSD:EG492119.1,INSD:EL184443.1,
FT                   INSD:BP646470.1,INSD:EL138531.1,INSD:EL092329.1,
FT                   INSD:EL014971.1,INSD:EH874045.1,INSD:EL038525.1,
FT                   INSD:BP666688.1,INSD:T46023.1,INSD:EL011200.1,
FT                   INSD:EL295380.1,INSD:EL259976.1,INSD:EL316201.1,
FT                   INSD:BP822857.1,INSD:EL104344.1,INSD:EH799941.1,
FT                   INSD:EH941863.1,INSD:T43737.1,INSD:EL111957.1,
FT                   INSD:EH842849.1,INSD:EH982317.1,INSD:EH970676.1,
FT                   INSD:EL279944.1,INSD:BP600297.1,INSD:EL281550.1,
FT                   INSD:EL198340.1,INSD:EL242130.1,INSD:EH973733.1,
FT                   INSD:EL327834.1,INSD:EL038429.1,INSD:EH988955.1,
FT                   INSD:DR357145.1,INSD:EL265772.1,INSD:EL275784.1,
FT                   INSD:BP812498.1,INSD:BP861545.1,INSD:EL224440.1,
FT                   INSD:EL120248.1,INSD:EL162573.1,INSD:EL168384.1,
FT                   INSD:EL244420.1,INSD:BP573192.1,INSD:AV521642.1,
FT                   INSD:BP634970.1,INSD:EG517111.1,INSD:BP637958.1,
FT                   INSD:EL200619.1,INSD:BP859699.1,INSD:BP640025.1,
FT                   INSD:EH906642.1,INSD:EL330844.1,INSD:EH912763.1,
FT                   INSD:EL311727.1,INSD:EL296591.1,INSD:DR357056.1,
FT                   INSD:DR357221.1,INSD:DR357080.1,INSD:AV801394.1,
FT                   INSD:EL024868.1,INSD:BE038756.1,INSD:EH833263.1,
FT                   INSD:ES207774.1,INSD:EH940495.1,INSD:AV806528.1,
FT                   INSD:DR357121.1,INSD:EL281849.1,INSD:DR343134.1,
FT                   INSD:BP662495.1,INSD:EL244498.1,INSD:DR357074.1,
FT                   INSD:EH993882.1,INSD:AV806050.1,INSD:EH855476.1,
FT                   INSD:EH971198.1,INSD:EL241589.1,INSD:EL144528.1,
FT                   INSD:EL003210.1,INSD:EL000594.1,INSD:EH895454.1,
FT                   INSD:BP794005.1,INSD:AV808458.1,INSD:EH834291.1,
FT                   INSD:BP659567.1,INSD:EL257393.1,INSD:EG508021.1,
FT                   INSD:AV793822.1,INSD:EL049279.1,INSD:EL210775.1,
FT                   INSD:AV812794.1,INSD:DR357043.1,INSD:DR357179.1,
FT                   INSD:EL215069.1,INSD:BP663903.1,INSD:EL096196.1,
FT                   INSD:BP632855.1,INSD:BP838465.1,INSD:EL147875.1,
FT                   INSD:EL163730.1,INSD:EL319829.1,INSD:ES176951.1,
FT                   INSD:EL220044.1,INSD:AV562418.1,INSD:BP827537.1,
FT                   INSD:EL176309.1,INSD:AV809595.1,INSD:EL000765.1,
FT                   INSD:BP650640.1,INSD:BP844470.1,INSD:EL301915.1,
FT                   INSD:EL069484.1,INSD:ES101368.1,INSD:N64928.1,
FT                   INSD:EL243265.1,INSD:EL333012.1,INSD:DR357147.1,
FT                   INSD:EL035942.1,INSD:BP660287.1,INSD:EL114622.1,
FT                   INSD:EL319750.1,INSD:EH977873.1,INSD:EH919530.1,
FT                   INSD:EH960339.1,INSD:BP606705.1,INSD:EL062931.1,
FT                   INSD:BP649780.1,INSD:ES178696.1,INSD:EH797657.1,
FT                   INSD:EL125516.1,INSD:EL079777.1,INSD:BP637066.1,
FT                   INSD:BP664827.1,INSD:BP595966.1,INSD:EL091996.1,
FT                   INSD:EL020097.1,INSD:BP594061.1,INSD:EL110915.1,
FT                   INSD:EL190191.1,INSD:EL294371.1,INSD:BU636532.1,
FT                   INSD:EL309039.1,INSD:EL254345.1,INSD:EH967994.1,
FT                   INSD:EL328838.1,INSD:ES033185.1,INSD:AV527227.1,
FT                   INSD:BP861446.1,INSD:BP834023.1,INSD:EL292063.1,
FT                   INSD:BP789009.1,INSD:AV805210.1,INSD:AV826123.1,
FT                   INSD:T20873.1,INSD:EL307465.1,INSD:EH876531.1,
FT                   INSD:EL323695.1,INSD:DR343128.1,INSD:BP622039.1,
FT                   INSD:AV816452.1,INSD:EL057470.1,INSD:BP622484.1,
FT                   INSD:EL081149.1,INSD:EL315157.1,INSD:EH923666.1,
FT                   INSD:AV520295.1,INSD:BP843973.1,INSD:BP847556.1,
FT                   INSD:BP859902.1,INSD:BP632269.1,INSD:DR357050.1,
FT                   INSD:CB074422.1,INSD:EG511498.1,INSD:BP638596.1,
FT                   INSD:BP634540.1,INSD:DR357097.1,INSD:DR357155.1,
FT                   INSD:DR357107.1,INSD:BP859745.1,INSD:BP820808.1,
FT                   INSD:EH990701.1,INSD:EL061664.1,INSD:EL127363.1,
FT                   INSD:EL082757.1,INSD:EL265003.1,INSD:DR357173.1,
FT                   INSD:BP821746.1,INSD:EL175719.1,INSD:BP855143.1,
FT                   INSD:EH967479.1,INSD:EH877767.1,INSD:DR357201.1,
FT                   INSD:ES029346.1,INSD:DR357094.1,INSD:DR357142.1,
FT                   INSD:BP593676.1,INSD:EL155749.1,INSD:EH876262.1,
FT                   INSD:EL020735.1,INSD:BP827818.1,INSD:DR357070.1,
FT                   INSD:EL159533.1,INSD:EL295439.1,INSD:AV829497.1,
FT                   INSD:BP661144.1,INSD:BP671692.1,INSD:ES139978.1,
FT                   INSD:ES151625.1,INSD:EL034716.1,INSD:EL068236.1,
FT                   INSD:EH890868.1,INSD:EL038809.1,INSD:BP613684.1,
FT                   INSD:BP855519.1,INSD:BE039038.1,INSD:EL119431.1,
FT                   INSD:BP652411.1,INSD:DR377946.1,INSD:EL208897.1,
FT                   INSD:ES196886.1,INSD:EL101609.1,INSD:EL194365.1,
FT                   INSD:EL221718.1,INSD:DR357185.1,INSD:EL148722.1,
FT                   INSD:EH829276.1,INSD:EL303230.1,INSD:EH990888.1,
FT                   INSD:EH975185.1,INSD:EH849120.1,INSD:EL206060.1,
FT                   INSD:EL215822.1,INSD:EL310862.1,INSD:EH926665.1,
FT                   INSD:DR357212.1,INSD:CF773721.1,INSD:BP594080.1,
FT                   INSD:BP638972.1,INSD:BP822068.1,INSD:BP857001.1,
FT                   INSD:EL022921.1,INSD:BP604557.1,INSD:DR377092.1,
FT                   INSD:EL285770.1,INSD:BP621611.1,INSD:T04122.1,
FT                   INSD:DR278042.1,INSD:DR357198.1,INSD:EH977226.1,
FT                   INSD:EH806587.1,INSD:EL080159.1,INSD:EH848559.1,
FT                   INSD:EH889532.1,INSD:DR357036.1,INSD:BP653613.1,
FT                   INSD:EL251566.1,INSD:BP668269.1,INSD:DR357193.1,
FT                   INSD:BP623791.1,INSD:EL118478.1,INSD:BP588799.1,
FT                   INSD:AV526457.1,INSD:CB261299.1,INSD:ES196259.1,
FT                   INSD:EH935721.1,INSD:EL065693.1,INSD:EG511609.1,
FT                   INSD:EH927885.1,INSD:BP848798.1,INSD:BE039309.1,
FT                   INSD:EL232383.1,INSD:ES174123.1,INSD:EH892071.1,
FT                   INSD:BP585717.1,INSD:DR357058.1,INSD:EH853021.1,
FT                   INSD:ES037944.1,INSD:BP817473.1,INSD:EL011413.1,
FT                   INSD:EH899030.1,INSD:DR357206.1,INSD:DR383009.1,
FT                   INSD:AV811109.1,INSD:EL126800.1,INSD:BP668751.1,
FT                   INSD:EL189552.1,INSD:BP564777.1,INSD:EL009389.1,
FT                   INSD:BP821526.1,INSD:EG459764.1,INSD:DR357034.1,
FT                   INSD:N65918.1,INSD:EL296741.1,INSD:DR357132.1,
FT                   INSD:AV819480.1,INSD:BP851439.1,INSD:H37346.1,
FT                   INSD:EL066498.1,INSD:EH815262.1,INSD:EL196774.1,
FT                   INSD:EL114163.1,INSD:BP664198.1,INSD:EH949480.1,
FT                   INSD:DR357182.1,INSD:EL104177.1,INSD:EL090636.1,
FT                   INSD:EH944891.1,INSD:DR357093.1,INSD:EL172535.1,
FT                   INSD:EL191355.1,INSD:EL324334.1,INSD:AV785353.1,
FT                   INSD:CB261249.1,INSD:EL056559.1,INSD:BP630093.1,
FT                   INSD:H36481.1,INSD:BP632546.1,INSD:BP858762.1,
FT                   INSD:BP821142.1,INSD:EL041528.1,INSD:EL267708.1,
FT                   INSD:EL151942.1,INSD:EL080025.1,INSD:EH825224.1,
FT                   INSD:BP626607.1,INSD:EH924906.1,INSD:EH795978.1,
FT                   INSD:BP787172.1,INSD:DR357061.1,INSD:EG494919.1,
FT                   INSD:BP867590.1,INSD:AV796738.1,INSD:DR357067.1,
FT                   INSD:EL205031.1,INSD:EH900776.1,INSD:AV808300.1,
FT                   INSD:EH871667.1,INSD:DR278043.1,INSD:BP597334.1,
FT                   INSD:BP664947.1,INSD:BP837533.1,INSD:EH971400.1,
FT                   INSD:DR357216.1,INSD:DR357112.1,INSD:EL028469.1,
FT                   INSD:EH932478.1,INSD:BP591159.1,INSD:BP865874.1,
FT                   INSD:EL196201.1,INSD:DR357218.1,INSD:AV808434.1,
FT                   INSD:DR357226.1,INSD:EL330069.1,INSD:BP663264.1,
FT                   INSD:DR357188.1,INSD:BP793489.1,INSD:DR357181.1,
FT                   INSD:AV801473.1,INSD:DR343139.1,INSD:BP841457.1,
FT                   INSD:EH943428.1,INSD:DR357146.1,INSD:EL092356.1,
FT                   INSD:EL253091.1,INSD:T44933.1,INSD:BP780317.1,
FT                   INSD:EL195273.1,INSD:DR357072.1,INSD:EL049445.1,
FT                   INSD:EL313069.1,INSD:EL201213.1,INSD:EH826752.1,
FT                   INSD:EL215972.1,INSD:CB256246.1,INSD:BP838991.1,
FT                   INSD:EH973550.1,INSD:DR357071.1,INSD:AV520046.1,
FT                   INSD:DR357017.1,INSD:EH828509.1,INSD:AV806291.1,
FT                   INSD:BP622296.1,INSD:BP655519.1,INSD:EL307695.1,
FT                   INSD:BP848666.1,INSD:EG511509.1,INSD:EH816983.1,
FT                   INSD:BP659741.1,INSD:BP865166.1,INSD:BP665846.1,
FT                   INSD:EL309547.1,INSD:CK121786.1,INSD:BP623061.1,
FT                   INSD:EH822285.1,INSD:ES057221.1,INSD:BP821094.1,
FT                   INSD:EH969942.1,INSD:EG470167.1,INSD:EH883531.1,
FT                   INSD:BP655551.1,INSD:BP663262.1,INSD:EL323031.1,
FT                   INSD:DR357152.1,INSD:BU636061.1,INSD:EL171198.1,
FT                   INSD:EL131563.1,INSD:EL274079.1,INSD:EL002540.1,
FT                   INSD:EH839650.1,INSD:DR357169.1,INSD:EL287661.1,
FT                   INSD:EG494920.1,INSD:BP594701.1,INSD:BP846605.1,
FT                   INSD:EL264280.1,INSD:EL026553.1,INSD:BP671238.1,
FT                   INSD:EG429654.1,INSD:EL133412.1,INSD:EL254956.1,
FT                   INSD:BP667049.1,INSD:EH948708.1,INSD:DR357046.1,
FT                   INSD:DR357176.1,INSD:BP588425.1,INSD:EH912440.1,
FT                   INSD:EL059166.1,INSD:EL106040.1,INSD:EL262393.1,
FT                   INSD:BP636549.1,INSD:EL336368.1,INSD:EL157061.1,
FT                   INSD:BP652610.1,INSD:BP631458.1,INSD:EH846216.1,
FT                   INSD:DR343126.1,INSD:EL051967.1,INSD:EH850946.1,
FT                   INSD:AV814564.1,INSD:BP842231.1,INSD:EL076951.1,
FT                   INSD:BP586952.1,INSD:EH803042.1,INSD:EH850008.1,
FT                   INSD:ES009672.1,INSD:DR357177.1,INSD:EH918461.1,
FT                   INSD:EH986766.1,INSD:EL025669.1,INSD:EH819768.1,
FT                   INSD:BP855567.1,INSD:BP832317.1,INSD:BP827578.1,
FT                   INSD:AV815094.1,INSD:DR357101.1,INSD:DR357161.1,
FT                   INSD:BP577326.1,INSD:BP662023.1,INSD:EL047126.1,
FT                   INSD:EL118493.1,INSD:BP654982.1,INSD:EL028110.1,
FT                   INSD:EL265606.1,INSD:EH866320.1,INSD:EL183779.1,
FT                   INSD:EL227216.1,INSD:EL160181.1,INSD:EL230942.1,
FT                   INSD:EL266951.1,INSD:EH942357.1,INSD:BP633684.1,
FT                   INSD:BP634460.1,INSD:EG508063.1,INSD:DR357126.1,
FT                   INSD:BP597860.1,INSD:EL232460.1,INSD:BP589572.1,
FT                   INSD:EH868562.1,INSD:EL279346.1,INSD:BP779490.1,
FT                   INSD:EH839892.1,INSD:DR357120.1,INSD:EH871422.1,
FT                   INSD:EL191816.1,INSD:EL118165.1,INSD:EG517110.1,
FT                   INSD:BP854619.1,INSD:EL165487.1,INSD:EL222931.1,
FT                   INSD:EL303939.1,INSD:EL079653.1,INSD:EH807855.1,
FT                   INSD:EG508061.1,INSD:BP630837.1,INSD:BP629585.1,
FT                   INSD:BE038195.1,INSD:EL171501.1,INSD:EH815491.1,
FT                   INSD:ES131879.1,INSD:EH860261.1,INSD:EH921233.1,
FT                   INSD:EG494917.1,INSD:BP670085.1,INSD:EL014988.1,
FT                   INSD:EL295088.1,INSD:N37418.1,INSD:BP659086.1,
FT                   INSD:H36407.1,INSD:EL259491.1,INSD:DR357066.1,
FT                   INSD:EH980017.1,INSD:EL193105.1,INSD:EH843952.1,
FT                   INSD:BP662659.1,INSD:EH875746.1,INSD:AV526224.1,
FT                   INSD:BP842219.1,INSD:EL196731.1,INSD:BP821988.1,
FT                   INSD:CK118113.1,INSD:BP590829.1,INSD:DR357229.1,
FT                   INSD:DR357084.1,INSD:BP862089.1,INSD:BP846317.1,
FT                   INSD:EL323766.1,INSD:BE524524.1,INSD:BP828468.1,
FT                   INSD:EH976368.1,INSD:EL112765.1,INSD:EL124918.1,
FT                   INSD:BP628529.1,INSD:BP837367.1,INSD:EL016465.1,
FT                   INSD:EH855441.1,INSD:BP603554.1,INSD:EH934020.1,
FT                   INSD:EG517118.1,INSD:EL287303.1,INSD:EL139915.1,
FT                   INSD:DR382648.1,INSD:BP670169.1,INSD:EL185543.1,
FT                   INSD:DR357210.1,INSD:EL143880.1,INSD:EH974069.1,
FT                   INSD:EL227716.1,INSD:EH836323.1,INSD:EH850690.1,
FT                   INSD:EH967930.1,INSD:BP647635.1,INSD:EL017441.1,
FT                   INSD:EH980365.1,INSD:BP647043.1,INSD:DR357059.1,
FT                   INSD:EL228901.1,INSD:DR357102.1,INSD:EL090401.1,
FT                   INSD:EH836005.1,INSD:EH984676.1,INSD:BP668139.1,
FT                   INSD:N65210.1,INSD:EH874613.1,INSD:BP633986.1,
FT                   INSD:CB262702.1,INSD:EL045573.1,INSD:BP811591.1,
FT                   INSD:EL077373.1,INSD:DR357018.1,INSD:BP856432.1,
FT                   INSD:EL286069.1,INSD:BP832272.1,INSD:EL003262.1,
FT                   INSD:EL041902.1,INSD:EL187032.1,INSD:BP852119.1,
FT                   INSD:EH958666.1,INSD:EH802396.1,INSD:EL003098.1,
FT                   INSD:EH944773.1,INSD:EL082512.1,INSD:BP669682.1,
FT                   INSD:EH941880.1,INSD:EL124304.1,INSD:DR357092.1,
FT                   INSD:DR357052.1,INSD:EH815773.1,INSD:EH812018.1,
FT                   INSD:DR357237.1,INSD:EL140638.1,INSD:EH840731.1,
FT                   INSD:BP590237.1,INSD:DR357186.1,INSD:EL147345.1,
FT                   INSD:EL015345.1,INSD:DR357141.1,INSD:EH989292.1,
FT                   INSD:DR357118.1,INSD:AV826663.1,INSD:BP823744.1,
FT                   INSD:EL114343.1,INSD:EH863519.1,INSD:BP660641.1,
FT                   INSD:T44266.1,INSD:BE039282.1,INSD:DR357183.1,
FT                   INSD:EH994732.1,INSD:DR357091.1,INSD:BP866327.1,
FT                   INSD:BP788468.1,INSD:EL284388.1,INSD:EL096578.1,
FT                   INSD:EL005452.1,INSD:EL293602.1,INSD:BP636026.1,
FT                   INSD:CB262452.1,INSD:BP623911.1,INSD:BP840149.1,
FT                   INSD:EL118431.1,INSD:EH856000.1,INSD:EH882273.1,
FT                   INSD:DR240099.1,INSD:BP863723.1,INSD:BP651147.1,
FT                   INSD:BP637198.1,INSD:DR343137.1,INSD:BP634561.1,
FT                   INSD:DR357025.1,INSD:R29802.1,INSD:BP841925.1,
FT                   INSD:EH929795.1,INSD:BP866700.1,INSD:EH899125.1,
FT                   INSD:BP839040.1,INSD:EL221749.1,INSD:EH933474.1,
FT                   INSD:EL289412.1,INSD:EH890101.1,INSD:BP853407.1,
FT                   INSD:BP596281.1,INSD:EH909300.1,INSD:DR357087.1,
FT                   INSD:DR357119.1,INSD:EH805793.1,INSD:EG480219.1,
FT                   INSD:EL008037.1,INSD:BP868156.1,INSD:EL064183.1,
FT                   INSD:EH815873.1,INSD:BP586521.1,INSD:EL029811.1,
FT                   INSD:EL233982.1,INSD:EL203195.1,INSD:EL281704.1,
FT                   INSD:BP808831.2,INSD:T42382.1,INSD:EL243169.1,
FT                   INSD:BP829082.1,INSD:DR357116.1,INSD:BP843832.1,
FT                   INSD:EL165342.1,INSD:EL240923.1,INSD:BP827545.1,
FT                   INSD:BP859450.1,INSD:BP859265.1,INSD:BP589528.1,
FT                   INSD:BP629450.1,INSD:BP657297.1,INSD:EL241477.1,
FT                   INSD:EL060527.1,INSD:EL231088.1,INSD:EL035782.1,
FT                   INSD:EL191278.1,INSD:H36385.1,INSD:EL026724.1,
FT                   INSD:EH940864.1,INSD:EH930018.1,INSD:EL166169.1,
FT                   INSD:EH853661.1,INSD:DR357068.1,INSD:EH800845.1,
FT                   INSD:EL243537.1,INSD:BP632374.1,INSD:EH813603.1,
FT                   INSD:EL025297.1,INSD:EL199792.1,INSD:BP656952.1,
FT                   INSD:ES164327.1,INSD:EH994580.1,INSD:EL137879.1,
FT                   INSD:EH898665.1,INSD:BP867026.1,INSD:DR343133.1,
FT                   INSD:AV812444.1,INSD:DR357100.1,INSD:BP792760.1,
FT                   INSD:EL240598.1,INSD:EH864434.1,INSD:DR357024.1,
FT                   INSD:EH858076.1,INSD:DR357138.1,INSD:EH961257.1,
FT                   INSD:DR357165.1,INSD:CK120611.1,INSD:DR357053.1,
FT                   INSD:DR357225.1,INSD:CB256892.1,INSD:EL190998.1,
FT                   INSD:EH922102.1,INSD:EL310476.1,INSD:BP816988.1,
FT                   INSD:DR229173.1,INSD:CK117842.1,INSD:BP591101.1,
FT                   INSD:DR378068.1,INSD:AV520771.1,INSD:BP779645.1,
FT                   INSD:EL071077.1,INSD:EH825282.1,INSD:EH845770.1,
FT                   INSD:EG459762.1,INSD:T46200.1,INSD:BP641691.1,
FT                   INSD:DR357063.1,INSD:DR357227.1,INSD:EL297504.1,
FT                   INSD:BP863109.1,INSD:EH870512.1,INSD:EG511631.1,
FT                   INSD:BP599488.1,INSD:EL171385.1,INSD:EL239594.1,
FT                   INSD:DR357125.1,INSD:BP843162.1,INSD:EL192081.1,
FT                   INSD:DR357069.1,INSD:EL296892.1,INSD:BE038444.1,
FT                   INSD:EL097202.1,INSD:EH815674.1,INSD:DR357115.1,
FT                   INSD:CB256709.1,INSD:EL000654.1,INSD:DR343140.1,
FT                   INSD:EH812211.1,INSD:EH972317.1,INSD:EL294120.1,
FT                   INSD:EH961369.1,INSD:EL285151.1,INSD:CD532555.1,
FT                   INSD:BP864918.1,INSD:BP851691.1,INSD:BP847134.1,
FT                   INSD:EH939885.1,INSD:DR343142.1,INSD:BP592632.1,
FT                   INSD:DR357222.1,INSD:EL334335.1,INSD:ES210012.1,
FT                   INSD:EG492120.1,INSD:EL316498.1,INSD:EH820842.1,
FT                   INSD:BP785994.1,INSD:CK120634.1,INSD:BP643215.1,
FT                   INSD:EL160308.1,INSD:DR357236.1,INSD:DR357033.1,
FT                   INSD:EL261133.1,INSD:ES100454.1,INSD:ES192059.1,
FT                   INSD:EL277251.1,INSD:BP588656.1,INSD:EL089952.1,
FT                   INSD:EH868987.1,INSD:EL243648.1,INSD:EG425023.1,
FT                   INSD:DR357199.1,INSD:EH946665.1,INSD:DR343132.1,
FT                   INSD:EL235619.1,INSD:EH827439.1,INSD:EH919340.1,
FT                   INSD:AV801971.1,INSD:EL124659.1,INSD:BP811964.1,
FT                   INSD:EH934561.1,INSD:EL043564.1,INSD:R84003.1,
FT                   INSD:BP832157.1,INSD:BP599377.1,INSD:EL051754.1,
FT                   INSD:EH824818.1,INSD:BP864620.1,INSD:EL249003.1,
FT                   INSD:EL293645.1,INSD:BP635785.1,INSD:EH879261.1,
FT                   INSD:DR357045.1,INSD:EL007654.1,INSD:BP827109.1,
FT                   INSD:BP829515.1,INSD:AV808304.1,INSD:EL193862.1,
FT                   INSD:DR357150.1,INSD:EL093410.1,INSD:BP811806.1,
FT                   INSD:DR357154.1,INSD:BP647169.1,INSD:EL248407.1,
FT                   INSD:DR357108.1,INSD:BP605003.1,INSD:EH863021.1,
FT                   INSD:DR357085.1,INSD:EL281988.1,INSD:EL273789.1,
FT                   INSD:EH976781.1,INSD:EH881388.1,INSD:EL332769.1,
FT                   INSD:BP664310.1,INSD:EH956295.1,INSD:BP586058.1,
FT                   INSD:DR357234.1,INSD:DR357242.1,INSD:BP654169.1,
FT                   INSD:EL194057.1,INSD:EL291279.1,INSD:DR357030.1,
FT                   INSD:EL193618.1,INSD:EL296990.1,INSD:EL309559.1,
FT                   INSD:EL333157.1,INSD:N37528.1,INSD:EL334412.1,
FT                   INSD:EL106913.1,INSD:ES021135.1,INSD:DR357219.1,
FT                   INSD:EH840006.1,INSD:EL265420.1,INSD:BP866111.1,
FT                   INSD:EH969235.1,INSD:EH928103.1,INSD:DR357151.1,
FT                   INSD:BP857947.1,INSD:ES165411.1,INSD:AA585784.1,
FT                   INSD:EL231986.1,INSD:EL315143.1,INSD:BP824687.1,
FT                   INSD:EH880670.1,INSD:EL203966.1,INSD:EL179955.1,
FT                   INSD:DR357166.1,INSD:EL069412.1,INSD:EL292900.1,
FT                   INSD:BP664809.1,INSD:AV800963.1,INSD:BP603390.1,
FT                   INSD:EL115100.1,INSD:AV814062.1,INSD:BP593519.1,
FT                   INSD:AV526119.1,INSD:EG444739.1,INSD:T14037.1,
FT                   INSD:EH810400.1,INSD:BP833682.1,INSD:BP663586.1,
FT                   INSD:BP854178.1,INSD:BP823304.1,INSD:EL280166.1,
FT                   INSD:BP651662.1,INSD:AV813935.1,INSD:EL023013.1,
FT                   INSD:CK120940.1,INSD:EL219731.1,INSD:DR357082.1,
FT                   INSD:AV789796.1,INSD:EH868676.1,INSD:EH938251.1,
FT                   INSD:EH938709.1,INSD:BP596630.1,INSD:AV818267.1,
FT                   INSD:BP587451.1,INSD:EH891977.1,INSD:BP639999.1,
FT                   INSD:DR357239.1,INSD:AV792686.1,INSD:EL201625.1,
FT                   INSD:BP597164.1,INSD:BP672084.1,INSD:DR357157.1,
FT                   INSD:EL095590.1,INSD:EL039920.1,INSD:BP860172.1,
FT                   INSD:EH870827.1,INSD:BP658429.1,INSD:EH944358.1,
FT                   INSD:EL203211.1,INSD:EL144036.1,INSD:EL133231.1,
FT                   INSD:BP861972.1,INSD:BP646835.1,INSD:EL030447.1,
FT                   INSD:EL176073.1,INSD:EH800546.1,INSD:EL286805.1,
FT                   INSD:BP663271.1,INSD:DR357105.1,INSD:EL294244.1,
FT                   INSD:BP799917.1,INSD:EL064628.1,INSD:BP642134.1,
FT                   INSD:EL139420.1,INSD:EL258123.1,INSD:AV522267.1,
FT                   INSD:EH914291.1,INSD:EL270612.1,INSD:DR357158.1,
FT                   INSD:EL172844.1,INSD:EL159009.1,INSD:EL279612.1,
FT                   INSD:DR357011.1,INSD:DR357014.1,INSD:DR357029.1,
FT                   INSD:CD532937.1,INSD:BP644879.1,INSD:EL134735.1,
FT                   INSD:BP842083.1,INSD:EH868817.1,INSD:EL191760.1,
FT                   INSD:DR357062.1,INSD:BP816933.1,INSD:EH903727.1,
FT                   INSD:BP832450.1,INSD:BP664810.1,INSD:BP657126.1,
FT                   INSD:EL211509.1,INSD:BP569654.1,INSD:BP789671.1,
FT                   INSD:EL280512.1,INSD:CK118162.1,INSD:BP625643.1,
FT                   INSD:EL161716.1,INSD:EL171126.1,INSD:EL142385.1,
FT                   INSD:DR357110.1,INSD:DR357039.1,INSD:EL195372.1,
FT                   INSD:DR357217.1,INSD:EL298576.1,INSD:ES063201.1,
FT                   INSD:EL033175.1,INSD:EH849531.1,INSD:EH930904.1,
FT                   INSD:EL300727.1,INSD:BP648034.1,INSD:BP646649.1,
FT                   INSD:EL031464.1,INSD:EL221444.1,INSD:DR357134.1,
FT                   INSD:EH884868.1,INSD:BP590454.1,INSD:EL305441.1,
FT                   INSD:BP866213.1,INSD:EL008990.1,INSD:EH870586.1,
FT                   INSD:EL086921.1,INSD:CK119381.1,INSD:EH994793.1,
FT                   INSD:EH825592.1,INSD:EL083795.1,INSD:EL094392.1,
FT                   INSD:EL042051.1,INSD:EL333754.1,INSD:EL091678.1,
FT                   INSD:BP594632.1,INSD:BP859633.1,INSD:BP846321.1,
FT                   INSD:EH864894.1,INSD:BP636313.1,INSD:EH905745.1,
FT                   INSD:EH839383.1,INSD:EH995038.1,INSD:DR357238.1,
FT                   INSD:EL127953.1,INSD:BP840099.1,INSD:H36110.1,
FT                   INSD:EH962339.1,INSD:EL061484.1,INSD:BP845346.1,
FT                   INSD:EG477848.1,INSD:DR357211.1,INSD:BP849400.1,
FT                   INSD:EL135535.1,INSD:EG449932.1,INSD:EL235144.1,
FT                   INSD:EL148514.1,INSD:EL244886.1,INSD:DR357189.1,
FT                   INSD:EL118388.1,INSD:CA781523.1,INSD:BP656895.1,
FT                   INSD:EL062662.1,INSD:BP861786.1,INSD:EH861846.1,
FT                   INSD:EL178672.1,INSD:AJ609316.1,INSD:BP866826.1,
FT                   INSD:EL113375.1,INSD:EL304859.1,INSD:BP650865.1,
FT                   INSD:BP788705.1,INSD:BP843171.1,INSD:DR357041.1,
FT                   INSD:EL193055.1,INSD:EH853732.1,INSD:EL054177.1,
FT                   INSD:BP650802.1,INSD:EL051388.1,INSD:AV532327.1,
FT                   INSD:BP865471.1,INSD:DR357214.1,INSD:BP787784.1,
FT                   INSD:BP846008.1,INSD:EH990576.1,INSD:EL098288.1,
FT                   INSD:EL159525.1,INSD:EL148704.1,INSD:BP857486.1,
FT                   INSD:EL111191.1,INSD:EH841853.1,INSD:BP864826.1,
FT                   INSD:EL022632.1,INSD:BP599535.1,INSD:EL144751.1,
FT                   INSD:DR240104.1,INSD:EH965254.1,INSD:EL223583.1,
FT                   INSD:EL114773.1,INSD:EL005454.1,INSD:EL240465.1,
FT                   INSD:EH937126.1,INSD:EL195686.1,INSD:AV531200.1,
FT                   INSD:BP842306.1,INSD:BP593595.1,INSD:BP805432.1,
FT                   INSD:EL213939.1,INSD:ES194932.1,INSD:DR357223.1,
FT                   INSD:BP860188.1,INSD:BP655327.1,INSD:BP666616.1,
FT                   INSD:BP596581.1,INSD:AV560376.1,INSD:BP596818.1,
FT                   INSD:R64920.1,INSD:EH833977.1,INSD:EL195141.1,
FT                   INSD:EH982969.1,INSD:DR357077.1,INSD:EL229083.1,
FT                   INSD:EL290274.1,INSD:DR357160.1,INSD:BP650909.1,
FT                   INSD:CB260112.1,INSD:BP815366.1,INSD:EL027455.1,
FT                   INSD:EH842254.1,INSD:EL166906.1,INSD:EH943274.1,
FT                   INSD:EL324998.1,INSD:DR357194.1,INSD:BP631359.1,
FT                   INSD:EH912262.1,INSD:AV797293.1,INSD:EH984169.1,
FT                   INSD:DR357232.1,INSD:EH801628.1,INSD:EG508067.1,
FT                   INSD:EH929075.1,INSD:EH838281.1,INSD:EL055678.1,
FT                   INSD:EL286141.1,INSD:AV786134.1,INSD:BP830071.1,
FT                   INSD:EL126922.1,INSD:EH811692.1,INSD:EL139408.1,
FT                   INSD:BP823510.1,INSD:EH885934.1,INSD:EL211071.1,
FT                   INSD:DR343141.1,INSD:EL158537.1,INSD:BP827138.1,
FT                   INSD:BP671725.1,INSD:EL263907.1,INSD:EL168191.1,
FT                   INSD:EL065691.1,INSD:EL133175.1,INSD:DR242931.1,
FT                   INSD:BP573011.1,INSD:DR357144.1,INSD:EL272428.1,
FT                   INSD:AV810824.1,INSD:EL003157.1,INSD:N38188.1,
FT                   INSD:EL333965.1,INSD:EL320936.1,INSD:AV527220.1,
FT                   INSD:EH955507.1,INSD:BP594229.1,INSD:EL333973.1,
FT                   INSD:DR357228.1,INSD:EG425022.1,INSD:EH902497.1,
FT                   INSD:BP569089.1,INSD:BE038221.1,INSD:EL297165.1,
FT                   INSD:EL289299.1,INSD:EL044658.1,INSD:EH979021.1,
FT                   INSD:EL283275.1,INSD:BP840186.1,INSD:EL174922.1,
FT                   INSD:EL012276.1,INSD:EL106921.1,INSD:EH983548.1,
FT                   INSD:AV811524.1,INSD:AV826157.1,INSD:BP853691.1,
FT                   INSD:EL111088.1,INSD:EH867993.1,INSD:EL249924.1,
FT                   INSD:BP821057.1,INSD:BP795725.1,INSD:AV815910.1,
FT                   INSD:BP842049.1,INSD:EL305734.1,INSD:EL315794.1,
FT                   INSD:EL156278.1,INSD:DR357090.1,INSD:EL169126.1,
FT                   INSD:EG508066.1,INSD:EH961624.1,INSD:DR357139.1,
FT                   INSD:BP589453.1,INSD:EL253703.1,INSD:BP837926.1,
FT                   INSD:ES108377.1,INSD:CD532322.1,INSD:EL140199.1,
FT                   INSD:EL194324.1,INSD:BP819030.1,INSD:EL244777.1,
FT                   INSD:ES065746.1,INSD:EL145221.1,INSD:DR357032.1,
FT                   INSD:EL329912.1,INSD:EL296454.1,INSD:DR357128.1,
FT                   INSD:EL249624.1,INSD:EH883351.1,INSD:DR357167.1,
FT                   INSD:EH920992.1,INSD:BP822558.1,INSD:EL136232.1,
FT                   INSD:AV520768.1,INSD:ES209475.1,INSD:AA651551.1,
FT                   INSD:BP662496.1,INSD:BP817991.1,INSD:EH990905.1,
FT                   INSD:ES140242.1,INSD:BP624726.1,INSD:EH937762.1,
FT                   INSD:AV807150.1,INSD:BP816326.1,INSD:AV534848.1,
FT                   INSD:BP787265.1,INSD:EH955128.1,INSD:EL203698.1,
FT                   INSD:EL314204.1,INSD:BP626659.1,INSD:BP624144.1,
FT                   INSD:EL017011.1,INSD:EG429646.1,INSD:DR357079.1,
FT                   INSD:EL240960.1,INSD:EH871009.1,INSD:BP824653.1,
FT                   INSD:DR357204.1,INSD:EL066301.1,INSD:BP612319.1,
FT                   INSD:T21875.1,INSD:DR357023.1,INSD:EL194623.1,
FT                   INSD:EL294603.1,INSD:EH902956.1,INSD:EL306709.1,
FT                   INSD:BP818996.1,INSD:CB259610.1,INSD:EL113649.1,
FT                   INSD:EH930696.1,INSD:EL073782.1,INSD:EL973152.1,
FT                   INSD:BP641761.1,INSD:BP861887.1,INSD:BP628355.1,
FT                   INSD:ES073440.1,INSD:ES134284.1,INSD:EH844142.1,
FT                   INSD:EL184052.1,INSD:R84031.1,INSD:BP593160.1,
FT                   INSD:EL019464.1,INSD:EL328907.1,INSD:DR357153.1,
FT                   INSD:EL163584.1,INSD:DR357191.1,INSD:EL094540.1,
FT                   INSD:EL012657.1,INSD:EL003372.1,INSD:BP818372.1,
FT                   INSD:EL116927.1,INSD:EL253990.1,INSD:EL034756.1,
FT                   INSD:BP860710.1,INSD:EL112451.1,INSD:EL292955.1,
FT                   INSD:EH943511.1,INSD:AV803386.1,INSD:EL150952.1,
FT                   INSD:BP852873.1,INSD:EH799321.1,INSD:EL059248.1,
FT                   INSD:EL005639.1,INSD:DR357159.1,INSD:EL294541.1,
FT                   INSD:EL075427.1,INSD:BP633294.1,INSD:EL194983.1,
FT                   INSD:DR357172.1,INSD:CD533417.1,INSD:DR357028.1,
FT                   INSD:DR357047.1,INSD:EH801890.1,INSD:DR357037.1,
FT                   INSD:EG517120.1,INSD:EL153169.1,INSD:ES111374.1,
FT                   INSD:EH806046.1,INSD:ES060705.1,INSD:AV787222.1,
FT                   INSD:BP627890.1,INSD:DR357020.1,INSD:EL239261.1,
FT                   INSD:EL205475.1,INSD:EH946766.1,INSD:EH959418.1,
FT                   INSD:BP646448.1,INSD:EL020559.1,INSD:EL258128.1,
FT                   INSD:EL312271.1,INSD:BP846021.1,INSD:EL215561.1,
FT                   INSD:BP647963.1,INSD:DR357164.1,INSD:EH932591.1,
FT                   INSD:EL080313.1,INSD:BP669425.1,INSD:EH833806.1,
FT                   INSD:EG508045.1,INSD:EL166965.1,INSD:EL078051.1,
FT                   INSD:DR357103.1,INSD:BP628243.1,INSD:AV535366.1,
FT                   INSD:EH814556.1,INSD:EH874080.1,INSD:DR357143.1,
FT                   INSD:T46738.1,INSD:BP592586.1,INSD:BP835640.1,
FT                   INSD:EH892626.1,INSD:EL206855.1,INSD:EH799300.1,
FT                   INSD:EL341039.1,INSD:BP566602.1,INSD:EL338134.1,
FT                   INSD:BP839791.1,INSD:ES151241.1,INSD:DR357054.1,
FT                   INSD:EH896843.1,INSD:DR357015.1,INSD:EH898057.1,
FT                   INSD:EL267411.1,INSD:EL307990.1,INSD:EH942539.1,
FT                   INSD:EL305930.1,INSD:BP816893.1,INSD:EL230800.1,
FT                   INSD:BP657513.1,INSD:BP860208.1,INSD:EL170182.1,
FT                   INSD:EL055123.1,INSD:EH835949.1,INSD:EH930702.1,
FT                   INSD:AV796005.1,INSD:BP829184.1,INSD:EL068012.1,
FT                   INSD:EH858467.1,INSD:EH935105.1,INSD:EL302934.1,
FT                   INSD:AV813160.1,INSD:BP638777.1,INSD:DR357203.1,
FT                   INSD:BP793406.1,INSD:DR357190.1,INSD:EL286036.1,
FT                   INSD:DR357163.1,INSD:EL012258.1,INSD:EL081443.1,
FT                   INSD:AV812517.1,INSD:EL297718.1,INSD:EL119737.1,
FT                   INSD:EL114952.1,INSD:EH909396.1,INSD:EH913808.1,
FT                   INSD:EL325790.1,INSD:EH976645.1,INSD:DR357207.1,
FT                   INSD:BP842184.1,INSD:EL106261.1,INSD:BP858753.1,
FT                   INSD:EL153181.1,INSD:EL260720.1,INSD:DR240105.1,
FT                   INSD:EL104626.1,INSD:EH907059.1,INSD:EL054869.1,
FT                   INSD:EH893339.1,INSD:EL277863.1,INSD:BP659097.1,
FT                   INSD:EL257998.1,INSD:ES156621.1,INSD:BP849361.1,
FT                   INSD:EL170138.1,INSD:BP815611.1,INSD:EL258189.1,
FT                   INSD:BP636830.1,INSD:BP655517.1,INSD:BP864389.1,
FT                   INSD:EL130037.1,INSD:DR357051.1,INSD:EL268391.1,
FT                   INSD:EL097233.1,INSD:EL305294.1,INSD:EL179028.1,
FT                   INSD:DR357162.1,INSD:EL142412.1,INSD:EH945270.1,
FT                   INSD:EH879331.1,INSD:EL230488.1,INSD:BP836512.1,
FT                   INSD:DR357044.1,INSD:EH958830.1,INSD:BP596810.1,
FT                   INSD:BP836830.1,INSD:EH943221.1,INSD:EH859365.1,
FT                   INSD:EL229381.1,INSD:EH833945.1,INSD:EH815875.1,
FT                   INSD:AV793652.1,INSD:EL318559.1,INSD:BP636844.1,
FT                   INSD:EL315103.1,INSD:BP840282.1,INSD:EL167633.1,
FT                   INSD:DR357148.1,INSD:EL007310.1,INSD:DR357178.1,
FT                   INSD:BP669252.1,INSD:EL206289.1,INSD:DR357135.1,
FT                   INSD:EH847687.1,INSD:EL206300.1,INSD:EL286602.1,
FT                   INSD:DR357042.1,INSD:EL195229.1,INSD:BP596459.1,
FT                   INSD:EL063646.1,INSD:EL232683.1,INSD:EL143802.1,
FT                   INSD:BP634606.1,INSD:AV813877.1,INSD:EL289335.1,
FT                   INSD:BP659725.1,INSD:BP589647.1,INSD:DR357065.1,
FT                   INSD:EH878239.1,INSD:EH885334.1,INSD:CB256894.1,
FT                   INSD:DR357241.1,INSD:EL251608.1,INSD:CB264668.1,
FT                   INSD:EL222640.1,INSD:EH892880.1,INSD:EL329511.1,
FT                   INSD:BP834251.1,INSD:EL321975.1,INSD:BP650073.1,
FT                   INSD:BP634583.1,INSD:DR357175.1,INSD:EL157834.1,
FT                   INSD:EL017078.1,INSD:EL156502.1,INSD:EH933565.1,
FT                   INSD:DR357224.1,INSD:BP829095.1,INSD:EH917658.1,
FT                   INSD:BP637661.1,INSD:BP652114.1,INSD:T45112.1,
FT                   INSD:DR357114.1,INSD:DR357122.1,INSD:BP820878.1,
FT                   INSD:DR357078.1,INSD:BP863148.1,INSD:EH943377.1,
FT                   INSD:EH821181.1,INSD:EH917277.1,INSD:EL097259.1,
FT                   INSD:BP594043.1,INSD:EL055967.1,INSD:EL117470.1,
FT                   INSD:BP596207.1,INSD:BP820102.1,INSD:BP663503.1,
FT                   INSD:EH928853.1,INSD:EL206478.1,INSD:EL035278.1,
FT                   INSD:H77106.1,INSD:CK118066.1,INSD:EL113188.1,
FT                   INSD:EL015550.1,INSD:DR357149.1,INSD:BP781242.1,
FT                   INSD:EL088605.1,INSD:EL128705.1,INSD:EH968509.1,
FT                   INSD:DR357019.1,INSD:BP628086.1,INSD:BP842063.2,
FT                   INSD:BP588100.1,INSD:EH905796.1,INSD:EL311101.1,
FT                   INSD:EL035979.1,INSD:AV807609.1,INSD:DR357168.1,
FT                   INSD:EH946403.1,INSD:EL040552.1,INSD:DR357109.1,
FT                   INSD:EH899750.1,INSD:ES050660.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY092980.1,INSD:BX831442.1,INSD:BX830685.1,
FT                   INSD:BX841630.1,INSD:AY059861.1,INSD:AY133566.1,
FT                   INSD:AK221043.1,INSD:AY081680.1,INSD:BT000363.1,
FT                   INSD:BX831299.1,INSD:BX831064.1,INSD:BX833597.1,
FT                   INSD:BX830573.1,INSD:BX830905.1,INSD:BX830127.1,
FT                   INSD:AY048262.1,INSD:AY048300.1,INSD:AK226459.1,
FT                   INSD:AY057641.1,INSD:AF370474.1"
FT   CDS_pept        join(209084..209593,209881..210243)
FT                   /codon_start=1
FT                   /gene="LHCB4.1"
FT                   /gene_synonym="F7A7.50"
FT                   /gene_synonym="F7A7_50"
FT                   /gene_synonym="light harvesting complex photosystem II"
FT                   /locus_tag="AT5G01530"
FT                   /product="light harvesting complex photosystem II"
FT                   /note="light harvesting complex photosystem II (LHCB4.1);
FT                   FUNCTIONS IN: chlorophyll binding; INVOLVED IN: response to
FT                   blue light, response to red light, response to far red
FT                   light, photosynthesis; LOCATED IN: in 6 components;
FT                   EXPRESSED IN: 27 plant structures; EXPRESSED DURING: 14
FT                   growth stages; CONTAINS InterPro DOMAIN/s: Chlorophyll A-B
FT                   binding protein (InterPro:IPR001344); BEST Arabidopsis
FT                   thaliana protein match is: light harvesting complex
FT                   photosystem II (TAIR:AT3G08940.2); Has 1807 Blast hits to
FT                   1807 proteins in 277 species: Archae - 0; Bacteria - 0;
FT                   Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
FT                   Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q07473"
FT                   /db_xref="InterPro:IPR001344"
FT                   /db_xref="InterPro:IPR022796"
FT                   /db_xref="InterPro:IPR023329"
FT                   /db_xref="PDB:5MDX"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q07473"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR377123.1,INSD:BP585695.1,INSD:DR242932.1,
FT                   INSD:BP795507.1,INSD:EL257427.1,INSD:EL179591.1,
FT                   INSD:BP667825.1,INSD:DR357137.1,INSD:DR357140.1,
FT                   INSD:EL097468.1,INSD:EL167333.1,INSD:BP837253.1,
FT                   INSD:CK119949.1,INSD:ES112811.1,INSD:EH860860.1,
FT                   INSD:EL149894.1,INSD:DR357171.1,INSD:BP633887.1,
FT                   INSD:EL163162.1,INSD:EH930459.1,INSD:DR357220.1,
FT                   INSD:EH916457.1,INSD:EH944811.1,INSD:EH928321.1,
FT                   INSD:EL286271.1,INSD:DR343138.1,INSD:EL183829.1,
FT                   INSD:T42932.1,INSD:BP658170.1,INSD:EL258304.1,
FT                   INSD:EH948373.1,INSD:EH913629.1,INSD:EL123537.1,
FT                   INSD:EL275160.1,INSD:BU635206.1,INSD:BP643416.1,
FT                   INSD:EH904324.1,INSD:EH931234.1,INSD:EH941269.1,
FT                   INSD:DR357022.1,INSD:BP619988.1,INSD:EL280767.1,
FT                   INSD:EL022738.1,INSD:BP844607.1,INSD:EH815098.1,
FT                   INSD:CK121044.1,INSD:BP641319.1,INSD:EL241258.1,
FT                   INSD:EL150011.1,INSD:EH930986.1,INSD:CK119394.1,
FT                   INSD:BP632607.1,INSD:EH917051.1,INSD:EH929317.1,
FT                   INSD:CD531890.1,INSD:DR240100.1,INSD:EH921612.1,
FT                   INSD:EL315250.1,INSD:BP818049.1,INSD:EL297424.1,
FT                   INSD:DR357111.1,INSD:EL037530.1,INSD:EL107446.1,
FT                   INSD:EL220510.1,INSD:BP632551.1,INSD:EL972681.1,
FT                   INSD:EH872584.1,INSD:BP607256.1,INSD:EL084703.1,
FT                   INSD:EL112033.1,INSD:EL078116.1,INSD:BP834316.1,
FT                   INSD:EL136213.1,INSD:EH877955.1,INSD:DR357184.1,
FT                   INSD:BE039496.1,INSD:BP656592.1,INSD:EH818226.1,
FT                   INSD:R90401.1,INSD:EH851426.1,INSD:H76004.1,
FT                   INSD:EH875650.1,INSD:AV806184.1,INSD:DR357016.1,
FT                   INSD:EL213496.1,INSD:H35969.1,INSD:EL189153.1,
FT                   INSD:BP635152.1,INSD:EL092692.1,INSD:EL051710.1,
FT                   INSD:EL166886.1,INSD:BP605172.1,INSD:EL203539.1,
FT                   INSD:EL123199.1,INSD:EH910719.1,INSD:BP794774.1,
FT                   INSD:BP867370.1,INSD:EH869084.1,INSD:BP595529.1,
FT                   INSD:EL161609.1,INSD:EH934912.1,INSD:EL117084.1,
FT                   INSD:EH966973.1,INSD:EH966974.1,INSD:DR357076.1,
FT                   INSD:EL316577.1,INSD:EL341701.1,INSD:EH886063.1,
FT                   INSD:EL295087.1,INSD:EL068884.1,INSD:EL125012.1,
FT                   INSD:BP624569.1,INSD:BP862511.1,INSD:BP621962.1,
FT                   INSD:EL213666.1,INSD:BP830374.1,INSD:EL254876.1,
FT                   INSD:EH992890.1,INSD:EL022165.1,INSD:EL097970.1,
FT                   INSD:EL123340.1,INSD:DR357098.1,INSD:DR357209.1,
FT                   INSD:EL264050.1,INSD:EH943136.1,INSD:BP659901.1,
FT                   INSD:BP847292.2,INSD:EL295863.1,INSD:EL145358.1,
FT                   INSD:EL037288.1,INSD:EL070638.1,INSD:EL032322.1,
FT                   INSD:EH800708.1,INSD:EL090696.1,INSD:EL303353.1,
FT                   INSD:EL158710.1,INSD:EH968182.1,INSD:EL062701.1,
FT                   INSD:EH921384.1,INSD:EH916079.1,INSD:AA720059.1,
FT                   INSD:BP785969.1,INSD:DR357031.1,INSD:BP838475.1,
FT                   INSD:EH852341.1,INSD:DR357192.1,INSD:BP636231.1,
FT                   INSD:BP845960.1,INSD:DR357021.1,INSD:EL227934.1,
FT                   INSD:AA042757.1,INSD:DR357187.1,INSD:EL071387.1,
FT                   INSD:EH982542.1,INSD:DR357064.1,INSD:EH839800.1,
FT                   INSD:DR357200.1,INSD:EL173333.1,INSD:EH877770.1,
FT                   INSD:EH821172.1,INSD:EL075837.1,INSD:DR357136.1,
FT                   INSD:EL069797.1,INSD:EL225549.1,INSD:CK121219.1,
FT                   INSD:BP778120.1,INSD:EL194682.1,INSD:BP625789.1,
FT                   INSD:EL147664.1,INSD:EL164787.1,INSD:AV829631.1,
FT                   INSD:EH863638.1,INSD:BP829922.1,INSD:EH917765.1,
FT                   INSD:BP615857.1,INSD:EH804698.1,INSD:EH877345.1,
FT                   INSD:EL014909.1,INSD:BP636449.1,INSD:DR357123.1,
FT                   INSD:EL035873.1,INSD:EL317696.1,INSD:ES194308.1,
FT                   INSD:EL296975.1,INSD:BP631149.1,INSD:DR372990.1,
FT                   INSD:DR357075.1,INSD:EH800548.1,INSD:EL316181.1,
FT                   INSD:ES020041.1,INSD:BP666910.1,INSD:EL141298.1,
FT                   INSD:ES194486.1,INSD:DR357156.1,INSD:EH978362.1,
FT                   INSD:AV799825.1,INSD:EL196887.1,INSD:EL998556.1,
FT                   INSD:BP639129.1,INSD:DR357096.1,INSD:EH951138.1,
FT                   INSD:BP829681.1,INSD:EL243016.1,INSD:BP628535.1,
FT                   INSD:EL163522.1,INSD:EL117278.1,INSD:EL012026.1,
FT                   INSD:EH892861.1,INSD:EL198319.1,INSD:EL251402.1,
FT                   INSD:EL040972.1,INSD:BP865482.1,INSD:EL080138.1,
FT                   INSD:CK119420.1,INSD:EL102692.1,INSD:EH838167.1,
FT                   INSD:EG477846.1,INSD:EL305253.1,INSD:BP594769.1,
FT                   INSD:BP666852.1,INSD:DR357049.1,INSD:AV439815.1,
FT                   INSD:EL007929.1,INSD:EH802346.1,INSD:EH955046.1,
FT                   INSD:EL310775.1,INSD:CK120707.1,INSD:T76720.1,
FT                   INSD:EL018324.1,INSD:BP827839.1,INSD:EH968219.1,
FT                   INSD:EL255762.1,INSD:EL106057.1,INSD:EH885648.1,
FT                   INSD:ES108672.1,INSD:EH934744.1,INSD:EL240744.1,
FT                   INSD:AV814878.1,INSD:BP819366.1,INSD:BP853438.1,
FT                   INSD:AV799576.1,INSD:AV797242.1,INSD:AV818522.1,
FT                   INSD:EL280333.1,INSD:EG454412.1,INSD:EL330729.1,
FT                   INSD:EH860090.1,INSD:AV801621.1,INSD:EH991928.1,
FT                   INSD:EH901229.1,INSD:EH935380.1,INSD:EH803447.1,
FT                   INSD:BP590361.1,INSD:BP589434.1,INSD:BP862937.1,
FT                   INSD:BP846335.1,INSD:DR357133.1,INSD:EL062983.1,
FT                   INSD:EL330641.1,INSD:EL034370.1,INSD:EH900747.1,
FT                   INSD:BP829508.1,INSD:EL087898.1,INSD:EL213582.1,
FT                   INSD:AV786964.1,INSD:BP850508.1,INSD:EL169882.1,
FT                   INSD:BP662608.1,INSD:CK118461.1,INSD:BP587787.1,
FT                   INSD:EH944646.1,INSD:EL170502.1,INSD:EH819904.1,
FT                   INSD:EH835298.1,INSD:DR357099.1,INSD:DR357095.1,
FT                   INSD:EH972373.1,INSD:N37691.1,INSD:N65746.1,
FT                   INSD:EH930331.1,INSD:DR357208.1,INSD:EH913497.1,
FT                   INSD:BP658834.1,INSD:DR357055.1,INSD:EL006801.1,
