(data stored in ACNUC8465 zone)

EMBL: DQ652874

ID   DQ652874; SV 1; linear; mRNA; STD; PLN; 918 BP.
AC   DQ652874;
DT   04-NOV-2006 (Rel. 89, Created)
DT   04-NOV-2006 (Rel. 89, Last updated, Version 1)
DE   Arabidopsis thaliana clone 0000012393_0000008947 unknown mRNA.
KW   .
OS   Arabidopsis thaliana (thale cress)
OC   Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
OC   Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae;
OC   rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis.
RN   [1]
RP   1-918
RA   Underwood B.A., Vanderhaeghen R., Whitford R., Town C.D., Hilson P.;
RT   "Simultaneous high-throughput recombinational cloning of open reading
RT   frames in closed and open configurations";
RL   Unpublished.
RN   [2]
RP   1-918
RA   Underwood B.A., Xiao Y., Moskal W., Monaghan E., Wang W., Redman J.,
RA   Wu H.C., Utterback T., Town C.D.;
RT   ;
RL   Submitted (18-MAY-2006) to the INSDC.
RL   Plant Genomics, The Institute for Genomic Research, 9712 Medical Center
RL   Drive, Rockville, MD 20850, USA
DR   MD5; f98e13587ecb1395b29a8e6903b72128.
CC   This clone is in the Gateway(TM) pENTR221 recombination vector and
CC   has been donated to the Arabidopsis Biological Resource Center.
CC   Shine-Dalgarno and Kozak consensus sequences for protein expression
CC   are included between the attL1 site and the start codon. The CDS
CC   was cloned without the stop codon. The last codon of the CDS is
CC   followed by a linker sequence and the attL2 site
CC   (GGATCCGGAGGCGGTGACCCAGCTTTCTTG - attL2). Locus assignment based on
CC   TIGR Annotation 01-21-2004.
FH   Key             Location/Qualifiers
FT   source          1..918
FT                   /organism="Arabidopsis thaliana"
FT                   /ecotype="Columbia"
FT                   /mol_type="mRNA"
FT                   /clone="0000012393_0000008947"
FT                   /db_xref="taxon:3702"
FT   CDS_pept        1..>918
FT                   /codon_start=1
FT                   /product="unknown"
FT                   /db_xref="GOA:Q9LQM8"
FT                   /db_xref="InterPro:IPR000719"
FT                   /db_xref="InterPro:IPR008271"
FT                   /db_xref="InterPro:IPR011009"
FT                   /db_xref="InterPro:IPR017441"
FT                   /db_xref="UniProtKB/Swiss-Prot:Q9LQM8"
FT                   /protein_id="ABK28427.1"
SQ   Sequence 918 BP; 258 A; 180 C; 228 G; 252 T; 0 other;
     atgacacttg ttagagaacg acgtcaccaa gaacctctca cactctctat tccaccactt        60
     atttaccacg gcaccgcctt ctccgtggca tcttcttcat cgtcaagccc tgaaacatcg       120
     ccgattcaaa ccttaaacga tctcgagaaa ctctccgttt taggacaagg aagcggtggg       180
     acagtctaca aaacccgtca ccggagaacc aaaacgcttt acgccttaaa agtcctccgg       240
     ccaaatctca acaccacggt caccgtcgaa gccgacatcc tcaagcgaat cgaatcgagt       300
     tttatcatta aatgctatgc cgtttttgtt agtttatacg atctctgttt cgtgatggag       360
     cttatggaga aaggatctct ccatgacgcg ttacttgctc aacaagtttt ctccgagcca       420
     atggtatcga gtctcgctaa cagaatcctc caagggttac gttatctgca aaaaatggga       480
     atagttcatg gagacataaa gccttcaaat ctccttatta ataagaaagg agaggtcaag       540
     attgcggatt ttggagcaag taggatagta gccggaggag actatggatc gaatgggaca       600
     tgtgcttata tgagtcctga acgtgtagat ctagagaaat ggggttttgg aggagaagtt       660
     ggatttgcag gagatgtgtg gtcattagga gttgtggttc ttgagtgtta cattggaaga       720
     tatccattga ccaaagttgg ggataaaccg gattgggcga cattattttg tgcaatttgc       780
     tgcaatgaga aggtggatat tccagtgagt tgttcgttgg agtttagaga ttttgttggg       840
     agatgtttgg agaaggattg gaggaagaga gacactgtgg aagagcttct tcgtcattct       900
     tttgtgaaaa acagagga                                                     918

If you have problems or comments...

PBIL Back to PBIL home page