(data stored in ACNUC18020 zone)

EMBL: EU931581

ID   EU931581; SV 1; linear; mRNA; STD; VRT; 273 BP.
AC   EU931581;
DT   04-SEP-2008 (Rel. 97, Created)
DT   04-SEP-2008 (Rel. 97, Last updated, Version 1)
DE   Gallus gallus clone ChBact1 beta-actin mRNA, partial cds.
KW   .
OS   Gallus gallus (chicken)
OC   Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
OC   Archelosauria; Archosauria; Dinosauria; Saurischia; Theropoda;
OC   Coelurosauria; Aves; Neognathae; Galloanserae; Galliformes; Phasianidae;
OC   Phasianinae; Gallus.
RN   [1]
RP   1-273
RA   Bera A.K., Pan D., Das S., Rana T., Dey S., Bhattacharya D., Manna B.,
RA   Das S.K.;
RT   "Sequence information of beta actin mRNA from splenocytes of broiler
RT   chicken";
RL   Unpublished.
RN   [2]
RP   1-273
RA   Bera A.K., Pan D., Das S., Rana T., Dey S., Bhattacharya D., Manna B.,
RA   Das S.K.;
RT   ;
RL   Submitted (31-JUL-2008) to the INSDC.
RL   Eastern Regional Station, Indian Veterinary Research Institute, 37,
RL   Belgachia Road, Kolkata, West Bengal 700037, India
DR   MD5; 531872765c874412fb89e075a249ebd6.
DR   EuropePMC; PMC3315791; 21401953.
FH   Key             Location/Qualifiers
FT   source          1..273
FT                   /organism="Gallus gallus"
FT                   /mol_type="mRNA"
FT                   /clone="ChBact1"
FT                   /PCR_primers="fwd_name: DP3, fwd_seq:
FT                   atgtgcaaggccggtttcgccgggga, rev_name: DP4, rev_seq:
FT                   tgtgagcagcacagggtgctcctcag"
FT                   /db_xref="taxon:9031"
FT   CDS_pept        <1..>273
FT                   /codon_start=1
FT                   /product="beta-actin"
FT                   /db_xref="InterPro:IPR004000"
FT                   /db_xref="InterPro:IPR004001"
FT                   /db_xref="UniProtKB/TrEMBL:B5M200"
FT                   /protein_id="ACH68557.1"
SQ   Sequence 273 BP; 65 A; 71 C; 79 G; 58 T; 0 other;
     atgtgcaagg ccggtttcgc cggggacgat gccccccgtg ctgtgttccc atctatcgtg        60
     ggtcgcccca gacatcaggg tgtgatggtt ggtatgggcc agaaagacag ctacgttggt       120
     gatgaagccc agagcaaaag aggtatcctg accctgaagt accccattga acacggtatt       180
     gtcaccaact gggatgatat ggagaagatc tggcaccaca ctttctacaa tgagctgaga       240
     gtagcccctg aggagcaccc tgtgctgctc aca                                    273

If you have problems or comments...

PBIL Back to PBIL home page