FT                   INSD:EL023008.1,INSD:DR343143.1,INSD:BP628233.1,
FT                   INSD:EL979800.1,INSD:BP785241.1,INSD:EH846219.1,
FT                   INSD:DR357131.1,INSD:EL134414.1,INSD:EL039318.1,
FT                   INSD:EL221136.1,INSD:BP823173.1,INSD:EH848445.1,
FT                   INSD:EL153266.1,INSD:AV803232.1,INSD:EL091047.1,
FT                   INSD:DR357230.1,INSD:BP813163.1,INSD:EL156424.1,
FT                   INSD:EL091479.1,INSD:EL268993.1,INSD:BP643376.1,
FT                   INSD:EL291380.1,INSD:EH842122.1,INSD:EL008075.1,
FT                   INSD:EL000933.1,INSD:DR357113.1,INSD:DR357086.1,
FT                   INSD:CK119031.1,INSD:EH897674.1,INSD:EL001845.1,
FT                   INSD:BP794903.1,INSD:EG508023.1,INSD:BP670241.1,
FT                   INSD:EH815418.1,INSD:EL134428.1,INSD:EH918679.1,
FT                   INSD:BP865268.1,INSD:EL276651.1,INSD:BP628078.1,
FT                   INSD:EH848316.1,INSD:AV817980.1,INSD:BP621923.1,
FT                   INSD:ES135043.1,INSD:BP671528.1,INSD:BP822123.1,
FT                   INSD:EL074863.1,INSD:DR357127.1,INSD:DR357089.1,
FT                   INSD:EL015825.1,INSD:EH844665.1,INSD:EL271653.1,
FT                   INSD:EL132301.1,INSD:EL087535.1,INSD:EL178377.1,
FT                   INSD:EL151883.1,INSD:EH799747.1,INSD:EL239065.1,
FT                   INSD:EL064761.1,INSD:EL248720.1,INSD:ES200147.1,
FT                   INSD:DR357196.1,INSD:EH857099.1,INSD:EH895940.1,
FT                   INSD:BP563662.1,INSD:EL026769.1,INSD:BP666108.1,
FT                   INSD:EH823157.1,INSD:DR357013.1,INSD:DR357083.1,
FT                   INSD:EH865711.1,INSD:BP645258.1,INSD:BP798795.1,
FT                   INSD:EH871538.1,INSD:EH877923.1,INSD:BP856760.1,
FT                   INSD:DR357235.1,INSD:EL045081.1,INSD:EH908838.1,
FT                   INSD:BP613710.1,INSD:DR357038.1,INSD:BP663336.1,
FT                   INSD:EL239339.1,INSD:CK119083.1,INSD:BP638685.1,
FT                   INSD:EL076358.1,INSD:EL096446.1,INSD:EH831531.1,
FT                   INSD:DR343144.1,INSD:DR357124.1,INSD:EL161203.1,
FT                   INSD:EL148409.1,INSD:DR357215.1,INSD:DR357117.1,
FT                   INSD:DR357081.1,INSD:EH868983.1,INSD:EL234121.1,
FT                   INSD:EH891534.1,INSD:EL135968.1,INSD:EH811187.1,
FT                   INSD:EL041523.1,INSD:EH953963.1,INSD:DR357060.1,
FT                   INSD:BP590703.1,INSD:EL199488.1,INSD:AV806230.1,
FT                   INSD:EH927465.1,INSD:EH873186.1,INSD:EH967618.1,
FT                   INSD:DR343131.1,INSD:DR357213.1,INSD:CD529081.1,
FT                   INSD:DR240103.1,INSD:BP669223.1,INSD:AV814365.1,
FT                   INSD:EL051658.1,INSD:BP818201.1,INSD:EL267112.1,
FT                   INSD:BP646501.1,INSD:EL047430.1,INSD:DR357197.1,
FT                   INSD:EH915350.1,INSD:EL177490.1,INSD:EL970191.1,
FT                   INSD:EH917221.1,INSD:EL153269.1,INSD:EL206913.1,
FT                   INSD:DR357012.1,INSD:BP785573.1,INSD:AV808452.1,
FT                   INSD:CB261128.1,INSD:DR357104.1,INSD:BP793772.1,
FT                   INSD:R30511.1,INSD:EH929964.1,INSD:DR357073.1,
FT                   INSD:BP864780.1,INSD:EL044358.1,INSD:EL295320.1,
FT                   INSD:EL310291.1,INSD:DR357129.1,INSD:DR357057.1,
FT                   INSD:DR357010.1,INSD:EL009420.1,INSD:H76565.1,
FT                   INSD:BP860619.1,INSD:DR357035.1,INSD:EL256127.1,
FT                   INSD:DR357205.1,INSD:EL121168.1,INSD:EL306287.1,
FT                   INSD:BP642651.1,INSD:EH911665.1,INSD:BP629802.1,
FT                   INSD:EH835586.1,INSD:DR343135.1,INSD:DR357174.1,
FT                   INSD:EL326449.1,INSD:EL226797.1,INSD:BP626966.1,
FT                   INSD:EL116622.1,INSD:BP650300.1,INSD:EL286914.1,
FT                   INSD:BP666506.1,INSD:DR343129.1,INSD:BP665215.1,
FT                   INSD:BP594877.1,INSD:EH802040.1,INSD:EL199263.1,
FT                   INSD:EL095333.1,INSD:EL206441.1,INSD:AV808893.1,
FT                   INSD:EH929789.1,INSD:EL072680.1,INSD:EL109498.1,
FT                   INSD:EH852632.1,INSD:BP616797.1,INSD:BP634798.1,
FT                   INSD:BE522881.1,INSD:EL277105.1,INSD:DR343136.1,
FT                   INSD:BP792953.1,INSD:EL225255.1,INSD:DR240108.1,
FT                   INSD:EH843557.1,INSD:EL337202.1,INSD:EL283577.1,
FT                   INSD:EL184450.1,INSD:EL054384.1,INSD:EL049204.1,
FT                   INSD:EL023787.1,INSD:BP624743.1,INSD:DR357240.1,
FT                   INSD:EL233303.1,INSD:AV832129.1,INSD:AV807181.1,
FT                   INSD:EG472383.1,INSD:EL321834.1,INSD:BP665096.1,
FT                   INSD:DR357180.1,INSD:EH921637.1,INSD:BP643845.1,
FT                   INSD:EH887944.1,INSD:EL006404.1,INSD:EH825972.1,
FT                   INSD:EH975600.1,INSD:EL276094.1,INSD:EL324419.1,
FT                   INSD:H37249.1,INSD:EH825515.1,INSD:DR357231.1,
FT                   INSD:EL236616.1,INSD:BP629357.1,INSD:BP851909.1,
FT                   INSD:BP624980.1,INSD:AV540401.1,INSD:BP853793.1,
FT                   INSD:BP625495.1,INSD:BP841845.1,INSD:EH801606.1,
FT                   INSD:EL137769.1,INSD:EH825128.1,INSD:EL321525.1,
FT                   INSD:BP850639.1,INSD:EL046127.1,INSD:EH825853.1,
FT                   INSD:EL141051.1,INSD:EL081946.1,INSD:EL188071.1,
FT                   INSD:BP832636.1,INSD:EL197487.1,INSD:BP852603.1,
FT                   INSD:EL083823.1,INSD:BP662107.1,INSD:DR357233.1,
FT                   INSD:EL170629.1,INSD:EL250060.1,INSD:T76626.1,
FT                   INSD:EH938362.1,INSD:EL052875.1,INSD:DR240106.1,
FT                   INSD:BP664138.1,INSD:BP865690.1,INSD:EH943327.1,
FT                   INSD:DR357088.1,INSD:BP650473.1,INSD:BP589947.1,
FT                   INSD:EL225696.1,INSD:EL260782.1,INSD:EL208894.1,
FT                   INSD:EH924059.1,INSD:BP825411.1,INSD:AV520792.1,
FT                   INSD:AV803150.1,INSD:DR357202.1,INSD:EL112542.1,
FT                   INSD:EL311110.1,INSD:EH884389.1,INSD:BP820944.1,
FT                   INSD:BP816868.1,INSD:EL975483.1,INSD:EG508048.1,
FT                   INSD:DR343127.1,INSD:EL303070.1,INSD:T45670.1,
FT                   INSD:EH969469.1,INSD:BP667010.1,INSD:AV807570.1,
FT                   INSD:BP635553.1,INSD:CB260094.1,INSD:BP633172.1,
FT                   INSD:DR357106.1,INSD:AV788594.1,INSD:BP846133.1,
FT                   INSD:BP597298.1,INSD:EH837348.1,INSD:EH863515.1,
FT                   INSD:BP626998.1,INSD:BP829798.1,INSD:BP624025.1,
FT                   INSD:EH862281.1,INSD:EL030786.1,INSD:EH927332.1,
FT                   INSD:DR357195.1,INSD:DR357130.1,INSD:BP670973.1,
FT                   INSD:EH982206.1,INSD:ES061055.1,INSD:EH867671.1,
FT                   INSD:EL067720.1,INSD:EH903017.1,INSD:BP830906.1,
FT                   INSD:BP841821.1,INSD:EL272253.1,INSD:EL319453.1,
FT                   INSD:AV819296.1,INSD:DR357170.1,INSD:EL121539.1,
FT                   INSD:EH838851.1,INSD:AV811895.1,INSD:EH965958.1,
FT                   INSD:EL195346.1,INSD:AV799844.1,INSD:BP671307.1,
FT                   INSD:DR357027.1,INSD:BP660696.1,INSD:DR357026.1,
FT                   INSD:EL277703.1,INSD:EH952387.1,INSD:EH916890.1,
FT                   INSD:BP856167.1,INSD:EL324414.1,INSD:EH799045.1,
FT                   INSD:EL245206.1,INSD:EL146290.1,INSD:BP663189.1,
FT                   INSD:EL199364.1,INSD:EH919432.1,INSD:BP667236.1,
FT                   INSD:BP638433.1,INSD:EG492119.1,INSD:EL184443.1,
FT                   INSD:BP646470.1,INSD:EL138531.1,INSD:EL092329.1,
FT                   INSD:EL014971.1,INSD:EH874045.1,INSD:EL038525.1,
FT                   INSD:BP666688.1,INSD:T46023.1,INSD:EL011200.1,
FT                   INSD:EL295380.1,INSD:EL259976.1,INSD:EL316201.1,
FT                   INSD:BP822857.1,INSD:EL104344.1,INSD:EH799941.1,
FT                   INSD:EH941863.1,INSD:T43737.1,INSD:EL111957.1,
FT                   INSD:EH842849.1,INSD:EH982317.1,INSD:EH970676.1,
FT                   INSD:EL279944.1,INSD:BP600297.1,INSD:EL281550.1,
FT                   INSD:EL198340.1,INSD:EL242130.1,INSD:EH973733.1,
FT                   INSD:EL327834.1,INSD:EL038429.1,INSD:EH988955.1,
FT                   INSD:DR357145.1,INSD:EL265772.1,INSD:EL275784.1,
FT                   INSD:BP812498.1,INSD:BP861545.1,INSD:EL224440.1,
FT                   INSD:EL120248.1,INSD:EL162573.1,INSD:EL168384.1,
FT                   INSD:EL244420.1,INSD:BP573192.1,INSD:AV521642.1,
FT                   INSD:BP634970.1,INSD:EG517111.1,INSD:BP637958.1,
FT                   INSD:EL200619.1,INSD:BP859699.1,INSD:BP640025.1,
FT                   INSD:EH906642.1,INSD:EL330844.1,INSD:EH912763.1,
FT                   INSD:EL311727.1,INSD:EL296591.1,INSD:DR357056.1,
FT                   INSD:DR357221.1,INSD:DR357080.1,INSD:AV801394.1,
FT                   INSD:EL024868.1,INSD:BE038756.1,INSD:EH833263.1,
FT                   INSD:ES207774.1,INSD:EH940495.1,INSD:AV806528.1,
FT                   INSD:DR357121.1,INSD:EL281849.1,INSD:DR343134.1,
FT                   INSD:BP662495.1,INSD:EL244498.1,INSD:DR357074.1,
FT                   INSD:EH993882.1,INSD:AV806050.1,INSD:EH855476.1,
FT                   INSD:EH971198.1,INSD:EL241589.1,INSD:EL144528.1,
FT                   INSD:EL003210.1,INSD:EL000594.1,INSD:EH895454.1,
FT                   INSD:BP794005.1,INSD:AV808458.1,INSD:EH834291.1,
FT                   INSD:BP659567.1,INSD:EL257393.1,INSD:EG508021.1,
FT                   INSD:AV793822.1,INSD:EL049279.1,INSD:EL210775.1,
FT                   INSD:AV812794.1,INSD:DR357043.1,INSD:DR357179.1,
FT                   INSD:EL215069.1,INSD:BP663903.1,INSD:EL096196.1,
FT                   INSD:BP632855.1,INSD:BP838465.1,INSD:EL147875.1,
FT                   INSD:EL163730.1,INSD:EL319829.1,INSD:ES176951.1,
FT                   INSD:EL220044.1,INSD:AV562418.1,INSD:BP827537.1,
FT                   INSD:EL176309.1,INSD:AV809595.1,INSD:EL000765.1,
FT                   INSD:BP650640.1,INSD:BP844470.1,INSD:EL301915.1,
FT                   INSD:EL069484.1,INSD:ES101368.1,INSD:N64928.1,
FT                   INSD:EL243265.1,INSD:EL333012.1,INSD:DR357147.1,
FT                   INSD:EL035942.1,INSD:BP660287.1,INSD:EL114622.1,
FT                   INSD:EL319750.1,INSD:EH977873.1,INSD:EH919530.1,
FT                   INSD:EH960339.1,INSD:BP606705.1,INSD:EL062931.1,
FT                   INSD:BP649780.1,INSD:ES178696.1,INSD:EH797657.1,
FT                   INSD:EL125516.1,INSD:EL079777.1,INSD:BP637066.1,
FT                   INSD:BP664827.1,INSD:BP595966.1,INSD:EL091996.1,
FT                   INSD:EL020097.1,INSD:BP594061.1,INSD:EL110915.1,
FT                   INSD:EL190191.1,INSD:EL294371.1,INSD:BU636532.1,
FT                   INSD:EL309039.1,INSD:EL254345.1,INSD:EH967994.1,
FT                   INSD:EL328838.1,INSD:ES033185.1,INSD:AV527227.1,
FT                   INSD:BP861446.1,INSD:BP834023.1,INSD:EL292063.1,
FT                   INSD:BP789009.1,INSD:AV805210.1,INSD:AV826123.1,
FT                   INSD:T20873.1,INSD:EL307465.1,INSD:EH876531.1,
FT                   INSD:EL323695.1,INSD:DR343128.1,INSD:BP622039.1,
FT                   INSD:AV816452.1,INSD:EL057470.1,INSD:BP622484.1,
FT                   INSD:EL081149.1,INSD:EL315157.1,INSD:EH923666.1,
FT                   INSD:AV520295.1,INSD:BP843973.1,INSD:BP847556.1,
FT                   INSD:BP859902.1,INSD:BP632269.1,INSD:DR357050.1,
FT                   INSD:CB074422.1,INSD:EG511498.1,INSD:BP638596.1,
FT                   INSD:BP634540.1,INSD:DR357097.1,INSD:DR357155.1,
FT                   INSD:DR357107.1,INSD:BP859745.1,INSD:BP820808.1,
FT                   INSD:EH990701.1,INSD:EL061664.1,INSD:EL127363.1,
FT                   INSD:EL082757.1,INSD:EL265003.1,INSD:DR357173.1,
FT                   INSD:BP821746.1,INSD:EL175719.1,INSD:BP855143.1,
FT                   INSD:EH967479.1,INSD:EH877767.1,INSD:DR357201.1,
FT                   INSD:ES029346.1,INSD:DR357094.1,INSD:DR357142.1,
FT                   INSD:BP593676.1,INSD:EL155749.1,INSD:EH876262.1,
FT                   INSD:EL020735.1,INSD:BP827818.1,INSD:DR357070.1,
FT                   INSD:EL159533.1,INSD:EL295439.1,INSD:AV829497.1,
FT                   INSD:BP661144.1,INSD:BP671692.1,INSD:ES139978.1,
FT                   INSD:ES151625.1,INSD:EL034716.1,INSD:EL068236.1,
FT                   INSD:EH890868.1,INSD:EL038809.1,INSD:BP613684.1,
FT                   INSD:BP855519.1,INSD:BE039038.1,INSD:EL119431.1,
FT                   INSD:BP652411.1,INSD:DR377946.1,INSD:EL208897.1,
FT                   INSD:ES196886.1,INSD:EL101609.1,INSD:EL194365.1,
FT                   INSD:EL221718.1,INSD:DR357185.1,INSD:EL148722.1,
FT                   INSD:EH829276.1,INSD:EL303230.1,INSD:EH990888.1,
FT                   INSD:EH975185.1,INSD:EH849120.1,INSD:EL206060.1,
FT                   INSD:EL215822.1,INSD:EL310862.1,INSD:EH926665.1,
FT                   INSD:DR357212.1,INSD:CF773721.1,INSD:BP594080.1,
FT                   INSD:BP638972.1,INSD:BP822068.1,INSD:BP857001.1,
FT                   INSD:EL022921.1,INSD:BP604557.1,INSD:DR377092.1,
FT                   INSD:EL285770.1,INSD:BP621611.1,INSD:T04122.1,
FT                   INSD:DR278042.1,INSD:DR357198.1,INSD:EH977226.1,
FT                   INSD:EH806587.1,INSD:EL080159.1,INSD:EH848559.1,
FT                   INSD:EH889532.1,INSD:DR357036.1,INSD:BP653613.1,
FT                   INSD:EL251566.1,INSD:BP668269.1,INSD:DR357193.1,
FT                   INSD:BP623791.1,INSD:EL118478.1,INSD:BP588799.1,
FT                   INSD:AV526457.1,INSD:CB261299.1,INSD:ES196259.1,
FT                   INSD:EH935721.1,INSD:EL065693.1,INSD:EG511609.1,
FT                   INSD:EH927885.1,INSD:BP848798.1,INSD:BE039309.1,
FT                   INSD:EL232383.1,INSD:ES174123.1,INSD:EH892071.1,
FT                   INSD:BP585717.1,INSD:DR357058.1,INSD:EH853021.1,
FT                   INSD:ES037944.1,INSD:BP817473.1,INSD:EL011413.1,
FT                   INSD:EH899030.1,INSD:DR357206.1,INSD:DR383009.1,
FT                   INSD:AV811109.1,INSD:EL126800.1,INSD:BP668751.1,
FT                   INSD:EL189552.1,INSD:BP564777.1,INSD:EL009389.1,
FT                   INSD:BP821526.1,INSD:EG459764.1,INSD:DR357034.1,
FT                   INSD:N65918.1,INSD:EL296741.1,INSD:DR357132.1,
FT                   INSD:AV819480.1,INSD:BP851439.1,INSD:H37346.1,
FT                   INSD:EL066498.1,INSD:EH815262.1,INSD:EL196774.1,
FT                   INSD:EL114163.1,INSD:BP664198.1,INSD:EH949480.1,
FT                   INSD:DR357182.1,INSD:EL104177.1,INSD:EL090636.1,
FT                   INSD:EH944891.1,INSD:DR357093.1,INSD:EL172535.1,
FT                   INSD:EL191355.1,INSD:EL324334.1,INSD:AV785353.1,
FT                   INSD:CB261249.1,INSD:EL056559.1,INSD:BP630093.1,
FT                   INSD:H36481.1,INSD:BP632546.1,INSD:BP858762.1,
FT                   INSD:BP821142.1,INSD:EL041528.1,INSD:EL267708.1,
FT                   INSD:EL151942.1,INSD:EL080025.1,INSD:EH825224.1,
FT                   INSD:BP626607.1,INSD:EH924906.1,INSD:EH795978.1,
FT                   INSD:BP787172.1,INSD:DR357061.1,INSD:EG494919.1,
FT                   INSD:BP867590.1,INSD:AV796738.1,INSD:DR357067.1,
FT                   INSD:EL205031.1,INSD:EH900776.1,INSD:AV808300.1,
FT                   INSD:EH871667.1,INSD:DR278043.1,INSD:BP597334.1,
FT                   INSD:BP664947.1,INSD:BP837533.1,INSD:EH971400.1,
FT                   INSD:DR357216.1,INSD:DR357112.1,INSD:EL028469.1,
FT                   INSD:EH932478.1,INSD:BP591159.1,INSD:BP865874.1,
FT                   INSD:EL196201.1,INSD:DR357218.1,INSD:AV808434.1,
FT                   INSD:DR357226.1,INSD:EL330069.1,INSD:BP663264.1,
FT                   INSD:DR357188.1,INSD:BP793489.1,INSD:DR357181.1,
FT                   INSD:AV801473.1,INSD:DR343139.1,INSD:BP841457.1,
FT                   INSD:EH943428.1,INSD:DR357146.1,INSD:EL092356.1,
FT                   INSD:EL253091.1,INSD:T44933.1,INSD:BP780317.1,
FT                   INSD:EL195273.1,INSD:DR357072.1,INSD:EL049445.1,
FT                   INSD:EL313069.1,INSD:EL201213.1,INSD:EH826752.1,
FT                   INSD:EL215972.1,INSD:CB256246.1,INSD:BP838991.1,
FT                   INSD:EH973550.1,INSD:DR357071.1,INSD:AV520046.1,
FT                   INSD:DR357017.1,INSD:EH828509.1,INSD:AV806291.1,
FT                   INSD:BP622296.1,INSD:BP655519.1,INSD:EL307695.1,
FT                   INSD:BP848666.1,INSD:EG511509.1,INSD:EH816983.1,
FT                   INSD:BP659741.1,INSD:BP865166.1,INSD:BP665846.1,
FT                   INSD:EL309547.1,INSD:CK121786.1,INSD:BP623061.1,
FT                   INSD:EH822285.1,INSD:ES057221.1,INSD:BP821094.1,
FT                   INSD:EH969942.1,INSD:EG470167.1,INSD:EH883531.1,
FT                   INSD:BP655551.1,INSD:BP663262.1,INSD:EL323031.1,
FT                   INSD:DR357152.1,INSD:BU636061.1,INSD:EL171198.1,
FT                   INSD:EL131563.1,INSD:EL274079.1,INSD:EL002540.1,
FT                   INSD:EH839650.1,INSD:DR357169.1,INSD:EL287661.1,
FT                   INSD:EG494920.1,INSD:BP594701.1,INSD:BP846605.1,
FT                   INSD:EL264280.1,INSD:EL026553.1,INSD:BP671238.1,
FT                   INSD:EG429654.1,INSD:EL133412.1,INSD:EL254956.1,
FT                   INSD:BP667049.1,INSD:EH948708.1,INSD:DR357046.1,
FT                   INSD:DR357176.1,INSD:BP588425.1,INSD:EH912440.1,
FT                   INSD:EL059166.1,INSD:EL106040.1,INSD:EL262393.1,
FT                   INSD:BP636549.1,INSD:EL336368.1,INSD:EL157061.1,
FT                   INSD:BP652610.1,INSD:BP631458.1,INSD:EH846216.1,
FT                   INSD:DR343126.1,INSD:EL051967.1,INSD:EH850946.1,
FT                   INSD:AV814564.1,INSD:BP842231.1,INSD:EL076951.1,
FT                   INSD:BP586952.1,INSD:EH803042.1,INSD:EH850008.1,
FT                   INSD:ES009672.1,INSD:DR357177.1,INSD:EH918461.1,
FT                   INSD:EH986766.1,INSD:EL025669.1,INSD:EH819768.1,
FT                   INSD:BP855567.1,INSD:BP832317.1,INSD:BP827578.1,
FT                   INSD:AV815094.1,INSD:DR357101.1,INSD:DR357161.1,
FT                   INSD:BP577326.1,INSD:BP662023.1,INSD:EL047126.1,
FT                   INSD:EL118493.1,INSD:BP654982.1,INSD:EL028110.1,
FT                   INSD:EL265606.1,INSD:EH866320.1,INSD:EL183779.1,
FT                   INSD:EL227216.1,INSD:EL160181.1,INSD:EL230942.1,
FT                   INSD:EL266951.1,INSD:EH942357.1,INSD:BP633684.1,
FT                   INSD:BP634460.1,INSD:EG508063.1,INSD:DR357126.1,
FT                   INSD:BP597860.1,INSD:EL232460.1,INSD:BP589572.1,
FT                   INSD:EH868562.1,INSD:EL279346.1,INSD:BP779490.1,
FT                   INSD:EH839892.1,INSD:DR357120.1,INSD:EH871422.1,
FT                   INSD:EL191816.1,INSD:EL118165.1,INSD:EG517110.1,
FT                   INSD:BP854619.1,INSD:EL165487.1,INSD:EL222931.1,
FT                   INSD:EL303939.1,INSD:EL079653.1,INSD:EH807855.1,
FT                   INSD:EG508061.1,INSD:BP630837.1,INSD:BP629585.1,
FT                   INSD:BE038195.1,INSD:EL171501.1,INSD:EH815491.1,
FT                   INSD:ES131879.1,INSD:EH860261.1,INSD:EH921233.1,
FT                   INSD:EG494917.1,INSD:BP670085.1,INSD:EL014988.1,
FT                   INSD:EL295088.1,INSD:N37418.1,INSD:BP659086.1,
FT                   INSD:H36407.1,INSD:EL259491.1,INSD:DR357066.1,
FT                   INSD:EH980017.1,INSD:EL193105.1,INSD:EH843952.1,
FT                   INSD:BP662659.1,INSD:EH875746.1,INSD:AV526224.1,
FT                   INSD:BP842219.1,INSD:EL196731.1,INSD:BP821988.1,
FT                   INSD:CK118113.1,INSD:BP590829.1,INSD:DR357229.1,
FT                   INSD:DR357084.1,INSD:BP862089.1,INSD:BP846317.1,
FT                   INSD:EL323766.1,INSD:BE524524.1,INSD:BP828468.1,
FT                   INSD:EH976368.1,INSD:EL112765.1,INSD:EL124918.1,
FT                   INSD:BP628529.1,INSD:BP837367.1,INSD:EL016465.1,
FT                   INSD:EH855441.1,INSD:BP603554.1,INSD:EH934020.1,
FT                   INSD:EG517118.1,INSD:EL287303.1,INSD:EL139915.1,
FT                   INSD:DR382648.1,INSD:BP670169.1,INSD:EL185543.1,
FT                   INSD:DR357210.1,INSD:EL143880.1,INSD:EH974069.1,
FT                   INSD:EL227716.1,INSD:EH836323.1,INSD:EH850690.1,
FT                   INSD:EH967930.1,INSD:BP647635.1,INSD:EL017441.1,
FT                   INSD:EH980365.1,INSD:BP647043.1,INSD:DR357059.1,
FT                   INSD:EL228901.1,INSD:DR357102.1,INSD:EL090401.1,
FT                   INSD:EH836005.1,INSD:EH984676.1,INSD:BP668139.1,
FT                   INSD:N65210.1,INSD:EH874613.1,INSD:BP633986.1,
FT                   INSD:CB262702.1,INSD:EL045573.1,INSD:BP811591.1,
FT                   INSD:EL077373.1,INSD:DR357018.1,INSD:BP856432.1,
FT                   INSD:EL286069.1,INSD:BP832272.1,INSD:EL003262.1,
FT                   INSD:EL041902.1,INSD:EL187032.1,INSD:BP852119.1,
FT                   INSD:EH958666.1,INSD:EH802396.1,INSD:EL003098.1,
FT                   INSD:EH944773.1,INSD:EL082512.1,INSD:BP669682.1,
FT                   INSD:EH941880.1,INSD:EL124304.1,INSD:DR357092.1,
FT                   INSD:DR357052.1,INSD:EH815773.1,INSD:EH812018.1,
FT                   INSD:DR357237.1,INSD:EL140638.1,INSD:EH840731.1,
FT                   INSD:BP590237.1,INSD:DR357186.1,INSD:EL147345.1,
FT                   INSD:EL015345.1,INSD:DR357141.1,INSD:EH989292.1,
FT                   INSD:DR357118.1,INSD:AV826663.1,INSD:BP823744.1,
FT                   INSD:EL114343.1,INSD:EH863519.1,INSD:BP660641.1,
FT                   INSD:T44266.1,INSD:BE039282.1,INSD:DR357183.1,
FT                   INSD:EH994732.1,INSD:DR357091.1,INSD:BP866327.1,
FT                   INSD:BP788468.1,INSD:EL284388.1,INSD:EL096578.1,
FT                   INSD:EL005452.1,INSD:EL293602.1,INSD:BP636026.1,
FT                   INSD:CB262452.1,INSD:BP623911.1,INSD:BP840149.1,
FT                   INSD:EL118431.1,INSD:EH856000.1,INSD:EH882273.1,
FT                   INSD:DR240099.1,INSD:BP863723.1,INSD:BP651147.1,
FT                   INSD:BP637198.1,INSD:DR343137.1,INSD:BP634561.1,
FT                   INSD:DR357025.1,INSD:R29802.1,INSD:BP841925.1,
FT                   INSD:EH929795.1,INSD:BP866700.1,INSD:EH899125.1,
FT                   INSD:BP839040.1,INSD:EL221749.1,INSD:EH933474.1,
FT                   INSD:EL289412.1,INSD:EH890101.1,INSD:BP853407.1,
FT                   INSD:BP596281.1,INSD:EH909300.1,INSD:DR357087.1,
FT                   INSD:DR357119.1,INSD:EH805793.1,INSD:EG480219.1,
FT                   INSD:EL008037.1,INSD:BP868156.1,INSD:EL064183.1,
FT                   INSD:EH815873.1,INSD:BP586521.1,INSD:EL029811.1,
FT                   INSD:EL233982.1,INSD:EL203195.1,INSD:EL281704.1,
FT                   INSD:BP808831.2,INSD:T42382.1,INSD:EL243169.1,
FT                   INSD:BP829082.1,INSD:DR357116.1,INSD:BP843832.1,
FT                   INSD:EL165342.1,INSD:EL240923.1,INSD:BP827545.1,
FT                   INSD:BP859450.1,INSD:BP859265.1,INSD:BP589528.1,
FT                   INSD:BP629450.1,INSD:BP657297.1,INSD:EL241477.1,
FT                   INSD:EL060527.1,INSD:EL231088.1,INSD:EL035782.1,
FT                   INSD:EL191278.1,INSD:H36385.1,INSD:EL026724.1,
FT                   INSD:EH940864.1,INSD:EH930018.1,INSD:EL166169.1,
FT                   INSD:EH853661.1,INSD:DR357068.1,INSD:EH800845.1,
FT                   INSD:EL243537.1,INSD:BP632374.1,INSD:EH813603.1,
FT                   INSD:EL025297.1,INSD:EL199792.1,INSD:BP656952.1,
FT                   INSD:ES164327.1,INSD:EH994580.1,INSD:EL137879.1,
FT                   INSD:EH898665.1,INSD:BP867026.1,INSD:DR343133.1,
FT                   INSD:AV812444.1,INSD:DR357100.1,INSD:BP792760.1,
FT                   INSD:EL240598.1,INSD:EH864434.1,INSD:DR357024.1,
FT                   INSD:EH858076.1,INSD:DR357138.1,INSD:EH961257.1,
FT                   INSD:DR357165.1,INSD:CK120611.1,INSD:DR357053.1,
FT                   INSD:DR357225.1,INSD:CB256892.1,INSD:EL190998.1,
FT                   INSD:EH922102.1,INSD:EL310476.1,INSD:BP816988.1,
FT                   INSD:DR229173.1,INSD:CK117842.1,INSD:BP591101.1,
FT                   INSD:DR378068.1,INSD:AV520771.1,INSD:BP779645.1,
FT                   INSD:EL071077.1,INSD:EH825282.1,INSD:EH845770.1,
FT                   INSD:EG459762.1,INSD:T46200.1,INSD:BP641691.1,
FT                   INSD:DR357063.1,INSD:DR357227.1,INSD:EL297504.1,
FT                   INSD:BP863109.1,INSD:EH870512.1,INSD:EG511631.1,
FT                   INSD:BP599488.1,INSD:EL171385.1,INSD:EL239594.1,
FT                   INSD:DR357125.1,INSD:BP843162.1,INSD:EL192081.1,
FT                   INSD:DR357069.1,INSD:EL296892.1,INSD:BE038444.1,
FT                   INSD:EL097202.1,INSD:EH815674.1,INSD:DR357115.1,
FT                   INSD:CB256709.1,INSD:EL000654.1,INSD:DR343140.1,
FT                   INSD:EH812211.1,INSD:EH972317.1,INSD:EL294120.1,
FT                   INSD:EH961369.1,INSD:EL285151.1,INSD:CD532555.1,
FT                   INSD:BP864918.1,INSD:BP851691.1,INSD:BP847134.1,
FT                   INSD:EH939885.1,INSD:DR343142.1,INSD:BP592632.1,
FT                   INSD:DR357222.1,INSD:EL334335.1,INSD:ES210012.1,
FT                   INSD:EG492120.1,INSD:EL316498.1,INSD:EH820842.1,
FT                   INSD:BP785994.1,INSD:CK120634.1,INSD:BP643215.1,
FT                   INSD:EL160308.1,INSD:DR357236.1,INSD:DR357033.1,
FT                   INSD:EL261133.1,INSD:ES100454.1,INSD:ES192059.1,
FT                   INSD:EL277251.1,INSD:BP588656.1,INSD:EL089952.1,
FT                   INSD:EH868987.1,INSD:EL243648.1,INSD:EG425023.1,
FT                   INSD:DR357199.1,INSD:EH946665.1,INSD:DR343132.1,
FT                   INSD:EL235619.1,INSD:EH827439.1,INSD:EH919340.1,
FT                   INSD:AV801971.1,INSD:EL124659.1,INSD:BP811964.1,
FT                   INSD:EH934561.1,INSD:EL043564.1,INSD:R84003.1,
FT                   INSD:BP832157.1,INSD:BP599377.1,INSD:EL051754.1,
FT                   INSD:EH824818.1,INSD:BP864620.1,INSD:EL249003.1,
FT                   INSD:EL293645.1,INSD:BP635785.1,INSD:EH879261.1,
FT                   INSD:DR357045.1,INSD:EL007654.1,INSD:BP827109.1,
FT                   INSD:BP829515.1,INSD:AV808304.1,INSD:EL193862.1,
FT                   INSD:DR357150.1,INSD:EL093410.1,INSD:BP811806.1,
FT                   INSD:DR357154.1,INSD:BP647169.1,INSD:EL248407.1,
FT                   INSD:DR357108.1,INSD:BP605003.1,INSD:EH863021.1,
FT                   INSD:DR357085.1,INSD:EL281988.1,INSD:EL273789.1,
FT                   INSD:EH976781.1,INSD:EH881388.1,INSD:EL332769.1,
FT                   INSD:BP664310.1,INSD:EH956295.1,INSD:BP586058.1,
FT                   INSD:DR357234.1,INSD:DR357242.1,INSD:BP654169.1,
FT                   INSD:EL194057.1,INSD:EL291279.1,INSD:DR357030.1,
FT                   INSD:EL193618.1,INSD:EL296990.1,INSD:EL309559.1,
FT                   INSD:EL333157.1,INSD:N37528.1,INSD:EL334412.1,
FT                   INSD:EL106913.1,INSD:ES021135.1,INSD:DR357219.1,
FT                   INSD:EH840006.1,INSD:EL265420.1,INSD:BP866111.1,
FT                   INSD:EH969235.1,INSD:EH928103.1,INSD:DR357151.1,
FT                   INSD:BP857947.1,INSD:ES165411.1,INSD:AA585784.1,
FT                   INSD:EL231986.1,INSD:EL315143.1,INSD:BP824687.1,
FT                   INSD:EH880670.1,INSD:EL203966.1,INSD:EL179955.1,
FT                   INSD:DR357166.1,INSD:EL069412.1,INSD:EL292900.1,
FT                   INSD:BP664809.1,INSD:AV800963.1,INSD:BP603390.1,
FT                   INSD:EL115100.1,INSD:AV814062.1,INSD:BP593519.1,
FT                   INSD:AV526119.1,INSD:EG444739.1,INSD:T14037.1,
FT                   INSD:EH810400.1,INSD:BP833682.1,INSD:BP663586.1,
FT                   INSD:BP854178.1,INSD:BP823304.1,INSD:EL280166.1,
FT                   INSD:BP651662.1,INSD:AV813935.1,INSD:EL023013.1,
FT                   INSD:CK120940.1,INSD:EL219731.1,INSD:DR357082.1,
FT                   INSD:AV789796.1,INSD:EH868676.1,INSD:EH938251.1,
FT                   INSD:EH938709.1,INSD:BP596630.1,INSD:AV818267.1,
FT                   INSD:BP587451.1,INSD:EH891977.1,INSD:BP639999.1,
FT                   INSD:DR357239.1,INSD:AV792686.1,INSD:EL201625.1,
FT                   INSD:BP597164.1,INSD:BP672084.1,INSD:DR357157.1,
FT                   INSD:EL095590.1,INSD:EL039920.1,INSD:BP860172.1,
FT                   INSD:EH870827.1,INSD:BP658429.1,INSD:EH944358.1,
FT                   INSD:EL203211.1,INSD:EL144036.1,INSD:EL133231.1,
FT                   INSD:BP861972.1,INSD:BP646835.1,INSD:EL030447.1,
FT                   INSD:EL176073.1,INSD:EH800546.1,INSD:EL286805.1,
FT                   INSD:BP663271.1,INSD:DR357105.1,INSD:EL294244.1,
FT                   INSD:BP799917.1,INSD:EL064628.1,INSD:BP642134.1,
FT                   INSD:EL139420.1,INSD:EL258123.1,INSD:AV522267.1,
FT                   INSD:EH914291.1,INSD:EL270612.1,INSD:DR357158.1,
FT                   INSD:EL172844.1,INSD:EL159009.1,INSD:EL279612.1,
FT                   INSD:DR357011.1,INSD:DR357014.1,INSD:DR357029.1,
FT                   INSD:CD532937.1,INSD:BP644879.1,INSD:EL134735.1,
FT                   INSD:BP842083.1,INSD:EH868817.1,INSD:EL191760.1,
FT                   INSD:DR357062.1,INSD:BP816933.1,INSD:EH903727.1,
FT                   INSD:BP832450.1,INSD:BP664810.1,INSD:BP657126.1,
FT                   INSD:EL211509.1,INSD:BP569654.1,INSD:BP789671.1,
FT                   INSD:EL280512.1,INSD:CK118162.1,INSD:BP625643.1,
FT                   INSD:EL161716.1,INSD:EL171126.1,INSD:EL142385.1,
FT                   INSD:DR357110.1,INSD:DR357039.1,INSD:EL195372.1,
FT                   INSD:DR357217.1,INSD:EL298576.1,INSD:ES063201.1,
FT                   INSD:EL033175.1,INSD:EH849531.1,INSD:EH930904.1,
FT                   INSD:EL300727.1,INSD:BP648034.1,INSD:BP646649.1,
FT                   INSD:EL031464.1,INSD:EL221444.1,INSD:DR357134.1,
FT                   INSD:EH884868.1,INSD:BP590454.1,INSD:EL305441.1,
FT                   INSD:BP866213.1,INSD:EL008990.1,INSD:EH870586.1,
FT                   INSD:EL086921.1,INSD:CK119381.1,INSD:EH994793.1,
FT                   INSD:EH825592.1,INSD:EL083795.1,INSD:EL094392.1,
FT                   INSD:EL042051.1,INSD:EL333754.1,INSD:EL091678.1,
FT                   INSD:BP594632.1,INSD:BP859633.1,INSD:BP846321.1,
FT                   INSD:EH864894.1,INSD:BP636313.1,INSD:EH905745.1,
FT                   INSD:EH839383.1,INSD:EH995038.1,INSD:DR357238.1,
FT                   INSD:EL127953.1,INSD:BP840099.1,INSD:H36110.1,
FT                   INSD:EH962339.1,INSD:EL061484.1,INSD:BP845346.1,
FT                   INSD:EG477848.1,INSD:DR357211.1,INSD:BP849400.1,
FT                   INSD:EL135535.1,INSD:EG449932.1,INSD:EL235144.1,
FT                   INSD:EL148514.1,INSD:EL244886.1,INSD:DR357189.1,
FT                   INSD:EL118388.1,INSD:CA781523.1,INSD:BP656895.1,
FT                   INSD:EL062662.1,INSD:BP861786.1,INSD:EH861846.1,
FT                   INSD:EL178672.1,INSD:AJ609316.1,INSD:BP866826.1,
FT                   INSD:EL113375.1,INSD:EL304859.1,INSD:BP650865.1,
FT                   INSD:BP788705.1,INSD:BP843171.1,INSD:DR357041.1,
FT                   INSD:EL193055.1,INSD:EH853732.1,INSD:EL054177.1,
FT                   INSD:BP650802.1,INSD:EL051388.1,INSD:AV532327.1,
FT                   INSD:BP865471.1,INSD:DR357214.1,INSD:BP787784.1,
FT                   INSD:BP846008.1,INSD:EH990576.1,INSD:EL098288.1,
FT                   INSD:EL159525.1,INSD:EL148704.1,INSD:BP857486.1,
FT                   INSD:EL111191.1,INSD:EH841853.1,INSD:BP864826.1,
FT                   INSD:EL022632.1,INSD:BP599535.1,INSD:EL144751.1,
FT                   INSD:DR240104.1,INSD:EH965254.1,INSD:EL223583.1,
FT                   INSD:EL114773.1,INSD:EL005454.1,INSD:EL240465.1,
FT                   INSD:EH937126.1,INSD:EL195686.1,INSD:AV531200.1,
FT                   INSD:BP842306.1,INSD:BP593595.1,INSD:BP805432.1,
FT                   INSD:EL213939.1,INSD:ES194932.1,INSD:DR357223.1,
FT                   INSD:BP860188.1,INSD:BP655327.1,INSD:BP666616.1,
FT                   INSD:BP596581.1,INSD:AV560376.1,INSD:BP596818.1,
FT                   INSD:R64920.1,INSD:EH833977.1,INSD:EL195141.1,
FT                   INSD:EH982969.1,INSD:DR357077.1,INSD:EL229083.1,
FT                   INSD:EL290274.1,INSD:DR357160.1,INSD:BP650909.1,
FT                   INSD:CB260112.1,INSD:BP815366.1,INSD:EL027455.1,
FT                   INSD:EH842254.1,INSD:EL166906.1,INSD:EH943274.1,
FT                   INSD:EL324998.1,INSD:DR357194.1,INSD:BP631359.1,
FT                   INSD:EH912262.1,INSD:AV797293.1,INSD:EH984169.1,
FT                   INSD:DR357232.1,INSD:EH801628.1,INSD:EG508067.1,
FT                   INSD:EH929075.1,INSD:EH838281.1,INSD:EL055678.1,
FT                   INSD:EL286141.1,INSD:AV786134.1,INSD:BP830071.1,
FT                   INSD:EL126922.1,INSD:EH811692.1,INSD:EL139408.1,
FT                   INSD:BP823510.1,INSD:EH885934.1,INSD:EL211071.1,
FT                   INSD:DR343141.1,INSD:EL158537.1,INSD:BP827138.1,
FT                   INSD:BP671725.1,INSD:EL263907.1,INSD:EL168191.1,
FT                   INSD:EL065691.1,INSD:EL133175.1,INSD:DR242931.1,
FT                   INSD:BP573011.1,INSD:DR357144.1,INSD:EL272428.1,
FT                   INSD:AV810824.1,INSD:EL003157.1,INSD:N38188.1,
FT                   INSD:EL333965.1,INSD:EL320936.1,INSD:AV527220.1,
FT                   INSD:EH955507.1,INSD:BP594229.1,INSD:EL333973.1,
FT                   INSD:DR357228.1,INSD:EG425022.1,INSD:EH902497.1,
FT                   INSD:BP569089.1,INSD:BE038221.1,INSD:EL297165.1,
FT                   INSD:EL289299.1,INSD:EL044658.1,INSD:EH979021.1,
FT                   INSD:EL283275.1,INSD:BP840186.1,INSD:EL174922.1,
FT                   INSD:EL012276.1,INSD:EL106921.1,INSD:EH983548.1,
FT                   INSD:AV811524.1,INSD:AV826157.1,INSD:BP853691.1,
FT                   INSD:EL111088.1,INSD:EH867993.1,INSD:EL249924.1,
FT                   INSD:BP821057.1,INSD:BP795725.1,INSD:AV815910.1,
FT                   INSD:BP842049.1,INSD:EL305734.1,INSD:EL315794.1,
FT                   INSD:EL156278.1,INSD:DR357090.1,INSD:EL169126.1,
FT                   INSD:EG508066.1,INSD:EH961624.1,INSD:DR357139.1,
FT                   INSD:BP589453.1,INSD:EL253703.1,INSD:BP837926.1,
FT                   INSD:ES108377.1,INSD:CD532322.1,INSD:EL140199.1,
FT                   INSD:EL194324.1,INSD:BP819030.1,INSD:EL244777.1,
FT                   INSD:ES065746.1,INSD:EL145221.1,INSD:DR357032.1,
FT                   INSD:EL329912.1,INSD:EL296454.1,INSD:DR357128.1,
FT                   INSD:EL249624.1,INSD:EH883351.1,INSD:DR357167.1,
FT                   INSD:EH920992.1,INSD:BP822558.1,INSD:EL136232.1,
FT                   INSD:AV520768.1,INSD:ES209475.1,INSD:AA651551.1,
FT                   INSD:BP662496.1,INSD:BP817991.1,INSD:EH990905.1,
FT                   INSD:ES140242.1,INSD:BP624726.1,INSD:EH937762.1,
FT                   INSD:AV807150.1,INSD:BP816326.1,INSD:AV534848.1,
FT                   INSD:BP787265.1,INSD:EH955128.1,INSD:EL203698.1,
FT                   INSD:EL314204.1,INSD:BP626659.1,INSD:BP624144.1,
FT                   INSD:EL017011.1,INSD:EG429646.1,INSD:DR357079.1,
FT                   INSD:EL240960.1,INSD:EH871009.1,INSD:BP824653.1,
FT                   INSD:DR357204.1,INSD:EL066301.1,INSD:BP612319.1,
FT                   INSD:T21875.1,INSD:DR357023.1,INSD:EL194623.1,
FT                   INSD:EL294603.1,INSD:EH902956.1,INSD:EL306709.1,
FT                   INSD:BP818996.1,INSD:CB259610.1,INSD:EL113649.1,
FT                   INSD:EH930696.1,INSD:EL073782.1,INSD:EL973152.1,
FT                   INSD:BP641761.1,INSD:BP861887.1,INSD:BP628355.1,
FT                   INSD:ES073440.1,INSD:ES134284.1,INSD:EH844142.1,
FT                   INSD:EL184052.1,INSD:R84031.1,INSD:BP593160.1,
FT                   INSD:EL019464.1,INSD:EL328907.1,INSD:DR357153.1,
FT                   INSD:EL163584.1,INSD:DR357191.1,INSD:EL094540.1,
FT                   INSD:EL012657.1,INSD:EL003372.1,INSD:BP818372.1,
FT                   INSD:EL116927.1,INSD:EL253990.1,INSD:EL034756.1,
FT                   INSD:BP860710.1,INSD:EL112451.1,INSD:EL292955.1,
FT                   INSD:EH943511.1,INSD:AV803386.1,INSD:EL150952.1,
FT                   INSD:BP852873.1,INSD:EH799321.1,INSD:EL059248.1,
FT                   INSD:EL005639.1,INSD:DR357159.1,INSD:EL294541.1,
FT                   INSD:EL075427.1,INSD:BP633294.1,INSD:EL194983.1,
FT                   INSD:DR357172.1,INSD:CD533417.1,INSD:DR357028.1,
FT                   INSD:DR357047.1,INSD:EH801890.1,INSD:DR357037.1,
FT                   INSD:EG517120.1,INSD:EL153169.1,INSD:ES111374.1,
FT                   INSD:EH806046.1,INSD:ES060705.1,INSD:AV787222.1,
FT                   INSD:BP627890.1,INSD:DR357020.1,INSD:EL239261.1,
FT                   INSD:EL205475.1,INSD:EH946766.1,INSD:EH959418.1,
FT                   INSD:BP646448.1,INSD:EL020559.1,INSD:EL258128.1,
FT                   INSD:EL312271.1,INSD:BP846021.1,INSD:EL215561.1,
FT                   INSD:BP647963.1,INSD:DR357164.1,INSD:EH932591.1,
FT                   INSD:EL080313.1,INSD:BP669425.1,INSD:EH833806.1,
FT                   INSD:EG508045.1,INSD:EL166965.1,INSD:EL078051.1,
FT                   INSD:DR357103.1,INSD:BP628243.1,INSD:AV535366.1,
FT                   INSD:EH814556.1,INSD:EH874080.1,INSD:DR357143.1,
FT                   INSD:T46738.1,INSD:BP592586.1,INSD:BP835640.1,
FT                   INSD:EH892626.1,INSD:EL206855.1,INSD:EH799300.1,
FT                   INSD:EL341039.1,INSD:BP566602.1,INSD:EL338134.1,
FT                   INSD:BP839791.1,INSD:ES151241.1,INSD:DR357054.1,
FT                   INSD:EH896843.1,INSD:DR357015.1,INSD:EH898057.1,
FT                   INSD:EL267411.1,INSD:EL307990.1,INSD:EH942539.1,
FT                   INSD:EL305930.1,INSD:BP816893.1,INSD:EL230800.1,
FT                   INSD:BP657513.1,INSD:BP860208.1,INSD:EL170182.1,
FT                   INSD:EL055123.1,INSD:EH835949.1,INSD:EH930702.1,
FT                   INSD:AV796005.1,INSD:BP829184.1,INSD:EL068012.1,
FT                   INSD:EH858467.1,INSD:EH935105.1,INSD:EL302934.1,
FT                   INSD:AV813160.1,INSD:BP638777.1,INSD:DR357203.1,
FT                   INSD:BP793406.1,INSD:DR357190.1,INSD:EL286036.1,
FT                   INSD:DR357163.1,INSD:EL012258.1,INSD:EL081443.1,
FT                   INSD:AV812517.1,INSD:EL297718.1,INSD:EL119737.1,
FT                   INSD:EL114952.1,INSD:EH909396.1,INSD:EH913808.1,
FT                   INSD:EL325790.1,INSD:EH976645.1,INSD:DR357207.1,
FT                   INSD:BP842184.1,INSD:EL106261.1,INSD:BP858753.1,
FT                   INSD:EL153181.1,INSD:EL260720.1,INSD:DR240105.1,
FT                   INSD:EL104626.1,INSD:EH907059.1,INSD:EL054869.1,
FT                   INSD:EH893339.1,INSD:EL277863.1,INSD:BP659097.1,
FT                   INSD:EL257998.1,INSD:ES156621.1,INSD:BP849361.1,
FT                   INSD:EL170138.1,INSD:BP815611.1,INSD:EL258189.1,
FT                   INSD:BP636830.1,INSD:BP655517.1,INSD:BP864389.1,
FT                   INSD:EL130037.1,INSD:DR357051.1,INSD:EL268391.1,
FT                   INSD:EL097233.1,INSD:EL305294.1,INSD:EL179028.1,
FT                   INSD:DR357162.1,INSD:EL142412.1,INSD:EH945270.1,
FT                   INSD:EH879331.1,INSD:EL230488.1,INSD:BP836512.1,
FT                   INSD:DR357044.1,INSD:EH958830.1,INSD:BP596810.1,
FT                   INSD:BP836830.1,INSD:EH943221.1,INSD:EH859365.1,
FT                   INSD:EL229381.1,INSD:EH833945.1,INSD:EH815875.1,
FT                   INSD:AV793652.1,INSD:EL318559.1,INSD:BP636844.1,
FT                   INSD:EL315103.1,INSD:BP840282.1,INSD:EL167633.1,
FT                   INSD:DR357148.1,INSD:EL007310.1,INSD:DR357178.1,
FT                   INSD:BP669252.1,INSD:EL206289.1,INSD:DR357135.1,
FT                   INSD:EH847687.1,INSD:EL206300.1,INSD:EL286602.1,
FT                   INSD:DR357042.1,INSD:EL195229.1,INSD:BP596459.1,
FT                   INSD:EL063646.1,INSD:EL232683.1,INSD:EL143802.1,
FT                   INSD:BP634606.1,INSD:AV813877.1,INSD:EL289335.1,
FT                   INSD:BP659725.1,INSD:BP589647.1,INSD:DR357065.1,
FT                   INSD:EH878239.1,INSD:EH885334.1,INSD:CB256894.1,
FT                   INSD:DR357241.1,INSD:EL251608.1,INSD:CB264668.1,
FT                   INSD:EL222640.1,INSD:EH892880.1,INSD:EL329511.1,
FT                   INSD:BP834251.1,INSD:EL321975.1,INSD:BP650073.1,
FT                   INSD:BP634583.1,INSD:DR357175.1,INSD:EL157834.1,
FT                   INSD:EL017078.1,INSD:EL156502.1,INSD:EH933565.1,
FT                   INSD:DR357224.1,INSD:BP829095.1,INSD:EH917658.1,
FT                   INSD:BP637661.1,INSD:BP652114.1,INSD:T45112.1,
FT                   INSD:DR357114.1,INSD:DR357122.1,INSD:BP820878.1,
FT                   INSD:DR357078.1,INSD:BP863148.1,INSD:EH943377.1,
FT                   INSD:EH821181.1,INSD:EH917277.1,INSD:EL097259.1,
FT                   INSD:BP594043.1,INSD:EL055967.1,INSD:EL117470.1,
FT                   INSD:BP596207.1,INSD:BP820102.1,INSD:BP663503.1,
FT                   INSD:EH928853.1,INSD:EL206478.1,INSD:EL035278.1,
FT                   INSD:H77106.1,INSD:CK118066.1,INSD:EL113188.1,
FT                   INSD:EL015550.1,INSD:DR357149.1,INSD:BP781242.1,
FT                   INSD:EL088605.1,INSD:EL128705.1,INSD:EH968509.1,
FT                   INSD:DR357019.1,INSD:BP628086.1,INSD:BP842063.2,
FT                   INSD:BP588100.1,INSD:EH905796.1,INSD:EL311101.1,
FT                   INSD:EL035979.1,INSD:AV807609.1,INSD:DR357168.1,
FT                   INSD:EH946403.1,INSD:EL040552.1,INSD:DR357109.1,
FT                   INSD:EH899750.1,INSD:ES050660.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY092980.1,INSD:BX831442.1,INSD:BX830685.1,
FT                   INSD:BX841630.1,INSD:AY059861.1,INSD:AY133566.1,
FT                   INSD:AK221043.1,INSD:AY081680.1,INSD:BT000363.1,
FT                   INSD:BX831299.1,INSD:BX831064.1,INSD:BX833597.1,
FT                   INSD:BX830573.1,INSD:BX830905.1,INSD:BX830127.1,
FT                   INSD:AY048262.1,INSD:AY048300.1,INSD:AK226459.1,
FT                   INSD:AY057641.1,INSD:AF370474.1"
FT                   /protein_id="AED90357.1"
FT                   TIIDTFSSS"
FT   gene            complement(210979..213472)
FT                   /gene="LECRKA4.1"
FT                   /gene_synonym="F7A7.60"
FT                   /gene_synonym="F7A7_60"
FT                   /gene_synonym="lectin receptor kinase a4.1"
FT                   /gene_synonym="L-type lectin receptor kinase-VI.2"
FT                   /gene_synonym="LecRK-VI.2"
FT                   /locus_tag="AT5G01540"
FT                   /note="Encodes LecRKA4.1, a member of the lectin receptor
FT                   kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2
FT                   At5g01550; LecRKA4.3 At5g01560). Together with other
FT                   members of the subfamily, functions redundantly in the
FT                   negative regulation of ABA response in seed germination.
FT                   Positively regulates pattern-triggered immunity."
FT   mRNA            complement(210979..213472)
FT                   /gene="LECRKA4.1"
FT                   /gene_synonym="F7A7.60"
FT                   /gene_synonym="F7A7_60"
FT                   /gene_synonym="lectin receptor kinase a4.1"
FT                   /gene_synonym="L-type lectin receptor kinase-VI.2"
FT                   /gene_synonym="LecRK-VI.2"
FT                   /locus_tag="AT5G01540"
FT                   /product="lectin receptor kinase a4.1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH802774.1,INSD:EL292499.1,INSD:R64824.1,
FT                   INSD:BP816100.2,INSD:AV829852.1,INSD:BP815877.2,
FT                   INSD:AV808896.1,INSD:BP592177.1,INSD:BP592187.1,
FT                   INSD:BP829512.2,INSD:AU239076.2,INSD:N97302.1,
FT                   INSD:BP648184.1,INSD:EH913539.1,INSD:EL144779.1,
FT                   INSD:AU036593.1,INSD:EL249303.1,INSD:BP651454.1,
FT                   INSD:BP642570.1,INSD:BP645106.1,INSD:EH939393.1,
FT                   INSD:EL139251.1,INSD:BP653054.1,INSD:BP831842.1,
FT                   INSD:AU230346.1,INSD:BP835046.1,INSD:EL331798.1,
FT                   INSD:BP644703.1,INSD:AV827157.1,INSD:AI993877.1,
FT                   INSD:AV797394.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF361597.1,INSD:BT000489.1"
FT   gene            211017..213593
FT                   /locus_tag="AT5G01542"
FT                   /note="Natural antisense transcript overlaps with
FT                   AT5G01540; Potential natural antisense gene, locus overlaps
FT                   with AT5G01540"
FT   ncRNA           211017..213593
FT                   /locus_tag="AT5G01542"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   CDS_pept        complement(211285..213333)
FT                   /codon_start=1
FT                   /gene="LECRKA4.1"
FT                   /gene_synonym="F7A7.60"
FT                   /gene_synonym="F7A7_60"
FT                   /gene_synonym="lectin receptor kinase a4.1"
FT                   /gene_synonym="L-type lectin receptor kinase-VI.2"
FT                   /gene_synonym="LecRK-VI.2"
FT                   /locus_tag="AT5G01540"
FT                   /product="lectin receptor kinase a4.1"
FT                   /note="lectin receptor kinase a4.1 (LECRKA4.1); FUNCTIONS
FT                   IN: kinase activity; INVOLVED IN: N-terminal protein
FT                   myristoylation, abscisic acid mediated signaling pathway,
FT                   response to abscisic acid stimulus, seed germination;
FT                   LOCATED IN: plasma membrane; EXPRESSED IN: 17 plant
FT                   structures; EXPRESSED DURING: 10 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Legume lectin, beta chain
FT                   (InterPro:IPR001220), Protein kinase, ATP binding site
FT                   (InterPro:IPR017441), Serine/threonine-protein kinase-like
FT                   domain (InterPro:IPR017442), Concanavalin A-like
FT                   lectin/glucanase, subgroup (InterPro:IPR013320), Protein
FT                   kinase-like domain (InterPro:IPR011009),
FT                   Serine/threonine-protein kinase, active site
FT                   (InterPro:IPR008271), Protein kinase, catalytic domain
FT                   (InterPro:IPR000719), Concanavalin A-like lectin/glucanase
FT                   (InterPro:IPR008985); BEST Arabidopsis thaliana protein
FT                   match is: lectin receptor kinase a4.1 (TAIR:AT5G01550.1);
FT                   Has 1807 Blast hits to 1807 proteins in 277 species: Archae
FT                   - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants -
FT                   385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI
FT                   BLink)."
FT                   /db_xref="GOA:Q9M021"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001220"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013320"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M021"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH802774.1,INSD:EL292499.1,INSD:R64824.1,
FT                   INSD:BP816100.2,INSD:AV829852.1,INSD:BP815877.2,
FT                   INSD:AV808896.1,INSD:BP592177.1,INSD:BP592187.1,
FT                   INSD:BP829512.2,INSD:AU239076.2,INSD:N97302.1,
FT                   INSD:BP648184.1,INSD:EH913539.1,INSD:EL144779.1,
FT                   INSD:AU036593.1,INSD:EL249303.1,INSD:BP651454.1,
FT                   INSD:BP642570.1,INSD:BP645106.1,INSD:EH939393.1,
FT                   INSD:EL139251.1,INSD:BP653054.1,INSD:BP831842.1,
FT                   INSD:AU230346.1,INSD:BP835046.1,INSD:EL331798.1,
FT                   INSD:BP644703.1,INSD:AV827157.1,INSD:AI993877.1,
FT                   INSD:AV797394.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF361597.1,INSD:BT000489.1"
FT                   /protein_id="AED90358.1"
FT   gene            complement(214373..216773)
FT                   /gene="LECRKA4.2"
FT                   /gene_synonym="F7A7.70"
FT                   /gene_synonym="F7A7_70"
FT                   /gene_synonym="L-type lectin receptor kinase VI.3"
FT                   /gene_synonym="LecRK-VI.3"
FT                   /gene_synonym="lectin receptor kinase a4.1"
FT                   /locus_tag="AT5G01550"
FT                   /note="Encodes LecRKA4.2, a member of the lectin receptor
FT                   kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2
FT                   At5g01550; LecRKA4.3 At5g01560). Together with other
FT                   members of the subfamily, functions redundantly in the
FT                   negative regulation of ABA response in seed germination."
FT   mRNA            complement(214373..216773)
FT                   /gene="LECRKA4.2"
FT                   /gene_synonym="F7A7.70"
FT                   /gene_synonym="F7A7_70"
FT                   /gene_synonym="L-type lectin receptor kinase VI.3"
FT                   /gene_synonym="LecRK-VI.3"
FT                   /gene_synonym="lectin receptor kinase a4.1"
FT                   /locus_tag="AT5G01550"
FT                   /product="lectin receptor kinase a4.1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CD534563.1,INSD:EH945244.1,INSD:CD534897.1,
FT                   INSD:EL158919.1,INSD:EH817813.1,INSD:EH945788.1"
FT   CDS_pept        complement(214517..216637)
FT                   /codon_start=1
FT                   /gene="LECRKA4.2"
FT                   /gene_synonym="F7A7.70"
FT                   /gene_synonym="F7A7_70"
FT                   /gene_synonym="lectin receptor kinase a4.1"
FT                   /gene_synonym="L-type lectin receptor kinase VI.3"
FT                   /gene_synonym="LecRK-VI.3"
FT                   /locus_tag="AT5G01550"
FT                   /product="lectin receptor kinase a4.1"
FT                   /note="lectin receptor kinase a4.1 (LECRKA4.2); FUNCTIONS
FT                   IN: protein serine/threonine kinase activity, binding,
FT                   protein kinase activity, kinase activity, ATP binding;
FT                   INVOLVED IN: abscisic acid mediated signaling pathway, seed
FT                   germination; EXPRESSED IN: 6 plant structures; EXPRESSED
FT                   DURING: 4 anthesis, petal differentiation and expansion
FT                   stage; CONTAINS InterPro DOMAIN/s: Legume lectin, beta
FT                   chain (InterPro:IPR001220), Protein kinase, ATP binding
FT                   site (InterPro:IPR017441), Serine/threonine-protein
FT                   kinase-like domain (InterPro:IPR017442), Concanavalin
FT                   A-like lectin/glucanase, subgroup (InterPro:IPR013320),
FT                   Protein kinase-like domain (InterPro:IPR011009),
FT                   Serine/threonine-protein kinase, active site
FT                   (InterPro:IPR008271), Protein kinase, catalytic domain
FT                   (InterPro:IPR000719), Concanavalin A-like lectin/glucanase
FT                   (InterPro:IPR008985); BEST Arabidopsis thaliana protein
FT                   match is: lectin receptor kinase a4.3 (TAIR:AT5G01560.1);
FT                   Has 1807 Blast hits to 1807 proteins in 277 species: Archae
FT                   - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants -
FT                   385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI
FT                   BLink)."
FT                   /db_xref="GOA:A0A2H1ZE50"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001220"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013320"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:A0A2H1ZE50"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CD534563.1,INSD:EH945244.1,INSD:CD534897.1,
FT                   INSD:EL158919.1,INSD:EH817813.1,INSD:EH945788.1"
FT                   /protein_id="AED90359.2"
FT                   TRVSSSSVISGR"
FT   gene            complement(218029..221198)
FT                   /gene="LECRKA4.3"
FT                   /gene_synonym="F7A7.80"
FT                   /gene_synonym="F7A7_80"
FT                   /gene_synonym="L-type lectin receptor kinase VI.4"
FT                   /gene_synonym="LecRK-VI.4"
FT                   /gene_synonym="lectin receptor kinase a4.3"
FT                   /locus_tag="AT5G01560"
FT                   /note="Encodes LecRKA4.3, a member of the lectin receptor
FT                   kinase subfamily A4 (LecRKA4.1 At5g01540; LecRKA4.2
FT                   At5g01550; LecRKA4.3 At5g01560). Together with other
FT                   members of the subfamily, functions redundantly in the
FT                   negative regulation of ABA response in seed germination."
FT   mRNA            complement(218029..221198)
FT                   /gene="LECRKA4.3"
FT                   /gene_synonym="F7A7.80"
FT                   /gene_synonym="F7A7_80"
FT                   /gene_synonym="L-type lectin receptor kinase VI.4"
FT                   /gene_synonym="LecRK-VI.4"
FT                   /gene_synonym="lectin receptor kinase a4.3"
FT                   /locus_tag="AT5G01560"
FT                   /product="lectin receptor kinase a4.3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR362574.1,INSD:EH834355.1,INSD:DR284978.1,
FT                   INSD:DR284979.1,INSD:AU229014.1,INSD:EL102384.1,
FT                   INSD:DR362576.1,INSD:ES163378.1,INSD:DR284976.1,
FT                   INSD:ES121584.1,INSD:EL315375.1,INSD:DR284983.1,
FT                   INSD:EL968859.1,INSD:DR362575.1,INSD:DR362573.1,
FT                   INSD:DR383078.1,INSD:BP806064.1,INSD:DR284981.1,
FT                   INSD:AV539856.1,INSD:DR284984.1,INSD:DR284971.1,
FT                   INSD:EL115538.1,INSD:EL041740.1,INSD:DR284975.1,
FT                   INSD:ES056429.1,INSD:AU237906.1,INSD:DR284982.1,
FT                   INSD:DR284980.1,INSD:DR284974.1,INSD:BE038489.1,
FT                   INSD:DR284969.1,INSD:DR284972.1,INSD:DR280931.1,
FT                   INSD:DR284977.1,INSD:DR280932.1,INSD:ES034744.1,
FT                   INSD:CB259719.1,INSD:ES085305.1,INSD:DR284973.1,
FT                   INSD:DR284970.1,INSD:EL120899.1,INSD:DR383090.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831757.1,INSD:BT015370.1"
FT   CDS_pept        complement(218170..220245)
FT                   /codon_start=1
FT                   /gene="LECRKA4.3"
FT                   /gene_synonym="F7A7.80"
FT                   /gene_synonym="F7A7_80"
FT                   /gene_synonym="lectin receptor kinase a4.3"
FT                   /gene_synonym="L-type lectin receptor kinase VI.4"
FT                   /gene_synonym="LecRK-VI.4"
FT                   /locus_tag="AT5G01560"
FT                   /product="lectin receptor kinase a4.3"
FT                   /note="lectin receptor kinase a4.3 (LECRKA4.3); FUNCTIONS
FT                   IN: kinase activity; INVOLVED IN: abscisic acid mediated
FT                   signaling pathway, seed germination; LOCATED IN:
FT                   endomembrane system; CONTAINS InterPro DOMAIN/s: Legume
FT                   lectin, beta chain (InterPro:IPR001220), Protein kinase,
FT                   ATP binding site (InterPro:IPR017441),
FT                   Serine/threonine-protein kinase-like domain
FT                   (InterPro:IPR017442), Concanavalin A-like lectin/glucanase,
FT                   subgroup (InterPro:IPR013320), Protein kinase-like domain
FT                   (InterPro:IPR011009), Serine/threonine-protein kinase,
FT                   active site (InterPro:IPR008271), Protein kinase, catalytic
FT                   domain (InterPro:IPR000719), Concanavalin A-like
FT                   lectin/glucanase (InterPro:IPR008985); BEST Arabidopsis
FT                   thaliana protein match is: lectin receptor kinase a4.1
FT                   (TAIR:AT5G01550.1); Has 124782 Blast hits to 123109
FT                   proteins in 4852 species: Archae - 131; Bacteria - 14218;
FT                   Metazoa - 45637; Fungi - 10709; Plants - 35284; Viruses -
FT                   441; Other Eukaryotes - 18362 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q66GN2"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001220"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013320"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q66GN2"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR362574.1,INSD:EH834355.1,INSD:DR284978.1,
FT                   INSD:DR284979.1,INSD:AU229014.1,INSD:EL102384.1,
FT                   INSD:DR362576.1,INSD:ES163378.1,INSD:DR284976.1,
FT                   INSD:ES121584.1,INSD:EL315375.1,INSD:DR284983.1,
FT                   INSD:EL968859.1,INSD:DR362575.1,INSD:DR362573.1,
FT                   INSD:DR383078.1,INSD:BP806064.1,INSD:DR284981.1,
FT                   INSD:AV539856.1,INSD:DR284984.1,INSD:DR284971.1,
FT                   INSD:EL115538.1,INSD:EL041740.1,INSD:DR284975.1,
FT                   INSD:ES056429.1,INSD:AU237906.1,INSD:DR284982.1,
FT                   INSD:DR284980.1,INSD:DR284974.1,INSD:BE038489.1,
FT                   INSD:DR284969.1,INSD:DR284972.1,INSD:DR280931.1,
FT                   INSD:DR284977.1,INSD:DR280932.1,INSD:ES034744.1,
FT                   INSD:CB259719.1,INSD:ES085305.1,INSD:DR284973.1,
FT                   INSD:DR284970.1,INSD:EL120899.1,INSD:DR383090.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831757.1,INSD:BT015370.1"
FT                   /protein_id="AED90360.1"
FT   gene            220974..222798
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT   mRNA            join(220974..221124,221323..221538,221607..221748,
FT                   221828..221929,222068..222141,222244..222436)
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT   mRNA            join(221129..221538,221607..221748,221828..221929,
FT                   222068..222141,222244..222327,222611..222639)
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT   mRNA            join(221129..221538,221607..221748,221828..221929,
FT                   222068..222141,222244..222515)
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT   mRNA            join(221129..221538,221607..221748,221828..221929,
FT                   222068..222141,222266..222515)
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT   mRNA            join(221308..221538,221607..221748,221828..221929,
FT                   222068..222141,222244..222327,222640..222669,
FT                   222764..222798)
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT                   /inference="similar to RNA sequence, EST:INSD:EG421705.1"
FT   CDS_pept        join(221367..221538,221607..221748,221828..221929,
FT                   222068..222141,222244..222327,222640..222669,
FT                   222764..222798)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT                   /note="unknown protein; BEST Arabidopsis thaliana protein
FT                   match is: unknown protein (TAIR:AT3G08880.1); Has 1807
FT                   Blast hits to 1807 proteins in 277 species: Archae - 0;
FT                   Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01570"
FT                   /db_xref="GOA:F4K9F4"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9F4"
FT                   /inference="similar to RNA sequence, EST:INSD:EG421705.1"
FT                   /protein_id="AED90361.2"
FT   CDS_pept        join(221367..221538,221607..221748,221828..221929,
FT                   222068..222141,222244..222327,222611..222639)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01570"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BFI7"
FT                   /protein_id="ANM70326.1"
FT   CDS_pept        join(221367..221538,221607..221748,221828..221929,
FT                   222068..222141,222244..222356)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BFF1"
FT                   /protein_id="ANM70328.1"
FT   CDS_pept        join(221367..221538,221607..221748,221828..221929,
FT                   222068..222141,222244..222356)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BFF1"
FT                   /protein_id="ANM70329.1"
FT   CDS_pept        join(221367..221538,221607..221748,221828..221929,
FT                   222068..222141,222266..222270)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.90"
FT                   /gene_synonym="F7A7_90"
FT                   /locus_tag="AT5G01570"
FT                   /product="plectin-like protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01570"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BFI9"
FT                   /protein_id="ANM70327.1"
FT                   C"
FT   gene            222511..224034
FT                   /locus_tag="AT5G00780"
FT                   /note="Natural antisense transcript overlaps with
FT                   AT5G01580"
FT   ncRNA           join(222511..222669,222764..222866,223196..223399,
FT                   223488..223932)
FT                   /locus_tag="AT5G00780"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   ncRNA           join(222528..222866,223196..223399,223488..224034)
FT                   /locus_tag="AT5G00780"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            complement(222760..223852)
FT                   /gene="OSH1"
FT                   /gene_synonym="F7A7.100"
FT                   /gene_synonym="F7A7_100"
FT                   /gene_synonym="OAS HIGH ACCUMULATION 1"
FT                   /locus_tag="AT5G01580"
FT                   /note="thiol reductase in OAS metabolism"
FT   mRNA            complement(join(222760..222921,223003..223095,
FT                   223203..223340,223460..223525,223610..223852))
FT                   /gene="OSH1"
FT                   /gene_synonym="F7A7.100"
FT                   /gene_synonym="F7A7_100"
FT                   /gene_synonym="OAS HIGH ACCUMULATION 1"
FT                   /locus_tag="AT5G01580"
FT                   /product="gamma interferon responsive lysosomal thiol
FT                   (GILT) reductase family protein"
FT                   /inference="similar to RNA sequence, EST:INSD:EG498736.1"
FT   CDS_pept        complement(join(222760..222921,223003..223095,
FT                   223203..223340,223460..223525,223610..223852))
FT                   /codon_start=1
FT                   /gene="OSH1"
FT                   /gene_synonym="F7A7.100"
FT                   /gene_synonym="F7A7_100"
FT                   /gene_synonym="OAS HIGH ACCUMULATION 1"
FT                   /locus_tag="AT5G01580"
FT                   /product="gamma interferon responsive lysosomal thiol
FT                   (GILT) reductase family protein"
FT                   /note="OAS HIGH ACCUMULATION 1 (OSH1); FUNCTIONS IN:
FT                   catalytic activity; INVOLVED IN: biological_process
FT                   unknown; LOCATED IN: endomembrane system; CONTAINS InterPro
FT                   DOMAIN/s: Gamma interferon inducible lysosomal thiol
FT                   reductase GILT (InterPro:IPR004911); BEST Arabidopsis
FT                   thaliana protein match is: Thioredoxin superfamily protein
FT                   (TAIR:AT1G07080.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01580"
FT                   /db_xref="InterPro:IPR004911"
FT                   /db_xref="UniProtKB/TrEMBL:Q9M017"
FT                   /inference="similar to RNA sequence, EST:INSD:EG498736.1"
FT                   /protein_id="AED90362.1"
FT                   SNSPQVCYSNH"
FT   ncRNA           join(222930..223399,223488..224033)
FT                   /locus_tag="AT5G00780"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            224134..226926
FT                   /gene_synonym="F7A7.110"
FT                   /gene_synonym="F7A7_110"
FT                   /gene_synonym="TIC56"
FT                   /gene_synonym="TRANSLOCON AT THE INNER ENVELOPE MEMBRANE OF
FT                   CHLOROPLASTS 56"
FT                   /locus_tag="AT5G01590"
FT   mRNA            join(224134..224942,225406..225603,225723..226005,
FT                   226096..226258,226375..226926)
FT                   /gene_synonym="F7A7.110"
FT                   /gene_synonym="F7A7_110"
FT                   /gene_synonym="TIC56"
FT                   /gene_synonym="TRANSLOCON AT THE INNER ENVELOPE MEMBRANE OF
FT                   CHLOROPLASTS 56"
FT                   /locus_tag="AT5G01590"
FT                   /product="histone-lysine N-methyltransferase ATXR3-like
FT                   protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH911764.1,INSD:EL290968.1,INSD:EH931539.1,
FT                   INSD:EL218017.1,INSD:AV823461.1,INSD:ES143249.1,
FT                   INSD:EL092353.1,INSD:ES120172.1,INSD:EL007365.1,
FT                   INSD:EL256320.1,INSD:AV831658.1,INSD:EL181728.1,
FT                   INSD:EL056969.1,INSD:EL283437.1,INSD:AV557842.1,
FT                   INSD:EL101886.1,INSD:AV818493.1,INSD:EH926525.1,
FT                   INSD:AV813268.1,INSD:EL177726.1,INSD:AV561759.1,
FT                   INSD:DR276411.1,INSD:EL198314.1,INSD:EL202109.1,
FT                   INSD:DR382050.1,INSD:AV817315.1,INSD:ES131814.1,
FT                   INSD:EL135187.1,INSD:EL098402.1,INSD:DR276406.1,
FT                   INSD:BP828760.1,INSD:BP792244.1,INSD:EH990670.1,
FT                   INSD:DR276407.1,INSD:EL000021.1,INSD:EL302326.1,
FT                   INSD:EL151413.1,INSD:AV793234.1,INSD:DR276410.1,
FT                   INSD:DR276413.1,INSD:ES130922.1,INSD:ES049605.1,
FT                   INSD:BP828158.1,INSD:EL267266.1,INSD:DR276408.1,
FT                   INSD:DR276414.1,INSD:EL053299.1,INSD:EL968234.1,
FT                   INSD:DR295561.1,INSD:EL213418.1,INSD:DR276409.1,
FT                   INSD:BP793384.1,INSD:EL204742.1,INSD:EH879547.1,
FT                   INSD:EH958482.1,INSD:EL249641.1,INSD:EL336451.1,
FT                   INSD:BP808788.1,INSD:EL021518.1,INSD:DR359650.1,
FT                   INSD:BP669191.1,INSD:AV795594.1,INSD:AV804151.1,
FT                   INSD:EL307140.1,INSD:AV810236.1,INSD:ES136729.1,
FT                   INSD:DR276412.1,INSD:BP778634.1,INSD:BP788608.1,
FT                   INSD:BP792470.1,INSD:BP829643.1,INSD:EL041791.1,
FT                   INSD:ES030362.1,INSD:ES114159.1,INSD:EL261902.1,
FT                   INSD:AV794834.1,INSD:BP785319.1,INSD:EL050969.1,
FT                   INSD:AV784430.1,INSD:BP809697.1,INSD:ES161261.1,
FT                   INSD:AV788755.1,INSD:AV795289.1,INSD:AV794545.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY050767.1,INSD:BT008696.1"
FT   CDS_pept        join(224249..224942,225406..225603,225723..226005,
FT                   226096..226258,226375..226620)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.110"
FT                   /gene_synonym="F7A7_110"
FT                   /gene_synonym="TIC56"
FT                   /gene_synonym="TRANSLOCON AT THE INNER ENVELOPE MEMBRANE OF
FT                   CHLOROPLASTS 56"
FT                   /locus_tag="AT5G01590"
FT                   /product="histone-lysine N-methyltransferase ATXR3-like
FT                   protein"
FT                   /note="unknown protein; FUNCTIONS IN: molecular_function
FT                   unknown; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: chloroplast, chloroplast envelope; EXPRESSED IN: 22
FT                   plant structures; EXPRESSED DURING: 13 growth stages; Has
FT                   60 Blast hits to 59 proteins in 31 species: Archae - 0;
FT                   Bacteria - 20; Metazoa - 1; Fungi - 2; Plants - 33; Viruses
FT                   - 0; Other Eukaryotes - 4 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01590.1"
FT                   /db_xref="GOA:Q7Y1W1"
FT                   /db_xref="InterPro:IPR025640"
FT                   /db_xref="InterPro:IPR037471"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q7Y1W1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH911764.1,INSD:EL290968.1,INSD:EH931539.1,
FT                   INSD:EL218017.1,INSD:AV823461.1,INSD:ES143249.1,
FT                   INSD:EL092353.1,INSD:ES120172.1,INSD:EL007365.1,
FT                   INSD:EL256320.1,INSD:AV831658.1,INSD:EL181728.1,
FT                   INSD:EL056969.1,INSD:EL283437.1,INSD:AV557842.1,
FT                   INSD:EL101886.1,INSD:AV818493.1,INSD:EH926525.1,
FT                   INSD:AV813268.1,INSD:EL177726.1,INSD:AV561759.1,
FT                   INSD:DR276411.1,INSD:EL198314.1,INSD:EL202109.1,
FT                   INSD:DR382050.1,INSD:AV817315.1,INSD:ES131814.1,
FT                   INSD:EL135187.1,INSD:EL098402.1,INSD:DR276406.1,
FT                   INSD:BP828760.1,INSD:BP792244.1,INSD:EH990670.1,
FT                   INSD:DR276407.1,INSD:EL000021.1,INSD:EL302326.1,
FT                   INSD:EL151413.1,INSD:AV793234.1,INSD:DR276410.1,
FT                   INSD:DR276413.1,INSD:ES130922.1,INSD:ES049605.1,
FT                   INSD:BP828158.1,INSD:EL267266.1,INSD:DR276408.1,
FT                   INSD:DR276414.1,INSD:EL053299.1,INSD:EL968234.1,
FT                   INSD:DR295561.1,INSD:EL213418.1,INSD:DR276409.1,
FT                   INSD:BP793384.1,INSD:EL204742.1,INSD:EH879547.1,
FT                   INSD:EH958482.1,INSD:EL249641.1,INSD:EL336451.1,
FT                   INSD:BP808788.1,INSD:EL021518.1,INSD:DR359650.1,
FT                   INSD:BP669191.1,INSD:AV795594.1,INSD:AV804151.1,
FT                   INSD:EL307140.1,INSD:AV810236.1,INSD:ES136729.1,
FT                   INSD:DR276412.1,INSD:BP778634.1,INSD:BP788608.1,
FT                   INSD:BP792470.1,INSD:BP829643.1,INSD:EL041791.1,
FT                   INSD:ES030362.1,INSD:ES114159.1,INSD:EL261902.1,
FT                   INSD:AV794834.1,INSD:BP785319.1,INSD:EL050969.1,
FT                   INSD:AV784430.1,INSD:BP809697.1,INSD:ES161261.1,
FT                   INSD:AV788755.1,INSD:AV795289.1,INSD:AV794545.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY050767.1,INSD:BT008696.1"
FT                   /protein_id="AED90363.1"
FT                   EDDDSNSKKD"
FT   gene            226972..229286
FT                   /locus_tag="AT5G01595"
FT                   /note="Natural antisense transcript overlaps with
FT                   AT5G01600; Potential natural antisense gene, locus overlaps
FT                   with AT5G01600"
FT   ncRNA           join(226972..227129,227757..227838,229263..229286)
FT                   /locus_tag="AT5G01595"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            complement(227953..230051)
FT                   /gene="FER1"
FT                   /gene_synonym="ARABIDOPSIS THALIANA FERRETIN 1"
FT                   /gene_synonym="ATFER1"
FT                   /gene_synonym="ferretin 1"
FT                   /locus_tag="AT5G01600"
FT                   /note="Encodes a ferretin protein that is targeted to the
FT                   chloroplast. Member of a Ferritin gene family. Gene
FT                   expression is induced in response to iron overload and by
FT                   nitric oxide. Expression of the gene is downregulated in
FT                   the presence of paraquat, an inducer of photoxidative
FT                   stress."
FT   mRNA            complement(join(227953..228183,228272..228335,
FT                   228429..228494,228590..228651,228753..228840,
FT                   228941..229001,229114..229197,229287..230051))
FT                   /gene="FER1"
FT                   /gene_synonym="ARABIDOPSIS THALIANA FERRETIN 1"
FT                   /gene_synonym="ATFER1"
FT                   /gene_synonym="ferretin 1"
FT                   /locus_tag="AT5G01600"
FT                   /product="ferretin 1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP797874.1,INSD:EH979537.1,INSD:EL073210.1,
FT                   INSD:BP816148.1,INSD:AV794321.1,INSD:BP817364.1,
FT                   INSD:BP560425.1,INSD:BP860204.1,INSD:ES014884.1,
FT                   INSD:BP592920.1,INSD:AV538677.1,INSD:EH856702.1,
FT                   INSD:BP841146.1,INSD:ES194421.1,INSD:AV824748.1,
FT                   INSD:EL095908.1,INSD:ES192958.1,INSD:EG487886.1,
FT                   INSD:BP815895.1,INSD:ES067962.1,INSD:BP805663.1,
FT                   INSD:AV806232.1,INSD:T04388.1,INSD:BP566435.1,
FT                   INSD:BP831265.1,INSD:AV796351.1,INSD:CK121416.1,
FT                   INSD:BP822013.1,INSD:BP661563.1,INSD:AA597366.1,
FT                   INSD:BP856254.1,INSD:ES166090.1,INSD:CB252417.1,
FT                   INSD:EL194740.1,INSD:BP632283.1,INSD:BP662030.1,
FT                   INSD:DR269953.1,INSD:AV535334.1,INSD:AV805648.1,
FT                   INSD:AV562066.1,INSD:EH877560.1,INSD:AV813381.1,
FT                   INSD:ES079349.1,INSD:EL284016.1,INSD:BP819416.2,
FT                   INSD:EG470686.1,INSD:BP655311.1,INSD:AV798328.1,
FT                   INSD:EH836858.1,INSD:DR370128.1,INSD:AV564705.1,
FT                   INSD:ES209040.1,INSD:BP832154.1,INSD:AV562617.1,
FT                   INSD:EH930890.1,INSD:DR269956.1,INSD:AV535957.1,
FT                   INSD:BP585560.1,INSD:BP810361.1,INSD:AV538072.1,
FT                   INSD:EG499974.1,INSD:EL160307.1,INSD:EH934272.1,
FT                   INSD:BP654467.1,INSD:EL999105.1,INSD:BP806424.2,
FT                   INSD:BP580340.1,INSD:ES187020.1,INSD:EH960949.1,
FT                   INSD:AI997778.1,INSD:ES085762.1,INSD:EH881232.1,
FT                   INSD:BP560959.1,INSD:ES196236.1,INSD:BP810315.1,
FT                   INSD:BP834986.1,INSD:BE521679.1,INSD:EH970502.1,
FT                   INSD:CK119363.1,INSD:BP640954.1,INSD:BP827683.1,
FT                   INSD:EL301410.1,INSD:BP819095.1,INSD:BP662544.1,
FT                   INSD:AV811046.1,INSD:EL149555.1,INSD:EL026621.1,
FT                   INSD:BP626937.1,INSD:EG470683.1,INSD:BP590189.1,
FT                   INSD:BP859687.1,INSD:CB258647.1,INSD:ES017254.1,
FT                   INSD:BP609131.1,INSD:ES191511.1,INSD:EL330029.1,
FT                   INSD:CK121876.1,INSD:ES124115.1,INSD:BP625953.1,
FT                   INSD:EL329119.1,INSD:BP845929.1,INSD:BP646760.1,
FT                   INSD:ES006023.1,INSD:BP860612.1,INSD:AV560343.1,
FT                   INSD:BP825595.2,INSD:DR269950.1,INSD:BP563456.1,
FT                   INSD:EL307118.1,INSD:BP856220.1,INSD:BP820048.1,
FT                   INSD:BP609436.1,INSD:BP821859.1,INSD:ES025478.1,
FT                   INSD:BP600938.1,INSD:BP586770.1,INSD:BP625670.1,
FT                   INSD:BP846074.1,INSD:BP857184.1,INSD:EL975874.1,
FT                   INSD:BP635438.1,INSD:BP859791.1,INSD:BP826907.1,
FT                   INSD:CB255259.1,INSD:AV785072.1,INSD:AV794252.1,
FT                   INSD:BP816337.1,INSD:BP567509.1,INSD:EG525532.1,
FT                   INSD:BP817680.1,INSD:BP834387.1,INSD:AV807258.1,
FT                   INSD:BP613355.1,INSD:EL149543.1,INSD:BP809325.1,
FT                   INSD:ES213334.1,INSD:AV815665.1,INSD:EG490027.1,
FT                   INSD:Z18156.1,INSD:BP831465.1,INSD:ES083624.1,
FT                   INSD:EH882205.1,INSD:ES097901.1,INSD:EL074981.1,
FT                   INSD:BP669507.1,INSD:ES030295.1,INSD:DR269951.1,
FT                   INSD:BP849105.2,INSD:CK119275.1,INSD:EG499976.1,
FT                   INSD:BP641849.1,INSD:EH893147.1,INSD:EG490028.1,
FT                   INSD:AV781358.1,INSD:EG522002.1,INSD:BP619422.1,
FT                   INSD:BP608335.1,INSD:BP651772.1,INSD:EH929694.1,
FT                   INSD:BP668442.1,INSD:EH884615.1,INSD:BP622037.1,
FT                   INSD:BE521680.1,INSD:BE844770.1,INSD:EH817469.1,
FT                   INSD:EL197986.1,INSD:BP819314.1,INSD:EL967890.1,
FT                   INSD:AV550220.1,INSD:BP657921.1,INSD:BP573643.1,
FT                   INSD:BP858424.1,INSD:BP590721.1,INSD:ES057102.1,
FT                   INSD:DR269954.1,INSD:BP820380.1,INSD:DR269947.1,
FT                   INSD:AV814866.1,INSD:CB257060.1,INSD:EL128033.1,
FT                   INSD:AV564739.1,INSD:EL300525.1,INSD:ES200955.1,
FT                   INSD:ES046008.1,INSD:BP856389.1,INSD:BP788691.1,
FT                   INSD:CB258963.1,INSD:EG523356.1,INSD:AV562546.1,
FT                   INSD:T42999.1,INSD:EH994988.1,INSD:EL204684.1,
FT                   INSD:BP588596.1,INSD:BP862986.1,INSD:BP571556.1,
FT                   INSD:BP617314.1,INSD:AV520721.1,INSD:EH860758.1,
FT                   INSD:DR269949.1,INSD:EG522003.1,INSD:EL982599.1,
FT                   INSD:AV441450.1,INSD:BP840633.1,INSD:BP831821.1,
FT                   INSD:EG481093.1,INSD:ES134179.1,INSD:ES214042.1,
FT                   INSD:EL974389.1,INSD:EH847154.1,INSD:EL267021.1,
FT                   INSD:EH891317.1,INSD:EL989508.1,INSD:BP844218.1,
FT                   INSD:T42023.1,INSD:AV560198.1,INSD:H37125.1,
FT                   INSD:EL069379.1,INSD:ES033298.1,INSD:EG488074.1,
FT                   INSD:BP650949.1,INSD:BP583353.1,INSD:AV557595.1,
FT                   INSD:BP841312.1,INSD:EL080897.1,INSD:BP649234.1,
FT                   INSD:EH841385.1,INSD:BP596709.1,INSD:EL074366.1,
FT                   INSD:ES043863.1,INSD:EL980930.1,INSD:BP589913.1,
FT                   INSD:ES151513.1,INSD:EL026516.1,INSD:BP595619.1,
FT                   INSD:T75606.1,INSD:CK119920.1,INSD:AV815804.1,
FT                   INSD:BP566589.1,INSD:BP863563.1,INSD:R64909.1,
FT                   INSD:BP563108.1,INSD:BP601579.1,INSD:BP854231.1,
FT                   INSD:BP861167.1,INSD:BP816671.1,INSD:BP824349.1,
FT                   INSD:BP671952.1,INSD:EL981070.1,INSD:BP666940.1,
FT                   INSD:BP654472.1,INSD:EL998576.1,INSD:DR269952.1,
FT                   INSD:EL064157.1,INSD:CK118115.1,INSD:BP836002.1,
FT                   INSD:EL275290.1,INSD:R86990.1,INSD:EH993315.1,
FT                   INSD:ES171814.1,INSD:ES076814.1,INSD:ES049091.1,
FT                   INSD:BP806131.1,INSD:AV809712.1,INSD:EL172942.1,
FT                   INSD:BP568263.1,INSD:BP621116.1,INSD:BP845329.1,
FT                   INSD:EG448548.1,INSD:BP604364.1,INSD:ES137834.1,
FT                   INSD:ES210817.1,INSD:BP818903.1,INSD:BP810006.2,
FT                   INSD:ES009937.1,INSD:BP833966.1,INSD:ES208448.1,
FT                   INSD:EL282324.1,INSD:BP843402.1,INSD:EG455144.1,
FT                   INSD:CD531964.1,INSD:BP781865.1,INSD:EG488085.1,
FT                   INSD:AV534494.1,INSD:EH865880.1,INSD:EL243281.1,
FT                   INSD:CD532714.1,INSD:EG455143.1,INSD:EL099544.1,
FT                   INSD:EL974150.1,INSD:ES161600.1,INSD:BP641191.1,
FT                   INSD:BP638206.1,INSD:BP845747.2,INSD:DR269955.1,
FT                   INSD:BP592385.1,INSD:BP649103.1,INSD:EG525534.1,
FT                   INSD:BP651373.1,INSD:EL038973.1,INSD:EL183283.1,
FT                   INSD:T45167.1,INSD:BP651874.1,INSD:ES132107.1,
FT                   INSD:EG520919.1,INSD:BP622742.1,INSD:BP657885.1,
FT                   INSD:BP824396.1,INSD:BP841252.1,INSD:BP625567.1,
FT                   INSD:AV553061.1,INSD:BP846350.1,INSD:BP840866.1,
FT                   INSD:EG448546.1,INSD:AV811958.1,INSD:BP842200.1,
FT                   INSD:BP859857.1,INSD:BP861364.2,INSD:BP843027.1,
FT                   INSD:Z30743.1,INSD:BP825262.2,INSD:DR269944.1,
FT                   INSD:BP560619.1,INSD:AV804569.1,INSD:AV562570.1,
FT                   INSD:EL970554.1,INSD:BP614111.1,INSD:AV565909.1,
FT                   INSD:ES177293.1,INSD:EL299935.1,INSD:EL334094.1,
FT                   INSD:BP628068.1,INSD:EL187175.1,INSD:BP840744.1,
FT                   INSD:BP659304.1,INSD:BP836907.1,INSD:BP857235.1,
FT                   INSD:CB255822.1,INSD:EL097395.1,INSD:BP867524.1,
FT                   INSD:AV784079.1,INSD:BP824954.1,INSD:BP798558.1,
FT                   INSD:ES026608.1,INSD:EH897465.1,INSD:BP800471.1,
FT                   INSD:EL037899.1,INSD:EH821718.1,INSD:BP670484.1,
FT                   INSD:BP638989.1,INSD:BP826928.1,INSD:BP802108.1,
FT                   INSD:EH978118.1,INSD:BP669013.1,INSD:EL147017.1,
FT                   INSD:BP811040.1,INSD:AV531795.1,INSD:DR269945.1,
FT                   INSD:BP638289.1,INSD:CF652310.1,INSD:ES124554.1,
FT                   INSD:BP605648.1,INSD:AV823972.1,INSD:AB050569.1,
FT                   INSD:ES197536.1,INSD:BP818773.1,INSD:BP641643.1,
FT                   INSD:BP820902.1,INSD:ES072116.1,INSD:ES012217.1,
FT                   INSD:ES050601.1,INSD:BP640637.1,INSD:EG471925.1,
FT                   INSD:EL145369.1,INSD:ES014864.1,INSD:ES147814.1,
FT                   INSD:BP832274.1,INSD:BP805829.1,INSD:ES155601.1,
FT                   INSD:BP827447.1,INSD:EL968460.1,INSD:AV818210.1,
FT                   INSD:ES164286.1,INSD:BP812589.1,INSD:AV527160.1,
FT                   INSD:ES023308.1,INSD:BP605075.1,INSD:ES179658.1,
FT                   INSD:BP572945.1,INSD:BP638159.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF339691.1,INSD:AK220892.1,INSD:BX829583.1,
FT                   INSD:BX830797.1,INSD:BX841654.1,INSD:AY084509.1,
FT                   INSD:X94248.1,INSD:AF326869.1,INSD:AF412065.1,
FT                   INSD:AK226433.1"
FT   CDS_pept        complement(join(228149..228183,228272..228335,
FT                   228429..228494,228590..228651,228753..228840,
FT                   228941..229001,229114..229197,229287..229594))
FT                   /codon_start=1
FT                   /gene="FER1"
FT                   /gene_synonym="ARABIDOPSIS THALIANA FERRETIN 1"
FT                   /gene_synonym="ATFER1"
FT                   /gene_synonym="ferretin 1"
FT                   /locus_tag="AT5G01600"
FT                   /product="ferretin 1"
FT                   /note="ferretin 1 (FER1); FUNCTIONS IN: ferric iron
FT                   binding, iron ion binding; INVOLVED IN: in 12 processes;
FT                   LOCATED IN: thylakoid, chloroplast thylakoid membrane,
FT                   chloroplast stroma, chloroplast, membrane; EXPRESSED IN: 25
FT                   plant structures; EXPRESSED DURING: 15 growth stages;
FT                   CONTAINS InterPro DOMAIN/s: Ferritin, N-terminal
FT                   (InterPro:IPR001519), Ferritin-related
FT                   (InterPro:IPR012347), Ferritin-like (InterPro:IPR009040),
FT                   Ferritin, conserved site (InterPro:IPR014034),
FT                   Ferritin/ribonucleotide reductase-like
FT                   (InterPro:IPR009078), Ferritin/Dps protein
FT                   (InterPro:IPR008331); BEST Arabidopsis thaliana protein
FT                   match is: ferritin 4 (TAIR:AT2G40300.1); Has 1807 Blast
FT                   hits to 1807 proteins in 277 species: Archae - 0; Bacteria
FT                   - 0; Metazoa - 736; Fungi - 347; Plants - 385; Viruses - 0;
FT                   Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q39101"
FT                   /db_xref="InterPro:IPR001519"
FT                   /db_xref="InterPro:IPR008331"
FT                   /db_xref="InterPro:IPR009040"
FT                   /db_xref="InterPro:IPR009078"
FT                   /db_xref="InterPro:IPR012347"
FT                   /db_xref="InterPro:IPR014034"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q39101"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP797874.1,INSD:EH979537.1,INSD:EL073210.1,
FT                   INSD:BP816148.1,INSD:AV794321.1,INSD:BP817364.1,
FT                   INSD:BP560425.1,INSD:BP860204.1,INSD:ES014884.1,
FT                   INSD:BP592920.1,INSD:AV538677.1,INSD:EH856702.1,
FT                   INSD:BP841146.1,INSD:ES194421.1,INSD:AV824748.1,
FT                   INSD:EL095908.1,INSD:ES192958.1,INSD:EG487886.1,
FT                   INSD:BP815895.1,INSD:ES067962.1,INSD:BP805663.1,
FT                   INSD:AV806232.1,INSD:T04388.1,INSD:BP566435.1,
FT                   INSD:BP831265.1,INSD:AV796351.1,INSD:CK121416.1,
FT                   INSD:BP822013.1,INSD:BP661563.1,INSD:AA597366.1,
FT                   INSD:BP856254.1,INSD:ES166090.1,INSD:CB252417.1,
FT                   INSD:EL194740.1,INSD:BP632283.1,INSD:BP662030.1,
FT                   INSD:DR269953.1,INSD:AV535334.1,INSD:AV805648.1,
FT                   INSD:AV562066.1,INSD:EH877560.1,INSD:AV813381.1,
FT                   INSD:ES079349.1,INSD:EL284016.1,INSD:BP819416.2,
FT                   INSD:EG470686.1,INSD:BP655311.1,INSD:AV798328.1,
FT                   INSD:EH836858.1,INSD:DR370128.1,INSD:AV564705.1,
FT                   INSD:ES209040.1,INSD:BP832154.1,INSD:AV562617.1,
FT                   INSD:EH930890.1,INSD:DR269956.1,INSD:AV535957.1,
FT                   INSD:BP585560.1,INSD:BP810361.1,INSD:AV538072.1,
FT                   INSD:EG499974.1,INSD:EL160307.1,INSD:EH934272.1,
FT                   INSD:BP654467.1,INSD:EL999105.1,INSD:BP806424.2,
FT                   INSD:BP580340.1,INSD:ES187020.1,INSD:EH960949.1,
FT                   INSD:AI997778.1,INSD:ES085762.1,INSD:EH881232.1,
FT                   INSD:BP560959.1,INSD:ES196236.1,INSD:BP810315.1,
FT                   INSD:BP834986.1,INSD:BE521679.1,INSD:EH970502.1,
FT                   INSD:CK119363.1,INSD:BP640954.1,INSD:BP827683.1,
FT                   INSD:EL301410.1,INSD:BP819095.1,INSD:BP662544.1,
FT                   INSD:AV811046.1,INSD:EL149555.1,INSD:EL026621.1,
FT                   INSD:BP626937.1,INSD:EG470683.1,INSD:BP590189.1,
FT                   INSD:BP859687.1,INSD:CB258647.1,INSD:ES017254.1,
FT                   INSD:BP609131.1,INSD:ES191511.1,INSD:EL330029.1,
FT                   INSD:CK121876.1,INSD:ES124115.1,INSD:BP625953.1,
FT                   INSD:EL329119.1,INSD:BP845929.1,INSD:BP646760.1,
FT                   INSD:ES006023.1,INSD:BP860612.1,INSD:AV560343.1,
FT                   INSD:BP825595.2,INSD:DR269950.1,INSD:BP563456.1,
FT                   INSD:EL307118.1,INSD:BP856220.1,INSD:BP820048.1,
FT                   INSD:BP609436.1,INSD:BP821859.1,INSD:ES025478.1,
FT                   INSD:BP600938.1,INSD:BP586770.1,INSD:BP625670.1,
FT                   INSD:BP846074.1,INSD:BP857184.1,INSD:EL975874.1,
FT                   INSD:BP635438.1,INSD:BP859791.1,INSD:BP826907.1,
FT                   INSD:CB255259.1,INSD:AV785072.1,INSD:AV794252.1,
FT                   INSD:BP816337.1,INSD:BP567509.1,INSD:EG525532.1,
FT                   INSD:BP817680.1,INSD:BP834387.1,INSD:AV807258.1,
FT                   INSD:BP613355.1,INSD:EL149543.1,INSD:BP809325.1,
FT                   INSD:ES213334.1,INSD:AV815665.1,INSD:EG490027.1,
FT                   INSD:Z18156.1,INSD:BP831465.1,INSD:ES083624.1,
FT                   INSD:EH882205.1,INSD:ES097901.1,INSD:EL074981.1,
FT                   INSD:BP669507.1,INSD:ES030295.1,INSD:DR269951.1,
FT                   INSD:BP849105.2,INSD:CK119275.1,INSD:EG499976.1,
FT                   INSD:BP641849.1,INSD:EH893147.1,INSD:EG490028.1,
FT                   INSD:AV781358.1,INSD:EG522002.1,INSD:BP619422.1,
FT                   INSD:BP608335.1,INSD:BP651772.1,INSD:EH929694.1,
FT                   INSD:BP668442.1,INSD:EH884615.1,INSD:BP622037.1,
FT                   INSD:BE521680.1,INSD:BE844770.1,INSD:EH817469.1,
FT                   INSD:EL197986.1,INSD:BP819314.1,INSD:EL967890.1,
FT                   INSD:AV550220.1,INSD:BP657921.1,INSD:BP573643.1,
FT                   INSD:BP858424.1,INSD:BP590721.1,INSD:ES057102.1,
FT                   INSD:DR269954.1,INSD:BP820380.1,INSD:DR269947.1,
FT                   INSD:AV814866.1,INSD:CB257060.1,INSD:EL128033.1,
FT                   INSD:AV564739.1,INSD:EL300525.1,INSD:ES200955.1,
FT                   INSD:ES046008.1,INSD:BP856389.1,INSD:BP788691.1,
FT                   INSD:CB258963.1,INSD:EG523356.1,INSD:AV562546.1,
FT                   INSD:T42999.1,INSD:EH994988.1,INSD:EL204684.1,
FT                   INSD:BP588596.1,INSD:BP862986.1,INSD:BP571556.1,
FT                   INSD:BP617314.1,INSD:AV520721.1,INSD:EH860758.1,
FT                   INSD:DR269949.1,INSD:EG522003.1,INSD:EL982599.1,
FT                   INSD:AV441450.1,INSD:BP840633.1,INSD:BP831821.1,
FT                   INSD:EG481093.1,INSD:ES134179.1,INSD:ES214042.1,
FT                   INSD:EL974389.1,INSD:EH847154.1,INSD:EL267021.1,
FT                   INSD:EH891317.1,INSD:EL989508.1,INSD:BP844218.1,
FT                   INSD:T42023.1,INSD:AV560198.1,INSD:H37125.1,
FT                   INSD:EL069379.1,INSD:ES033298.1,INSD:EG488074.1,
FT                   INSD:BP650949.1,INSD:BP583353.1,INSD:AV557595.1,
FT                   INSD:BP841312.1,INSD:EL080897.1,INSD:BP649234.1,
FT                   INSD:EH841385.1,INSD:BP596709.1,INSD:EL074366.1,
FT                   INSD:ES043863.1,INSD:EL980930.1,INSD:BP589913.1,
FT                   INSD:ES151513.1,INSD:EL026516.1,INSD:BP595619.1,
FT                   INSD:T75606.1,INSD:CK119920.1,INSD:AV815804.1,
FT                   INSD:BP566589.1,INSD:BP863563.1,INSD:R64909.1,
FT                   INSD:BP563108.1,INSD:BP601579.1,INSD:BP854231.1,
FT                   INSD:BP861167.1,INSD:BP816671.1,INSD:BP824349.1,
FT                   INSD:BP671952.1,INSD:EL981070.1,INSD:BP666940.1,
FT                   INSD:BP654472.1,INSD:EL998576.1,INSD:DR269952.1,
FT                   INSD:EL064157.1,INSD:CK118115.1,INSD:BP836002.1,
FT                   INSD:EL275290.1,INSD:R86990.1,INSD:EH993315.1,
FT                   INSD:ES171814.1,INSD:ES076814.1,INSD:ES049091.1,
FT                   INSD:BP806131.1,INSD:AV809712.1,INSD:EL172942.1,
FT                   INSD:BP568263.1,INSD:BP621116.1,INSD:BP845329.1,
FT                   INSD:EG448548.1,INSD:BP604364.1,INSD:ES137834.1,
FT                   INSD:ES210817.1,INSD:BP818903.1,INSD:BP810006.2,
FT                   INSD:ES009937.1,INSD:BP833966.1,INSD:ES208448.1,
FT                   INSD:EL282324.1,INSD:BP843402.1,INSD:EG455144.1,
FT                   INSD:CD531964.1,INSD:BP781865.1,INSD:EG488085.1,
FT                   INSD:AV534494.1,INSD:EH865880.1,INSD:EL243281.1,
FT                   INSD:CD532714.1,INSD:EG455143.1,INSD:EL099544.1,
FT                   INSD:EL974150.1,INSD:ES161600.1,INSD:BP641191.1,
FT                   INSD:BP638206.1,INSD:BP845747.2,INSD:DR269955.1,
FT                   INSD:BP592385.1,INSD:BP649103.1,INSD:EG525534.1,
FT                   INSD:BP651373.1,INSD:EL038973.1,INSD:EL183283.1,
FT                   INSD:T45167.1,INSD:BP651874.1,INSD:ES132107.1,
FT                   INSD:EG520919.1,INSD:BP622742.1,INSD:BP657885.1,
FT                   INSD:BP824396.1,INSD:BP841252.1,INSD:BP625567.1,
FT                   INSD:AV553061.1,INSD:BP846350.1,INSD:BP840866.1,
FT                   INSD:EG448546.1,INSD:AV811958.1,INSD:BP842200.1,
FT                   INSD:BP859857.1,INSD:BP861364.2,INSD:BP843027.1,
FT                   INSD:Z30743.1,INSD:BP825262.2,INSD:DR269944.1,
FT                   INSD:BP560619.1,INSD:AV804569.1,INSD:AV562570.1,
FT                   INSD:EL970554.1,INSD:BP614111.1,INSD:AV565909.1,
FT                   INSD:ES177293.1,INSD:EL299935.1,INSD:EL334094.1,
FT                   INSD:BP628068.1,INSD:EL187175.1,INSD:BP840744.1,
FT                   INSD:BP659304.1,INSD:BP836907.1,INSD:BP857235.1,
FT                   INSD:CB255822.1,INSD:EL097395.1,INSD:BP867524.1,
FT                   INSD:AV784079.1,INSD:BP824954.1,INSD:BP798558.1,
FT                   INSD:ES026608.1,INSD:EH897465.1,INSD:BP800471.1,
FT                   INSD:EL037899.1,INSD:EH821718.1,INSD:BP670484.1,
FT                   INSD:BP638989.1,INSD:BP826928.1,INSD:BP802108.1,
FT                   INSD:EH978118.1,INSD:BP669013.1,INSD:EL147017.1,
FT                   INSD:BP811040.1,INSD:AV531795.1,INSD:DR269945.1,
FT                   INSD:BP638289.1,INSD:CF652310.1,INSD:ES124554.1,
FT                   INSD:BP605648.1,INSD:AV823972.1,INSD:AB050569.1,
FT                   INSD:ES197536.1,INSD:BP818773.1,INSD:BP641643.1,
FT                   INSD:BP820902.1,INSD:ES072116.1,INSD:ES012217.1,
FT                   INSD:ES050601.1,INSD:BP640637.1,INSD:EG471925.1,
FT                   INSD:EL145369.1,INSD:ES014864.1,INSD:ES147814.1,
FT                   INSD:BP832274.1,INSD:BP805829.1,INSD:ES155601.1,
FT                   INSD:BP827447.1,INSD:EL968460.1,INSD:AV818210.1,
FT                   INSD:ES164286.1,INSD:BP812589.1,INSD:AV527160.1,
FT                   INSD:ES023308.1,INSD:BP605075.1,INSD:ES179658.1,
FT                   INSD:BP572945.1,INSD:BP638159.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF339691.1,INSD:AK220892.1,INSD:BX829583.1,
FT                   INSD:BX830797.1,INSD:BX841654.1,INSD:AY084509.1,
FT                   INSD:X94248.1,INSD:AF326869.1,INSD:AF412065.1,
FT                   INSD:AK226433.1"
FT                   /protein_id="AED90364.1"
FT   gene            230829..232216
FT                   /gene_synonym="F7A7.130"
FT                   /gene_synonym="F7A7_130"
FT                   /locus_tag="AT5G01610"
FT   mRNA            join(230829..230839,230947..231161,231485..231539,
FT                   231624..232205)
FT                   /gene_synonym="F7A7.130"
FT                   /gene_synonym="F7A7_130"
FT                   /locus_tag="AT5G01610"
FT                   /product="hypothetical protein (Protein of unknown
FT                   function, DUF538)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR373420.1,INSD:BP562720.2,INSD:DR211904.1,
FT                   INSD:ES152253.1,INSD:DR211905.1,INSD:BP841998.1,
FT                   INSD:DR211906.1,INSD:AU226437.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT011918.1,INSD:AY086139.1,INSD:AK227765.1,
FT                   INSD:BT004797.1"
FT   mRNA            join(230843..231161,231485..231539,231624..232216)
FT                   /gene_synonym="F7A7.130"
FT                   /gene_synonym="F7A7_130"
FT                   /locus_tag="AT5G01610"
FT                   /product="hypothetical protein (Protein of unknown
FT                   function, DUF538)"
FT   CDS_pept        join(231075..231161,231485..231539,231624..231994)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.130"
FT                   /gene_synonym="F7A7_130"
FT                   /locus_tag="AT5G01610"
FT                   /product="hypothetical protein (Protein of unknown
FT                   function, DUF538)"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01610"
FT                   /db_xref="GOA:Q9M015"
FT                   /db_xref="InterPro:IPR007493"
FT                   /db_xref="InterPro:IPR036758"
FT                   /db_xref="PDB:1YDU"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M015"
FT                   /protein_id="ANM68392.1"
FT                   GLRVDKF"
FT   CDS_pept        join(231075..231161,231485..231539,231624..231994)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.130"
FT                   /gene_synonym="F7A7_130"
FT                   /locus_tag="AT5G01610"
FT                   /product="hypothetical protein (Protein of unknown
FT                   function, DUF538)"
FT                   /note="Protein of unknown function, DUF538; CONTAINS
FT                   InterPro DOMAIN/s: Protein of unknown function DUF538
FT                   (InterPro:IPR007493); BEST Arabidopsis thaliana protein
FT                   match is: Protein of unknown function, DUF538
FT                   (TAIR:AT3G08890.2); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M015"
FT                   /db_xref="InterPro:IPR007493"
FT                   /db_xref="InterPro:IPR036758"
FT                   /db_xref="PDB:1YDU"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M015"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR373420.1,INSD:BP562720.2,INSD:DR211904.1,
FT                   INSD:ES152253.1,INSD:DR211905.1,INSD:BP841998.1,
FT                   INSD:DR211906.1,INSD:AU226437.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT011918.1,INSD:AY086139.1,INSD:AK227765.1,
FT                   INSD:BT004797.1"
FT                   /protein_id="AED90365.1"
FT                   GLRVDKF"
FT   gene            232565..234916
FT                   /gene="TBL35"
FT                   /gene_synonym="F7A7.140"
FT                   /gene_synonym="F7A7_140"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /locus_tag="AT5G01620"
FT                   /note="Encodes a member of the TBL (TRICHOME
FT                   BIREFRINGENCE-LIKE) gene family containing a plant-specific
FT                   DUF231 (domain of unknown function) domain. TBL gene family
FT                   has 46 members, two of which (TBR/AT5G06700 and
FT                   TBL3/AT5G01360) have been shown to be involved in the
FT                   synthesis and deposition of secondary wall cellulose,
FT                   presumably by influencing the esterification state of
FT                   pectic polymers. A nomenclature for this gene family has
FT                   been proposed (Volker Bischoff & Wolf Scheible, 2010,
FT                   personal communication)."
FT   mRNA            join(232565..232659,232774..233092,233207..233492,
FT                   233691..233862,233964..234160,234242..234394,
FT                   234491..234916)
FT                   /gene="TBL35"
FT                   /gene_synonym="F7A7.140"
FT                   /gene_synonym="F7A7_140"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /locus_tag="AT5G01620"
FT                   /product="TRICHOME BIREFRINGENCE-LIKE 35"
FT   mRNA            join(232585..233092,233207..233492,233691..233862,
FT                   233964..234160,234242..234394,234491..234916)
FT                   /gene="TBL35"
FT                   /gene_synonym="F7A7.140"
FT                   /gene_synonym="F7A7_140"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /locus_tag="AT5G01620"
FT                   /product="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV785707.1,INSD:CF772985.1,INSD:AV441710.1,
FT                   INSD:ES123425.1,INSD:DR379270.1,INSD:ES003552.1,
FT                   INSD:EH852298.1,INSD:DR378727.1,INSD:ES181936.1,
FT                   INSD:EL146039.1,INSD:AU227536.1,INSD:AV543066.1,
FT                   INSD:ES066611.1,INSD:EL131616.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY117243.1,INSD:BX831772.1,INSD:AY080736.1"
FT   mRNA            join(232732..233092,233183..233492,233691..233862,
FT                   233964..234160,234242..234394,234491..234847)
FT                   /gene="TBL35"
FT                   /gene_synonym="F7A7.140"
FT                   /gene_synonym="F7A7_140"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /locus_tag="AT5G01620"
FT                   /product="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV785707.1,INSD:CF772985.1,INSD:AV441710.1,
FT                   INSD:ES123425.1,INSD:DR379270.1,INSD:ES003552.1,
FT                   INSD:EH852298.1,INSD:DR378727.1,INSD:DR287059.1,
FT                   INSD:ES181936.1,INSD:EL146039.1,INSD:AU227536.1,
FT                   INSD:ES066611.1,INSD:EL131616.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY117243.1,INSD:AY084435.1,INSD:BX831772.1"
FT   CDS_pept        join(232882..233092,233183..233492,233691..233862,
FT                   233964..234160,234242..234394,234491..234821)
FT                   /codon_start=1
FT                   /gene="TBL35"
FT                   /gene_synonym="F7A7.140"
FT                   /gene_synonym="F7A7_140"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /locus_tag="AT5G01620"
FT                   /product="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /note="TRICHOME BIREFRINGENCE-LIKE 35 (TBL35); LOCATED IN:
FT                   endomembrane system; EXPRESSED IN: 22 plant structures;
FT                   EXPRESSED DURING: 14 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Protein of unknown function DUF231, plant
FT                   (InterPro:IPR004253); BEST Arabidopsis thaliana protein
FT                   match is: TRICHOME BIREFRINGENCE-LIKE 34
FT                   (TAIR:AT2G38320.1)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01620"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01620.3"
FT                   /db_xref="GOA:Q8RXQ1"
FT                   /db_xref="InterPro:IPR025846"
FT                   /db_xref="InterPro:IPR026057"
FT                   /db_xref="InterPro:IPR029962"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8RXQ1"
FT                   /protein_id="AED90368.1"
FT   CDS_pept        join(232882..233092,233207..233492,233691..233862,
FT                   233964..234160,234242..234394,234491..234821)
FT                   /codon_start=1
FT                   /gene="TBL35"
FT                   /gene_synonym="F7A7.140"
FT                   /gene_synonym="F7A7_140"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /locus_tag="AT5G01620"
FT                   /product="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /note="TRICHOME BIREFRINGENCE-LIKE 35 (TBL35); LOCATED IN:
FT                   endomembrane system; EXPRESSED IN: 23 plant structures;
FT                   EXPRESSED DURING: 14 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Protein of unknown function DUF231, plant
FT                   (InterPro:IPR004253); BEST Arabidopsis thaliana protein
FT                   match is: TRICHOME BIREFRINGENCE-LIKE 34
FT                   (TAIR:AT2G38320.1); Has 30201 Blast hits to 17322 proteins
FT                   in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
FT                   17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
FT                   Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01620"
FT                   /db_xref="GOA:Q8RXQ1"
FT                   /db_xref="InterPro:IPR025846"
FT                   /db_xref="InterPro:IPR026057"
FT                   /db_xref="InterPro:IPR029962"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8RXQ1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV785707.1,INSD:CF772985.1,INSD:AV441710.1,
FT                   INSD:ES123425.1,INSD:DR379270.1,INSD:ES003552.1,
FT                   INSD:EH852298.1,INSD:DR378727.1,INSD:DR287059.1,
FT                   INSD:ES181936.1,INSD:EL146039.1,INSD:AU227536.1,
FT                   INSD:ES066611.1,INSD:EL131616.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY117243.1,INSD:AY084435.1,INSD:BX831772.1"
FT                   /protein_id="AED90366.1"
FT   CDS_pept        join(232882..233092,233207..233492,233691..233862,
FT                   233964..234160,234242..234394,234491..234821)
FT                   /codon_start=1
FT                   /gene="TBL35"
FT                   /gene_synonym="F7A7.140"
FT                   /gene_synonym="F7A7_140"
FT                   /gene_synonym="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   /locus_tag="AT5G01620"
FT                   /product="TRICHOME BIREFRINGENCE-LIKE 35"
FT                   endomembrane system; EXPRESSED IN: 23 plant structures;
FT                   EXPRESSED DURING: 14 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Protein of unknown function DUF231, plant
FT                   (InterPro:IPR004253); BEST Arabidopsis thaliana protein
FT                   match is: TRICHOME BIREFRINGENCE-LIKE 34
FT                   (TAIR:AT2G38320.1); Has 1369 Blast hits to 1347 proteins in
FT                   38 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi -
FT                   0; Plants - 1344; Viruses - 0; Other Eukaryotes - 0
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q8RXQ1"
FT                   /db_xref="InterPro:IPR025846"
FT                   /db_xref="InterPro:IPR026057"
FT                   /db_xref="InterPro:IPR029962"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8RXQ1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV785707.1,INSD:CF772985.1,INSD:AV441710.1,
FT                   INSD:ES123425.1,INSD:DR379270.1,INSD:ES003552.1,
FT                   INSD:EH852298.1,INSD:DR378727.1,INSD:ES181936.1,
FT                   INSD:EL146039.1,INSD:AU227536.1,INSD:AV543066.1,
FT                   INSD:ES066611.1,INSD:EL131616.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY117243.1,INSD:BX831772.1,INSD:AY080736.1"
FT                   /protein_id="AED90367.1"
FT   gene            complement(234851..241106)
FT                   /gene="BRCA2B"
FT                   /gene_synonym="ATBRCA2(V)"
FT                   /gene_synonym="BRCA2(V)"
FT                   /gene_synonym="BRCA2-like B"
FT                   /gene_synonym="F7A7.150"
FT                   /gene_synonym="F7A7_150"
FT                   /locus_tag="AT5G01630"
FT                   /note="Ortholog of breast cancer susceptibility protein 2.
FT                   Essential at meiosis. Interacts with with both Rad51 and
FT                   Dss1(I) or both Dmc1 and Dss1(I) in a tripartite complex."
FT   mRNA            complement(join(234851..235182,235275..235448,
FT                   235552..235756,235846..235908,235982..236124,
FT                   236411..236593,236662..236860,237159..237230,
FT                   237314..237425,237525..237606,237693..237743,
FT                   237843..237924,237999..238184,238257..238379,
FT                   238541..238695,238783..238907,239000..239986,
FT                   240231..240392,240528..240671,240758..241106))
FT                   /gene="BRCA2B"
FT                   /gene_synonym="ATBRCA2(V)"
FT                   /gene_synonym="BRCA2(V)"
FT                   /gene_synonym="BRCA2-like B"
FT                   /gene_synonym="F7A7.150"
FT                   /gene_synonym="F7A7_150"
FT                   /locus_tag="AT5G01630"
FT                   /product="BRCA2-like B"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL083723.1,INSD:EH957220.1,INSD:AU227536.1,
FT                   INSD:DR379270.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AJ488305.1,INSD:BT004117.1"
FT   CDS_pept        complement(join(235117..235182,235275..235448,
FT                   235552..235756,235846..235908,235982..236124,
FT                   236411..236593,236662..236860,237159..237230,
FT                   237314..237425,237525..237606,237693..237743,
FT                   237843..237924,237999..238184,238257..238379,
FT                   238541..238695,238783..238907,239000..239986,
FT                   240231..240392,240528..240671,240758..240911))
FT                   /codon_start=1
FT                   /gene="BRCA2B"
FT                   /gene_synonym="ATBRCA2(V)"
FT                   /gene_synonym="BRCA2(V)"
FT                   /gene_synonym="BRCA2-like B"
FT                   /gene_synonym="F7A7.150"
FT                   /gene_synonym="F7A7_150"
FT                   /locus_tag="AT5G01630"
FT                   /product="BRCA2-like B"
FT                   /note="BRCA2-like B (BRCA2B); FUNCTIONS IN: single-stranded
FT                   DNA binding; INVOLVED IN: meiosis; LOCATED IN:
FT                   mitochondrion; CONTAINS InterPro DOMAIN/s: Nucleic
FT                   acid-binding, OB-fold-like (InterPro:IPR016027), DNA
FT                   recombination/repair protein BRCA2, helical domain
FT                   (InterPro:IPR015252), DNA recombination and repair protein,
FT                   BRCA2 (InterPro:IPR011370), BRCA2,
FT                   oligonucleotide/oligosaccharide-binding 1
FT                   (InterPro:IPR015187), Breast cancer type 2 susceptibility
FT                   protein (InterPro:IPR015525), BRCA2 repeat
FT                   (InterPro:IPR002093); BEST Arabidopsis thaliana protein
FT                   match is: BREAST CANCER 2 like 2A (TAIR:AT4G00020.1); Has
FT                   281 Blast hits to 210 proteins in 91 species: Archae - 0;
FT                   Bacteria - 4; Metazoa - 134; Fungi - 18; Plants - 61;
FT                   Viruses - 0; Other Eukaryotes - 64 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q7Y1C4"
FT                   /db_xref="InterPro:IPR002093"
FT                   /db_xref="InterPro:IPR012340"
FT                   /db_xref="InterPro:IPR015187"
FT                   /db_xref="InterPro:IPR015252"
FT                   /db_xref="InterPro:IPR015525"
FT                   /db_xref="InterPro:IPR036315"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q7Y1C4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL083723.1,INSD:EH957220.1,INSD:AU227536.1,
FT                   INSD:DR379270.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AJ488305.1,INSD:BT004117.1"
FT                   /protein_id="AED90369.1"
FT   gene            complement(241212..242322)
FT                   /gene="PRA1.B5"
FT                   /gene_synonym="F7A7.160"
FT                   /gene_synonym="F7A7_160"
FT                   /gene_synonym="prenylated RAB acceptor 1.B5"
FT                   /locus_tag="AT5G01640"
FT   mRNA            complement(241212..242322)
FT                   /gene="PRA1.B5"
FT                   /gene_synonym="F7A7.160"
FT                   /gene_synonym="F7A7_160"
FT                   /gene_synonym="prenylated RAB acceptor 1.B5"
FT                   /locus_tag="AT5G01640"
FT                   /product="prenylated RAB acceptor 1.B5"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP561368.2,INSD:ES179858.1,INSD:EG451121.1,
FT                   INSD:CK120161.1,INSD:EG451124.1,INSD:AV789803.1,
FT                   INSD:BP790051.1,INSD:EL114233.1,INSD:EG451123.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT000918.1,INSD:AY090930.1"
FT   CDS_pept        complement(241442..242113)
FT                   /codon_start=1
FT                   /gene="PRA1.B5"
FT                   /gene_synonym="F7A7.160"
FT                   /gene_synonym="F7A7_160"
FT                   /gene_synonym="prenylated RAB acceptor 1.B5"
FT                   /locus_tag="AT5G01640"
FT                   /product="prenylated RAB acceptor 1.B5"
FT                   /note="prenylated RAB acceptor 1.B5 (PRA1.B5); CONTAINS
FT                   InterPro DOMAIN/s: Prenylated rab acceptor PRA1
FT                   (InterPro:IPR004895); BEST Arabidopsis thaliana protein
FT                   match is: prenylated RAB acceptor 1.B4 (TAIR:AT2G38360.1);
FT                   Has 1807 Blast hits to 1807 proteins in 277 species: Archae
FT                   - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants -
FT                   385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI
FT                   BLink)."
FT                   /db_xref="GOA:Q9M012"
FT                   /db_xref="InterPro:IPR004895"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M012"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP561368.2,INSD:ES179858.1,INSD:EG451121.1,
FT                   INSD:CK120161.1,INSD:EG451124.1,INSD:AV789803.1,
FT                   INSD:BP790051.1,INSD:EL114233.1,INSD:EG451123.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT000918.1,INSD:AY090930.1"
FT                   /protein_id="AED90370.1"
FT                   V"
FT   gene            complement(242450..244111)
FT                   /gene_synonym="F7A7.170"
FT                   /gene_synonym="F7A7_170"
FT                   /locus_tag="AT5G01650"
FT   mRNA            complement(join(242450..242769,243248..243448,
FT                   243923..244111))
FT                   /gene_synonym="F7A7.170"
FT                   /gene_synonym="F7A7_170"
FT                   /locus_tag="AT5G01650"
FT                   /product="Tautomerase/MIF superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL975524.1,INSD:EL977901.1,INSD:EL306996.1,
FT                   INSD:EH885476.1,INSD:BP851259.1,INSD:AI996103.1,
FT                   INSD:EG503170.1,INSD:DR211124.1,INSD:EL310221.1,
FT                   INSD:EL995482.1,INSD:AV823736.2,INSD:EH916322.1,
FT                   INSD:EG481199.1,INSD:EH941550.1,INSD:AA713318.1,
FT                   INSD:ES213204.1,INSD:BP868249.1,INSD:DR211123.1,
FT                   INSD:BP852291.1,INSD:ES068836.1,INSD:BP588414.1,
FT                   INSD:DR211122.1,INSD:EL994591.1,INSD:EL291872.1,
FT                   INSD:EL078851.1,INSD:BP802073.1,INSD:DR211112.1,
FT                   INSD:ES042723.1,INSD:EL219072.1,INSD:EG459589.1,
FT                   INSD:ES216094.1,INSD:EL267247.1,INSD:ES146690.1,
FT                   INSD:BE038533.1,INSD:ES002070.1,INSD:DR211115.1,
FT                   INSD:EL978997.1,INSD:EH928446.1,INSD:ES169934.1,
FT                   INSD:EL295164.1,INSD:EL130133.1,INSD:DR211120.1,
FT                   INSD:ES176124.1,INSD:EG472385.1,INSD:EG459588.1,
FT                   INSD:DR211107.1,INSD:AV532350.1,INSD:EL990632.1,
FT                   INSD:EG481198.1,INSD:EH991369.1,INSD:ES196376.1,
FT                   INSD:ES006297.1,INSD:EL986992.1,INSD:EL103452.1,
FT                   INSD:ES161950.1,INSD:EH869973.1,INSD:EL029951.1,
FT                   INSD:DR211116.1,INSD:ES003119.1,INSD:DR261297.1,
FT                   INSD:EL002917.1,INSD:ES021924.1,INSD:ES187411.1,
FT                   INSD:EL231807.1,INSD:EH980638.1,INSD:EL339329.1,
FT                   INSD:AV820539.1,INSD:EG472386.1,INSD:ES162861.1,
FT                   INSD:EL196164.1,INSD:DR211118.1,INSD:DR211111.1,
FT                   INSD:EL971339.1,INSD:DR211114.1,INSD:DR211106.1,
FT                   INSD:DR211117.1,INSD:AV534735.1,INSD:EG503182.1,
FT                   INSD:BP844092.1,INSD:DR211125.1,INSD:AV789394.1,
FT                   INSD:EH993777.1,INSD:DR211126.1,INSD:DR211119.1,
FT                   INSD:EL109927.1,INSD:EL136751.1,INSD:EG503171.1,
FT                   INSD:DR211110.1,INSD:EL224701.1,INSD:DR370544.1,
FT                   INSD:DR211113.1,INSD:DR211105.1,INSD:EL185350.1,
FT                   INSD:BP591041.1,INSD:EL982202.1,INSD:ES019282.1,
FT                   INSD:ES002268.1,INSD:DR211108.1,INSD:DR211121.1,
FT                   INSD:EH900018.1,INSD:F14405.1,INSD:DR378529.1,
FT                   INSD:ES110201.1,INSD:EL196546.1,INSD:ES203016.1,
FT                   INSD:EL112857.1,INSD:ES064280.1,INSD:ES068071.1,
FT                   INSD:ES023022.1,INSD:DR211109.1,INSD:EG503181.1,
FT                   INSD:DR378149.1,INSD:ES118764.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY062859.1,INSD:AY081575.1,INSD:BX833438.1,
FT                   INSD:BX830182.1,INSD:X58827.1"
FT   mRNA            complement(join(242450..242769,243034..243123,
FT                   243248..243448,243923..244111))
FT                   /gene_synonym="F7A7.170"
FT                   /gene_synonym="F7A7_170"
FT                   /locus_tag="AT5G01650"
FT                   /product="Tautomerase/MIF superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL975524.1,INSD:EL977901.1,INSD:ES187411.1,
FT                   INSD:EL231807.1,INSD:EH885476.1,INSD:EH980638.1,
FT                   INSD:EL339329.1,INSD:EG503170.1,INSD:EL310221.1,
FT                   INSD:EL995482.1,INSD:EL196164.1,INSD:EH916322.1,
FT                   INSD:EL971339.1,INSD:DR211114.1,INSD:DR211106.1,
FT                   INSD:AA713318.1,INSD:EG481199.1,INSD:DR211123.1,
FT                   INSD:ES213204.1,INSD:ES068836.1,INSD:EG503182.1,
FT                   INSD:EL994591.1,INSD:EL291872.1,INSD:EL078851.1,
FT                   INSD:EH993777.1,INSD:ES042723.1,INSD:EL219072.1,
FT                   INSD:EL109927.1,INSD:EL136751.1,INSD:EG503171.1,
FT                   INSD:ES216094.1,INSD:ES146690.1,INSD:ES002070.1,
FT                   INSD:EL978997.1,INSD:EH928446.1,INSD:EL185350.1,
FT                   INSD:ES169934.1,INSD:EL295164.1,INSD:EL982202.1,
FT                   INSD:EL130133.1,INSD:ES019282.1,INSD:ES002268.1,
FT                   INSD:EG459588.1,INSD:ES176124.1,INSD:EH900018.1,
FT                   INSD:DR211107.1,INSD:EL990632.1,INSD:EG481198.1,
FT                   INSD:ES110201.1,INSD:EL196546.1,INSD:ES203016.1,
FT                   INSD:EL112857.1,INSD:EH991369.1,INSD:ES064280.1,
FT                   INSD:ES196376.1,INSD:ES006297.1,INSD:EL986992.1,
FT                   INSD:EL103452.1,INSD:ES161950.1,INSD:EL029951.1,
FT                   INSD:EG503181.1,INSD:ES003119.1,INSD:ES021924.1,
FT                   INSD:EL002917.1,INSD:ES118764.1"
FT   mRNA            complement(join(242450..243123,243248..243448,
FT                   243923..244111))
FT                   /gene_synonym="F7A7.170"
FT                   /gene_synonym="F7A7_170"
FT                   /locus_tag="AT5G01650"
FT                   /product="Tautomerase/MIF superfamily protein"
FT   mRNA            complement(join(242579..242769,243034..243448,
FT                   243923..244111))
FT                   /gene_synonym="F7A7.170"
FT                   /gene_synonym="F7A7_170"
FT                   /locus_tag="AT5G01650"
FT                   /product="Tautomerase/MIF superfamily protein"
FT   CDS_pept        complement(join(242734..242769,243248..243448,
FT                   243923..244033))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.170"
FT                   /gene_synonym="F7A7_170"
FT                   /locus_tag="AT5G01650"
FT                   /product="Tautomerase/MIF superfamily protein"
FT                   /note="Tautomerase/MIF superfamily protein; FUNCTIONS IN:
FT                   molecular_function unknown; INVOLVED IN: inflammatory
FT                   response, response to other organism; LOCATED IN:
FT                   chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED
FT                   DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s:
FT                   Tautomerase (InterPro:IPR014347), Macrophage migration
FT                   inhibitory factor (InterPro:IPR001398); BEST Arabidopsis
FT                   thaliana protein match is: Tautomerase/MIF superfamily
FT                   protein (TAIR:AT5G57170.1); Has 1807 Blast hits to 1807
FT                   proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa
FT                   - 736; Fungi - 347; Plants - 385; Viruses - 0; Other
FT                   Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01650"
FT                   /db_xref="InterPro:IPR001398"
FT                   /db_xref="InterPro:IPR014347"
FT                   /db_xref="UniProtKB/TrEMBL:Q9M011"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL975524.1,INSD:EL977901.1,INSD:EL306996.1,
FT                   INSD:EH885476.1,INSD:BP851259.1,INSD:AI996103.1,
FT                   INSD:EG503170.1,INSD:DR211124.1,INSD:EL310221.1,
FT                   INSD:EL995482.1,INSD:AV823736.2,INSD:EH916322.1,
FT                   INSD:EG481199.1,INSD:EH941550.1,INSD:AA713318.1,
FT                   INSD:ES213204.1,INSD:BP868249.1,INSD:DR211123.1,
FT                   INSD:BP852291.1,INSD:ES068836.1,INSD:BP588414.1,
FT                   INSD:DR211122.1,INSD:EL994591.1,INSD:EL291872.1,
FT                   INSD:EL078851.1,INSD:BP802073.1,INSD:DR211112.1,
FT                   INSD:ES042723.1,INSD:EL219072.1,INSD:EG459589.1,
FT                   INSD:ES216094.1,INSD:EL267247.1,INSD:ES146690.1,
FT                   INSD:BE038533.1,INSD:ES002070.1,INSD:DR211115.1,
FT                   INSD:EL978997.1,INSD:EH928446.1,INSD:ES169934.1,
FT                   INSD:EL295164.1,INSD:EL130133.1,INSD:DR211120.1,
FT                   INSD:ES176124.1,INSD:EG472385.1,INSD:EG459588.1,
FT                   INSD:DR211107.1,INSD:AV532350.1,INSD:EL990632.1,
FT                   INSD:EG481198.1,INSD:EH991369.1,INSD:ES196376.1,
FT                   INSD:ES006297.1,INSD:EL986992.1,INSD:EL103452.1,
FT                   INSD:ES161950.1,INSD:EH869973.1,INSD:EL029951.1,
FT                   INSD:DR211116.1,INSD:ES003119.1,INSD:DR261297.1,
FT                   INSD:EL002917.1,INSD:ES021924.1,INSD:ES187411.1,
FT                   INSD:EL231807.1,INSD:EH980638.1,INSD:EL339329.1,
FT                   INSD:AV820539.1,INSD:EG472386.1,INSD:ES162861.1,
FT                   INSD:EL196164.1,INSD:DR211118.1,INSD:DR211111.1,
FT                   INSD:EL971339.1,INSD:DR211114.1,INSD:DR211106.1,
FT                   INSD:DR211117.1,INSD:AV534735.1,INSD:EG503182.1,
FT                   INSD:BP844092.1,INSD:DR211125.1,INSD:AV789394.1,
FT                   INSD:EH993777.1,INSD:DR211126.1,INSD:DR211119.1,
FT                   INSD:EL109927.1,INSD:EL136751.1,INSD:EG503171.1,
FT                   INSD:DR211110.1,INSD:EL224701.1,INSD:DR370544.1,
FT                   INSD:DR211113.1,INSD:DR211105.1,INSD:EL185350.1,
FT                   INSD:BP591041.1,INSD:EL982202.1,INSD:ES019282.1,
FT                   INSD:ES002268.1,INSD:DR211108.1,INSD:DR211121.1,
FT                   INSD:EH900018.1,INSD:F14405.1,INSD:DR378529.1,
FT                   INSD:ES110201.1,INSD:EL196546.1,INSD:ES203016.1,
FT                   INSD:EL112857.1,INSD:ES064280.1,INSD:ES068071.1,
FT                   INSD:ES023022.1,INSD:DR211109.1,INSD:EG503181.1,
FT                   INSD:DR378149.1,INSD:ES118764.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY062859.1,INSD:AY081575.1,INSD:BX833438.1,
FT                   INSD:BX830182.1,INSD:X58827.1"
FT                   /protein_id="AED90371.1"
FT                   GSFFGWNGATL"
FT   CDS_pept        complement(join(243067..243123,243248..243448,
FT                   243923..244033))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.170"
FT                   /gene_synonym="F7A7_170"
FT                   /locus_tag="AT5G01650"
FT                   /product="Tautomerase/MIF superfamily protein"
FT                   /db_xref="GOA:F4K9G5"
FT                   /db_xref="InterPro:IPR001398"
FT                   /db_xref="InterPro:IPR014347"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9G5"
FT                   /protein_id="ANM68179.1"
FT                   DHQSQEYAQCLHALHQHY"
FT   CDS_pept        complement(join(243067..243123,243248..243448,
FT                   243923..244033))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.170"
FT                   /gene_synonym="F7A7_170"
FT                   /locus_tag="AT5G01650"
FT                   /product="Tautomerase/MIF superfamily protein"
FT                   /note="Tautomerase/MIF superfamily protein; FUNCTIONS IN:
FT                   molecular_function unknown; INVOLVED IN: inflammatory
FT                   response, response to other organism; EXPRESSED IN: 23
FT                   plant structures; EXPRESSED DURING: 13 growth stages;
FT                   CONTAINS InterPro DOMAIN/s: Tautomerase
FT                   (InterPro:IPR014347), Macrophage migration inhibitory
FT                   factor (InterPro:IPR001398); BEST Arabidopsis thaliana
FT                   protein match is: Tautomerase/MIF superfamily protein
FT                   (TAIR:AT5G57170.2); Has 820 Blast hits to 820 proteins in
FT                   207 species: Archae - 0; Bacteria - 141; Metazoa - 384;
FT                   Fungi - 26; Plants - 141; Viruses - 0; Other Eukaryotes -
FT                   128 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01650"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01650.2"
FT                   /db_xref="GOA:F4K9G5"
FT                   /db_xref="InterPro:IPR001398"
FT                   /db_xref="InterPro:IPR014347"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9G5"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL975524.1,INSD:EL977901.1,INSD:ES187411.1,
FT                   INSD:EL231807.1,INSD:EH885476.1,INSD:EH980638.1,
FT                   INSD:EL339329.1,INSD:EG503170.1,INSD:EL310221.1,
FT                   INSD:EL995482.1,INSD:EL196164.1,INSD:EH916322.1,
FT                   INSD:EL971339.1,INSD:DR211114.1,INSD:DR211106.1,
FT                   INSD:AA713318.1,INSD:EG481199.1,INSD:DR211123.1,
FT                   INSD:ES213204.1,INSD:ES068836.1,INSD:EG503182.1,
FT                   INSD:EL994591.1,INSD:EL291872.1,INSD:EL078851.1,
FT                   INSD:EH993777.1,INSD:ES042723.1,INSD:EL219072.1,
FT                   INSD:EL109927.1,INSD:EL136751.1,INSD:EG503171.1,
FT                   INSD:ES216094.1,INSD:ES146690.1,INSD:ES002070.1,
FT                   INSD:EL978997.1,INSD:EH928446.1,INSD:EL185350.1,
FT                   INSD:ES169934.1,INSD:EL295164.1,INSD:EL982202.1,
FT                   INSD:EL130133.1,INSD:ES019282.1,INSD:ES002268.1,
FT                   INSD:EG459588.1,INSD:ES176124.1,INSD:EH900018.1,
FT                   INSD:DR211107.1,INSD:EL990632.1,INSD:EG481198.1,
FT                   INSD:ES110201.1,INSD:EL196546.1,INSD:ES203016.1,
FT                   INSD:EL112857.1,INSD:EH991369.1,INSD:ES064280.1,
FT                   INSD:ES196376.1,INSD:ES006297.1,INSD:EL986992.1,
FT                   INSD:EL103452.1,INSD:ES161950.1,INSD:EL029951.1,
FT                   INSD:EG503181.1,INSD:ES003119.1,INSD:ES021924.1,
FT                   INSD:EL002917.1,INSD:ES118764.1"
FT                   /protein_id="AED90372.1"
FT                   DHQSQEYAQCLHALHQHY"
FT   CDS_pept        complement(join(243209..243448,243923..244033))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.170"
FT                   /gene_synonym="F7A7_170"
FT                   /locus_tag="AT5G01650"
FT                   /product="Tautomerase/MIF superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01650"
FT                   /db_xref="InterPro:IPR001398"
FT                   /db_xref="InterPro:IPR014347"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8B982"
FT                   /protein_id="ANM68178.1"
FT                   ASNSLSLITFLM"
FT   gene            complement(244250..249207)
FT                   /gene_synonym="F7A7.180"
FT                   /gene_synonym="F7A7_180"
FT                   /locus_tag="AT5G01660"
FT   mRNA            complement(join(244250..244593,244681..244870,
FT                   244969..245070,245166..245242,245548..245747,
FT                   246111..246450,246687..246764,247203..247796,
FT                   247951..248132,248325..248443,248980..249207))
FT                   /gene_synonym="F7A7.180"
FT                   /gene_synonym="F7A7_180"
FT                   /locus_tag="AT5G01660"
FT                   /product="influenza virus NS1A-binding protein"
FT   mRNA            complement(join(244250..244593,244681..244870,
FT                   244969..245070,245166..245242,245548..245747,
FT                   246111..246450,246687..246764,247203..247796,
FT                   247951..248132,248325..248443,248876..249207))
FT                   /gene_synonym="F7A7.180"
FT                   /gene_synonym="F7A7_180"
FT                   /locus_tag="AT5G01660"
FT                   /product="influenza virus NS1A-binding protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES019901.1,INSD:ES059766.1"
FT   CDS_pept        complement(join(244504..244593,244681..244870,
FT                   244969..245070,245166..245242,245548..245747,
FT                   246111..246450,246687..246764,247203..247796,
FT                   247951..248132,248325..248442))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.180"
FT                   /gene_synonym="F7A7_180"
FT                   /locus_tag="AT5G01660"
FT                   /product="influenza virus NS1A-binding protein"
FT                   /db_xref="InterPro:IPR006652"
FT                   /db_xref="InterPro:IPR013989"
FT                   /db_xref="InterPro:IPR015915"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9G6"
FT                   /protein_id="ANM69769.1"
FT   CDS_pept        complement(join(244504..244593,244681..244870,
FT                   244969..245070,245166..245242,245548..245747,
FT                   246111..246450,246687..246764,247203..247796,
FT                   247951..248132,248325..248442))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.180"
FT                   /gene_synonym="F7A7_180"
FT                   /locus_tag="AT5G01660"
FT                   /product="influenza virus NS1A-binding protein"
FT                   /note="CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch,
FT                   beta-propeller (InterPro:IPR011043), Kelch repeat type 1
FT                   (InterPro:IPR006652), Development/cell death domain
FT                   (InterPro:IPR013989), Kelch related (InterPro:IPR013089),
FT                   Kelch-type beta propeller (InterPro:IPR015915); BEST
FT                   Arabidopsis thaliana protein match is: DCD (Development and
FT                   Cell Death) domain protein (TAIR:AT3G11000.1); Has 16133
FT                   Blast hits to 7053 proteins in 482 species: Archae - 40;
FT                   Bacteria - 1227; Metazoa - 10756; Fungi - 311; Plants -
FT                   1896; Viruses - 673; Other Eukaryotes - 1230 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01660"
FT                   /db_xref="InterPro:IPR006652"
FT                   /db_xref="InterPro:IPR013989"
FT                   /db_xref="InterPro:IPR015915"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9G6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES019901.1,INSD:ES059766.1"
FT                   /protein_id="AED90373.1"
FT   mRNA            complement(join(245279..245747,246111..246450,
FT                   246687..246764,247203..247796,247951..248132,
FT                   248325..248443,248980..249165))
FT                   /gene_synonym="F7A7.180"
FT                   /gene_synonym="F7A7_180"
FT                   /locus_tag="AT5G01660"
FT                   /product="influenza virus NS1A-binding protein"
FT   CDS_pept        complement(join(245512..245747,246111..246450,
FT                   246687..246764,247203..247796,247951..248132,
FT                   248325..248442))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.180"
FT                   /gene_synonym="F7A7_180"
FT                   /locus_tag="AT5G01660"
FT                   /product="influenza virus NS1A-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01660"
FT                   /db_xref="InterPro:IPR006652"
FT                   /db_xref="InterPro:IPR013989"
FT                   /db_xref="InterPro:IPR015915"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BDS4"
FT                   /protein_id="ANM69768.1"
FT   gene            251686..253972
FT                   /gene_synonym="F7A7.190"
FT                   /gene_synonym="F7A7_190"
FT                   /locus_tag="AT5G01670"
FT   mRNA            join(251686..252143,252298..252348,252448..252690,
FT                   252762..252968,253043..253114,253186..253428,
FT                   253767..253972)
FT                   /gene_synonym="F7A7.190"
FT                   /gene_synonym="F7A7_190"
FT                   /locus_tag="AT5G01670"
FT                   /product="NAD(P)-linked oxidoreductase superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP623788.1,INSD:EL065720.1,INSD:BP836767.1,
FT                   INSD:CK121221.1,INSD:BP604014.1,INSD:BE529419.1,
FT                   INSD:BP642126.1,INSD:BE520928.1,INSD:BE525213.1,
FT                   INSD:BP651268.1,INSD:BE524761.1,INSD:BE526293.1,
FT                   INSD:BE522549.1,INSD:BP830409.1,INSD:BP657803.1,
FT                   INSD:AU238858.1,INSD:BP646310.1,INSD:BP832562.1,
FT                   INSD:BP834102.1,INSD:BE528959.1,INSD:BE520929.1,
FT                   INSD:BE530268.1,INSD:BE520689.1,INSD:BP824263.1,
FT                   INSD:BP830821.1,INSD:AU230104.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832789.1,INSD:AK118010.1,INSD:BT030096.1"
FT   mRNA            join(251686..252143,252298..252348,252448..252521,
FT                   252603..252690,252762..252968,253043..253114,
FT                   253186..253428,253767..253972)
FT                   /gene_synonym="F7A7.190"
FT                   /gene_synonym="F7A7_190"
FT                   /locus_tag="AT5G01670"
FT                   /product="NAD(P)-linked oxidoreductase superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP623788.1,INSD:EL065720.1,INSD:BE524891.1,
FT                   INSD:BE522549.1,INSD:BP604014.1,INSD:BP657803.1,
FT                   INSD:BE529419.1,INSD:BP642126.1,INSD:BP646310.1,
FT                   INSD:BP651268.1,INSD:BE528959.1,INSD:BE530268.1,
FT                   INSD:AU230104.1,INSD:BP828621.1"
FT   CDS_pept        join(252000..252143,252298..252348,252448..252690,
FT                   252762..252968,253043..253114,253186..253428,
FT                   253767..253856)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.190"
FT                   /gene_synonym="F7A7_190"
FT                   /locus_tag="AT5G01670"
FT                   /product="NAD(P)-linked oxidoreductase superfamily protein"
FT                   /note="NAD(P)-linked oxidoreductase superfamily protein;
FT                   FUNCTIONS IN: oxidoreductase activity; INVOLVED IN:
FT                   oxidation reduction; EXPRESSED IN: 18 plant structures;
FT                   EXPRESSED DURING: 11 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395),
FT                   Aldo/keto reductase subgroup (InterPro:IPR020471),
FT                   Aldo/keto reductase, conserved site (InterPro:IPR018170);
FT                   BEST Arabidopsis thaliana protein match is: NAD(P)-linked
FT                   oxidoreductase superfamily protein (TAIR:AT2G37770.2); Has
FT                   16960 Blast hits to 16922 proteins in 2239 species: Archae
FT                   - 315; Bacteria - 10569; Metazoa - 1835; Fungi - 1554;
FT                   Plants - 1108; Viruses - 0; Other Eukaryotes - 1579
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01670"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01670.2"
FT                   /db_xref="GOA:F4K9G7"
FT                   /db_xref="InterPro:IPR018170"
FT                   /db_xref="InterPro:IPR020471"
FT                   /db_xref="InterPro:IPR023210"
FT                   /db_xref="InterPro:IPR036812"
FT                   /db_xref="UniProtKB/TrEMBL:F4K9G7"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP623788.1,INSD:EL065720.1,INSD:BE524891.1,
FT                   INSD:BE522549.1,INSD:BP604014.1,INSD:BP657803.1,
FT                   INSD:BE529419.1,INSD:BP642126.1,INSD:BP646310.1,
FT                   INSD:BP651268.1,INSD:BE528959.1,INSD:BE530268.1,
FT                   INSD:AU230104.1,INSD:BP828621.1"
FT                   /protein_id="AED90375.1"
FT                   VADLWDHED"
FT   CDS_pept        join(252000..252143,252298..252348,252448..252521,
FT                   252603..252690,252762..252968,253043..253114,
FT                   253186..253428,253767..253856)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.190"
FT                   /gene_synonym="F7A7_190"
FT                   /locus_tag="AT5G01670"
FT                   /product="NAD(P)-linked oxidoreductase superfamily protein"
FT                   /note="NAD(P)-linked oxidoreductase superfamily protein;
FT                   FUNCTIONS IN: oxidoreductase activity; INVOLVED IN:
FT                   oxidation reduction; EXPRESSED IN: 18 plant structures;
FT                   EXPRESSED DURING: 11 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Aldo/keto reductase (InterPro:IPR001395),
FT                   Aldo/keto reductase subgroup (InterPro:IPR020471),
FT                   Aldo/keto reductase, conserved site (InterPro:IPR018170);
FT                   BEST Arabidopsis thaliana protein match is: NAD(P)-linked
FT                   oxidoreductase superfamily protein (TAIR:AT2G37770.2); Has
FT                   19068 Blast hits to 19040 proteins in 2308 species: Archae
FT                   - 339; Bacteria - 12194; Metazoa - 2060; Fungi - 1600;
FT                   Plants - 1171; Viruses - 0; Other Eukaryotes - 1704
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01670"
FT                   /db_xref="GOA:Q8GXW0"
FT                   /db_xref="InterPro:IPR018170"
FT                   /db_xref="InterPro:IPR020471"
FT                   /db_xref="InterPro:IPR023210"
FT                   /db_xref="InterPro:IPR036812"
FT                   /db_xref="UniProtKB/TrEMBL:Q8GXW0"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP623788.1,INSD:EL065720.1,INSD:BP836767.1,
FT                   INSD:CK121221.1,INSD:BP604014.1,INSD:BE529419.1,
FT                   INSD:BP642126.1,INSD:BE520928.1,INSD:BE525213.1,
FT                   INSD:BP651268.1,INSD:BE524761.1,INSD:BE526293.1,
FT                   INSD:BE522549.1,INSD:BP830409.1,INSD:BP657803.1,
FT                   INSD:AU238858.1,INSD:BP646310.1,INSD:BP832562.1,
FT                   INSD:BP834102.1,INSD:BE528959.1,INSD:BE520929.1,
FT                   INSD:BE530268.1,INSD:BE520689.1,INSD:BP824263.1,
FT                   INSD:BP830821.1,INSD:AU230104.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832789.1,INSD:AK118010.1,INSD:BT030096.1"
FT                   /protein_id="AED90374.1"
FT   gene            complement(253996..256640)
FT                   /gene="CHX26"
FT                   /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
FT                   EXCHANGER 26"
FT                   /gene_synonym="ATCHX26"
FT                   /gene_synonym="cation/H+ exchanger 26"
FT                   /gene_synonym="F7A7.200"
FT                   /gene_synonym="F7A7_200"
FT                   /locus_tag="AT5G01680"
FT                   /note="member of Putative Na+/H+ antiporter family"
FT   mRNA            complement(join(253996..254238,254315..255202,
FT                   255287..256297,256428..256640))
FT                   /gene="CHX26"
FT                   /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
FT                   EXCHANGER 26"
FT                   /gene_synonym="ATCHX26"
FT                   /gene_synonym="cation/H+ exchanger 26"
FT                   /gene_synonym="F7A7.200"
FT                   /gene_synonym="F7A7_200"
FT                   /locus_tag="AT5G01680"
FT                   /product="cation/H+ exchanger 26"
FT   CDS_pept        complement(join(253996..254238,254315..255202,
FT                   255287..256297,256428..256640))
FT                   /codon_start=1
FT                   /gene="CHX26"
FT                   /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
FT                   EXCHANGER 26"
FT                   /gene_synonym="ATCHX26"
FT                   /gene_synonym="cation/H+ exchanger 26"
FT                   /gene_synonym="F7A7.200"
FT                   /gene_synonym="F7A7_200"
FT                   /locus_tag="AT5G01680"
FT                   /product="cation/H+ exchanger 26"
FT                   /note="cation/H+ exchanger 26 (CHX26); FUNCTIONS IN:
FT                   monovalent cation:hydrogen antiporter activity,
FT                   sodium:hydrogen antiporter activity; INVOLVED IN: cation
FT                   transport; LOCATED IN: integral to membrane; EXPRESSED IN:
FT                   male gametophyte, leaf, pollen tube; CONTAINS InterPro
FT                   DOMAIN/s: Cation/H+ exchanger (InterPro:IPR006153); BEST
FT                   Arabidopsis thaliana protein match is: cation/H+ exchanger
FT                   27 (TAIR:AT5G01690.1); Has 1807 Blast hits to 1807 proteins
FT                   in 277 species: Archae - 0; Bacteria - 0; Metazoa - 736;
FT                   Fungi - 347; Plants - 385; Viruses - 0; Other Eukaryotes -
FT                   339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M008"
FT                   /db_xref="InterPro:IPR006153"
FT                   /db_xref="InterPro:IPR038770"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M008"
FT                   /protein_id="AED90376.1"
FT   gene            257306..260490
FT                   /gene="CHX27"
FT                   /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
FT                   EXCHANGER 27"
FT                   /gene_synonym="ATCHX27"
FT                   /gene_synonym="cation/H+ exchanger 27"
FT                   /gene_synonym="F7A7.210"
FT                   /gene_synonym="F7A7_210"
FT                   /locus_tag="AT5G01690"
FT                   /note="member of Putative Na+/H+ antiporter family"
FT   mRNA            join(257306..257628,257769..258281,258516..259013,
FT                   259096..259953,260130..260490)
FT                   /gene="CHX27"
FT                   /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
FT                   EXCHANGER 27"
FT                   /gene_synonym="ATCHX27"
FT                   /gene_synonym="cation/H+ exchanger 27"
FT                   /gene_synonym="F7A7.210"
FT                   /gene_synonym="F7A7_210"
FT                   /locus_tag="AT5G01690"
FT                   /product="cation/H+ exchanger 27"
FT   CDS_pept        join(257410..257628,257769..258281,258516..259013,
FT                   259096..259953,260130..260345)
FT                   /codon_start=1
FT                   /gene="CHX27"
FT                   /gene_synonym="ARABIDOPSIS THALIANA CATION/HYDROGEN
FT                   EXCHANGER 27"
FT                   /gene_synonym="ATCHX27"
FT                   /gene_synonym="cation/H+ exchanger 27"
FT                   /gene_synonym="F7A7.210"
FT                   /gene_synonym="F7A7_210"
FT                   /locus_tag="AT5G01690"
FT                   /product="cation/H+ exchanger 27"
FT                   /note="cation/H+ exchanger 27 (CHX27); BEST Arabidopsis
FT                   thaliana protein match is: cation/H+ exchanger 26
FT                   (TAIR:AT5G01680.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01690"
FT                   /db_xref="GOA:Q9M007"
FT                   /db_xref="InterPro:IPR038770"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9M007"
FT                   /protein_id="AED90377.2"
FT                   KDLELSVSVLAVQQ"
FT   gene            complement(260723..263451)
FT                   /gene_synonym="F7A7.220"
FT                   /gene_synonym="F7A7_220"
FT                   /locus_tag="AT5G01700"
FT   mRNA            complement(join(260723..261147,261229..261452,
FT                   261583..261697,261785..262090,262289..262475,
FT                   263302..263451))
FT                   /gene_synonym="F7A7.220"
FT                   /gene_synonym="F7A7_220"
FT                   /locus_tag="AT5G01700"
FT                   /product="Protein phosphatase 2C family protein"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT011618.1,INSD:BT012622.1"
FT   mRNA            complement(join(260748..261147,261229..261452,
FT                   261583..261697,261785..262090,262289..263185))
FT                   /gene_synonym="F7A7.220"
FT                   /gene_synonym="F7A7_220"
FT                   /locus_tag="AT5G01700"
FT                   /product="Protein phosphatase 2C family protein"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX831823.1"
FT   CDS_pept        complement(join(260848..261147,261229..261452,
FT                   261583..261697,261785..262090,262289..262492))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.220"
FT                   /gene_synonym="F7A7_220"
FT                   /locus_tag="AT5G01700"
FT                   /product="Protein phosphatase 2C family protein"
FT                   /note="Protein phosphatase 2C family protein; FUNCTIONS IN:
FT                   protein serine/threonine phosphatase activity, catalytic
FT                   activity; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: cellular_component unknown; EXPRESSED IN: 9 plant
FT                   structures; EXPRESSED DURING: L mature pollen stage, M
FT                   germinated pollen stage, 4 anthesis, petal differentiation
FT                   and expansion stage; CONTAINS InterPro DOMAIN/s: Protein
FT                   phosphatase 2C-related (InterPro:IPR001932), Protein
FT                   phosphatase 2C (InterPro:IPR015655), Protein phosphatase
FT                   2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis
FT                   thaliana protein match is: Protein phosphatase 2C family
FT                   protein (TAIR:AT5G36250.1); Has 5499 Blast hits to 5498
FT                   proteins in 290 species: Archae - 0; Bacteria - 8; Metazoa
FT                   - 1364; Fungi - 621; Plants - 2393; Viruses - 5; Other
FT                   Eukaryotes - 1108 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q6NKS1"
FT                   /db_xref="InterPro:IPR001932"
FT                   /db_xref="InterPro:IPR015655"
FT                   /db_xref="InterPro:IPR036457"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q6NKS1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT011618.1,INSD:BT012622.1"
FT                   /protein_id="AED90379.1"
FT   CDS_pept        complement(join(260848..261147,261229..261452,
FT                   261583..261697,261785..262090,262289..262345))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.220"
FT                   /gene_synonym="F7A7_220"
FT                   /locus_tag="AT5G01700"
FT                   /product="Protein phosphatase 2C family protein"
FT                   /note="Protein phosphatase 2C family protein; FUNCTIONS IN:
FT                   protein serine/threonine phosphatase activity, catalytic
FT                   activity; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: cellular_component unknown; EXPRESSED IN: 9 plant
FT                   structures; EXPRESSED DURING: L mature pollen stage, M
FT                   germinated pollen stage, 4 anthesis, petal differentiation
FT                   and expansion stage; CONTAINS InterPro DOMAIN/s: Protein
FT                   phosphatase 2C-related (InterPro:IPR001932), Protein
FT                   phosphatase 2C (InterPro:IPR015655), Protein phosphatase
FT                   2C, N-terminal (InterPro:IPR014045); BEST Arabidopsis
FT                   thaliana protein match is: Protein phosphatase 2C family
FT                   protein (TAIR:AT3G02750.2); Has 5490 Blast hits to 5489
FT                   proteins in 289 species: Archae - 0; Bacteria - 8; Metazoa
FT                   - 1364; Fungi - 619; Plants - 2389; Viruses - 5; Other
FT                   Eukaryotes - 1105 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01700"
FT                   /db_xref="GOA:Q6NKS1"
FT                   /db_xref="InterPro:IPR001932"
FT                   /db_xref="InterPro:IPR015655"
FT                   /db_xref="InterPro:IPR036457"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q6NKS1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX831823.1"
FT                   /protein_id="AED90378.1"
FT   gene            complement(263511..265633)
FT                   /gene_synonym="F7A7.230"
FT                   /gene_synonym="F7A7_230"
FT                   /locus_tag="AT5G01710"
FT   mRNA            complement(263511..265633)
FT                   /gene_synonym="F7A7.230"
FT                   /gene_synonym="F7A7_230"
FT                   /locus_tag="AT5G01710"
FT                   /product="methyltransferase"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CF773980.1,INSD:EG443085.1,INSD:EH817539.1,
FT                   INSD:BP647620.1,INSD:EL289107.1,INSD:EL181351.1,
FT                   INSD:AV540969.1,INSD:BE522910.1,INSD:EL072035.1,
FT                   INSD:W43410.1,INSD:EH982582.1,INSD:BP599580.1,
FT                   INSD:AV566181.1,INSD:BP841876.1,INSD:DR380759.1,
FT                   INSD:EL313762.1,INSD:T76053.1,INSD:EH883977.1,
FT                   INSD:AV784527.1,INSD:BE521478.1,INSD:EH953050.1,
FT                   INSD:BP865296.1,INSD:EH907257.1,INSD:BP588897.1,
FT                   INSD:BP624674.1,INSD:EL223515.1,INSD:BP598554.1,
FT                   INSD:BP593845.1,INSD:AV551908.1,INSD:EL122522.1,
FT                   INSD:EH803671.1,INSD:Z34188.1,INSD:EL991498.1,
FT                   INSD:Z34608.1,INSD:BP795867.1,INSD:CD530100.1,
FT                   INSD:AV823538.1,INSD:AV541112.1,INSD:BP846823.1,
FT                   INSD:N96523.1,INSD:DR362437.1,INSD:CB262888.1,
FT                   INSD:ES138069.1,INSD:BE521154.1,INSD:EL302614.1,
FT                   INSD:BP631664.1,INSD:EH889277.1,INSD:BP659729.1,
FT                   INSD:BP620795.1,INSD:T76061.1,INSD:ES210573.1,
FT                   INSD:BE528634.1,INSD:AI993715.1,INSD:ES020781.1,
FT                   INSD:BP592681.1,INSD:BE526422.1,INSD:EL004399.1,
FT                   INSD:DR362436.1,INSD:BE529912.1,INSD:BE526246.1,
FT                   INSD:EG443086.1,INSD:BP590806.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY056223.1,INSD:BX831689.1,INSD:BX830348.1,
FT                   INSD:AF083794.1,INSD:AY142665.1"
FT   CDS_pept        complement(263709..265250)
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.230"
FT                   /gene_synonym="F7A7_230"
FT                   /locus_tag="AT5G01710"
FT                   /product="methyltransferase"
FT                   /note="methyltransferases; FUNCTIONS IN: methyltransferase
FT                   activity; INVOLVED IN: metabolic process; LOCATED IN:
FT                   endomembrane system; EXPRESSED IN: sperm cell, male
FT                   gametophyte, pollen tube; EXPRESSED DURING: L mature pollen
FT                   stage, M germinated pollen stage; CONTAINS InterPro
FT                   DOMAIN/s: Methyltransferase FkbM (InterPro:IPR006342),
FT                   Methyltransferase type 11 (InterPro:IPR013216); BEST
FT                   Arabidopsis thaliana protein match is: unknown protein
FT                   (TAIR:AT3G53400.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9M005"
FT                   /db_xref="InterPro:IPR006342"
FT                   /db_xref="InterPro:IPR013216"
FT                   /db_xref="InterPro:IPR029063"
FT                   /db_xref="UniProtKB/TrEMBL:Q9M005"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CF773980.1,INSD:EG443085.1,INSD:EH817539.1,
FT                   INSD:BP647620.1,INSD:EL289107.1,INSD:EL181351.1,
FT                   INSD:AV540969.1,INSD:BE522910.1,INSD:EL072035.1,
FT                   INSD:W43410.1,INSD:EH982582.1,INSD:BP599580.1,
FT                   INSD:AV566181.1,INSD:BP841876.1,INSD:DR380759.1,
FT                   INSD:EL313762.1,INSD:T76053.1,INSD:EH883977.1,
FT                   INSD:AV784527.1,INSD:BE521478.1,INSD:EH953050.1,
FT                   INSD:BP865296.1,INSD:EH907257.1,INSD:BP588897.1,
FT                   INSD:BP624674.1,INSD:EL223515.1,INSD:BP598554.1,
FT                   INSD:BP593845.1,INSD:AV551908.1,INSD:EL122522.1,
FT                   INSD:EH803671.1,INSD:Z34188.1,INSD:EL991498.1,
FT                   INSD:Z34608.1,INSD:BP795867.1,INSD:CD530100.1,
FT                   INSD:AV823538.1,INSD:AV541112.1,INSD:BP846823.1,
FT                   INSD:N96523.1,INSD:DR362437.1,INSD:CB262888.1,
FT                   INSD:ES138069.1,INSD:BE521154.1,INSD:EL302614.1,
FT                   INSD:BP631664.1,INSD:EH889277.1,INSD:BP659729.1,
FT                   INSD:BP620795.1,INSD:T76061.1,INSD:ES210573.1,
FT                   INSD:BE528634.1,INSD:AI993715.1,INSD:ES020781.1,
FT                   INSD:BP592681.1,INSD:BE526422.1,INSD:EL004399.1,
FT                   INSD:DR362436.1,INSD:BE529912.1,INSD:BE526246.1,
FT                   INSD:EG443086.1,INSD:BP590806.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY056223.1,INSD:BX831689.1,INSD:BX830348.1,
FT                   INSD:AF083794.1,INSD:AY142665.1"
FT                   /protein_id="AED90380.1"
FT   misc_feature    complement(265379..265492)
FT                   /gene_synonym="F7A7.230"
FT                   /gene_synonym="F7A7_230"
FT                   /locus_tag="AT5G01710"
FT                   /note="AT5G01710.uORF1"
FT   gene            complement(266278..270646)
FT                   /gene_synonym="F7A7.240"
FT                   /gene_synonym="F7A7_240"
FT                   /locus_tag="AT5G01720"
FT   mRNA            complement(join(266278..267171,267315..267566,
FT                   267657..267951,268032..268161,268247..268643,
FT                   268895..268999,269351..269476,269753..270646))
FT                   /gene_synonym="F7A7.240"
FT                   /gene_synonym="F7A7_240"
FT                   /locus_tag="AT5G01720"
FT                   /product="RNI-like superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH971110.1,INSD:BP838681.1,INSD:ES157889.1,
FT                   INSD:AV831599.1,INSD:AV530096.1,INSD:ES197841.1,
FT                   INSD:EH852755.1,INSD:AV524232.1,INSD:ES141206.1,
FT                   INSD:DR349128.1,INSD:BP816558.1,INSD:BE525539.1,
FT                   INSD:AA651109.1,INSD:BP828560.1,INSD:EH993152.1,
FT                   INSD:CB252999.1,INSD:EL004558.1,INSD:AV816937.1,
FT                   INSD:BP840029.1,INSD:BP819491.1,INSD:AU230138.1,
FT                   INSD:BP827837.1,INSD:BP840154.1,INSD:AV534404.1,
FT                   INSD:AU238890.1,INSD:DR288402.1,INSD:AV534461.1,
FT                   INSD:ES193526.1,INSD:EL156940.1,INSD:DR381930.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832007.1,INSD:AY086589.1,INSD:AY091103.1,
FT                   INSD:AK229588.1,INSD:AY122938.1"
FT   gene            266640..266874
FT                   /locus_tag="AT5G00785"
FT                   /note="Natural antisense transcript overlaps with
FT                   AT5G01720"
FT   ncRNA           266640..266874
FT                   /locus_tag="AT5G00785"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   CDS_pept        complement(join(267118..267171,267315..267566,
FT                   267657..267951,268032..268161,268247..268643,
FT                   268895..268999,269351..269476,269753..270391))
FT                   /codon_start=1
FT                   /gene_synonym="F7A7.240"
FT                   /gene_synonym="F7A7_240"
FT                   /locus_tag="AT5G01720"
FT                   /product="RNI-like superfamily protein"
FT                   /note="RNI-like superfamily protein; FUNCTIONS IN:
FT                   ubiquitin-protein ligase activity; INVOLVED IN:
FT                   ubiquitin-dependent protein catabolic process; LOCATED IN:
FT                   endomembrane system; EXPRESSED IN: 17 plant structures;
FT                   EXPRESSED DURING: 8 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Leucine-rich repeat, cysteine-containing subtype
FT                   (InterPro:IPR006553); BEST Arabidopsis thaliana protein
FT                   match is: F-box family protein (TAIR:AT5G27920.1); Has
FT                   15959 Blast hits to 6468 proteins in 357 species: Archae -
FT                   0; Bacteria - 920; Metazoa - 6194; Fungi - 1434; Plants -
FT                   4975; Viruses - 16; Other Eukaryotes - 2420 (source: NCBI
FT                   BLink)."
FT                   /db_xref="GOA:Q8RWU5"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR006553"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q8RWU5"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH971110.1,INSD:BP838681.1,INSD:ES157889.1,
FT                   INSD:AV831599.1,INSD:AV530096.1,INSD:ES197841.1,
FT                   INSD:EH852755.1,INSD:AV524232.1,INSD:ES141206.1,
FT                   INSD:DR349128.1,INSD:BP816558.1,INSD:BE525539.1,
FT                   INSD:AA651109.1,INSD:BP828560.1,INSD:EH993152.1,
FT                   INSD:CB252999.1,INSD:EL004558.1,INSD:AV816937.1,
FT                   INSD:BP840029.1,INSD:BP819491.1,INSD:AU230138.1,
FT                   INSD:BP827837.1,INSD:BP840154.1,INSD:AV534404.1,
FT                   INSD:AU238890.1,INSD:DR288402.1,INSD:AV534461.1,
FT                   INSD:ES193526.1,INSD:EL156940.1,INSD:DR381930.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832007.1,INSD:AY086589.1,INSD:AY091103.1,
FT                   INSD:AK229588.1,INSD:AY122938.1"
FT                   /protein_id="AED90382.1"
FT   gene            267185..269354
FT                   /pseudo
FT                   /locus_tag="AT5G01715"
FT   misc_RNA        join(267185..268739,268828..269018,269178..269354)
FT                   /pseudo
FT                   /locus_tag="AT5G01715"
FT                   /note="pseudogene of RNI-like superfamily protein;
FT                   AT5G01715.1"
FT   gene            complement(272832..277886)
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /note="Encodes a member of the SCAR family.These proteins
FT                   are part of a complex (WAVE) complex.The SCAR subunit
FT                   activates the ARP2/3 complex which in turn act as a
FT                   nucleator for actin filaments."
FT   mRNA            complement(join(272832..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..276826,276918..277081,
FT                   277407..277596,277683..277886))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH856854.1,INSD:AV529548.1,INSD:EL096384.1,
FT                   INSD:EL103007.1,INSD:AV529540.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX833319.1,INSD:AY743927.1"
FT   gene            272839..276426
FT                   /locus_tag="AT5G01732"
FT                   /note="Natural antisense transcript overlaps with
FT                   AT5G01730; Potential natural antisense gene, locus overlaps
FT                   with AT5G01730"
FT   ncRNA           join(272839..273647,273724..275937,276024..276426)
FT                   /locus_tag="AT5G01732"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   mRNA            complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..277081,277407..277596,
FT                   277683..277886))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   mRNA            complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..276826,276918..277081,
FT                   277407..277682))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   mRNA            complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..277081,277407..277645))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   CDS_pept        complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..276826,276918..277081,
FT                   277407..277561))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="GOA:Q5XPJ6"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q5XPJ6"
FT                   /protein_id="ANM68918.1"
FT                   SWSE"
FT   CDS_pept        complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..276826,276918..277081,
FT                   277407..277561))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /note="SCAR family protein 4 (SCAR4); FUNCTIONS IN:
FT                   molecular_function unknown; INVOLVED IN: positive
FT                   regulation of actin nucleation; LOCATED IN: SCAR complex,
FT                   chloroplast, plastoglobule; EXPRESSED IN: 23 plant
FT                   structures; EXPRESSED DURING: 12 growth stages; BEST
FT                   Arabidopsis thaliana protein match is: SCAR homolog 2
FT                   (TAIR:AT2G38440.1); Has 1330 Blast hits to 874 proteins in
FT                   188 species: Archae - 2; Bacteria - 349; Metazoa - 454;
FT                   Fungi - 169; Plants - 213; Viruses - 0; Other Eukaryotes -
FT                   143 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q5XPJ6"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q5XPJ6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH856854.1,INSD:AV529548.1,INSD:EL096384.1,
FT                   INSD:EL103007.1,INSD:AV529540.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX833319.1,INSD:AY743927.1"
FT                   /protein_id="AED90383.1"
FT                   SWSE"
FT   mRNA            complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..276877))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   CDS_pept        complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..276755))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="GOA:A0A1P8BBH5"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BBH5"
FT                   /protein_id="ANM68917.1"
FT   CDS_pept        complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..276755))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01730"
FT                   /db_xref="GOA:A0A1P8BBH5"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BBH5"
FT                   /protein_id="ANM68921.1"
FT   CDS_pept        complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276179,276292..276353,
FT                   276490..276619,276703..276755))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="GOA:A0A1P8BBH5"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BBH5"
FT                   /protein_id="ANM68922.1"
FT   mRNA            complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276055))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   CDS_pept        complement(join(273019..273069,273192..273305,
FT                   273389..273475,273554..276055))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01730"
FT                   /db_xref="GOA:A0A1P8BBE5"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BBE5"
FT                   /protein_id="ANM68920.1"
FT   mRNA            complement(join(273165..273305,273389..273475,
FT                   273554..276179,276292..276353,276490..276619,
FT                   276703..277081,277407..277596,277683..277886))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   mRNA            complement(join(273165..273305,273389..273475,
FT                   273554..276179,276292..276353,276490..276619,
FT                   276703..277081,277407..277645))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   mRNA            complement(join(273165..273305,273389..273475,
FT                   273554..276179,276292..276353,276490..276619,
FT                   276703..276826,276918..277081,277407..277641))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   CDS_pept        complement(join(273165..273305,273389..273475,
FT                   273554..276179,276292..276353,276490..276619,
FT                   276703..276826,276918..277081,277407..277561))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01730"
FT                   /db_xref="GOA:A0A1P8BBE6"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BBE6"
FT                   /protein_id="ANM68923.1"
FT   CDS_pept        complement(join(273165..273305,273389..273475,
FT                   273554..276179,276292..276353,276490..276619,
FT                   276703..276755))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="GOA:A0A1P8BBE9"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BBE9"
FT                   /protein_id="ANM68919.1"
FT   CDS_pept        complement(join(273165..273305,273389..273475,
FT                   273554..276179,276292..276353,276490..276619,
FT                   276703..276755))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01730"
FT                   /db_xref="GOA:A0A1P8BBE9"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BBE9"
FT                   /protein_id="ANM68924.1"
FT   mRNA            complement(join(273335..273475,273554..276179,
FT                   276292..276353,276490..276619,276703..276826,
FT                   276918..277081,277407..277682))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   mRNA            complement(join(273335..273475,273554..276179,
FT                   276292..276353,276490..276619,276703..277081,
FT                   277407..277645))
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT   CDS_pept        complement(join(273335..273475,273554..276179,
FT                   276292..276353,276490..276619,276703..276826,
FT                   276918..277081,277407..277561))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="GOA:A0A178UA95"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/TrEMBL:A0A178UA95"
FT                   /protein_id="ANM68915.1"
FT   CDS_pept        complement(join(273335..273475,273554..276179,
FT                   276292..276353,276490..276619,276703..276755))
FT                   /codon_start=1
FT                   /gene="SCAR4"
FT                   /gene_synonym="ATSCAR4"
FT                   /gene_synonym="F7A7.250"
FT                   /gene_synonym="F7A7_250"
FT                   /gene_synonym="SCAR family protein 4"
FT                   /gene_synonym="WAVE3"
FT                   /locus_tag="AT5G01730"
FT                   /product="SCAR family protein 4"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01730"
FT                   /db_xref="GOA:A0A1P8BBE8"
FT                   /db_xref="InterPro:IPR028288"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BBE8"
FT                   /protein_id="ANM68916.1"
FT                   PFHLFLFTLFSFLL"
FT   gene            280674..281532
FT                   /gene_synonym="T20L15.10"
FT                   /gene_synonym="T20L15_10"
FT                   /locus_tag="AT5G01740"
FT   mRNA            280674..281532
FT                   /gene_synonym="T20L15.10"
FT                   /gene_synonym="T20L15_10"
FT                   /locus_tag="AT5G01740"
FT                   /product="Nuclear transport factor 2 (NTF2) family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP561180.1,INSD:AV801748.1,INSD:EL061742.1,
FT                   INSD:EL253127.1,INSD:DR381603.1,INSD:EL044656.1,
FT                   INSD:BP843349.1,INSD:BP663016.1,INSD:EH919201.1,
FT                   INSD:EL125910.1,INSD:EL299142.1,INSD:AV785326.1,
FT                   INSD:EH806022.1,INSD:EL225895.1,INSD:EH796608.1,
FT                   INSD:EL115784.1,INSD:EH935016.1,INSD:BP846951.1,
FT                   INSD:EL044843.1,INSD:EL064426.1,INSD:EH917951.1,
FT                   INSD:EL096076.1,INSD:EL135985.1,INSD:EH968314.1,
FT                   INSD:EH856352.1,INSD:EH803158.1,INSD:EL050959.1,
FT                   INSD:BP662570.1,INSD:EH833407.1,INSD:BP861266.1,
FT                   INSD:EH978411.1,INSD:BP651008.1,INSD:EL216475.1,
FT                   INSD:EL079543.1,INSD:EL288553.1,INSD:EL027171.1,
FT                   INSD:DR350255.1,INSD:EH966641.1,INSD:EL230991.1,
FT                   INSD:EL231937.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY075604.1,INSD:BT014870.1,INSD:AY089058.1"
FT   CDS_pept        280793..281281
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.10"
FT                   /gene_synonym="T20L15_10"
FT                   /locus_tag="AT5G01740"
FT                   /product="Nuclear transport factor 2 (NTF2) family protein"
FT                   /note="Nuclear transport factor 2 (NTF2) family protein;
FT                   CONTAINS InterPro DOMAIN/s: Wound-induced protein, Wun1
FT                   (InterPro:IPR009798); BEST Arabidopsis thaliana protein
FT                   match is: senescence associated gene 20 (TAIR:AT3G10985.1);
FT                   Has 1807 Blast hits to 1807 proteins in 277 species: Archae
FT                   - 0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants -
FT                   385; Viruses - 0; Other Eukaryotes - 339 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01740"
FT                   /db_xref="GOA:Q9LZX2"
FT                   /db_xref="InterPro:IPR009798"
FT                   /db_xref="InterPro:IPR032710"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LZX2"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP561180.1,INSD:AV801748.1,INSD:EL061742.1,
FT                   INSD:EL253127.1,INSD:DR381603.1,INSD:EL044656.1,
FT                   INSD:BP843349.1,INSD:BP663016.1,INSD:EH919201.1,
FT                   INSD:EL125910.1,INSD:EL299142.1,INSD:AV785326.1,
FT                   INSD:EH806022.1,INSD:EL225895.1,INSD:EH796608.1,
FT                   INSD:EL115784.1,INSD:EH935016.1,INSD:BP846951.1,
FT                   INSD:EL044843.1,INSD:EL064426.1,INSD:EH917951.1,
FT                   INSD:EL096076.1,INSD:EL135985.1,INSD:EH968314.1,
FT                   INSD:EH856352.1,INSD:EH803158.1,INSD:EL050959.1,
FT                   INSD:BP662570.1,INSD:EH833407.1,INSD:BP861266.1,
FT                   INSD:EH978411.1,INSD:BP651008.1,INSD:EL216475.1,
FT                   INSD:EL079543.1,INSD:EL288553.1,INSD:EL027171.1,
FT                   INSD:DR350255.1,INSD:EH966641.1,INSD:EL230991.1,
FT                   INSD:EL231937.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY075604.1,INSD:BT014870.1,INSD:AY089058.1"
FT                   /protein_id="AED90385.1"
FT   gene            287584..287736
FT                   /gene="MIR164b"
FT                   /gene_synonym="MICRORNA 164"
FT                   /gene_synonym="microRNA164B"
FT                   /gene_synonym="MIR164"
FT                   /gene_synonym="MIR164B"
FT                   /gene_synonym="p_MI0000198"
FT                   /locus_tag="AT5G01747"
FT                   /note="Encodes a microRNA that targets several genes
FT                   containing NAC domains including NAC1. Overexpression leads
FT                   to decreased NAC1 mRNA and reduced lateral roots. Loss of
FT                   function mutants have increased NAC1 and increased number
FT                   of lateral roots. Also targets ORE1 to negatively regulate
FT                   the timing of leaf senescence. MicroRNAs are regulatory
FT                   RNAs with a mature length of 21-nucleotides that are
FT                   processed from hairpin precursors by Dicer-like enzymes.
FT                   MicroRNAs can negatively regulate gene expression by
FT                   attenuating translation or by directing mRNA
FT                   cleavage.Mature sequence: UGGAGAAGCAGGGCACGUGCA"
FT   precursor_RNA   287584..287736
FT                   /gene="MIR164b"
FT                   /gene_synonym="MICRORNA 164"
FT                   /gene_synonym="microRNA164B"
FT                   /gene_synonym="MIR164"
FT                   /gene_synonym="MIR164B"
FT                   /gene_synonym="p_MI0000198"
FT                   /locus_tag="AT5G01747"
FT                   /product="microRNA ath-MIR164b precursor"
FT   ncRNA           287586..287606
FT                   /gene="MIR164b"
FT                   /gene_synonym="MICRORNA 164"
FT                   /gene_synonym="microRNA164B"
FT                   /gene_synonym="MIR164"
FT                   /gene_synonym="MIR164B"
FT                   /gene_synonym="p_MI0000198"
FT                   /locus_tag="AT5G01747"
FT                   /product="microRNA ath-miR164b-5p"
FT                   /note="mature miRNA accession:MIMAT0000186"
FT                   /ncRNA_class="miRNA"
FT   ncRNA           287716..287736
FT                   /gene="MIR164b"
FT                   /gene_synonym="MICRORNA 164"
FT                   /gene_synonym="microRNA164B"
FT                   /gene_synonym="MIR164"
FT                   /gene_synonym="MIR164B"
FT                   /gene_synonym="p_MI0000198"
FT                   /locus_tag="AT5G01747"
FT                   /product="microRNA ath-miR164b-3p"
FT                   /note="mature miRNA accession:MIMAT0031878"
FT                   /ncRNA_class="miRNA"
FT   gene            complement(288329..288574)
FT                   /locus_tag="AT5G00790"
FT   ncRNA           complement(288329..288574)
FT                   /locus_tag="AT5G00790"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            289717..291604
FT                   /gene_synonym="T20L15.20"
FT                   /gene_synonym="T20L15_20"
FT                   /locus_tag="AT5G01750"
FT   mRNA            join(289717..290315,290443..291369)
FT                   /gene_synonym="T20L15.20"
FT                   /gene_synonym="T20L15_20"
FT                   /locus_tag="AT5G01750"
FT                   /product="LURP-one-like protein (DUF567)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES140458.1,INSD:ES092266.1,INSD:DR316087.1,
FT                   INSD:EH810655.1,INSD:DR358207.1,INSD:EH911067.1,
FT                   INSD:EH980661.1,INSD:EL174033.1,INSD:T44947.1,
FT                   INSD:EL215332.1,INSD:EH828907.1,INSD:DR358203.1,
FT                   INSD:EL196476.1,INSD:EL160892.1,INSD:EH913881.1,
FT                   INSD:ES142402.1,INSD:AV553247.1,INSD:EL991652.1,
FT                   INSD:EL066272.1,INSD:EL993803.1,INSD:BP822864.1,
FT                   INSD:DR259602.1,INSD:EL316666.1,INSD:CB263328.1,
FT                   INSD:EL228909.1,INSD:ES166032.1,INSD:EL155019.1,
FT                   INSD:EL285042.1,INSD:DR350571.1,INSD:EL117135.1,
FT                   INSD:BP855110.1,INSD:T42596.1,INSD:CB260128.1,
FT                   INSD:EL262512.1,INSD:EL175224.1,INSD:ES115316.1,
FT                   INSD:DR358206.1,INSD:EL104647.1,INSD:EL136622.1,
FT                   INSD:BP807051.1,INSD:EL164658.1,INSD:W43248.1,
FT                   INSD:ES075885.1,INSD:EH991836.1,INSD:BP822838.1,
FT                   INSD:ES017732.1,INSD:EH882905.1,INSD:EH822048.1,
FT                   INSD:ES096397.1,INSD:EL276194.1,INSD:EL983879.1,
FT                   INSD:EH836588.1,INSD:BE038953.1,INSD:BP852115.1,
FT                   INSD:DR358204.1,INSD:EH811841.1,INSD:EL332416.1,
FT                   INSD:ES195211.1,INSD:BP829010.1,INSD:EH925056.1,
FT                   INSD:EL080306.1,INSD:ES125222.1,INSD:BP833555.1,
FT                   INSD:BP853304.1,INSD:CB254258.1,INSD:ES123471.1,
FT                   INSD:EL270096.1,INSD:BP831152.1,INSD:ES157246.1,
FT                   INSD:ES122880.1,INSD:EL254238.1,INSD:EL312705.1,
FT                   INSD:BP821217.1,INSD:EL017720.1,INSD:EL163467.1,
FT                   INSD:EL266955.1,INSD:BP860061.1,INSD:DR316088.1,
FT                   INSD:EG419797.1,INSD:ES072927.1,INSD:DR259603.1,
FT                   INSD:EG419786.1,INSD:Z34868.1,INSD:R30135.1,
FT                   INSD:BP820367.1,INSD:BP828347.1,INSD:AV526198.1,
FT                   INSD:AV554258.1,INSD:AA721870.1,INSD:ES101816.1,
FT                   INSD:AV553580.1,INSD:EL213022.1,INSD:DR372338.1,
FT                   INSD:ES097621.1,INSD:DR358209.1,INSD:DR259604.1,
FT                   INSD:EL254036.1,INSD:EL314953.1,INSD:EL274893.1,
FT                   INSD:EL099481.1,INSD:CB262288.1,INSD:T42564.1,
FT                   INSD:EH850293.1,INSD:N37667.1,INSD:EL212695.1,
FT                   INSD:EH839936.1,INSD:EL260736.1,INSD:EH978623.1,
FT                   INSD:EH871421.1,INSD:AV536937.1,INSD:EH873326.1,
FT                   INSD:ES025939.1,INSD:BP831850.1,INSD:EL197381.1,
FT                   INSD:T46542.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AY085369.1"
FT   mRNA            join(289722..290315,290443..290670,290966..291604)
FT                   /gene_synonym="T20L15.20"
FT                   /gene_synonym="T20L15_20"
FT                   /locus_tag="AT5G01750"
FT                   /product="LURP-one-like protein (DUF567)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL980340.1,INSD:ES092266.1,INSD:DR316087.1,
FT                   INSD:DR358207.1,INSD:BP618413.1,INSD:EH980661.1,
FT                   INSD:EL215332.1,INSD:EH828907.1,INSD:BP836836.1,
FT                   INSD:DR358203.1,INSD:EL196476.1,INSD:BP652809.1,
FT                   INSD:EL160892.1,INSD:EL055921.1,INSD:EG446924.1,
FT                   INSD:EH913881.1,INSD:EL280873.1,INSD:ES142402.1,
FT                   INSD:EG481204.1,INSD:EL066272.1,INSD:EL993803.1,
FT                   INSD:ES023112.1,INSD:CB252414.1,INSD:EG447725.1,
FT                   INSD:EL316666.1,INSD:EG445940.1,INSD:EL228909.1,
FT                   INSD:EL129783.1,INSD:AV788635.1,INSD:CB259389.1,
FT                   INSD:BP855110.1,INSD:EL117135.1,INSD:T42596.1,
FT                   INSD:CB260128.1,INSD:EL262512.1,INSD:EL175224.1,
FT                   INSD:EL061321.1,INSD:ES028002.1,INSD:ES115316.1,
FT                   INSD:BP632794.1,INSD:DR358206.1,INSD:EL195477.1,
FT                   INSD:BP650532.1,INSD:EL078591.1,INSD:W43248.1,
FT                   INSD:ES017732.1,INSD:EL276194.1,INSD:EL983879.1,
FT                   INSD:EH836588.1,INSD:BE038953.1,INSD:EH804468.1,
FT                   INSD:EL300321.1,INSD:EH811841.1,INSD:EG512996.1,
FT                   INSD:AV545517.1,INSD:BP829010.1,INSD:EL080306.1,
FT                   INSD:EG421299.1,INSD:ES136720.1,INSD:BP853304.1,
FT                   INSD:BP629275.1,INSD:CB254109.1,INSD:ES007118.1,
FT                   INSD:EG421494.1,INSD:DR358205.1,INSD:BP617513.1,
FT                   INSD:EL312705.1,INSD:BP821217.1,INSD:AV821222.1,
FT                   INSD:EL163467.1,INSD:CD532427.1,INSD:EH805585.1,
FT                   INSD:DR316088.1,INSD:AV520101.1,INSD:EG445941.1,
FT                   INSD:EG419440.1,INSD:ES072927.1,INSD:DR259603.1,
FT                   INSD:EG419786.1,INSD:Z34868.1,INSD:R30135.1,
FT                   INSD:BP820367.1,INSD:BP828347.1,INSD:AV526198.1,
FT                   INSD:AV787457.1,INSD:AA721870.1,INSD:BP638621.1,
FT                   INSD:ES101816.1,INSD:AV553580.1,INSD:ES032319.1,
FT                   INSD:EG481205.1,INSD:DR358209.1,INSD:EL996642.1,
FT                   INSD:EH876830.1,INSD:EH960616.1,INSD:EL099481.1,
FT                   INSD:EG419470.1,INSD:AV532967.1,INSD:T42564.1,
FT                   INSD:EG445270.1,INSD:ES012956.1,INSD:N37667.1,
FT                   INSD:EL212695.1,INSD:EH894458.1,INSD:EL987615.1,
FT                   INSD:EH864532.1,INSD:EH867952.1,INSD:EL197381.1,
FT                   INSD:T46542.1,INSD:ES140458.1,INSD:EH810655.1,
FT                   INSD:EH911067.1,INSD:EL174033.1,INSD:EG444300.1,
FT                   INSD:T44947.1,INSD:BP657514.1,INSD:AV562636.1,
FT                   INSD:BP603769.1,INSD:AV553247.1,INSD:EL991652.1,
FT                   INSD:EL009979.1,INSD:BP654910.1,INSD:ES035271.1,
FT                   INSD:BP822864.1,INSD:DR259602.1,INSD:EL219317.1,
FT                   INSD:EG446093.1,INSD:EG512995.1,INSD:CB263328.1,
FT                   INSD:ES166032.1,INSD:EL155019.1,INSD:ES080621.1,
FT                   INSD:BP642313.1,INSD:EL285042.1,INSD:BP671586.1,
FT                   INSD:EG445518.1,INSD:DR350571.1,INSD:DR358202.1,
FT                   INSD:ES040879.1,INSD:DR383062.1,INSD:EG419595.1,
FT                   INSD:CB260088.1,INSD:EL104647.1,INSD:EL136622.1,
FT                   INSD:BP807051.1,INSD:EL275255.1,INSD:ES075885.1,
FT                   INSD:AV536277.1,INSD:EL200347.1,INSD:EH991836.1,
FT                   INSD:BP822838.1,INSD:EH882905.1,INSD:EH822048.1,
FT                   INSD:ES096397.1,INSD:AV560647.1,INSD:BP852115.1,
FT                   INSD:DR358204.1,INSD:BP667998.1,INSD:EG445691.1,
FT                   INSD:EL332416.1,INSD:CB252438.1,INSD:ES195211.1,
FT                   INSD:EL267514.1,INSD:DR358201.1,INSD:EH925056.1,
FT                   INSD:ES125222.1,INSD:EL029214.1,INSD:EL997083.1,
FT                   INSD:BP833555.1,INSD:AI997432.1,INSD:BP633883.1,
FT                   INSD:CB254258.1,INSD:ES123471.1,INSD:EL270096.1,
FT                   INSD:BP831152.1,INSD:ES157246.1,INSD:BP638443.1,
FT                   INSD:ES122880.1,INSD:AV786653.1,INSD:AV567679.1,
FT                   INSD:EL017720.1,INSD:EG444291.1,INSD:EL266955.1,
FT                   INSD:BP860061.1,INSD:EL030844.1,INSD:EG446194.1,
FT                   INSD:EG419797.1,INSD:AV544750.1,INSD:AV781556.1,
FT                   INSD:BP606647.1,INSD:AV554258.1,INSD:ES106379.1,
FT                   INSD:EG443729.1,INSD:DR358208.1,INSD:EL213022.1,
FT                   INSD:EG443730.1,INSD:CB254110.1,INSD:EL026235.1,
FT                   INSD:ES097621.1,INSD:BP662677.1,INSD:DR259604.1,
FT                   INSD:BE038615.1,INSD:EL254036.1,INSD:AV566328.1,
FT                   INSD:EL314953.1,INSD:EG425753.1,INSD:EL274893.1,
FT                   INSD:AV789130.1,INSD:CB262288.1,INSD:EH850293.1,
FT                   INSD:BP639034.1,INSD:EH839936.1,INSD:Z35003.1,
FT                   INSD:BP625934.1,INSD:EL260736.1,INSD:EH978623.1,
FT                   INSD:EH871421.1,INSD:AV536937.1,INSD:EH873326.1,
FT                   INSD:ES025939.1,INSD:BP831850.1,INSD:EL135524.1,
FT                   INSD:BP610156.1,INSD:EH992711.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831294.1,INSD:AF372877.1,INSD:AY142034.1,
FT                   INSD:BX841669.1"
FT   CDS_pept        join(290034..290315,290443..290670,290966..291109)
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.20"
FT                   /gene_synonym="T20L15_20"
FT                   /locus_tag="AT5G01750"
FT                   /product="LURP-one-like protein (DUF567)"
FT                   /note="Protein of unknown function (DUF567); FUNCTIONS IN:
FT                   molecular_function unknown; INVOLVED IN: biological_process
FT                   unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant
FT                   structures; EXPRESSED DURING: 13 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Protein of unknown function DUF567
FT                   (InterPro:IPR007612); BEST Arabidopsis thaliana protein
FT                   match is: Protein of unknown function (DUF567)
FT                   (TAIR:AT3G11740.1); Has 468 Blast hits to 466 proteins in
FT                   44 species: Archae - 0; Bacteria - 29; Metazoa - 0; Fungi -
FT                   27; Plants - 412; Viruses - 0; Other Eukaryotes - 0
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZX1"
FT                   /db_xref="InterPro:IPR007612"
FT                   /db_xref="InterPro:IPR025659"
FT                   /db_xref="InterPro:IPR038595"
FT                   /db_xref="PDB:1ZXU"
FT                   /db_xref="PDB:2Q4M"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZX1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL980340.1,INSD:ES092266.1,INSD:DR316087.1,
FT                   INSD:DR358207.1,INSD:BP618413.1,INSD:EH980661.1,
FT                   INSD:EL215332.1,INSD:EH828907.1,INSD:BP836836.1,
FT                   INSD:DR358203.1,INSD:EL196476.1,INSD:BP652809.1,
FT                   INSD:EL160892.1,INSD:EL055921.1,INSD:EG446924.1,
FT                   INSD:EH913881.1,INSD:EL280873.1,INSD:ES142402.1,
FT                   INSD:EG481204.1,INSD:EL066272.1,INSD:EL993803.1,
FT                   INSD:ES023112.1,INSD:CB252414.1,INSD:EG447725.1,
FT                   INSD:EL316666.1,INSD:EG445940.1,INSD:EL228909.1,
FT                   INSD:EL129783.1,INSD:AV788635.1,INSD:CB259389.1,
FT                   INSD:BP855110.1,INSD:EL117135.1,INSD:T42596.1,
FT                   INSD:CB260128.1,INSD:EL262512.1,INSD:EL175224.1,
FT                   INSD:EL061321.1,INSD:ES028002.1,INSD:ES115316.1,
FT                   INSD:BP632794.1,INSD:DR358206.1,INSD:EL195477.1,
FT                   INSD:BP650532.1,INSD:EL078591.1,INSD:W43248.1,
FT                   INSD:ES017732.1,INSD:EL276194.1,INSD:EL983879.1,
FT                   INSD:EH836588.1,INSD:BE038953.1,INSD:EH804468.1,
FT                   INSD:EL300321.1,INSD:EH811841.1,INSD:EG512996.1,
FT                   INSD:AV545517.1,INSD:BP829010.1,INSD:EL080306.1,
FT                   INSD:EG421299.1,INSD:ES136720.1,INSD:BP853304.1,
FT                   INSD:BP629275.1,INSD:CB254109.1,INSD:ES007118.1,
FT                   INSD:EG421494.1,INSD:DR358205.1,INSD:BP617513.1,
FT                   INSD:EL312705.1,INSD:BP821217.1,INSD:AV821222.1,
FT                   INSD:EL163467.1,INSD:CD532427.1,INSD:EH805585.1,
FT                   INSD:DR316088.1,INSD:AV520101.1,INSD:EG445941.1,
FT                   INSD:EG419440.1,INSD:ES072927.1,INSD:DR259603.1,
FT                   INSD:EG419786.1,INSD:Z34868.1,INSD:R30135.1,
FT                   INSD:BP820367.1,INSD:BP828347.1,INSD:AV526198.1,
FT                   INSD:AV787457.1,INSD:AA721870.1,INSD:BP638621.1,
FT                   INSD:ES101816.1,INSD:AV553580.1,INSD:ES032319.1,
FT                   INSD:EG481205.1,INSD:DR358209.1,INSD:EL996642.1,
FT                   INSD:EH876830.1,INSD:EH960616.1,INSD:EL099481.1,
FT                   INSD:EG419470.1,INSD:AV532967.1,INSD:T42564.1,
FT                   INSD:EG445270.1,INSD:ES012956.1,INSD:N37667.1,
FT                   INSD:EL212695.1,INSD:EH894458.1,INSD:EL987615.1,
FT                   INSD:EH864532.1,INSD:EH867952.1,INSD:EL197381.1,
FT                   INSD:T46542.1,INSD:ES140458.1,INSD:EH810655.1,
FT                   INSD:EH911067.1,INSD:EL174033.1,INSD:EG444300.1,
FT                   INSD:T44947.1,INSD:BP657514.1,INSD:AV562636.1,
FT                   INSD:BP603769.1,INSD:AV553247.1,INSD:EL991652.1,
FT                   INSD:EL009979.1,INSD:BP654910.1,INSD:ES035271.1,
FT                   INSD:BP822864.1,INSD:DR259602.1,INSD:EL219317.1,
FT                   INSD:EG446093.1,INSD:EG512995.1,INSD:CB263328.1,
FT                   INSD:ES166032.1,INSD:EL155019.1,INSD:ES080621.1,
FT                   INSD:BP642313.1,INSD:EL285042.1,INSD:BP671586.1,
FT                   INSD:EG445518.1,INSD:DR350571.1,INSD:DR358202.1,
FT                   INSD:ES040879.1,INSD:DR383062.1,INSD:EG419595.1,
FT                   INSD:CB260088.1,INSD:EL104647.1,INSD:EL136622.1,
FT                   INSD:BP807051.1,INSD:EL275255.1,INSD:ES075885.1,
FT                   INSD:AV536277.1,INSD:EL200347.1,INSD:EH991836.1,
FT                   INSD:BP822838.1,INSD:EH882905.1,INSD:EH822048.1,
FT                   INSD:ES096397.1,INSD:AV560647.1,INSD:BP852115.1,
FT                   INSD:DR358204.1,INSD:BP667998.1,INSD:EG445691.1,
FT                   INSD:EL332416.1,INSD:CB252438.1,INSD:ES195211.1,
FT                   INSD:EL267514.1,INSD:DR358201.1,INSD:EH925056.1,
FT                   INSD:ES125222.1,INSD:EL029214.1,INSD:EL997083.1,
FT                   INSD:BP833555.1,INSD:AI997432.1,INSD:BP633883.1,
FT                   INSD:CB254258.1,INSD:ES123471.1,INSD:EL270096.1,
FT                   INSD:BP831152.1,INSD:ES157246.1,INSD:BP638443.1,
FT                   INSD:ES122880.1,INSD:AV786653.1,INSD:AV567679.1,
FT                   INSD:EL017720.1,INSD:EG444291.1,INSD:EL266955.1,
FT                   INSD:BP860061.1,INSD:EL030844.1,INSD:EG446194.1,
FT                   INSD:EG419797.1,INSD:AV544750.1,INSD:AV781556.1,
FT                   INSD:BP606647.1,INSD:AV554258.1,INSD:ES106379.1,
FT                   INSD:EG443729.1,INSD:DR358208.1,INSD:EL213022.1,
FT                   INSD:EG443730.1,INSD:CB254110.1,INSD:EL026235.1,
FT                   INSD:ES097621.1,INSD:BP662677.1,INSD:DR259604.1,
FT                   INSD:BE038615.1,INSD:EL254036.1,INSD:AV566328.1,
FT                   INSD:EL314953.1,INSD:EG425753.1,INSD:EL274893.1,
FT                   INSD:AV789130.1,INSD:CB262288.1,INSD:EH850293.1,
FT                   INSD:BP639034.1,INSD:EH839936.1,INSD:Z35003.1,
FT                   INSD:BP625934.1,INSD:EL260736.1,INSD:EH978623.1,
FT                   INSD:EH871421.1,INSD:AV536937.1,INSD:EH873326.1,
FT                   INSD:ES025939.1,INSD:BP831850.1,INSD:EL135524.1,
FT                   INSD:BP610156.1,INSD:EH992711.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX831294.1,INSD:AF372877.1,INSD:AY142034.1,
FT                   INSD:BX841669.1"
FT                   /protein_id="AED90387.1"
FT   CDS_pept        join(290034..290315,290443..290685)
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.20"
FT                   /gene_synonym="T20L15_20"
FT                   /locus_tag="AT5G01750"
FT                   /product="LURP-one-like protein (DUF567)"
FT                   /note="Protein of unknown function (DUF567); FUNCTIONS IN:
FT                   molecular_function unknown; INVOLVED IN: biological_process
FT                   unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant
FT                   structures; EXPRESSED DURING: 13 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Protein of unknown function DUF567
FT                   (InterPro:IPR007612); BEST Arabidopsis thaliana protein
FT                   match is: Protein of unknown function (DUF567)
FT                   (TAIR:AT1G33840.1); Has 30201 Blast hits to 17322 proteins
FT                   in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
FT                   17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
FT                   Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01750"
FT                   /db_xref="GOA:Q9LZX1"
FT                   /db_xref="InterPro:IPR007612"
FT                   /db_xref="InterPro:IPR025659"
FT                   /db_xref="InterPro:IPR038595"
FT                   /db_xref="PDB:1ZXU"
FT                   /db_xref="PDB:2Q4M"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZX1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES140458.1,INSD:ES092266.1,INSD:DR316087.1,
FT                   INSD:EH810655.1,INSD:DR358207.1,INSD:EH911067.1,
FT                   INSD:EH980661.1,INSD:EL174033.1,INSD:T44947.1,
FT                   INSD:EL215332.1,INSD:EH828907.1,INSD:DR358203.1,
FT                   INSD:EL196476.1,INSD:EL160892.1,INSD:EH913881.1,
FT                   INSD:ES142402.1,INSD:AV553247.1,INSD:EL991652.1,
FT                   INSD:EL066272.1,INSD:EL993803.1,INSD:BP822864.1,
FT                   INSD:DR259602.1,INSD:EL316666.1,INSD:CB263328.1,
FT                   INSD:EL228909.1,INSD:ES166032.1,INSD:EL155019.1,
FT                   INSD:EL285042.1,INSD:DR350571.1,INSD:EL117135.1,
FT                   INSD:BP855110.1,INSD:T42596.1,INSD:CB260128.1,
FT                   INSD:EL262512.1,INSD:EL175224.1,INSD:ES115316.1,
FT                   INSD:DR358206.1,INSD:EL104647.1,INSD:EL136622.1,
FT                   INSD:BP807051.1,INSD:EL164658.1,INSD:W43248.1,
FT                   INSD:ES075885.1,INSD:EH991836.1,INSD:BP822838.1,
FT                   INSD:ES017732.1,INSD:EH882905.1,INSD:EH822048.1,
FT                   INSD:ES096397.1,INSD:EL276194.1,INSD:EL983879.1,
FT                   INSD:EH836588.1,INSD:BE038953.1,INSD:BP852115.1,
FT                   INSD:DR358204.1,INSD:EH811841.1,INSD:EL332416.1,
FT                   INSD:ES195211.1,INSD:BP829010.1,INSD:EH925056.1,
FT                   INSD:EL080306.1,INSD:ES125222.1,INSD:BP833555.1,
FT                   INSD:BP853304.1,INSD:CB254258.1,INSD:ES123471.1,
FT                   INSD:EL270096.1,INSD:BP831152.1,INSD:ES157246.1,
FT                   INSD:ES122880.1,INSD:EL254238.1,INSD:EL312705.1,
FT                   INSD:BP821217.1,INSD:EL017720.1,INSD:EL163467.1,
FT                   INSD:EL266955.1,INSD:BP860061.1,INSD:DR316088.1,
FT                   INSD:EG419797.1,INSD:ES072927.1,INSD:DR259603.1,
FT                   INSD:EG419786.1,INSD:Z34868.1,INSD:R30135.1,
FT                   INSD:BP820367.1,INSD:BP828347.1,INSD:AV526198.1,
FT                   INSD:AV554258.1,INSD:AA721870.1,INSD:ES101816.1,
FT                   INSD:AV553580.1,INSD:EL213022.1,INSD:DR372338.1,
FT                   INSD:ES097621.1,INSD:DR358209.1,INSD:DR259604.1,
FT                   INSD:EL254036.1,INSD:EL314953.1,INSD:EL274893.1,
FT                   INSD:EL099481.1,INSD:CB262288.1,INSD:T42564.1,
FT                   INSD:EH850293.1,INSD:N37667.1,INSD:EL212695.1,
FT                   INSD:EH839936.1,INSD:EL260736.1,INSD:EH978623.1,
FT                   INSD:EH871421.1,INSD:AV536937.1,INSD:EH873326.1,
FT                   INSD:ES025939.1,INSD:BP831850.1,INSD:EL197381.1,
FT                   INSD:T46542.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AY085369.1"
FT                   /protein_id="AED90386.1"
FT                   SDAIVAQVYYL"
FT   gene            291687..294304
FT                   /gene_synonym="T20L15.30"
FT                   /gene_synonym="T20L15_30"
FT                   /locus_tag="AT5G01760"
FT   mRNA            join(291687..291913,292000..292078,292175..292273,
FT                   292393..292506,292582..292745,292838..292919,
FT                   293013..293098,293200..293466,293551..294304)
FT                   /gene_synonym="T20L15.30"
FT                   /gene_synonym="T20L15_30"
FT                   /locus_tag="AT5G01760"
FT                   /product="ENTH/VHS/GAT family protein"
FT                   /inference="similar to RNA sequence, EST:INSD:AU230780.1"
FT   CDS_pept        join(291753..291913,292000..292078,292175..292273,
FT                   292393..292506,292582..292745,292838..292919,
FT                   293013..293098,293200..293466,293551..294127)
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.30"
FT                   /gene_synonym="T20L15_30"
FT                   /locus_tag="AT5G01760"
FT                   /product="ENTH/VHS/GAT family protein"
FT                   /note="ENTH/VHS/GAT family protein; FUNCTIONS IN: protein
FT                   transporter activity; INVOLVED IN: intracellular protein
FT                   transport, intra-Golgi vesicle-mediated transport; LOCATED
FT                   IN: Golgi stack, intracellular; CONTAINS InterPro DOMAIN/s:
FT                   VHS (InterPro:IPR002014), GAT (InterPro:IPR004152), VHS
FT                   subgroup (InterPro:IPR018205), ENTH/VHS
FT                   (InterPro:IPR008942); BEST Arabidopsis thaliana protein
FT                   match is: ENTH/VHS/GAT family protein (TAIR:AT2G38410.1);
FT                   Has 1737 Blast hits to 1724 proteins in 203 species: Archae
FT                   - 0; Bacteria - 8; Metazoa - 865; Fungi - 471; Plants -
FT                   276; Viruses - 2; Other Eukaryotes - 115 (source: NCBI
FT                   BLink)."
FT                   /db_xref="GOA:F4KAU9"
FT                   /db_xref="InterPro:IPR002014"
FT                   /db_xref="InterPro:IPR004152"
FT                   /db_xref="InterPro:IPR008942"
FT                   /db_xref="InterPro:IPR038425"
FT                   /db_xref="UniProtKB/Swiss-Prot:F4KAU9"
FT                   /inference="similar to RNA sequence, EST:INSD:AU230780.1"
FT                   /protein_id="AED90388.1"
FT   gene            complement(293675..302015)
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /note="Encodes one of two Arabidopsis RAPTOR/KOG1 homologs.
FT                   RAPTOR proteins are binding partners of the target of
FT                   rapamycin kinase that is present in all eukaryotes and play
FT                   a central role in the stimulation of cell growth and
FT                   metabolism in response to nutrients. Mutations in this gene
FT                   have no visible effects on embryo or plant development."
FT   mRNA            complement(join(293675..294880,294961..295042,
FT                   295152..295237,295386..295487,295583..295728,
FT                   295828..295952,296266..296392,296485..296802,
FT                   296909..297475,297716..297896,297996..298349,
FT                   298667..298777,298881..298964,299183..299284,
FT                   299378..299456,299537..299681,299813..299967,
FT                   300464..300612,300703..300819,300902..301060,
FT                   301140..301225,301317..301419,301495..302015))
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT   mRNA            complement(join(293675..294880,294961..295237,
FT                   295386..295487,295583..295728,295828..295952,
FT                   296266..296392,296485..296802,296909..297475,
FT                   297716..297896,297996..298349,298667..298777,
FT                   298881..298964,299183..299284,299378..299456,
FT                   299537..299681,299813..299967,300464..300612,
FT                   300703..300819,300902..301060,301140..301225,
FT                   301317..301419,301495..302015))
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT   mRNA            complement(join(293675..294880,294961..295042,
FT                   295152..295237,295386..295487,295583..295728,
FT                   295828..295952,296266..296392,296485..296802,
FT                   296909..297475,297716..297927,298030..298349,
FT                   298667..298777,298881..298964,299183..299284,
FT                   299378..299456,299537..299681,299813..299967,
FT                   300464..300612,300703..300819,300902..301060,
FT                   301140..301225,301317..301419,301495..301984))
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT   mRNA            complement(join(294304..294880,294961..295042,
FT                   295152..295237,295386..295487,295583..295728,
FT                   295828..295952,296266..296392,296485..296802,
FT                   296909..297475,297716..297896,297996..298349,
FT                   298667..298777,298881..298964,299183..299284,
FT                   299378..299456,299537..299681,299813..299967,
FT                   300464..300603,300703..300819,300902..301060,
FT                   301140..301225,301317..301419,301495..301984))
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT   mRNA            complement(join(294313..294880,294961..295042,
FT                   295152..295237,295386..295487,295583..295716,
FT                   295792..295952,296266..296392,296485..296802,
FT                   296909..297475,297716..297927,298030..298349,
FT                   298667..298777,298881..298964,299183..299284,
FT                   299378..299456,299537..299681,299813..299967,
FT                   300464..300603,300703..300819,300902..301060,
FT                   301140..301225,301317..301419,301495..301984))
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES059290.1,INSD:ES008809.1,INSD:ES198247.1,
FT                   INSD:EH921215.1,INSD:EH800654.1,INSD:EG424616.1,
FT                   INSD:EL998946.1"
FT   CDS_pept        complement(join(294539..294880,294961..295042,
FT                   295152..295237,295386..295487,295583..295716,
FT                   295792..295952,296266..296392,296485..296802,
FT                   296909..297475,297716..297927,298030..298349,
FT                   298667..298777,298881..298964,299183..299284,
FT                   299378..299456,299537..299681,299813..299967,
FT                   300464..300603,300703..300819,300902..301060,
FT                   301140..301225,301317..301419,301495..301773))
FT                   /codon_start=1
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT                   /note="RAPTOR2 (RAPTOR2); FUNCTIONS IN: binding, nucleotide
FT                   binding; INVOLVED IN: cell growth; LOCATED IN: CUL4 RING
FT                   ubiquitin ligase complex; EXPRESSED IN: 22 plant
FT                   structures; EXPRESSED DURING: 12 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Armadillo-like helical
FT                   (InterPro:IPR011989), WD40 repeat (InterPro:IPR001680),
FT                   Regulatory associated protein of TOR (InterPro:IPR004083),
FT                   WD40 repeat-like-containing domain (InterPro:IPR011046),
FT                   WD40-repeat-containing domain (InterPro:IPR017986),
FT                   WD40/YVTN repeat-like-containing domain
FT                   (InterPro:IPR015943), Armadillo-type fold
FT                   (InterPro:IPR016024), WD40 repeat, subgroup
FT                   (InterPro:IPR019781); BEST Arabidopsis thaliana protein
FT                   match is: HEAT repeat; WD domain, G-beta repeat protein
FT                   protein (TAIR:AT3G08850.1); Has 30201 Blast hits to 17322
FT                   proteins in 780 species: Archae - 12; Bacteria - 1396;
FT                   Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
FT                   Other Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01770"
FT                   /db_xref="GOA:Q9LZW9"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR004083"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR029347"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZW9"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES059290.1,INSD:ES008809.1,INSD:ES198247.1,
FT                   INSD:EH921215.1,INSD:EH800654.1,INSD:EG424616.1,
FT                   INSD:EL998946.1"
FT                   /protein_id="AED90389.1"
FT   CDS_pept        complement(join(294539..294880,294961..295042,
FT                   295152..295237,295386..295487,295583..295728,
FT                   295828..295952,296266..296392,296485..296802,
FT                   296909..297475,297716..297896,297996..298349,
FT                   298667..298777,298881..298964,299183..299284,
FT                   299378..299456,299537..299681,299813..299967,
FT                   300464..300603,300703..300819,300902..301060,
FT                   301140..301225,301317..301419,301495..301773))
FT                   /codon_start=1
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01770"
FT                   /db_xref="GOA:A0A1P8BAR8"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR004083"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR029347"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BAR8"
FT                   /protein_id="ANM68698.1"
FT   CDS_pept        complement(join(294539..294880,294961..295042,
FT                   295152..295237,295386..295487,295583..295728,
FT                   295828..295952,296266..296392,296485..296802,
FT                   296909..297475,297716..297927,298030..298349,
FT                   298667..298777,298881..298964,299183..299284,
FT                   299378..299456,299537..299681,299813..299967,
FT                   300464..300612,300703..300819,300902..301060,
FT                   301140..301225,301317..301419,301495..301773))
FT                   /codon_start=1
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01770"
FT                   /db_xref="GOA:A0A1P8BAS5"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR004083"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR029347"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BAS5"
FT                   /protein_id="ANM68699.1"
FT   CDS_pept        complement(join(294539..294880,294961..295042,
FT                   295152..295237,295386..295487,295583..295728,
FT                   295828..295952,296266..296392,296485..296802,
FT                   296909..297475,297716..297896,297996..298349,
FT                   298667..298777,298881..298964,299183..299284,
FT                   299378..299456,299537..299681,299813..299967,
FT                   300464..300612,300703..300819,300902..301060,
FT                   301140..301225,301317..301419,301495..301773))
FT                   /codon_start=1
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01770"
FT                   /db_xref="GOA:A0A1P8BAT3"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR004083"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR029347"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BAT3"
FT                   /protein_id="ANM68696.1"
FT   CDS_pept        complement(join(295148..295237,295386..295487,
FT                   295583..295728,295828..295952,296266..296392,
FT                   296485..296802,296909..297475,297716..297896,
FT                   297996..298349,298667..298777,298881..298964,
FT                   299183..299284,299378..299456,299537..299681,
FT                   299813..299967,300464..300612,300703..300819,
FT                   300902..301060,301140..301225,301317..301419,
FT                   301495..301773))
FT                   /codon_start=1
FT                   /gene="RAPTOR2"
FT                   /gene_synonym="ATRAPTOR1A"
FT                   /gene_synonym="RAPTOR1A"
FT                   /gene_synonym="T20L15.40"
FT                   /gene_synonym="T20L15_40"
FT                   /locus_tag="AT5G01770"
FT                   /product="regulatory-associated protein of TOR 2 (RAPTOR2)"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01770"
FT                   /db_xref="GOA:A0A1P8BAT5"
FT                   /db_xref="InterPro:IPR001680"
FT                   /db_xref="InterPro:IPR004083"
FT                   /db_xref="InterPro:IPR011989"
FT                   /db_xref="InterPro:IPR015943"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="InterPro:IPR017986"
FT                   /db_xref="InterPro:IPR029347"
FT                   /db_xref="InterPro:IPR036322"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BAT5"
FT                   /protein_id="ANM68697.1"
FT   gene            complement(302098..304279)
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT   mRNA            complement(join(302098..302640,302729..303067,
FT                   303141..303725,304001..304279))
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL213056.1,INSD:ES075606.1,INSD:BP636128.1,
FT                   INSD:EL180229.1,INSD:ES066752.1,INSD:ES079460.1,
FT                   INSD:ES103227.1,INSD:AU036569.1,INSD:ES133826.1,
FT                   INSD:ES048503.1,INSD:EG498571.1,INSD:ES060807.1,
FT                   INSD:EG498572.1,INSD:BP624617.1,INSD:EL258554.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX830679.1"
FT   mRNA            complement(join(302098..303067,303141..303725,
FT                   304001..304279))
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT   mRNA            complement(join(302098..302640,302729..303067,
FT                   303141..303854,304001..304279))
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT   mRNA            complement(join(302098..302640,302729..303067,
FT                   303141..304279))
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT   mRNA            complement(join(302267..302640,302729..303067,
FT                   303141..303560,304001..304185))
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT   CDS_pept        complement(join(302365..302640,302729..303067,
FT                   303141..303560,304001..304129))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT                   /note="2-oxoglutarate-dependent dioxygenase family protein;
FT                   FUNCTIONS IN: oxidoreductase activity; LOCATED IN:
FT                   cellular_component unknown; EXPRESSED IN: 21 plant
FT                   structures; EXPRESSED DURING: 11 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Oxoglutarate/iron-dependent oxygenase
FT                   (InterPro:IPR005123); BEST Arabidopsis thaliana protein
FT                   match is: 2-oxoglutarate-dependent dioxygenase family
FT                   protein (TAIR:AT3G14160.1); Has 30201 Blast hits to 17322
FT                   proteins in 780 species: Archae - 12; Bacteria - 1396;
FT                   Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0;
FT                   Other Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01780"
FT                   /db_xref="GOA:F4KAV1"
FT                   /db_xref="InterPro:IPR004574"
FT                   /db_xref="InterPro:IPR005123"
FT                   /db_xref="InterPro:IPR027450"
FT                   /db_xref="InterPro:IPR037151"
FT                   /db_xref="UniProtKB/TrEMBL:F4KAV1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL213056.1,INSD:ES075606.1,INSD:BP636128.1,
FT                   INSD:EL180229.1,INSD:ES066752.1,INSD:ES079460.1,
FT                   INSD:ES103227.1,INSD:AU036569.1,INSD:ES133826.1,
FT                   INSD:ES048503.1,INSD:EG498571.1,INSD:ES060807.1,
FT                   INSD:EG498572.1,INSD:BP624617.1,INSD:EL258554.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:BX830679.1"
FT                   /protein_id="AED90390.1"
FT   CDS_pept        complement(join(302365..302640,302729..303067,
FT                   303141..303725,304001..304129))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT                   /note="2-oxoglutarate-dependent dioxygenase family protein;
FT                   LOCATED IN: cellular_component unknown; EXPRESSED IN: 21
FT                   plant structures; EXPRESSED DURING: 11 growth stages; BEST
FT                   Arabidopsis thaliana protein match is:
FT                   2-oxoglutarate-dependent dioxygenase family protein
FT                   (TAIR:AT3G14160.1)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01780"
FT                   /db_xref="GOA:F4KAV2"
FT                   /db_xref="InterPro:IPR004574"
FT                   /db_xref="InterPro:IPR005123"
FT                   /db_xref="InterPro:IPR027450"
FT                   /db_xref="InterPro:IPR037151"
FT                   /db_xref="UniProtKB/TrEMBL:F4KAV2"
FT                   /protein_id="AED90391.1"
FT   CDS_pept        complement(join(302365..302640,302729..303067,
FT                   303141..303449))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT                   /db_xref="GOA:A0A1P8BHF5"
FT                   /db_xref="InterPro:IPR004574"
FT                   /db_xref="InterPro:IPR005123"
FT                   /db_xref="InterPro:IPR027450"
FT                   /db_xref="InterPro:IPR037151"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BHF5"
FT                   /protein_id="ANM71029.1"
FT   CDS_pept        complement(join(302365..302640,302729..303067,
FT                   303141..303449))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01780"
FT                   /db_xref="GOA:A0A1P8BHF5"
FT                   /db_xref="InterPro:IPR004574"
FT                   /db_xref="InterPro:IPR005123"
FT                   /db_xref="InterPro:IPR027450"
FT                   /db_xref="InterPro:IPR037151"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BHF5"
FT                   /protein_id="ANM71030.1"
FT   CDS_pept        complement(join(302684..303067,303141..303725,
FT                   304001..304129))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.50"
FT                   /gene_synonym="T20L15_50"
FT                   /locus_tag="AT5G01780"
FT                   /product="2-oxoglutarate-dependent dioxygenase family
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01780"
FT                   /db_xref="GOA:A0A1P8BHF6"
FT                   /db_xref="InterPro:IPR004574"
FT                   /db_xref="InterPro:IPR027450"
FT                   /db_xref="InterPro:IPR037151"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BHF6"
FT                   /protein_id="ANM71031.1"
FT   gene            complement(304677..305912)
FT                   /gene_synonym="T20L15.60"
FT                   /gene_synonym="T20L15_60"
FT                   /locus_tag="AT5G01790"
FT   mRNA            complement(304677..305912)
FT                   /gene_synonym="T20L15.60"
FT                   /gene_synonym="T20L15_60"
FT                   /locus_tag="AT5G01790"
FT                   /product="hypothetical protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG516967.1,INSD:ES052854.1,INSD:ES087009.1,
FT                   INSD:ES152420.1,INSD:AV556068.1,INSD:DR382885.1,
FT                   INSD:DR358030.1,INSD:ES165735.1,INSD:EL969275.1,
FT                   INSD:ES046949.1,INSD:ES151941.1,INSD:AV567657.1,
FT                   INSD:T03962.1,INSD:EG516966.1,INSD:EL986476.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT010833.1,INSD:BX833131.1,INSD:BX833182.1,
FT                   INSD:BT011294.1,INSD:BT015487.1,INSD:BX833276.1,
FT                   INSD:BX833153.1"
FT   CDS_pept        complement(305057..305683)
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.60"
FT                   /gene_synonym="T20L15_60"
FT                   /locus_tag="AT5G01790"
FT                   /product="hypothetical protein"
FT                   /note="unknown protein; FUNCTIONS IN: molecular_function
FT                   unknown; INVOLVED IN: biological_process unknown; LOCATED
FT                   IN: chloroplast; EXPRESSED IN: 19 plant structures;
FT                   EXPRESSED DURING: 13 growth stages; Has 121 Blast hits to
FT                   121 proteins in 12 species: Archae - 0; Bacteria - 0;
FT                   Metazoa - 0; Fungi - 0; Plants - 121; Viruses - 0; Other
FT                   Eukaryotes - 0 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01790"
FT                   /db_xref="GOA:Q6NNJ2"
FT                   /db_xref="UniProtKB/TrEMBL:Q6NNJ2"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG516967.1,INSD:ES052854.1,INSD:ES087009.1,
FT                   INSD:ES152420.1,INSD:AV556068.1,INSD:DR382885.1,
FT                   INSD:DR358030.1,INSD:ES165735.1,INSD:EL969275.1,
FT                   INSD:ES046949.1,INSD:ES151941.1,INSD:AV567657.1,
FT                   INSD:T03962.1,INSD:EG516966.1,INSD:EL986476.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT010833.1,INSD:BX833131.1,INSD:BX833182.1,
FT                   INSD:BT011294.1,INSD:BT015487.1,INSD:BX833276.1,
FT                   INSD:BX833153.1"
FT                   /protein_id="AED90392.1"
FT   gene            306939..309289
FT                   /gene_synonym="T20L15.70"
FT                   /gene_synonym="T20L15_70"
FT                   /locus_tag="AT5G01800"
FT   mRNA            join(306939..307114,307407..307509,307732..307880,
FT                   307976..308176,308316..308375,308491..309289)
FT                   /gene_synonym="T20L15.70"
FT                   /gene_synonym="T20L15_70"
FT                   /locus_tag="AT5G01800"
FT                   /product="saposin B domain-containing protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV786281.1,INSD:ES155587.1,INSD:CF651301.1,
FT                   INSD:BP820469.2,INSD:DR373625.1,INSD:ES156334.1,
FT                   INSD:CA782013.1,INSD:EL155867.1,INSD:BP623188.1,
FT                   INSD:EH913951.1,INSD:BP810596.1,INSD:ES123589.1,
FT                   INSD:EL095419.1,INSD:ES095499.1,INSD:BP605571.1,
FT                   INSD:DR251561.1,INSD:T46286.1,INSD:EH882448.1,
FT                   INSD:ES082269.1,INSD:EL156870.1,INSD:EL280246.1,
FT                   INSD:ES139225.1,INSD:AV536823.1,INSD:CB261910.1,
FT                   INSD:ES078455.1,INSD:EL330829.1,INSD:EH824011.1,
FT                   INSD:AV539745.1,INSD:EL252815.1,INSD:EH798239.1,
FT                   INSD:EL076095.1,INSD:EL310237.1,INSD:EL332483.1,
FT                   INSD:EL037097.1,INSD:EH934565.1,INSD:Z17475.1,
FT                   INSD:EL285752.1,INSD:ES212048.1,INSD:CF651302.1,
FT                   INSD:EH819068.1,INSD:EL208794.1,INSD:BP615397.1,
FT                   INSD:EL983588.1,INSD:ES100109.1,INSD:EH977072.1,
FT                   INSD:BP851133.2,INSD:EL975354.1,INSD:ES190736.1,
FT                   INSD:EH967478.1,INSD:EL095637.1,INSD:EH814423.1,
FT                   INSD:EL189751.1,INSD:AA720259.1,INSD:ES166906.1,
FT                   INSD:EH885076.1,INSD:EH862378.1,INSD:DR251562.1,
FT                   INSD:EL327821.1,INSD:EH848374.1,INSD:EL050696.1,
FT                   INSD:EH889506.1,INSD:EL206675.1,INSD:T43403.1,
FT                   INSD:EL254135.1,INSD:ES175802.1,INSD:EL056448.1,
FT                   INSD:EH803510.1,INSD:EL021464.1,INSD:ES182599.1,
FT                   INSD:EL969371.1,INSD:ES085984.1,INSD:EG495642.1,
FT                   INSD:BP588159.1,INSD:EL065598.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX834065.1,INSD:AY056420.1,INSD:BX830665.1,
FT                   INSD:AY081711.1,INSD:BX833129.1"
FT   CDS_pept        join(307422..307509,307732..307880,307976..308176,
FT                   308316..308375,308491..308646)
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.70"
FT                   /gene_synonym="T20L15_70"
FT                   /locus_tag="AT5G01800"
FT                   /product="saposin B domain-containing protein"
FT                   /note="saposin B domain-containing protein; FUNCTIONS IN:
FT                   molecular_function unknown; INVOLVED IN: N-terminal protein
FT                   myristoylation, lipid metabolic process; LOCATED IN:
FT                   endomembrane system; EXPRESSED IN: 23 plant structures;
FT                   EXPRESSED DURING: 15 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Saposin B (InterPro:IPR008139), Saposin-like
FT                   (InterPro:IPR011001), Saposin-like type B, 1
FT                   (InterPro:IPR007856), Saposin-like type B, 2
FT                   (InterPro:IPR008138); BEST Arabidopsis thaliana protein
FT                   match is: saposin B domain-containing protein
FT                   (TAIR:AT3G51730.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZW6"
FT                   /db_xref="InterPro:IPR007856"
FT                   /db_xref="InterPro:IPR008138"
FT                   /db_xref="InterPro:IPR008139"
FT                   /db_xref="InterPro:IPR011001"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LZW6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AV786281.1,INSD:ES155587.1,INSD:CF651301.1,
FT                   INSD:BP820469.2,INSD:DR373625.1,INSD:ES156334.1,
FT                   INSD:CA782013.1,INSD:EL155867.1,INSD:BP623188.1,
FT                   INSD:EH913951.1,INSD:BP810596.1,INSD:ES123589.1,
FT                   INSD:EL095419.1,INSD:ES095499.1,INSD:BP605571.1,
FT                   INSD:DR251561.1,INSD:T46286.1,INSD:EH882448.1,
FT                   INSD:ES082269.1,INSD:EL156870.1,INSD:EL280246.1,
FT                   INSD:ES139225.1,INSD:AV536823.1,INSD:CB261910.1,
FT                   INSD:ES078455.1,INSD:EL330829.1,INSD:EH824011.1,
FT                   INSD:AV539745.1,INSD:EL252815.1,INSD:EH798239.1,
FT                   INSD:EL076095.1,INSD:EL310237.1,INSD:EL332483.1,
FT                   INSD:EL037097.1,INSD:EH934565.1,INSD:Z17475.1,
FT                   INSD:EL285752.1,INSD:ES212048.1,INSD:CF651302.1,
FT                   INSD:EH819068.1,INSD:EL208794.1,INSD:BP615397.1,
FT                   INSD:EL983588.1,INSD:ES100109.1,INSD:EH977072.1,
FT                   INSD:BP851133.2,INSD:EL975354.1,INSD:ES190736.1,
FT                   INSD:EH967478.1,INSD:EL095637.1,INSD:EH814423.1,
FT                   INSD:EL189751.1,INSD:AA720259.1,INSD:ES166906.1,
FT                   INSD:EH885076.1,INSD:EH862378.1,INSD:DR251562.1,
FT                   INSD:EL327821.1,INSD:EH848374.1,INSD:EL050696.1,
FT                   INSD:EH889506.1,INSD:EL206675.1,INSD:T43403.1,
FT                   INSD:EL254135.1,INSD:ES175802.1,INSD:EL056448.1,
FT                   INSD:EH803510.1,INSD:EL021464.1,INSD:ES182599.1,
FT                   INSD:EL969371.1,INSD:ES085984.1,INSD:EG495642.1,
FT                   INSD:BP588159.1,INSD:EL065598.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX834065.1,INSD:AY056420.1,INSD:BX830665.1,
FT                   INSD:AY081711.1,INSD:BX833129.1"
FT                   /protein_id="AED90393.1"
FT   gene            309374..312097
FT                   /gene="CIPK15"
FT                   /gene_synonym="ATPK10"
FT                   /gene_synonym="CBL-interacting protein kinase 15"
FT                   /gene_synonym="PKS3"
FT                   /gene_synonym="PROTEIN KINASE 10"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 10"
FT                   /gene_synonym="SIP2"
FT                   /gene_synonym="SMALL AND BASIC INTRINSIC PROTEIN 2"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.1"
FT                   /gene_synonym="SNRK3.1"
FT                   /gene_synonym="SOS3-INTERACTING PROTEIN 2"
FT                   /gene_synonym="T20L15.80"
FT                   /gene_synonym="T20L15_80"
FT                   /locus_tag="AT5G01810"
FT                   /note="Encodes a CBL-interacting serine/threonine protein
FT                   kinase, also has similarities to SOS2 kinase."
FT   mRNA            join(309374..309804,310086..312097)
FT                   /gene="CIPK15"
FT                   /gene_synonym="ATPK10"
FT                   /gene_synonym="CBL-interacting protein kinase 15"
FT                   /gene_synonym="PKS3"
FT                   /gene_synonym="PROTEIN KINASE 10"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 10"
FT                   /gene_synonym="SIP2"
FT                   /gene_synonym="SMALL AND BASIC INTRINSIC PROTEIN 2"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.1"
FT                   /gene_synonym="SNRK3.1"
FT                   /gene_synonym="SOS3-INTERACTING PROTEIN 2"
FT                   /gene_synonym="T20L15.80"
FT                   /gene_synonym="T20L15_80"
FT                   /locus_tag="AT5G01810"
FT                   /product="CBL-interacting protein kinase 15"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES018919.1,INSD:DR379310.1,INSD:AV525606.1,
FT                   INSD:AA605419.1,INSD:BP654359.1,INSD:T13762.1,
FT                   INSD:EL218677.1,INSD:EL024734.1,INSD:EL230005.1,
FT                   INSD:ES108963.1,INSD:AU228447.1,INSD:AV539575.1,
FT                   INSD:BP646999.1,INSD:EL232861.1,INSD:EH984511.1,
FT                   INSD:EL024470.1,INSD:EL060892.1,INSD:ES165951.1,
FT                   INSD:EL158213.1,INSD:EH831676.1,INSD:BP651430.1,
FT                   INSD:EL235817.1,INSD:BP844096.1,INSD:R90018.1,
FT                   INSD:ES203344.1,INSD:EH983318.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT028964.1,INSD:AF339144.1,INSD:AF302111.1"
FT   mRNA            join(309434..309569,309739..309804,310086..312097)
FT                   /gene="CIPK15"
FT                   /gene_synonym="ATPK10"
FT                   /gene_synonym="CBL-interacting protein kinase 15"
FT                   /gene_synonym="PKS3"
FT                   /gene_synonym="PROTEIN KINASE 10"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 10"
FT                   /gene_synonym="SIP2"
FT                   /gene_synonym="SMALL AND BASIC INTRINSIC PROTEIN 2"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.1"
FT                   /gene_synonym="SNRK3.1"
FT                   /gene_synonym="SOS3-INTERACTING PROTEIN 2"
FT                   /gene_synonym="T20L15.80"
FT                   /gene_synonym="T20L15_80"
FT                   /locus_tag="AT5G01810"
FT                   /product="CBL-interacting protein kinase 15"
FT   mRNA            join(309434..309569,309739..309804,310086..311308,
FT                   311444..312097)
FT                   /gene="CIPK15"
FT                   /gene_synonym="ATPK10"
FT                   /gene_synonym="CBL-interacting protein kinase 15"
FT                   /gene_synonym="PKS3"
FT                   /gene_synonym="PROTEIN KINASE 10"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 10"
FT                   /gene_synonym="SIP2"
FT                   /gene_synonym="SMALL AND BASIC INTRINSIC PROTEIN 2"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.1"
FT                   /gene_synonym="SNRK3.1"
FT                   /gene_synonym="SOS3-INTERACTING PROTEIN 2"
FT                   /gene_synonym="T20L15.80"
FT                   /gene_synonym="T20L15_80"
FT                   /locus_tag="AT5G01810"
FT                   /product="CBL-interacting protein kinase 15"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES018919.1,INSD:DR379310.1,INSD:AU237397.1,
FT                   INSD:AV525606.1,INSD:AA605419.1,INSD:BP654359.1,
FT                   INSD:BP810542.1,INSD:T13762.1,INSD:EL218677.1,
FT                   INSD:EL024734.1,INSD:EL230005.1,INSD:BP828286.1,
FT                   INSD:ES108963.1,INSD:AU228447.1,INSD:AV539575.1,
FT                   INSD:BP646999.1,INSD:BP834356.1,INSD:EH984511.1,
FT                   INSD:EL232861.1,INSD:BP802304.1,INSD:EL024470.1,
FT                   INSD:EL060892.1,INSD:ES165951.1,INSD:EL158213.1,
FT                   INSD:EH831676.1,INSD:BP855286.1,INSD:BP651430.1,
FT                   INSD:EL235817.1,INSD:R90018.1,INSD:DR261305.1,
FT                   INSD:ES203344.1,INSD:EH983318.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT028964.1,INSD:AK228889.1,INSD:AF339144.1,
FT                   INSD:D30622.1,INSD:AF302111.1"
FT   CDS_pept        310460..311725
FT                   /codon_start=1
FT                   /gene="CIPK15"
FT                   /gene_synonym="ATPK10"
FT                   /gene_synonym="CBL-interacting protein kinase 15"
FT                   /gene_synonym="PKS3"
FT                   /gene_synonym="PROTEIN KINASE 10"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 10"
FT                   /gene_synonym="SIP2"
FT                   /gene_synonym="SMALL AND BASIC INTRINSIC PROTEIN 2"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.1"
FT                   /gene_synonym="SNRK3.1"
FT                   /gene_synonym="SOS3-INTERACTING PROTEIN 2"
FT                   /gene_synonym="T20L15.80"
FT                   /gene_synonym="T20L15_80"
FT                   /locus_tag="AT5G01810"
FT                   /product="CBL-interacting protein kinase 15"
FT                   /note="CBL-interacting protein kinase 15 (CIPK15); CONTAINS
FT                   InterPro DOMAIN/s: Protein kinase, ATP binding site
FT                   (InterPro:IPR017441), Serine/threonine-protein kinase
FT                   domain (InterPro:IPR002290), NAF/FISL domain
FT                   (InterPro:IPR018451), Serine/threonine-protein kinase-like
FT                   domain (InterPro:IPR017442), Protein kinase-like domain
FT                   (InterPro:IPR011009), Serine/threonine-protein kinase,
FT                   active site (InterPro:IPR008271), NAF domain
FT                   (InterPro:IPR004041), CBL-interacting protein kinase
FT                   (InterPro:IPR020660), Protein kinase, catalytic domain
FT                   (InterPro:IPR000719), Calcium/calmodulin-dependent protein
FT                   kinase-like (InterPro:IPR020636); BEST Arabidopsis thaliana
FT                   protein match is: SOS3-interacting protein 1
FT                   (TAIR:AT5G58380.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:P92937"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR004041"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR018451"
FT                   /db_xref="InterPro:IPR020636"
FT                   /db_xref="UniProtKB/Swiss-Prot:P92937"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES018919.1,INSD:DR379310.1,INSD:AU237397.1,
FT                   INSD:AV525606.1,INSD:AA605419.1,INSD:BP654359.1,
FT                   INSD:BP810542.1,INSD:T13762.1,INSD:EL218677.1,
FT                   INSD:EL024734.1,INSD:EL230005.1,INSD:BP828286.1,
FT                   INSD:ES108963.1,INSD:AU228447.1,INSD:AV539575.1,
FT                   INSD:BP646999.1,INSD:BP834356.1,INSD:EH984511.1,
FT                   INSD:EL232861.1,INSD:BP802304.1,INSD:EL024470.1,
FT                   INSD:EL060892.1,INSD:ES165951.1,INSD:EL158213.1,
FT                   INSD:EH831676.1,INSD:BP855286.1,INSD:BP651430.1,
FT                   INSD:EL235817.1,INSD:R90018.1,INSD:DR261305.1,
FT                   INSD:ES203344.1,INSD:EH983318.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT028964.1,INSD:AK228889.1,INSD:AF339144.1,
FT                   INSD:D30622.1,INSD:AF302111.1"
FT                   /protein_id="AED90394.1"
FT   CDS_pept        310460..311725
FT                   /codon_start=1
FT                   /gene="CIPK15"
FT                   /gene_synonym="ATPK10"
FT                   /gene_synonym="CBL-interacting protein kinase 15"
FT                   /gene_synonym="PKS3"
FT                   /gene_synonym="PROTEIN KINASE 10"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 10"
FT                   /gene_synonym="SIP2"
FT                   /gene_synonym="SMALL AND BASIC INTRINSIC PROTEIN 2"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.1"
FT                   /gene_synonym="SNRK3.1"
FT                   /gene_synonym="SOS3-INTERACTING PROTEIN 2"
FT                   /gene_synonym="T20L15.80"
FT                   /gene_synonym="T20L15_80"
FT                   /locus_tag="AT5G01810"
FT                   /product="CBL-interacting protein kinase 15"
FT                   /note="CBL-interacting protein kinase 15 (CIPK15); CONTAINS
FT                   InterPro DOMAIN/s: Protein kinase, ATP binding site
FT                   (InterPro:IPR017441), Serine/threonine-protein kinase
FT                   domain (InterPro:IPR002290), NAF/FISL domain
FT                   (InterPro:IPR018451), Serine/threonine-protein kinase-like
FT                   domain (InterPro:IPR017442), Protein kinase-like domain
FT                   (InterPro:IPR011009), Serine/threonine-protein kinase,
FT                   active site (InterPro:IPR008271), NAF domain
FT                   (InterPro:IPR004041), CBL-interacting protein kinase
FT                   (InterPro:IPR020660), Protein kinase, catalytic domain
FT                   (InterPro:IPR000719), Calcium/calmodulin-dependent protein
FT                   kinase-like (InterPro:IPR020636); BEST Arabidopsis thaliana
FT                   protein match is: SOS3-interacting protein 1
FT                   (TAIR:AT5G58380.1); Has 132404 Blast hits to 130096
FT                   proteins in 4624 species: Archae - 185; Bacteria - 15280;
FT                   Metazoa - 48696; Fungi - 13190; Plants - 32556; Viruses -
FT                   526; Other Eukaryotes - 21971 (source: NCBI BLink)."
FT                   /db_xref="GOA:P92937"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR004041"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR018451"
FT                   /db_xref="InterPro:IPR020636"
FT                   /db_xref="UniProtKB/Swiss-Prot:P92937"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES018919.1,INSD:DR379310.1,INSD:AV525606.1,
FT                   INSD:AA605419.1,INSD:BP654359.1,INSD:T13762.1,
FT                   INSD:EL218677.1,INSD:EL024734.1,INSD:EL230005.1,
FT                   INSD:ES108963.1,INSD:AU228447.1,INSD:AV539575.1,
FT                   INSD:BP646999.1,INSD:EL232861.1,INSD:EH984511.1,
FT                   INSD:EL024470.1,INSD:EL060892.1,INSD:ES165951.1,
FT                   INSD:EL158213.1,INSD:EH831676.1,INSD:BP651430.1,
FT                   INSD:EL235817.1,INSD:BP844096.1,INSD:R90018.1,
FT                   INSD:ES203344.1,INSD:EH983318.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT028964.1,INSD:AF339144.1,INSD:AF302111.1"
FT                   /protein_id="AED90395.1"
FT   CDS_pept        join(310460..311308,311444..311725)
FT                   /codon_start=1
FT                   /gene="CIPK15"
FT                   /gene_synonym="ATPK10"
FT                   /gene_synonym="CBL-interacting protein kinase 15"
FT                   /gene_synonym="PKS3"
FT                   /gene_synonym="PROTEIN KINASE 10"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 10"
FT                   /gene_synonym="SIP2"
FT                   /gene_synonym="SMALL AND BASIC INTRINSIC PROTEIN 2"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.1"
FT                   /gene_synonym="SNRK3.1"
FT                   /gene_synonym="SOS3-INTERACTING PROTEIN 2"
FT                   /gene_synonym="T20L15.80"
FT                   /gene_synonym="T20L15_80"
FT                   /locus_tag="AT5G01810"
FT                   /product="CBL-interacting protein kinase 15"
FT                   /note="CBL-interacting protein kinase 15 (CIPK15); CONTAINS
FT                   InterPro DOMAIN/s: Protein kinase, ATP binding site
FT                   (InterPro:IPR017441), Serine/threonine-protein kinase
FT                   domain (InterPro:IPR002290), Serine/threonine-protein
FT                   kinase-like domain (InterPro:IPR017442),
FT                   Serine/threonine-protein kinase, active site
FT                   (InterPro:IPR008271), Protein kinase-like domain
FT                   (InterPro:IPR011009), NAF domain (InterPro:IPR004041),
FT                   CBL-interacting protein kinase (InterPro:IPR020660),
FT                   Protein kinase, catalytic domain (InterPro:IPR000719),
FT                   Tyrosine-protein kinase, catalytic domain
FT                   (InterPro:IPR020635), Calcium/calmodulin-dependent protein
FT                   kinase-like (InterPro:IPR020636); BEST Arabidopsis thaliana
FT                   protein match is: CBL-interacting protein kinase 20
FT                   (TAIR:AT5G45820.1)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01810"
FT                   /db_xref="GOA:F4KAV7"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR004041"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR020636"
FT                   /db_xref="UniProtKB/TrEMBL:F4KAV7"
FT                   /protein_id="AED90396.1"
FT   gene            complement(313190..315405)
FT                   /gene="SR1"
FT                   /gene_synonym="ATCIPK14"
FT                   /gene_synonym="ATSR1"
FT                   /gene_synonym="CBL-INTERACTING PROTEIN KINASE 14"
FT                   /gene_synonym="CIPK14"
FT                   /gene_synonym="PKS24"
FT                   /gene_synonym="serine/threonine protein kinase 1"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 1"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.15"
FT                   /gene_synonym="SnRK3.15"
FT                   /gene_synonym="SOS2-like protein kinase 24"
FT                   /gene_synonym="T20L15.90"
FT                   /gene_synonym="T20L15_90"
FT                   /locus_tag="AT5G01820"
FT                   /note="Encodes a CBL-interacting serine/threonine protein
FT                   kinase."
FT   mRNA            complement(313190..315405)
FT                   /gene="SR1"
FT                   /gene_synonym="ATCIPK14"
FT                   /gene_synonym="ATSR1"
FT                   /gene_synonym="CBL-INTERACTING PROTEIN KINASE 14"
FT                   /gene_synonym="CIPK14"
FT                   /gene_synonym="PKS24"
FT                   /gene_synonym="serine/threonine protein kinase 1"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 1"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.15"
FT                   /gene_synonym="SnRK3.15"
FT                   /gene_synonym="SOS2-like protein kinase 24"
FT                   /gene_synonym="T20L15.90"
FT                   /gene_synonym="T20L15_90"
FT                   /locus_tag="AT5G01820"
FT                   /product="serine/threonine protein kinase 1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG508678.1,INSD:AV810130.1,INSD:BP812529.1,
FT                   INSD:CB259689.1,INSD:ES129059.1,INSD:BP834022.1,
FT                   INSD:EH854951.1,INSD:ES014287.1,INSD:DR339470.1,
FT                   INSD:H37465.1,INSD:EL341569.1,INSD:CB257243.1,
FT                   INSD:CD529105.1,INSD:CD530616.1,INSD:EH848117.1,
FT                   INSD:BE527250.1,INSD:AV808027.1,INSD:T45283.1,
FT                   INSD:BP647565.1,INSD:CB260079.1,INSD:BP829028.1,
FT                   INSD:CB259979.1,INSD:ES134390.1,INSD:ES137442.1,
FT                   INSD:BE522098.1,INSD:ES142224.1,INSD:AV566674.1,
FT                   INSD:AV818150.1,INSD:ES179268.1,INSD:CB260648.1,
FT                   INSD:BE522099.1,INSD:BP834394.1,INSD:BP829967.1,
FT                   INSD:W43158.1,INSD:BP861006.1,INSD:EL205963.1,
FT                   INSD:EL016491.1,INSD:ES062448.1,INSD:CK118220.1,
FT                   INSD:CB255865.1,INSD:EL999478.1,INSD:AV830729.1,
FT                   INSD:ES086863.1,INSD:DR339471.1,INSD:CF773405.1,
FT                   INSD:EL994646.1,INSD:ES167392.1,INSD:H36240.1,
FT                   INSD:BP827495.1,INSD:AV812815.1,INSD:BP646669.1,
FT                   INSD:EL011114.1,INSD:AV558457.1,INSD:BP561730.2,
FT                   INSD:ES010780.1,INSD:ES134325.1,INSD:EL180254.1,
FT                   INSD:BP777505.1,INSD:N96318.1,INSD:EH858888.1,
FT                   INSD:EL095292.1,INSD:EG508668.1,INSD:AV809753.1,
FT                   INSD:CB255566.1,INSD:CB255570.1,INSD:AV439652.1,
FT                   INSD:BP648276.1,INSD:CB260946.1,INSD:BP847557.1,
FT                   INSD:AV831909.1,INSD:EG508679.1,INSD:ES052278.1,
FT                   INSD:EL174264.1,INSD:EG428947.1,INSD:EG428948.1,
FT                   INSD:ES043670.1,INSD:BP779716.1,INSD:ES170934.1,
FT                   INSD:AV521433.1,INSD:DR365707.1,INSD:AV798221.1,
FT                   INSD:AV553225.1,INSD:ES175977.1,INSD:ES157234.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AB035147.1,INSD:BX829749.1,INSD:BX830122.1,
FT                   INSD:AF360189.1,INSD:BX830723.1,INSD:BT015592.1,
FT                   INSD:AF295669.1,INSD:AY142684.1,INSD:BX829819.1"
FT   CDS_pept        complement(313423..314751)
FT                   /codon_start=1
FT                   /gene="SR1"
FT                   /gene_synonym="ATCIPK14"
FT                   /gene_synonym="ATSR1"
FT                   /gene_synonym="CBL-INTERACTING PROTEIN KINASE 14"
FT                   /gene_synonym="CIPK14"
FT                   /gene_synonym="serine/threonine protein kinase 1"
FT                   /gene_synonym="SERINE/THREONINE PROTEIN KINASE 1"
FT                   /gene_synonym="SNF1-RELATED PROTEIN KINASE 3.15"
FT                   /gene_synonym="SnRK3.15"
FT                   /gene_synonym="T20L15.90"
FT                   /gene_synonym="T20L15_90"
FT                   /gene_synonym="PKS24"
FT                   /gene_synonym="SOS2-like protein kinase 24"
FT                   /locus_tag="AT5G01820"
FT                   /product="serine/threonine protein kinase 1"
FT                   /note="serine/threonine protein kinase 1 (SR1); FUNCTIONS
FT                   IN: protein serine/threonine kinase activity, protein
FT                   kinase activity, kinase activity, ATP binding; INVOLVED IN:
FT                   signal transduction, protein amino acid phosphorylation;
FT                   LOCATED IN: vacuole; EXPRESSED IN: 23 plant structures;
FT                   EXPRESSED DURING: 15 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Protein kinase, ATP binding site
FT                   (InterPro:IPR017441), Serine/threonine-protein kinase
FT                   domain (InterPro:IPR002290), NAF/FISL domain
FT                   (InterPro:IPR018451), Serine/threonine-protein kinase-like
FT                   domain (InterPro:IPR017442), Protein kinase-like domain
FT                   (InterPro:IPR011009), Serine/threonine-protein kinase,
FT                   active site (InterPro:IPR008271), NAF domain
FT                   (InterPro:IPR004041), CBL-interacting protein kinase
FT                   (InterPro:IPR020660), Protein kinase, catalytic domain
FT                   (InterPro:IPR000719), Calcium/calmodulin-dependent protein
FT                   kinase-like (InterPro:IPR020636); BEST Arabidopsis thaliana
FT                   protein match is: SOS3-interacting protein 4
FT                   (TAIR:AT2G30360.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZW4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR004041"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR018451"
FT                   /db_xref="InterPro:IPR020636"
FT                   /db_xref="PDB:2ZFD"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZW4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG508678.1,INSD:AV810130.1,INSD:BP812529.1,
FT                   INSD:CB259689.1,INSD:ES129059.1,INSD:BP834022.1,
FT                   INSD:EH854951.1,INSD:ES014287.1,INSD:DR339470.1,
FT                   INSD:H37465.1,INSD:EL341569.1,INSD:CB257243.1,
FT                   INSD:CD529105.1,INSD:CD530616.1,INSD:EH848117.1,
FT                   INSD:BE527250.1,INSD:AV808027.1,INSD:T45283.1,
FT                   INSD:BP647565.1,INSD:CB260079.1,INSD:BP829028.1,
FT                   INSD:CB259979.1,INSD:ES134390.1,INSD:ES137442.1,
FT                   INSD:BE522098.1,INSD:ES142224.1,INSD:AV566674.1,
FT                   INSD:AV818150.1,INSD:ES179268.1,INSD:CB260648.1,
FT                   INSD:BE522099.1,INSD:BP834394.1,INSD:BP829967.1,
FT                   INSD:W43158.1,INSD:BP861006.1,INSD:EL205963.1,
FT                   INSD:EL016491.1,INSD:ES062448.1,INSD:CK118220.1,
FT                   INSD:CB255865.1,INSD:EL999478.1,INSD:AV830729.1,
FT                   INSD:ES086863.1,INSD:DR339471.1,INSD:CF773405.1,
FT                   INSD:EL994646.1,INSD:ES167392.1,INSD:H36240.1,
FT                   INSD:BP827495.1,INSD:AV812815.1,INSD:BP646669.1,
FT                   INSD:EL011114.1,INSD:AV558457.1,INSD:BP561730.2,
FT                   INSD:ES010780.1,INSD:ES134325.1,INSD:EL180254.1,
FT                   INSD:BP777505.1,INSD:N96318.1,INSD:EH858888.1,
FT                   INSD:EL095292.1,INSD:EG508668.1,INSD:AV809753.1,
FT                   INSD:CB255566.1,INSD:CB255570.1,INSD:AV439652.1,
FT                   INSD:BP648276.1,INSD:CB260946.1,INSD:BP847557.1,
FT                   INSD:AV831909.1,INSD:EG508679.1,INSD:ES052278.1,
FT                   INSD:EL174264.1,INSD:EG428947.1,INSD:EG428948.1,
FT                   INSD:ES043670.1,INSD:BP779716.1,INSD:ES170934.1,
FT                   INSD:AV521433.1,INSD:DR365707.1,INSD:AV798221.1,
FT                   INSD:AV553225.1,INSD:ES175977.1,INSD:ES157234.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AB035147.1,INSD:BX829749.1,INSD:BX830122.1,
FT                   INSD:AF360189.1,INSD:BX830723.1,INSD:BT015592.1,
FT                   INSD:AF295669.1,INSD:AY142684.1,INSD:BX829819.1"
FT                   /protein_id="AED90397.1"
FT   gene            318153..318475
FT                   /locus_tag="AT5G00800"
FT   ncRNA           join(318153..318253,318330..318475)
FT                   /locus_tag="AT5G00800"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            complement(318153..318406)
FT                   /locus_tag="AT5G00795"
FT   ncRNA           complement(318153..318406)
FT                   /locus_tag="AT5G00795"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            320349..323213
FT                   /gene="SAUR21"
FT                   /gene_synonym="SMALL AUXIN UP RNA 21"
FT                   /gene_synonym="T20L15.100"
FT                   /gene_synonym="T20L15_100"
FT                   /locus_tag="AT5G01830"
FT   mRNA            320349..323213
FT                   /gene="SAUR21"
FT                   /gene_synonym="SMALL AUXIN UP RNA 21"
FT                   /gene_synonym="T20L15.100"
FT                   /gene_synonym="T20L15_100"
FT                   /locus_tag="AT5G01830"
FT                   /product="ARM repeat superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP620856.1,INSD:ES111102.1,INSD:BP608621.1,
FT                   INSD:T76464.1,INSD:AU036576.1,INSD:BP798947.1,
FT                   INSD:AU237885.1,INSD:BP610001.1,INSD:AA394623.1,
FT                   INSD:AU228988.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT015725.1,INSD:BT015367.1,INSD:AK229397.1"
FT   CDS_pept        320983..323007
FT                   /codon_start=1
FT                   /gene="SAUR21"
FT                   /gene_synonym="T20L15.100"
FT                   /gene_synonym="T20L15_100"
FT                   /gene_synonym="SMALL AUXIN UP RNA 21"
FT                   /locus_tag="AT5G01830"
FT                   /product="ARM repeat superfamily protein"
FT                   /note="ARM repeat superfamily protein; FUNCTIONS IN:
FT                   ubiquitin-protein ligase activity, binding; INVOLVED IN:
FT                   response to chitin; LOCATED IN: ubiquitin ligase complex;
FT                   EXPRESSED IN: root; CONTAINS InterPro DOMAIN/s: U box
FT                   domain (InterPro:IPR003613), Armadillo-like helical
FT                   (InterPro:IPR011989), Armadillo (InterPro:IPR000225),
FT                   Armadillo-type fold (InterPro:IPR016024); BEST Arabidopsis
FT                   thaliana protein match is: plant U-box 17
FT                   (TAIR:AT1G29340.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZW3"
FT                   /db_xref="InterPro:IPR000225"
FT                   /db_xref="InterPro:IPR003613"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR016024"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZW3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP620856.1,INSD:ES111102.1,INSD:BP608621.1,
FT                   INSD:T76464.1,INSD:AU036576.1,INSD:BP798947.1,
FT                   INSD:AU237885.1,INSD:BP610001.1,INSD:AA394623.1,
FT                   INSD:AU228988.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT015725.1,INSD:BT015367.1,INSD:AK229397.1"
FT                   /protein_id="AED90398.1"
FT   gene            324428..325678
FT                   /gene="OFP1"
FT                   /gene_synonym="ARABIDOPSIS THALIANA OVATE FAMILY PROTEIN 1"
FT                   /gene_synonym="ATOFP1"
FT                   /gene_synonym="ovate family protein 1"
FT                   /gene_synonym="T20L15.110"
FT                   /gene_synonym="T20L15_110"
FT                   /locus_tag="AT5G01840"
FT                   /note="Encodes a member of the plant specific ovate protein
FT                   family. Members of this family have been shown to bind to
FT                   KNOX and BELL- like TALE class homeodomain proteins. This
FT                   interaction may mediate relocalization of the TALE
FT                   homeodomain from the nucleus to the cytoplasm. Functions as
FT                   a transcriptional repressor that suppresses cell
FT                   elongation."
FT   mRNA            324428..325678
FT                   /gene="OFP1"
FT                   /gene_synonym="ARABIDOPSIS THALIANA OVATE FAMILY PROTEIN 1"
FT                   /gene_synonym="ATOFP1"
FT                   /gene_synonym="ovate family protein 1"
FT                   /gene_synonym="T20L15.110"
FT                   /gene_synonym="T20L15_110"
FT                   /locus_tag="AT5G01840"
FT                   /product="ovate family protein 1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU226103.1,INSD:ES086497.1,INSD:ES136487.1,
FT                   INSD:AV549614.1,INSD:ES194491.1,INSD:AV537628.1,
FT                   INSD:ES171740.1"
FT   CDS_pept        324552..325364
FT                   /codon_start=1
FT                   /gene="OFP1"
FT                   /gene_synonym="ARABIDOPSIS THALIANA OVATE FAMILY PROTEIN 1"
FT                   /gene_synonym="ATOFP1"
FT                   /gene_synonym="ovate family protein 1"
FT                   /gene_synonym="T20L15.110"
FT                   /gene_synonym="T20L15_110"
FT                   /locus_tag="AT5G01840"
FT                   /product="ovate family protein 1"
FT                   /note="ovate family protein 1 (OFP1); FUNCTIONS IN: protein
FT                   binding, transcription repressor activity; INVOLVED IN:
FT                   N-terminal protein myristoylation, regulation of
FT                   unidimensional cell growth; LOCATED IN: nucleolus,
FT                   cytoskeleton; EXPRESSED IN: 14 plant structures; EXPRESSED
FT                   DURING: 4 anthesis, F mature embryo stage, petal
FT                   differentiation and expansion stage, E expanded cotyledon
FT                   stage, D bilateral stage; CONTAINS InterPro DOMAIN/s:
FT                   Protein of unknown function DUF623 (InterPro:IPR006458);
FT                   BEST Arabidopsis thaliana protein match is: ovate family
FT                   protein 3 (TAIR:AT5G58360.1); Has 1807 Blast hits to 1807
FT                   proteins in 277 species: Archae - 0; Bacteria - 0; Metazoa
FT                   - 736; Fungi - 347; Plants - 385; Viruses - 0; Other
FT                   Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZW2"
FT                   /db_xref="InterPro:IPR006458"
FT                   /db_xref="InterPro:IPR025830"
FT                   /db_xref="InterPro:IPR038933"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZW2"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AU226103.1,INSD:ES086497.1,INSD:ES136487.1,
FT                   INSD:AV549614.1,INSD:ES194491.1,INSD:AV537628.1,
FT                   INSD:ES171740.1"
FT                   /protein_id="AED90399.1"
FT   gene            328205..328477
FT                   /locus_tag="AT5G00805"
FT   ncRNA           328205..328477
FT                   /locus_tag="AT5G00805"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            332330..334543
FT                   /gene_synonym="T20L15.120"
FT                   /gene_synonym="T20L15_120"
FT                   /locus_tag="AT5G01850"
FT   mRNA            join(332330..333336,333420..333544,333639..333797,
FT                   333899..334543)
FT                   /gene_synonym="T20L15.120"
FT                   /gene_synonym="T20L15_120"
FT                   /locus_tag="AT5G01850"
FT                   /product="Protein kinase superfamily protein"
FT   mRNA            join(332330..333068,333141..333336,333420..333544,
FT                   333639..333797,333899..334543)
FT                   /gene_synonym="T20L15.120"
FT                   /gene_synonym="T20L15_120"
FT                   /locus_tag="AT5G01850"
FT                   /product="Protein kinase superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES215389.1,INSD:EL186897.1,INSD:AV560070.1,
FT                   INSD:ES001505.1,INSD:AV533466.1,INSD:EH981384.1,
FT                   INSD:EL083070.1,INSD:EL990112.1,INSD:AV830310.1,
FT                   INSD:EL974629.1,INSD:AV811144.1,INSD:AV440394.1,
FT                   INSD:ES079158.1,INSD:EL001430.1,INSD:ES066339.1,
FT                   INSD:BP866957.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT002168.1,INSD:AY140072.1,INSD:BX830646.1"
FT   CDS_pept        join(332829..333336,333420..333544,333639..333797,
FT                   333899..334180)
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.120"
FT                   /gene_synonym="T20L15_120"
FT                   /locus_tag="AT5G01850"
FT                   /product="Protein kinase superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01850"
FT                   /db_xref="GOA:A0A1P8BGL4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BGL4"
FT                   /protein_id="ANM70739.1"
FT                   KFAFIRQLFAAKRNINS"
FT   CDS_pept        join(332829..333068,333141..333336,333420..333544,
FT                   333639..333797,333899..334180)
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.120"
FT                   /gene_synonym="T20L15_120"
FT                   /locus_tag="AT5G01850"
FT                   /product="Protein kinase superfamily protein"
FT                   /note="Protein kinase superfamily protein; FUNCTIONS IN:
FT                   protein serine/threonine/tyrosine kinase activity, kinase
FT                   activity; INVOLVED IN: protein amino acid phosphorylation;
FT                   EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13
FT                   growth stages; CONTAINS InterPro DOMAIN/s: Protein kinase,
FT                   ATP binding site (InterPro:IPR017441),
FT                   Serine/threonine-protein kinase domain
FT                   (InterPro:IPR002290), Serine-threonine/tyrosine-protein
FT                   kinase (InterPro:IPR001245), Protein kinase-like domain
FT                   (InterPro:IPR011009), Serine/threonine-protein kinase,
FT                   active site (InterPro:IPR008271), Protein kinase, catalytic
FT                   domain (InterPro:IPR000719), Serine/threonine-protein
FT                   kinase, ATN1-like (InterPro:IPR015784); BEST Arabidopsis
FT                   thaliana protein match is: Protein kinase superfamily
FT                   protein (TAIR:AT3G27560.1); Has 131148 Blast hits to 129643
FT                   proteins in 5072 species: Archae - 162; Bacteria - 15033;
FT                   Metazoa - 49603; Fungi - 12189; Plants - 33321; Viruses -
FT                   522; Other Eukaryotes - 20318 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01850"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01850.1"
FT                   /db_xref="GOA:Q8L6Y9"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/TrEMBL:Q8L6Y9"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES215389.1,INSD:EL186897.1,INSD:AV560070.1,
FT                   INSD:ES001505.1,INSD:AV533466.1,INSD:EH981384.1,
FT                   INSD:EL083070.1,INSD:EL990112.1,INSD:AV830310.1,
FT                   INSD:EL974629.1,INSD:AV811144.1,INSD:AV440394.1,
FT                   INSD:ES079158.1,INSD:EL001430.1,INSD:ES066339.1,
FT                   INSD:BP866957.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT002168.1,INSD:AY140072.1,INSD:BX830646.1"
FT                   /protein_id="AED90401.1"
FT   gene            335630..336277
FT                   /gene_synonym="T20L15.130"
FT                   /gene_synonym="T20L15_130"
FT                   /locus_tag="AT5G01860"
FT   mRNA            335630..336277
FT                   /gene_synonym="T20L15.130"
FT                   /gene_synonym="T20L15_130"
FT                   /locus_tag="AT5G01860"
FT                   /product="C2H2 and C2HC zinc fingers superfamily protein"
FT   CDS_pept        335630..336277
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.130"
FT                   /gene_synonym="T20L15_130"
FT                   /locus_tag="AT5G01860"
FT                   /product="C2H2 and C2HC zinc fingers superfamily protein"
FT                   /note="C2H2 and C2HC zinc fingers superfamily protein;
FT                   FUNCTIONS IN: sequence-specific DNA binding transcription
FT                   factor activity, zinc ion binding, nucleic acid binding;
FT                   INVOLVED IN: regulation of transcription; LOCATED IN:
FT                   intracellular, chloroplast; EXPRESSED IN: shoot, sepal,
FT                   root, leaf; EXPRESSED DURING: LP.02 two leaves visible,
FT                   petal differentiation and expansion stage; CONTAINS
FT                   InterPro DOMAIN/s: Zinc finger, C2H2-like
FT                   (InterPro:IPR015880), Zinc finger, C2H2-type
FT                   (InterPro:IPR007087); BEST Arabidopsis thaliana protein
FT                   match is: C2H2 and C2HC zinc fingers superfamily protein
FT                   (TAIR:AT5G27880.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZW0"
FT                   /db_xref="InterPro:IPR013087"
FT                   /db_xref="InterPro:IPR036236"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LZW0"
FT                   /protein_id="AED90402.1"
FT   gene            337128..337914
FT                   /gene_synonym="T20L15.140"
FT                   /gene_synonym="T20L15_140"
FT                   /locus_tag="AT5G01870"
FT                   /note="Predicted to encode a PR (pathogenesis-related)
FT                   protein. Belongs to the lipid transfer protein (PR-14)
FT                   family with the following members: At2g38540/LTP1,
FT                   At2g38530/LTP2, At5g59320/LTP3, At5g59310/LTP4,
FT                   At3g51600/LTP5, At3g08770/LTP6, At2g15050/LTP7,
FT                   At2g18370/LTP8, At2g15325/LTP9, At5g01870/LTP10,
FT                   At4g33355/LTP11, At3g51590/LTP12, At5g44265/LTP13,
FT                   At5g62065/LTP14, At4g08530/LTP15."
FT   mRNA            join(337128..337574,337669..337914)
FT                   /gene_synonym="T20L15.140"
FT                   /gene_synonym="T20L15_140"
FT                   /locus_tag="AT5G01870"
FT                   /product="Bifunctional inhibitor/lipid-transfer
FT                   protein/seed storage 2S albumin superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP587064.1,INSD:AI998609.1,INSD:BP593031.1,
FT                   INSD:AA597869.1,INSD:BP857534.1,INSD:EL976573.1,
FT                   INSD:BP625831.1,INSD:CB253232.1,INSD:AU235904.1,
FT                   INSD:AA650642.1,INSD:EL034220.1,INSD:BP635731.1,
FT                   INSD:BP595196.1,INSD:BP576943.1,INSD:ES174257.1,
FT                   INSD:BP565153.1,INSD:BP636339.1,INSD:ES145400.1,
FT                   INSD:ES050770.1,INSD:ES073859.1,INSD:BP584949.1,
FT                   INSD:EG466378.1,INSD:ES079750.1,INSD:BP575437.1,
FT                   INSD:BP865464.1,INSD:BP623814.1,INSD:AU226677.1,
FT                   INSD:BP636021.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK227988.1,INSD:BX833231.1,INSD:BX832243.1"
FT   CDS_pept        join(337234..337574,337669..337678)
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.140"
FT                   /gene_synonym="T20L15_140"
FT                   /locus_tag="AT5G01870"
FT                   /product="Bifunctional inhibitor/lipid-transfer
FT                   protein/seed storage 2S albumin superfamily protein"
FT                   /note="Bifunctional inhibitor/lipid-transfer protein/seed
FT                   storage 2S albumin superfamily protein; FUNCTIONS IN: lipid
FT                   binding; INVOLVED IN: lipid transport; LOCATED IN:
FT                   endomembrane system; EXPRESSED IN: 15 plant structures;
FT                   EXPRESSED DURING: 7 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Bifunctional inhibitor/plant lipid transfer
FT                   protein/seed storage (InterPro:IPR016140), Plant lipid
FT                   transfer protein/seed storage/trypsin-alpha amylase
FT                   inhibitor (InterPro:IPR003612), Plant lipid transfer
FT                   protein/Par allergen (InterPro:IPR000528), Plant lipid
FT                   transfer protein/hydrophobic protein, helical domain
FT                   (InterPro:IPR013770); BEST Arabidopsis thaliana protein
FT                   match is: lipid transfer protein 6 (TAIR:AT3G08770.1); Has
FT                   1807 Blast hits to 1807 proteins in 277 species: Archae -
FT                   0; Bacteria - 0; Metazoa - 736; Fungi - 347; Plants - 385;
FT                   Viruses - 0; Other Eukaryotes - 339 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZV9"
FT                   /db_xref="InterPro:IPR000528"
FT                   /db_xref="InterPro:IPR016140"
FT                   /db_xref="InterPro:IPR036312"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZV9"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP587064.1,INSD:AI998609.1,INSD:BP593031.1,
FT                   INSD:AA597869.1,INSD:BP857534.1,INSD:EL976573.1,
FT                   INSD:BP625831.1,INSD:CB253232.1,INSD:AU235904.1,
FT                   INSD:AA650642.1,INSD:EL034220.1,INSD:BP635731.1,
FT                   INSD:BP595196.1,INSD:BP576943.1,INSD:ES174257.1,
FT                   INSD:BP565153.1,INSD:BP636339.1,INSD:ES145400.1,
FT                   INSD:ES050770.1,INSD:ES073859.1,INSD:BP584949.1,
FT                   INSD:EG466378.1,INSD:ES079750.1,INSD:BP575437.1,
FT                   INSD:BP865464.1,INSD:BP623814.1,INSD:AU226677.1,
FT                   INSD:BP636021.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK227988.1,INSD:BX833231.1,INSD:BX832243.1"
FT                   /protein_id="AED90403.1"
FT                   KIDPSTNCNSIK"
FT   gene            338896..340253
FT                   /gene_synonym="DAF-Like gene 2"
FT                   /gene_synonym="DAFL2"
FT                   /gene_synonym="T20L15.150"
FT                   /gene_synonym="T20L15_150"
FT                   /locus_tag="AT5G01880"
FT   mRNA            338896..340253
FT                   /gene_synonym="DAF-Like gene 2"
FT                   /gene_synonym="DAFL2"
FT                   /gene_synonym="T20L15.150"
FT                   /gene_synonym="T20L15_150"
FT                   /locus_tag="AT5G01880"
FT                   /product="RING/U-box superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH928766.1,INSD:EG479466.1,INSD:EG479459.1,
FT                   INSD:EG479471.1,INSD:EG419709.1,INSD:Z34026.1,
FT                   INSD:EG479456.1,INSD:EG478682.1,INSD:EG478698.1,
FT                   INSD:EG479462.1,INSD:EG479465.1,INSD:EG479457.1,
FT                   INSD:EG479461.1,INSD:EH917560.1,INSD:EG478683.1,
FT                   INSD:EL158103.1,INSD:EG479455.1,INSD:BP655144.1,
FT                   INSD:EG479472.1,INSD:EH960988.1,INSD:EG478696.1,
FT                   INSD:EG478680.1,INSD:EG478694.1,INSD:EG479458.1,
FT                   INSD:EG478699.1,INSD:CB258748.1,INSD:BP641836.1,
FT                   INSD:EG479470.1,INSD:EG478689.1,INSD:EG479474.1,
FT                   INSD:EG478681.1,INSD:EG478687.1,INSD:EG479467.1,
FT                   INSD:ES093711.1,INSD:EG479469.1,INSD:BP612083.1,
FT                   INSD:EG478692.1,INSD:AU228792.1,INSD:EG478677.1,
FT                   INSD:EG478690.1,INSD:EG479468.1,INSD:EG478691.1,
FT                   INSD:EG479463.1,INSD:BP660370.1,INSD:EG478695.1,
FT                   INSD:EG478684.1,INSD:BP655253.1,INSD:AU237707.1,
FT                   INSD:EG478685.1,INSD:EL251213.1,INSD:BP833856.1,
FT                   INSD:EL249069.1,INSD:EG479454.1,INSD:EG478688.1,
FT                   INSD:ES137740.1,INSD:EL072657.1,INSD:EG478676.1,
FT                   INSD:BP623598.1,INSD:EG479460.1,INSD:BP629875.1,
FT                   INSD:EG479473.1,INSD:EG479476.1,INSD:BP651369.1,
FT                   INSD:EG478693.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK229217.1,INSD:BX830343.1,INSD:BX833914.1,
FT                   INSD:BX833639.1,INSD:BT010973.1,INSD:EF182905.1,
FT                   INSD:BT010682.1"
FT   CDS_pept        339017..339496
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.150"
FT                   /gene_synonym="T20L15_150"
FT                   /gene_synonym="DAF-Like gene 2"
FT                   /gene_synonym="DAFL2"
FT                   /locus_tag="AT5G01880"
FT                   /product="RING/U-box superfamily protein"
FT                   /note="RING/U-box superfamily protein; FUNCTIONS IN: zinc
FT                   ion binding; EXPRESSED IN: 10 plant structures; EXPRESSED
FT                   DURING: LP.04 four leaves visible, 4 anthesis, C globular
FT                   stage, petal differentiation and expansion stage; CONTAINS
FT                   InterPro DOMAIN/s: Zinc finger, RING-type
FT                   (InterPro:IPR001841), Zinc finger, C3HC4 RING-type
FT                   (InterPro:IPR018957); BEST Arabidopsis thaliana protein
FT                   match is: RING/U-box superfamily protein
FT                   (TAIR:AT3G10910.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZV8"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZV8"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH928766.1,INSD:EG479466.1,INSD:EG479459.1,
FT                   INSD:EG479471.1,INSD:EG419709.1,INSD:Z34026.1,
FT                   INSD:EG479456.1,INSD:EG478682.1,INSD:EG478698.1,
FT                   INSD:EG479462.1,INSD:EG479465.1,INSD:EG479457.1,
FT                   INSD:EG479461.1,INSD:EH917560.1,INSD:EG478683.1,
FT                   INSD:EL158103.1,INSD:EG479455.1,INSD:BP655144.1,
FT                   INSD:EG479472.1,INSD:EH960988.1,INSD:EG478696.1,
FT                   INSD:EG478680.1,INSD:EG478694.1,INSD:EG479458.1,
FT                   INSD:EG478699.1,INSD:CB258748.1,INSD:BP641836.1,
FT                   INSD:EG479470.1,INSD:EG478689.1,INSD:EG479474.1,
FT                   INSD:EG478681.1,INSD:EG478687.1,INSD:EG479467.1,
FT                   INSD:ES093711.1,INSD:EG479469.1,INSD:BP612083.1,
FT                   INSD:EG478692.1,INSD:AU228792.1,INSD:EG478677.1,
FT                   INSD:EG478690.1,INSD:EG479468.1,INSD:EG478691.1,
FT                   INSD:EG479463.1,INSD:BP660370.1,INSD:EG478695.1,
FT                   INSD:EG478684.1,INSD:BP655253.1,INSD:AU237707.1,
FT                   INSD:EG478685.1,INSD:EL251213.1,INSD:BP833856.1,
FT                   INSD:EL249069.1,INSD:EG479454.1,INSD:EG478688.1,
FT                   INSD:ES137740.1,INSD:EL072657.1,INSD:EG478676.1,
FT                   INSD:BP623598.1,INSD:EG479460.1,INSD:BP629875.1,
FT                   INSD:EG479473.1,INSD:EG479476.1,INSD:BP651369.1,
FT                   INSD:EG478693.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK229217.1,INSD:BX830343.1,INSD:BX833914.1,
FT                   INSD:BX833639.1,INSD:BT010973.1,INSD:EF182905.1,
FT                   INSD:BT010682.1"
FT                   /protein_id="AED90404.1"
FT   gene            339838..340266
FT                   /locus_tag="AT5G01881"
FT   mRNA            339838..340266
FT                   /locus_tag="AT5G01881"
FT                   /product="transmembrane protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG479467.1,INSD:EG478687.1,INSD:EH928766.1,
FT                   INSD:EG479469.1,INSD:EG479466.1,INSD:EG478692.1,
FT                   INSD:EG479459.1,INSD:EG479471.1,INSD:EG478677.1,
FT                   INSD:EG419709.1,INSD:EG478690.1,INSD:EG479468.1,
FT                   INSD:EG479456.1,INSD:EG478682.1,INSD:EG479463.1,
FT                   INSD:EG478691.1,INSD:EG478695.1,INSD:EG478684.1,
FT                   INSD:EG478685.1,INSD:EG479465.1,INSD:EG479462.1,
FT                   INSD:EG478698.1,INSD:EG479454.1,INSD:EG479457.1,
FT                   INSD:EG478688.1,INSD:EG479461.1,INSD:EG478683.1,
FT                   INSD:EL158103.1,INSD:EG479455.1,INSD:EG479472.1,
FT                   INSD:EH960988.1,INSD:EG478696.1,INSD:EL072657.1,
FT                   INSD:EG478680.1,INSD:EG478694.1,INSD:EG478676.1,
FT                   INSD:EG479458.1,INSD:EG478699.1,INSD:EG479460.1,
FT                   INSD:EG479470.1,INSD:EG479473.1,INSD:EG479476.1,
FT                   INSD:EG479474.1,INSD:EG478689.1,INSD:EG478693.1,
FT                   INSD:EG478681.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:EF182905.1,INSD:BX830343.1"
FT   CDS_pept        339838..340266
FT                   /codon_start=1
FT                   /locus_tag="AT5G01881"
FT                   /product="transmembrane protein"
FT                   /note="unknown protein; Has 3 Blast hits to 3 proteins in 2
FT                   species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0;
FT                   Plants - 3; Viruses - 0; Other Eukaryotes - 0 (source: NCBI
FT                   BLink)."
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01881.1"
FT                   /db_xref="GOA:Q2V3A8"
FT                   /db_xref="UniProtKB/TrEMBL:Q2V3A8"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG479467.1,INSD:EG478687.1,INSD:EH928766.1,
FT                   INSD:EG479469.1,INSD:EG479466.1,INSD:EG478692.1,
FT                   INSD:EG479459.1,INSD:EG479471.1,INSD:EG478677.1,
FT                   INSD:EG419709.1,INSD:EG478690.1,INSD:EG479468.1,
FT                   INSD:EG479456.1,INSD:EG478682.1,INSD:EG479463.1,
FT                   INSD:EG478691.1,INSD:EG478695.1,INSD:EG478684.1,
FT                   INSD:EG478685.1,INSD:EG479465.1,INSD:EG479462.1,
FT                   INSD:EG478698.1,INSD:EG479454.1,INSD:EG479457.1,
FT                   INSD:EG478688.1,INSD:EG479461.1,INSD:EG478683.1,
FT                   INSD:EL158103.1,INSD:EG479455.1,INSD:EG479472.1,
FT                   INSD:EH960988.1,INSD:EG478696.1,INSD:EL072657.1,
FT                   INSD:EG478680.1,INSD:EG478694.1,INSD:EG478676.1,
FT                   INSD:EG479458.1,INSD:EG478699.1,INSD:EG479460.1,
FT                   INSD:EG479470.1,INSD:EG479473.1,INSD:EG479476.1,
FT                   INSD:EG479474.1,INSD:EG478689.1,INSD:EG478693.1,
FT                   INSD:EG478681.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:EF182905.1,INSD:BX830343.1"
FT                   /protein_id="AED90405.1"
FT   gene            complement(341376..345457)
FT                   /gene_synonym="PXC2"
FT                   /gene_synonym="PXY/TDR-correlated 2"
FT                   /gene_synonym="T20L15.160"
FT                   /gene_synonym="T20L15_160"
FT                   /locus_tag="AT5G01890"
FT   mRNA            complement(join(341376..343107,343194..345457))
FT                   /gene_synonym="PXC2"
FT                   /gene_synonym="PXY/TDR-correlated 2"
FT                   /gene_synonym="T20L15.160"
FT                   /gene_synonym="T20L15_160"
FT                   /locus_tag="AT5G01890"
FT                   /product="Leucine-rich receptor-like protein kinase family
FT                   protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP591269.1,INSD:DR362258.1,INSD:AV545971.1,
FT                   INSD:AV546670.1,INSD:EH833919.1,INSD:AV550395.1,
FT                   INSD:BP603095.1,INSD:EL019187.1,INSD:EL256797.1,
FT                   INSD:BP798200.1,INSD:EL226709.1,INSD:EL172632.1,
FT                   INSD:EL031685.1,INSD:BP598389.1,INSD:AV530444.1,
FT                   INSD:AV553714.1,INSD:EG519415.1,INSD:BP606476.1,
FT                   INSD:AV532756.1,INSD:AV824587.1,INSD:EL031903.1,
FT                   INSD:BP601690.1,INSD:EH897067.1,INSD:DR362259.1,
FT                   INSD:AV554791.1,INSD:AV546291.1,INSD:AV522783.1,
FT                   INSD:EG519416.1,INSD:AV548793.1,INSD:AV786807.1,
FT                   INSD:EL106101.1,INSD:BP609202.1,INSD:AV548219.1,
FT                   INSD:EG422692.1,INSD:BP612496.1,INSD:AV547112.1,
FT                   INSD:AV545809.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF424563.1,INSD:BT004520.1"
FT   CDS_pept        complement(join(341661..343107,343194..344650))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.160"
FT                   /gene_synonym="T20L15_160"
FT                   /gene_synonym="PXC2"
FT                   /gene_synonym="PXY/TDR-correlated 2"
FT                   /locus_tag="AT5G01890"
FT                   /product="Leucine-rich receptor-like protein kinase family
FT                   protein"
FT                   /note="Leucine-rich receptor-like protein kinase family
FT                   protein; FUNCTIONS IN: protein serine/threonine kinase
FT                   activity, kinase activity, ATP binding; INVOLVED IN:
FT                   transmembrane receptor protein tyrosine kinase signaling
FT                   pathway, protein amino acid phosphorylation; LOCATED IN:
FT                   plasma membrane; EXPRESSED IN: 22 plant structures;
FT                   EXPRESSED DURING: 13 growth stages; CONTAINS InterPro
FT                   DOMAIN/s: Protein kinase, ATP binding site
FT                   (InterPro:IPR017441), Protein kinase, catalytic domain
FT                   (InterPro:IPR000719), Leucine-rich repeat-containing
FT                   N-terminal domain, type 2 (InterPro:IPR013210),
FT                   Leucine-rich repeat (InterPro:IPR001611),
FT                   Serine-threonine/tyrosine-protein kinase
FT                   (InterPro:IPR001245), Protein kinase-like domain
FT                   (InterPro:IPR011009); BEST Arabidopsis thaliana protein
FT                   match is: Leucine-rich repeat protein kinase family protein
FT                   (TAIR:AT3G56370.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01890"
FT                   /db_xref="GOA:Q9LZV7"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR003591"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013210"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZV7"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:BP591269.1,INSD:DR362258.1,INSD:AV545971.1,
FT                   INSD:AV546670.1,INSD:EH833919.1,INSD:AV550395.1,
FT                   INSD:BP603095.1,INSD:EL019187.1,INSD:EL256797.1,
FT                   INSD:BP798200.1,INSD:EL226709.1,INSD:EL172632.1,
FT                   INSD:EL031685.1,INSD:BP598389.1,INSD:AV530444.1,
FT                   INSD:AV553714.1,INSD:EG519415.1,INSD:BP606476.1,
FT                   INSD:AV532756.1,INSD:AV824587.1,INSD:EL031903.1,
FT                   INSD:BP601690.1,INSD:EH897067.1,INSD:DR362259.1,
FT                   INSD:AV554791.1,INSD:AV546291.1,INSD:AV522783.1,
FT                   INSD:EG519416.1,INSD:AV548793.1,INSD:AV786807.1,
FT                   INSD:EL106101.1,INSD:BP609202.1,INSD:AV548219.1,
FT                   INSD:EG422692.1,INSD:BP612496.1,INSD:AV547112.1,
FT                   INSD:AV545809.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AF424563.1,INSD:BT004520.1"
FT                   /protein_id="AED90406.1"
FT   gene            343277..343910
FT                   /locus_tag="AT5G01895"
FT   mRNA            343277..343910
FT                   /locus_tag="AT5G01895"
FT                   /product="hypothetical protein"
FT   CDS_pept        343365..343910
FT                   /codon_start=1
FT                   /locus_tag="AT5G01895"
FT                   /product="hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01895"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BBA6"
FT                   /protein_id="ANM68878.1"
FT                   MELQEPRLFIESGRFPEK"
FT   gene            345262..345614
FT                   /locus_tag="AT5G00810"
FT   ncRNA           345262..345614
FT                   /locus_tag="AT5G00810"
FT                   /product="other RNA"
FT                   /ncRNA_class="lncRNA"
FT   gene            complement(350925..352095)
FT                   /gene="WRKY62"
FT                   /gene_synonym="ARABIDOPSIS THALIANA WRKY DNA-BINDING
FT                   PROTEIN 62"
FT                   /gene_synonym="ATWRKY62"
FT                   /gene_synonym="T20L15.170"
FT                   /gene_synonym="T20L15_170"
FT                   /gene_synonym="WRKY DNA-binding protein 62"
FT                   /locus_tag="AT5G01900"
FT                   /note="member of WRKY Transcription Factor; Group III"
FT   mRNA            complement(join(350925..351661,351748..352095))
FT                   /gene="WRKY62"
FT                   /gene_synonym="ARABIDOPSIS THALIANA WRKY DNA-BINDING
FT                   PROTEIN 62"
FT                   /gene_synonym="ATWRKY62"
FT                   /gene_synonym="T20L15.170"
FT                   /gene_synonym="T20L15_170"
FT                   /gene_synonym="WRKY DNA-binding protein 62"
FT                   /locus_tag="AT5G01900"
FT                   /product="WRKY DNA-binding protein 62"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CB185474.1,INSD:CB185507.1,INSD:BE662848.1,
FT                   INSD:CB185477.1,INSD:CB185574.1,INSD:CB185517.1,
FT                   INSD:CB185503.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AF224700.1"
FT   CDS_pept        complement(join(351136..351661,351748..352013))
FT                   /codon_start=1
FT                   /gene="WRKY62"
FT                   /gene_synonym="ARABIDOPSIS THALIANA WRKY DNA-BINDING
FT                   PROTEIN 62"
FT                   /gene_synonym="ATWRKY62"
FT                   /gene_synonym="T20L15.170"
FT                   /gene_synonym="T20L15_170"
FT                   /gene_synonym="WRKY DNA-binding protein 62"
FT                   /locus_tag="AT5G01900"
FT                   /product="WRKY DNA-binding protein 62"
FT                   /note="WRKY DNA-binding protein 62 (WRKY62); CONTAINS
FT                   InterPro DOMAIN/s: DNA-binding WRKY (InterPro:IPR003657);
FT                   BEST Arabidopsis thaliana protein match is: WRKY
FT                   DNA-binding protein 38 (TAIR:AT5G22570.1); Has 3146 Blast
FT                   hits to 2717 proteins in 131 species: Archae - 0; Bacteria
FT                   - 0; Metazoa - 0; Fungi - 0; Plants - 3132; Viruses - 0;
FT                   Other Eukaryotes - 14 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZV6"
FT                   /db_xref="InterPro:IPR003657"
FT                   /db_xref="InterPro:IPR036576"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZV6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:CB185474.1,INSD:CB185507.1,INSD:BE662848.1,
FT                   INSD:CB185477.1,INSD:CB185574.1,INSD:CB185517.1,
FT                   INSD:CB185503.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:AF224700.1"
FT                   /protein_id="AED90407.1"
FT   gene            complement(357675..358962)
FT                   /gene_synonym="T20L15.180"
FT                   /gene_synonym="T20L15_180"
FT                   /locus_tag="AT5G01910"
FT   mRNA            complement(join(357675..358084,358164..358229,
FT                   358314..358962))
FT                   /gene_synonym="T20L15.180"
FT                   /gene_synonym="T20L15_180"
FT                   /locus_tag="AT5G01910"
FT                   /product="myelin transcription factor"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG525076.1,INSD:EG525064.1,INSD:EG525071.1,
FT                   INSD:EG525077.1,INSD:EG525081.1,INSD:EG525066.1,
FT                   INSD:EG525059.1,INSD:EG525083.1,INSD:EG525080.1,
FT                   INSD:EG525065.1,INSD:EG525079.1,INSD:EG525063.1,
FT                   INSD:EG525060.1,INSD:ES029881.1,INSD:EG421639.1,
FT                   INSD:EL255089.1,INSD:EG525082.1,INSD:EG525069.1,
FT                   INSD:EG421638.1,INSD:ES020167.1,INSD:EG525084.1,
FT                   INSD:EG525073.1,INSD:EG421636.1,INSD:EL170641.1,
FT                   INSD:EG421637.1,INSD:EG525068.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:DQ653260.1,INSD:DQ446912.1"
FT   mRNA            complement(join(357675..358229,358314..358962))
FT                   /gene_synonym="T20L15.180"
FT                   /gene_synonym="T20L15_180"
FT                   /locus_tag="AT5G01910"
FT                   /product="myelin transcription factor"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG525084.1,INSD:EG525074.1,INSD:EL255089.1,
FT                   INSD:EG525075.1,INSD:ES029881.1,INSD:ES020167.1"
FT   CDS_pept        complement(join(357950..358084,358164..358229,
FT                   358314..358655))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.180"
FT                   /gene_synonym="T20L15_180"
FT                   /locus_tag="AT5G01910"
FT                   /product="myelin transcription factor"
FT                   /note="unknown protein; Has 66 Blast hits to 66 proteins in
FT                   27 species: Archae - 0; Bacteria - 2; Metazoa - 18; Fungi -
FT                   7; Plants - 29; Viruses - 0; Other Eukaryotes - 10 (source:
FT                   NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01910"
FT                   /db_xref="GOA:Q1PE06"
FT                   /db_xref="UniProtKB/TrEMBL:Q1PE06"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG525076.1,INSD:EG525064.1,INSD:EG525071.1,
FT                   INSD:EG525077.1,INSD:EG525081.1,INSD:EG525066.1,
FT                   INSD:EG525059.1,INSD:EG525083.1,INSD:EG525080.1,
FT                   INSD:EG525065.1,INSD:EG525079.1,INSD:EG525063.1,
FT                   INSD:EG525060.1,INSD:ES029881.1,INSD:EG421639.1,
FT                   INSD:EL255089.1,INSD:EG525082.1,INSD:EG525069.1,
FT                   INSD:EG421638.1,INSD:ES020167.1,INSD:EG525084.1,
FT                   INSD:EG525073.1,INSD:EG421636.1,INSD:EL170641.1,
FT                   INSD:EG421637.1,INSD:EG525068.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:DQ653260.1,INSD:DQ446912.1"
FT                   /protein_id="AED90408.1"
FT                   NVLERDMIIANTQPIIS"
FT   CDS_pept        complement(join(358077..358229,358314..358655))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.180"
FT                   /gene_synonym="T20L15_180"
FT                   /locus_tag="AT5G01910"
FT                   /product="myelin transcription factor"
FT                   /note="unknown protein; FUNCTIONS IN: molecular_function
FT                   unknown; INVOLVED IN: biological_process unknown; EXPRESSED
FT                   IN: 16 plant structures; EXPRESSED DURING: 11 growth
FT                   stages; Has 30201 Blast hits to 17322 proteins in 780
FT                   species: Archae - 12; Bacteria - 1396; Metazoa - 17338;
FT                   Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes
FT                   - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01910"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01910.2"
FT                   /db_xref="GOA:B3H7E6"
FT                   /db_xref="UniProtKB/TrEMBL:B3H7E6"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG525084.1,INSD:EG525074.1,INSD:EL255089.1,
FT                   INSD:EG525075.1,INSD:ES029881.1,INSD:ES020167.1"
FT                   /protein_id="AED90409.1"
FT                   R"
FT   gene            359107..361310
FT                   /gene="STN8"
FT                   /gene_synonym="State transition 8"
FT                   /gene_synonym="STATE TRANSITION 8"
FT                   /gene_synonym="T20L15.190"
FT                   /gene_synonym="T20L15_190"
FT                   /locus_tag="AT5G01920"
FT                   /note="Chloroplast thylakoid protein kinase STN8 is
FT                   specific in phosphorylation of N-terminal threonine
FT                   residues in D1, D2 and CP43 proteins, and Thr-4 in PsbH
FT                   protein of photosystem II. Phosphorylation of Thr-4 in the
FT                   wild type required both light and prior phosphorylation at
FT                   Thr-2."
FT   mRNA            join(359107..359714,359784..359957,360042..360446,
FT                   360520..361079,361163..361310)
FT                   /gene="STN8"
FT                   /gene_synonym="State transition 8"
FT                   /gene_synonym="STATE TRANSITION 8"
FT                   /gene_synonym="T20L15.190"
FT                   /gene_synonym="T20L15_190"
FT                   /locus_tag="AT5G01920"
FT                   /product="Protein kinase superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH876384.1,INSD:EH950729.1,INSD:AV439725.1,
FT                   INSD:EH938339.1,INSD:EL302052.1,INSD:EL977838.1,
FT                   INSD:EH839753.1,INSD:EL116967.1,INSD:EL180379.1,
FT                   INSD:T45796.1,INSD:ES141832.1,INSD:BP639025.1,
FT                   INSD:EL310215.1,INSD:EH872822.1,INSD:EH946965.1,
FT                   INSD:EL166710.1,INSD:ES192978.1,INSD:EL036614.1,
FT                   INSD:EL070085.1,INSD:EL325644.1,INSD:EH859208.1,
FT                   INSD:EL002181.1,INSD:EL018655.1,INSD:EL042271.1,
FT                   INSD:AV528501.1,INSD:EL315440.1,INSD:AU036595.1,
FT                   INSD:EL154510.1,INSD:EH886935.1,INSD:EL063804.1,
FT                   INSD:AV522946.1,INSD:N37171.1,INSD:EL312318.1,
FT                   INSD:AU229659.1,INSD:AU237907.2,INSD:EL268923.1,
FT                   INSD:N65375.1,INSD:T45057.1,INSD:ES140505.1,
FT                   INSD:EG522395.1,INSD:AU238469.1,INSD:EL282868.1,
FT                   INSD:EL176046.1,INSD:BP812686.1,INSD:EG522394.1,
FT                   INSD:EL150970.1,INSD:AV561129.1,INSD:DR360743.1,
FT                   INSD:AI994858.1,INSD:EL024500.1,INSD:DR260570.1,
FT                   INSD:BP796665.1,INSD:BP609170.1,INSD:EH818179.1,
FT                   INSD:EL033062.1,INSD:EH938199.1,INSD:AU229015.1,
FT                   INSD:EH934159.1,INSD:AU036582.1,INSD:EL068336.1,
FT                   INSD:AI994926.1,INSD:ES005506.1,INSD:DR382295.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK117124.1,INSD:BT006132.1,INSD:AK117628.1"
FT   mRNA            join(359107..359714,359784..359957,360042..360446,
FT                   360520..360939)
FT                   /gene="STN8"
FT                   /gene_synonym="State transition 8"
FT                   /gene_synonym="STATE TRANSITION 8"
FT                   /gene_synonym="T20L15.190"
FT                   /gene_synonym="T20L15_190"
FT                   /locus_tag="AT5G01920"
FT                   /product="Protein kinase superfamily protein"
FT   CDS_pept        join(359154..359714,359784..359957,360042..360446,
FT                   360520..360867)
FT                   /codon_start=1
FT                   /gene="STN8"
FT                   /gene_synonym="State transition 8"
FT                   /gene_synonym="STATE TRANSITION 8"
FT                   /gene_synonym="T20L15.190"
FT                   /gene_synonym="T20L15_190"
FT                   /locus_tag="AT5G01920"
FT                   /product="Protein kinase superfamily protein"
FT                   /db_xref="GOA:Q9LZV4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZV4"
FT                   /protein_id="ANM70167.1"
FT   CDS_pept        join(359154..359714,359784..359957,360042..360446,
FT                   360520..360867)
FT                   /codon_start=1
FT                   /gene="STN8"
FT                   /gene_synonym="STATE TRANSITION 8"
FT                   /gene_synonym="T20L15.190"
FT                   /gene_synonym="T20L15_190"
FT                   /gene_synonym="State transition 8"
FT                   /locus_tag="AT5G01920"
FT                   /product="Protein kinase superfamily protein"
FT                   /note="STN8; FUNCTIONS IN: protein kinase activity, kinase
FT                   activity; INVOLVED IN: photosystem II stabilization;
FT                   LOCATED IN: thylakoid, chloroplast; EXPRESSED IN: 22 plant
FT                   structures; EXPRESSED DURING: 14 growth stages; CONTAINS
FT                   InterPro DOMAIN/s: Protein kinase, core
FT                   (InterPro:IPR000719), Serine/threonine protein
FT                   kinase-related (InterPro:IPR017442), Protein kinase-like
FT                   (InterPro:IPR011009), Serine/threonine protein kinase,
FT                   active site (InterPro:IPR008271); BEST Arabidopsis thaliana
FT                   protein match is: STN7 (Stt7 homolog STN7); kinase/ protein
FT                   kinase (TAIR:AT1G68830.1); Has 33057 Blast hits to 33030
FT                   proteins in 1682 species: Archae - 26; Bacteria - 4053;
FT                   Metazoa - 14243; Fungi - 4538; Plants - 3212; Viruses - 96;
FT                   Other Eukaryotes - 6889 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZV4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZV4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EH876384.1,INSD:EH950729.1,INSD:AV439725.1,
FT                   INSD:EH938339.1,INSD:EL302052.1,INSD:EL977838.1,
FT                   INSD:EH839753.1,INSD:EL116967.1,INSD:EL180379.1,
FT                   INSD:T45796.1,INSD:ES141832.1,INSD:BP639025.1,
FT                   INSD:EL310215.1,INSD:EH872822.1,INSD:EH946965.1,
FT                   INSD:EL166710.1,INSD:ES192978.1,INSD:EL036614.1,
FT                   INSD:EL070085.1,INSD:EL325644.1,INSD:EH859208.1,
FT                   INSD:EL002181.1,INSD:EL018655.1,INSD:EL042271.1,
FT                   INSD:AV528501.1,INSD:EL315440.1,INSD:AU036595.1,
FT                   INSD:EL154510.1,INSD:EH886935.1,INSD:EL063804.1,
FT                   INSD:AV522946.1,INSD:N37171.1,INSD:EL312318.1,
FT                   INSD:AU229659.1,INSD:AU237907.2,INSD:EL268923.1,
FT                   INSD:N65375.1,INSD:T45057.1,INSD:ES140505.1,
FT                   INSD:EG522395.1,INSD:AU238469.1,INSD:EL282868.1,
FT                   INSD:EL176046.1,INSD:BP812686.1,INSD:EG522394.1,
FT                   INSD:EL150970.1,INSD:AV561129.1,INSD:DR360743.1,
FT                   INSD:AI994858.1,INSD:EL024500.1,INSD:DR260570.1,
FT                   INSD:BP796665.1,INSD:BP609170.1,INSD:EH818179.1,
FT                   INSD:EL033062.1,INSD:EH938199.1,INSD:AU229015.1,
FT                   INSD:EH934159.1,INSD:AU036582.1,INSD:EL068336.1,
FT                   INSD:AI994926.1,INSD:ES005506.1,INSD:DR382295.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK117124.1,INSD:BT006132.1,INSD:AK117628.1"
FT                   /protein_id="AED90410.1"
FT   gene            complement(361081..362901)
FT                   /gene="MAN6"
FT                   /gene_synonym="T20L15.200"
FT                   /gene_synonym="T20L15_200"
FT                   /gene_synonym="AtMAN6"
FT                   /gene_synonym="endo-beta-mannase 6"
FT                   /locus_tag="AT5G01930"
FT                   /note="Encodes a endo-beta-mannanase involved in seed
FT                   germination."
FT   mRNA            complement(join(361081..361627,361726..362060,
FT                   362146..362340,362413..362689,362767..362901))
FT                   /gene="MAN6"
FT                   /gene_synonym="T20L15.200"
FT                   /gene_synonym="T20L15_200"
FT                   /gene_synonym="AtMAN6"
FT                   /gene_synonym="endo-beta-mannase 6"
FT                   /locus_tag="AT5G01930"
FT                   /product="Glycosyl hydrolase superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR275249.1,INSD:EH934159.1,INSD:AA597792.1,
FT                   INSD:BP807570.1,INSD:EL989024.1,INSD:CF652410.1,
FT                   INSD:BP578231.1,INSD:AU225967.1,INSD:DR275248.1,
FT                   INSD:BP858373.1,INSD:AA713141.1,INSD:BP583233.1,
FT                   INSD:AA394852.1,INSD:BP572699.1,INSD:BP571628.1,
FT                   INSD:AU235301.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT005831.1,INSD:BT011805.1,INSD:AK227325.1"
FT   CDS_pept        complement(join(361189..361627,361726..362060,
FT                   362146..362340,362413..362689,362767..362867))
FT                   /codon_start=1
FT                   /gene="MAN6"
FT                   /gene_synonym="T20L15.200"
FT                   /gene_synonym="T20L15_200"
FT                   /gene_synonym="AtMAN6"
FT                   /gene_synonym="endo-beta-mannase 6"
FT                   /locus_tag="AT5G01930"
FT                   /product="Glycosyl hydrolase superfamily protein"
FT                   /note="Glycosyl hydrolase superfamily protein; FUNCTIONS
FT                   IN: cation binding, hydrolase activity, hydrolyzing
FT                   O-glycosyl compounds, catalytic activity; INVOLVED IN:
FT                   carbohydrate metabolic process; LOCATED IN: endomembrane
FT                   system; EXPRESSED IN: 19 plant structures; EXPRESSED
FT                   DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s:
FT                   Glycoside hydrolase, catalytic core (InterPro:IPR017853),
FT                   Glycoside hydrolase, family 5 (InterPro:IPR001547),
FT                   Glycoside hydrolase, subgroup, catalytic core
FT                   (InterPro:IPR013781); BEST Arabidopsis thaliana protein
FT                   match is: Glycosyl hydrolase superfamily protein
FT                   (TAIR:AT5G66460.1); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01930"
FT                   /db_xref="GOA:Q9LZV3"
FT                   /db_xref="InterPro:IPR001547"
FT                   /db_xref="InterPro:IPR017853"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZV3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR275249.1,INSD:EH934159.1,INSD:AA597792.1,
FT                   INSD:BP807570.1,INSD:EL989024.1,INSD:CF652410.1,
FT                   INSD:BP578231.1,INSD:AU225967.1,INSD:DR275248.1,
FT                   INSD:BP858373.1,INSD:AA713141.1,INSD:BP583233.1,
FT                   INSD:AA394852.1,INSD:BP572699.1,INSD:BP571628.1,
FT                   INSD:AU235301.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BT005831.1,INSD:BT011805.1,INSD:AK227325.1"
FT                   /protein_id="AED90411.1"
FT   gene            complement(363213..364891)
FT                   /gene_synonym="T20L15.210"
FT                   /gene_synonym="T20L15_210"
FT                   /locus_tag="AT5G01940"
FT   mRNA            complement(join(363213..363635,363732..363820,
FT                   363913..364055,364135..364277,364357..364418,
FT                   364526..364625,364701..364814))
FT                   /gene_synonym="T20L15.210"
FT                   /gene_synonym="T20L15_210"
FT                   /locus_tag="AT5G01940"
FT                   /product="eukaryotic translation initiation factor 2B
FT                   family protein / eIF-2B family protein"
FT   mRNA            complement(join(363343..363635,363732..363820,
FT                   363913..364055,364135..364277,364357..364418,
FT                   364526..364625,364701..364891))
FT                   /gene_synonym="T20L15.210"
FT                   /gene_synonym="T20L15_210"
FT                   /locus_tag="AT5G01940"
FT                   /product="eukaryotic translation initiation factor 2B
FT                   family protein / eIF-2B family protein"
FT   CDS_pept        complement(join(363594..363635,363732..363820,
FT                   363913..364055,364135..364277,364357..364418,
FT                   364526..364625,364701..364865))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.210"
FT                   /gene_synonym="T20L15_210"
FT                   /locus_tag="AT5G01940"
FT                   /product="eukaryotic translation initiation factor 2B
FT                   family protein / eIF-2B family protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01940"
FT                   /db_xref="GOA:A0A1P8BFD8"
FT                   /db_xref="InterPro:IPR002735"
FT                   /db_xref="InterPro:IPR016189"
FT                   /db_xref="InterPro:IPR016190"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BFD8"
FT                   /protein_id="ANM70277.1"
FT   mRNA            complement(join(363594..363683,363732..363820,
FT                   363913..364055,364135..364277,364357..364418,
FT                   364526..364625,364701..364853))
FT                   /gene_synonym="T20L15.210"
FT                   /gene_synonym="T20L15_210"
FT                   /locus_tag="AT5G01940"
FT                   /product="eukaryotic translation initiation factor 2B
FT                   family protein / eIF-2B family protein"
FT                   /inference="similar to RNA sequence, EST:INSD:EL192540.1"
FT   CDS_pept        complement(join(363594..363635,363732..363820,
FT                   363913..364055,364135..364277,364357..364418,
FT                   364526..364625,364701..364769))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.210"
FT                   /gene_synonym="T20L15_210"
FT                   /locus_tag="AT5G01940"
FT                   /product="eukaryotic translation initiation factor 2B
FT                   family protein / eIF-2B family protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01940"
FT                   /db_xref="GOA:A0A178UNV7"
FT                   /db_xref="InterPro:IPR002735"
FT                   /db_xref="InterPro:IPR016189"
FT                   /db_xref="InterPro:IPR016190"
FT                   /db_xref="UniProtKB/TrEMBL:A0A178UNV7"
FT                   /protein_id="ANM70276.1"
FT   CDS_pept        complement(join(363594..363683,363732..363820,
FT                   363913..364055,364135..364277,364357..364418,
FT                   364526..364625,364701..364769))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.210"
FT                   /gene_synonym="T20L15_210"
FT                   /locus_tag="AT5G01940"
FT                   /product="eukaryotic translation initiation factor 2B
FT                   family protein / eIF-2B family protein"
FT                   /note="eukaryotic translation initiation factor 2B family
FT                   protein / eIF-2B family protein; FUNCTIONS IN: translation
FT                   initiation factor activity; INVOLVED IN: translational
FT                   initiation; LOCATED IN: cellular_component unknown;
FT                   EXPRESSED IN: 19 plant structures; EXPRESSED DURING: 12
FT                   growth stages; CONTAINS InterPro DOMAIN/s: Translation
FT                   initiation factor IF2/IF5, N-terminal (InterPro:IPR016189),
FT                   Translation initiation factor IF2/IF5 (InterPro:IPR002735);
FT                   BEST Arabidopsis thaliana protein match is: eukaryotic
FT                   translation initiation factor 2 beta subunit
FT                   (TAIR:AT5G20920.2); Has 1807 Blast hits to 1807 proteins in
FT                   277 species: Archae - 0; Bacteria - 0; Metazoa - 736; Fungi
FT                   - 347; Plants - 385; Viruses - 0; Other Eukaryotes - 339
FT                   (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01940"
FT                   /db_xref="GOA:Q9LZV2"
FT                   /db_xref="InterPro:IPR002735"
FT                   /db_xref="InterPro:IPR016189"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LZV2"
FT                   /inference="similar to RNA sequence, EST:INSD:EL192540.1"
FT                   /protein_id="AED90412.1"
FT                   APVDIPNLL"
FT   gene            complement(364902..370295)
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT   mRNA            complement(join(364902..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369537,369691..369786,369895..370295))
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AA712879.1,INSD:AV523401.1,INSD:BP839115.1,
FT                   INSD:CA782044.1,INSD:EL163808.1,INSD:DR368835.1,
FT                   INSD:AV529062.1,INSD:AI993749.1,INSD:ES037161.1,
FT                   INSD:AV526845.1,INSD:ES143186.1,INSD:DR383549.1,
FT                   INSD:AV547400.1,INSD:AV522986.1,INSD:EL983739.1,
FT                   INSD:AV523939.1,INSD:AU036572.1"
FT   mRNA            complement(join(364902..365507,365585..365970,
FT                   366062..366345,366430..366588,366682..367202,
FT                   367278..367346,367434..367520,367615..367686,
FT                   367795..367863,367941..368009,368114..368188,
FT                   368266..368337,368419..368490,368583..368726,
FT                   368833..368904,369011..369082,369285..369537,
FT                   369691..369786,369895..370218))
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT   mRNA            complement(join(364902..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369537,
FT                   369691..369786,369895..370216))
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT   mRNA            complement(join(364902..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369537,369691..370216))
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT   mRNA            complement(join(364902..365835,365919..365970,
FT                   366062..366345,366430..366588,366682..367202,
FT                   367278..367346,367434..367520,367615..367686,
FT                   367795..367863,367941..368009,368114..368188,
FT                   368266..368337,368419..368490,368583..368726,
FT                   368833..368904,369011..369082,369285..369537,
FT                   369691..369786,369895..370215))
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT   mRNA            complement(join(364902..365507,365585..365835,
FT                   365919..365985,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369537,369691..369786,369895..370215))
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT   mRNA            complement(join(364902..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369786,369895..370209))
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT   mRNA            complement(join(364902..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369600))
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT   CDS_pept        complement(join(365040..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369532))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT                   /db_xref="GOA:F4KAX4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013210"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:F4KAX4"
FT                   /protein_id="ANM68700.1"
FT   CDS_pept        complement(join(365040..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369532))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT                   /db_xref="GOA:F4KAX4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013210"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:F4KAX4"
FT                   /protein_id="ANM68702.1"
FT   CDS_pept        complement(join(365040..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369532))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01950"
FT                   /db_xref="GOA:F4KAX4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013210"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:F4KAX4"
FT                   /protein_id="ANM68705.1"
FT   CDS_pept        complement(join(365040..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369532))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT                   /note="Leucine-rich repeat protein kinase family protein;
FT                   FUNCTIONS IN: protein serine/threonine kinase activity,
FT                   kinase activity, ATP binding; INVOLVED IN: transmembrane
FT                   receptor protein tyrosine kinase signaling pathway, protein
FT                   amino acid phosphorylation; LOCATED IN: chloroplast, plasma
FT                   membrane; EXPRESSED IN: 19 plant structures; EXPRESSED
FT                   DURING: 10 growth stages; CONTAINS InterPro DOMAIN/s:
FT                   Protein kinase, ATP binding site (InterPro:IPR017441),
FT                   Serine/threonine-protein kinase domain
FT                   (InterPro:IPR002290), Leucine-rich repeat-containing
FT                   N-terminal domain, type 2 (InterPro:IPR013210),
FT                   Leucine-rich repeat (InterPro:IPR001611),
FT                   Serine/threonine-protein kinase-like domain
FT                   (InterPro:IPR017442), Protein kinase-like domain
FT                   (InterPro:IPR011009), Serine/threonine-protein kinase,
FT                   active site (InterPro:IPR008271), Protein kinase, catalytic
FT                   domain (InterPro:IPR000719), Tyrosine-protein kinase,
FT                   catalytic domain (InterPro:IPR020635); BEST Arabidopsis
FT                   thaliana protein match is: Leucine-rich repeat protein
FT                   kinase family protein (TAIR:AT1G06840.1); Has 195622 Blast
FT                   hits to 137374 proteins in 5075 species: Archae - 144;
FT                   Bacteria - 18537; Metazoa - 60927; Fungi - 10261; Plants -
FT                   82888; Viruses - 345; Other Eukaryotes - 22520 (source:
FT                   NCBI BLink)."
FT                   /db_xref="GOA:F4KAX4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013210"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:F4KAX4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:AA712879.1,INSD:AV523401.1,INSD:BP839115.1,
FT                   INSD:CA782044.1,INSD:EL163808.1,INSD:DR368835.1,
FT                   INSD:AV529062.1,INSD:AI993749.1,INSD:ES037161.1,
FT                   INSD:AV526845.1,INSD:ES143186.1,INSD:DR383549.1,
FT                   INSD:AV547400.1,INSD:AV522986.1,INSD:EL983739.1,
FT                   INSD:AV523939.1,INSD:AU036572.1"
FT                   /protein_id="AED90413.1"
FT   CDS_pept        complement(join(365040..365507,365585..365835,
FT                   365919..365985,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369082,
FT                   369285..369532))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01950"
FT                   /db_xref="GOA:A0A1P8BAT4"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013210"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BAT4"
FT                   /protein_id="ANM68703.1"
FT   CDS_pept        complement(join(365040..365507,365585..365835,
FT                   365919..365970,366062..366345,366430..366588,
FT                   366682..367202,367278..367346,367434..367520,
FT                   367615..367686,367795..367863,367941..368009,
FT                   368114..368188,368266..368337,368419..368490,
FT                   368583..368726,368833..368904,369011..369075))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01950"
FT                   /db_xref="GOA:A0A1P8BAU6"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BAU6"
FT                   /protein_id="ANM68706.1"
FT   CDS_pept        complement(join(365564..365835,365919..365970,
FT                   366062..366345,366430..366588,366682..367202,
FT                   367278..367346,367434..367520,367615..367686,
FT                   367795..367863,367941..368009,368114..368188,
FT                   368266..368337,368419..368490,368583..368726,
FT                   368833..368904,369011..369082,369285..369532))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01950"
FT                   /db_xref="GOA:A0A1P8BAT2"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013210"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BAT2"
FT                   /protein_id="ANM68704.1"
FT   CDS_pept        complement(join(365902..365970,366062..366345,
FT                   366430..366588,366682..367202,367278..367346,
FT                   367434..367520,367615..367686,367795..367863,
FT                   367941..368009,368114..368188,368266..368337,
FT                   368419..368490,368583..368726,368833..368904,
FT                   369011..369082,369285..369532))
FT                   /codon_start=1
FT                   /gene_synonym="T20L15.220"
FT                   /gene_synonym="T20L15_220"
FT                   /locus_tag="AT5G01950"
FT                   /product="Leucine-rich repeat protein kinase family
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01950"
FT                   /db_xref="GOA:A0A1P8BAS1"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR001245"
FT                   /db_xref="InterPro:IPR001611"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR013210"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="InterPro:IPR032675"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BAS1"
FT                   /protein_id="ANM68701.1"
FT   gene            370239..372969
FT                   /gene_synonym="T7H20.10"
FT                   /gene_synonym="T7H20_10"
FT                   /locus_tag="AT5G01960"
FT   mRNA            join(370239..370720,370800..371303,371390..371466,
FT                   371547..371715,371872..371960,372074..372238,
FT                   372316..372393,372487..372590,372670..372969)
FT                   /gene_synonym="T7H20.10"
FT                   /gene_synonym="T7H20_10"
FT                   /locus_tag="AT5G01960"
FT                   /product="RING/U-box superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL258898.1,INSD:DR265258.1,INSD:DR265259.1,
FT                   INSD:ES132740.1,INSD:BP602982.1,INSD:EL015073.1,
FT                   INSD:DR376177.1,INSD:EH885634.1,INSD:BP617848.1,
FT                   INSD:EL276317.1,INSD:BP798101.1,INSD:ES140842.1,
FT                   INSD:ES054192.1,INSD:BP811157.1,INSD:EH806755.1,
FT                   INSD:BP633168.1,INSD:EH891928.1,INSD:ES181425.1,
FT                   INSD:AA651156.1,INSD:BP778029.1,INSD:EL973782.1,
FT                   INSD:EL991767.1,INSD:BP671641.1,INSD:EL266887.1,
FT                   INSD:DR265260.1,INSD:ES088035.1,INSD:EL260254.1,
FT                   INSD:BP619694.1,INSD:ES022858.1,INSD:EG463064.1,
FT                   INSD:AV562969.1,INSD:DR265264.1,INSD:BP827788.1,
FT                   INSD:DR265261.1,INSD:BP610341.1,INSD:AV440114.1,
FT                   INSD:AV830898.1,INSD:ES012017.1,INSD:EH828778.1,
FT                   INSD:CD530902.1,INSD:DR265262.1,INSD:BP866120.2,
FT                   INSD:EH862623.1,INSD:BP623208.1,INSD:AV809752.1,
FT                   INSD:EL971150.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY087766.1,INSD:BX832142.1,INSD:AY099711.1,
FT                   INSD:BX831206.1,INSD:BX832766.1,INSD:BT000282.1"
FT   CDS_pept        join(370811..371303,371390..371466,371547..371715,
FT                   371872..371960,372074..372238,372316..372393,
FT                   372487..372590,372670..372775)
FT                   /codon_start=1
FT                   /gene_synonym="T7H20.10"
FT                   /gene_synonym="T7H20_10"
FT                   /locus_tag="AT5G01960"
FT                   /product="RING/U-box superfamily protein"
FT                   /note="RING/U-box superfamily protein; FUNCTIONS IN: zinc
FT                   ion binding; LOCATED IN: chloroplast; EXPRESSED IN: 23
FT                   plant structures; EXPRESSED DURING: 14 growth stages;
FT                   CONTAINS InterPro DOMAIN/s: Zinc finger, RING-type,
FT                   conserved site (InterPro:IPR017907), Zinc finger, RING-type
FT                   (InterPro:IPR001841), Zinc finger, C3HC4 RING-type
FT                   (InterPro:IPR018957); BEST Arabidopsis thaliana protein
FT                   match is: RING/U-box superfamily protein
FT                   (TAIR:AT1G65040.1); Has 30201 Blast hits to 17322 proteins
FT                   in 780 species: Archae - 12; Bacteria - 1396; Metazoa -
FT                   17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other
FT                   Eukaryotes - 2996 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01960"
FT                   /db_xref="EnsemblGenomes-Tr:AT5G01960.1"
FT                   /db_xref="GOA:Q8L610"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="InterPro:IPR017907"
FT                   /db_xref="UniProtKB/TrEMBL:Q8L610"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL258898.1,INSD:DR265258.1,INSD:DR265259.1,
FT                   INSD:ES132740.1,INSD:BP602982.1,INSD:EL015073.1,
FT                   INSD:DR376177.1,INSD:EH885634.1,INSD:BP617848.1,
FT                   INSD:EL276317.1,INSD:BP798101.1,INSD:ES140842.1,
FT                   INSD:ES054192.1,INSD:BP811157.1,INSD:EH806755.1,
FT                   INSD:BP633168.1,INSD:EH891928.1,INSD:ES181425.1,
FT                   INSD:AA651156.1,INSD:BP778029.1,INSD:EL973782.1,
FT                   INSD:EL991767.1,INSD:BP671641.1,INSD:EL266887.1,
FT                   INSD:DR265260.1,INSD:ES088035.1,INSD:EL260254.1,
FT                   INSD:BP619694.1,INSD:ES022858.1,INSD:EG463064.1,
FT                   INSD:AV562969.1,INSD:DR265264.1,INSD:BP827788.1,
FT                   INSD:DR265261.1,INSD:BP610341.1,INSD:AV440114.1,
FT                   INSD:AV830898.1,INSD:ES012017.1,INSD:EH828778.1,
FT                   INSD:CD530902.1,INSD:DR265262.1,INSD:BP866120.2,
FT                   INSD:EH862623.1,INSD:BP623208.1,INSD:AV809752.1,
FT                   INSD:EL971150.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AY087766.1,INSD:BX832142.1,INSD:AY099711.1,
FT                   INSD:BX831206.1,INSD:BX832766.1,INSD:BT000282.1"
FT                   /protein_id="AED90414.1"
FT   gene            complement(372905..375154)
FT                   /gene_synonym="T7H20.20"
FT                   /gene_synonym="T7H20_20"
FT                   /locus_tag="AT5G01970"
FT   mRNA            complement(join(372905..373319,373401..373568,
FT                   373660..373863,373942..374067,374166..374270,
FT                   374505..375154))
FT                   /gene_synonym="T7H20.20"
FT                   /gene_synonym="T7H20_20"
FT                   /locus_tag="AT5G01970"
FT                   /product="heat-inducible transcription repressor"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES148234.1,INSD:ES088521.1,INSD:DR364977.1,
FT                   INSD:BP602982.1,INSD:AV813758.1,INSD:BP852438.1,
FT                   INSD:DR376177.1,INSD:EL993490.1,INSD:EH885634.1,
FT                   INSD:BP617848.1,INSD:EL261050.1,INSD:BP610341.1,
FT                   INSD:BP854911.1,INSD:BP633168.1,INSD:AV440114.1,
FT                   INSD:ES216087.1,INSD:ES060403.1,INSD:ES199462.1,
FT                   INSD:AA651156.1,INSD:BP671641.1,INSD:EH862623.1,
FT                   INSD:AV830045.1,INSD:BP854344.1,INSD:AV809752.1,
FT                   INSD:AV535704.1,INSD:BP619694.1,INSD:BP808597.1,
FT                   INSD:EL052097.1,INSD:ES048200.1,INSD:DR384098.1,
FT                   INSD:EG463064.1,INSD:EL031229.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832073.1,INSD:AY072408.1,INSD:BT000237.1"
FT   mRNA            complement(join(373014..373319,373401..373568,
FT                   373660..373863,373942..374067,374166..374954))
FT                   /gene_synonym="T7H20.20"
FT                   /gene_synonym="T7H20_20"
FT                   /locus_tag="AT5G01970"
FT                   /product="heat-inducible transcription repressor"
FT   CDS_pept        complement(join(373014..373319,373401..373568,
FT                   373660..373863,373942..374067,374166..374270,
FT                   374505..374651))
FT                   /codon_start=1
FT                   /gene_synonym="T7H20.20"
FT                   /gene_synonym="T7H20_20"
FT                   /locus_tag="AT5G01970"
FT                   /product="heat-inducible transcription repressor"
FT                   /note="unknown protein; BEST Arabidopsis thaliana protein
FT                   match is: unknown protein (TAIR:AT1G30050.1); Has 240 Blast
FT                   hits to 236 proteins in 72 species: Archae - 0; Bacteria -
FT                   15; Metazoa - 51; Fungi - 19; Plants - 119; Viruses - 0;
FT                   Other Eukaryotes - 36 (source: NCBI BLink)."
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01970"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LZN4"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:ES148234.1,INSD:ES088521.1,INSD:DR364977.1,
FT                   INSD:BP602982.1,INSD:AV813758.1,INSD:BP852438.1,
FT                   INSD:DR376177.1,INSD:EL993490.1,INSD:EH885634.1,
FT                   INSD:BP617848.1,INSD:EL261050.1,INSD:BP610341.1,
FT                   INSD:BP854911.1,INSD:BP633168.1,INSD:AV440114.1,
FT                   INSD:ES216087.1,INSD:ES060403.1,INSD:ES199462.1,
FT                   INSD:AA651156.1,INSD:BP671641.1,INSD:EH862623.1,
FT                   INSD:AV830045.1,INSD:BP854344.1,INSD:AV809752.1,
FT                   INSD:AV535704.1,INSD:BP619694.1,INSD:BP808597.1,
FT                   INSD:EL052097.1,INSD:ES048200.1,INSD:DR384098.1,
FT                   INSD:EG463064.1,INSD:EL031229.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832073.1,INSD:AY072408.1,INSD:BT000237.1"
FT                   /protein_id="AED90415.1"
FT                   SSVCASVVSVS"
FT   CDS_pept        complement(join(373014..373319,373401..373568,
FT                   373660..373863,373942..374028))
FT                   /codon_start=1
FT                   /gene_synonym="T7H20.20"
FT                   /gene_synonym="T7H20_20"
FT                   /locus_tag="AT5G01970"
FT                   /product="heat-inducible transcription repressor"
FT                   /db_xref="EnsemblGenomes-Gn:AT5G01970"
FT                   /db_xref="UniProtKB/TrEMBL:A0A1P8BB54"
FT                   /protein_id="ANM68812.1"
FT   gene            375208..377603
FT                   /gene_synonym="T7H20.30"
FT                   /gene_synonym="T7H20_30"
FT                   /locus_tag="AT5G01980"
FT   mRNA            join(375208..375388,375515..377603)
FT                   /gene_synonym="T7H20.30"
FT                   /gene_synonym="T7H20_30"
FT                   /locus_tag="AT5G01980"
FT                   /product="RING/U-box superfamily protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR260584.1,INSD:AV441319.1,INSD:AV551469.1,
FT                   INSD:DR260581.1,INSD:EL277240.1,INSD:BG459143.1,
FT                   INSD:EH878080.1,INSD:EH984701.1,INSD:DR380969.1,
FT                   INSD:ES010506.1,INSD:DR260579.1,INSD:DR260585.1,
FT                   INSD:AV562413.1,INSD:ES024013.1,INSD:CA781575.1,
FT                   INSD:EH959271.1,INSD:DR260582.1,INSD:EH802410.1,
FT                   INSD:DR260580.1,INSD:EH991196.1,INSD:BP807909.1,
FT                   INSD:ES021913.1,INSD:BP850946.1,INSD:EH826893.1,
FT                   INSD:EH877176.1,INSD:DR260583.1,INSD:EL264037.1,
FT                   INSD:EL985971.1,INSD:AV539111.1,INSD:AV442150.1,
FT                   INSD:DR242098.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK230335.1,INSD:BX832272.1,INSD:BT029027.1,
FT                   INSD:BX831675.1,INSD:AK176418.1,INSD:BT021990.1,
FT                   INSD:BX832364.1"
FT   CDS_pept        375542..377023
FT                   /codon_start=1
FT                   /gene_synonym="T7H20.30"
FT                   /gene_synonym="T7H20_30"
FT                   /locus_tag="AT5G01980"
FT                   /product="RING/U-box superfamily protein"
FT                   /note="RING/U-box superfamily protein; FUNCTIONS IN: zinc
FT                   ion binding; EXPRESSED IN: 22 plant structures; EXPRESSED
FT                   DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Zinc
FT                   finger, RING-type (InterPro:IPR001841), Zinc finger, C3HC4
FT                   RING-type (InterPro:IPR018957); BEST Arabidopsis thaliana
FT                   protein match is: RING/U-box superfamily protein
FT                   (TAIR:AT5G08139.1); Has 7827 Blast hits to 7813 proteins in
FT                   270 species: Archae - 0; Bacteria - 9; Metazoa - 2445;
FT                   Fungi - 565; Plants - 3731; Viruses - 72; Other Eukaryotes
FT                   - 1005 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZN3"
FT                   /db_xref="InterPro:IPR001841"
FT                   /db_xref="InterPro:IPR013083"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LZN3"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:DR260584.1,INSD:AV441319.1,INSD:AV551469.1,
FT                   INSD:DR260581.1,INSD:EL277240.1,INSD:BG459143.1,
FT                   INSD:EH878080.1,INSD:EH984701.1,INSD:DR380969.1,
FT                   INSD:ES010506.1,INSD:DR260579.1,INSD:DR260585.1,
FT                   INSD:AV562413.1,INSD:ES024013.1,INSD:CA781575.1,
FT                   INSD:EH959271.1,INSD:DR260582.1,INSD:EH802410.1,
FT                   INSD:DR260580.1,INSD:EH991196.1,INSD:BP807909.1,
FT                   INSD:ES021913.1,INSD:BP850946.1,INSD:EH826893.1,
FT                   INSD:EH877176.1,INSD:DR260583.1,INSD:EL264037.1,
FT                   INSD:EL985971.1,INSD:AV539111.1,INSD:AV442150.1,
FT                   INSD:DR242098.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:AK230335.1,INSD:BX832272.1,INSD:BT029027.1,
FT                   INSD:BX831675.1,INSD:AK176418.1,INSD:BT021990.1,
FT                   INSD:BX832364.1"
FT                   /protein_id="AED90416.1"
FT   gene            complement(377231..379911)
FT                   /gene_synonym="T7H20.40"
FT                   /gene_synonym="T7H20_40"
FT                   /gene_synonym="PILS6"
FT                   /gene_synonym="PIN-LIKES 6"
FT                   /locus_tag="AT5G01990"
FT   mRNA            complement(join(377231..377683,377775..377827,
FT                   377907..378007,378121..378195,378298..378528,
FT                   378830..378951,379029..379153,379232..379311,
FT                   379403..379911))
FT                   /gene_synonym="T7H20.40"
FT                   /gene_synonym="T7H20_40"
FT                   /gene_synonym="PILS6"
FT                   /gene_synonym="PIN-LIKES 6"
FT                   /locus_tag="AT5G01990"
FT                   /product="Auxin efflux carrier family protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL283049.1,INSD:ES072120.1,INSD:ES036133.1,
FT                   INSD:BP846668.1,INSD:BP588778.1,INSD:EL024781.1,
FT                   INSD:AU036570.1,INSD:ES021913.1,INSD:AU231077.1,
FT                   INSD:EH868614.1,INSD:ES135887.1,INSD:AU236480.1,
FT                   INSD:AU227410.1,INSD:BP842377.1,INSD:EL997047.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832768.1,INSD:BX832718.1,INSD:BT002925.1,
FT                   INSD:BX829574.1,INSD:BX829737.1"
FT   CDS_pept        complement(join(377373..377683,377775..377827,
FT                   377907..378007,378121..378195,378298..378528,
FT                   378830..378951,379029..379153,379232..379311,
FT                   379403..379600))
FT                   /codon_start=1
FT                   /gene_synonym="T7H20.40"
FT                   /gene_synonym="T7H20_40"
FT                   /gene_synonym="PILS6"
FT                   /gene_synonym="PIN-LIKES 6"
FT                   /locus_tag="AT5G01990"
FT                   /product="Auxin efflux carrier family protein"
FT                   /note="Auxin efflux carrier family protein; FUNCTIONS IN:
FT                   auxin:hydrogen symporter activity; INVOLVED IN: auxin polar
FT                   transport, transmembrane transport; LOCATED IN: integral to
FT                   membrane; EXPRESSED IN: 23 plant structures; EXPRESSED
FT                   DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Auxin
FT                   efflux carrier (InterPro:IPR004776); BEST Arabidopsis
FT                   thaliana protein match is: Auxin efflux carrier family
FT                   protein (TAIR:AT1G71090.1); Has 514 Blast hits to 486
FT                   proteins in 113 species: Archae - 2; Bacteria - 6; Metazoa
FT                   - 0; Fungi - 225; Plants - 217; Viruses - 0; Other
FT                   Eukaryotes - 64 (source: NCBI BLink)."
FT                   /db_xref="GOA:Q9LZN2"
FT                   /db_xref="InterPro:IPR004776"
FT                   /db_xref="InterPro:IPR039305"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LZN2"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EL283049.1,INSD:ES072120.1,INSD:ES036133.1,
FT                   INSD:BP846668.1,INSD:BP588778.1,INSD:EL024781.1,
FT                   INSD:AU036570.1,INSD:ES021913.1,INSD:AU231077.1,
FT                   INSD:EH868614.1,INSD:ES135887.1,INSD:AU236480.1,
FT                   INSD:AU227410.1,INSD:BP842377.1,INSD:EL997047.1"
FT                   /inference="similar to RNA sequence,
FT                   mRNA:INSD:BX832768.1,INSD:BX832718.1,INSD:BT002925.1,
FT                   INSD:BX829574.1,INSD:BX829737.1"
FT                   /protein_id="AED90417.1"
FT   gene            complement(379925..380629)
FT                   /gene_synonym="T7H20.50"
FT                   /gene_synonym="T7H20_50"
FT                   /locus_tag="AT5G02000"
FT   mRNA            complement(379925..380629)
FT                   /gene_synonym="T7H20.50"
FT                   /gene_synonym="T7H20_50"
FT                   /locus_tag="AT5G02000"
FT                   /product="hypothetical protein"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG485119.1,INSD:EG484864.1,INSD:EG485030.1,
FT                   INSD:EG484964.1,INSD:EG484820.1,INSD:EG486656.1,
FT                   INSD:EG485042.1,INSD:EG486657.1,INSD:EG484975.1,
FT                   INSD:EG485097.1,INSD:EG486658.1,INSD:EG484875.1,
FT                   INSD:EG486659.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:DQ132718.1"
FT   CDS_pept        complement(380155..380595)
FT                   /codon_start=1
FT                   /gene_synonym="T7H20.50"
FT                   /gene_synonym="T7H20_50"
FT                   /locus_tag="AT5G02000"
FT                   /product="hypothetical protein"
FT                   /note="unknown protein; Has 5 Blast hits to 5 proteins in 2
FT                   species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0;
FT                   Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI
FT                   BLink)."
FT                   /db_xref="GOA:Q9LZN1"
FT                   /db_xref="UniProtKB/TrEMBL:Q9LZN1"
FT                   /inference="similar to RNA sequence,
FT                   EST:INSD:EG485119.1,INSD:EG484864.1,INSD:EG485030.1,
FT                   INSD:EG484964.1,INSD:EG484820.1,INSD:EG486656.1,
FT                   INSD:EG485042.1,INSD:EG486657.1,INSD:EG484975.1,
FT                   INSD:EG485097.1,INSD:EG486658.1,INSD:EG484875.1,
FT                   INSD:EG486659.1"
FT                   /inference="similar to RNA sequence, mRNA:INSD:DQ132718.1"
FT                   /protein_id="AED90418.1"
FT   gene            383153..385910
FT                   /gene="ROPGEF7"
FT                   /gene_synonym="ATROPGEF7"
FT                   /gene_s