(data stored in ACNUC7421 zone)

EMBL: FN666575

ID   FN666575; SV 1; circular; genomic DNA; STD; PRO; 3805874 BP.
AC   FN666575;
PR   Project:PRJEA43757;
DT   19-MAR-2010 (Rel. 104, Created)
DT   04-FEB-2016 (Rel. 127, Last updated, Version 4)
DE   Erwinia amylovora ATCC 49946 chromosomal sequence.
KW   complete genome.
OS   Erwinia amylovora ATCC 49946
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacterales;
OC   Erwiniaceae; Erwinia.
OS   unidentified phage
OC   Viruses; unclassified bacterial viruses.
RN   [1]
RP   1-3805874
RA   Aslett M.A.;
RT   ;
RL   Submitted (02-FEB-2010) to the INSDC.
RL   Aslett M.A., Wellcome Trust Sanger Institute, Pathogen Sequencing Unit,
RL   Wellcome Trust Genome Campus, Hinxton, Cambridge, Cambridgeshire. CB10 1SA,
RN   [2]
RX   DOI; 10.1128/JB.00022-10.
RX   PUBMED; 20118253.
RA   Sebaihia M., Bocsanczy A.M., Biehl B.S., Quail M.A., Perna N.T.,
RA   Glasner J.D., Declerck G.A., Cartinhour S., Schneider D.J., Bentley S.D.,
RA   Parkhill J., Beer S.V.;
RT   "Complete genome sequence of the plant pathogen Erwinia amylovora strain
RT   ATCC 49946";
RL   J. Bacteriol. 192(7):2020-2021(2010).
DR   MD5; 970dc24a60903aa1853c43759a92898f.
DR   BioSample; SAMEA2272701.
DR   EnsemblGenomes-Gn; EAM_0023.
DR   EnsemblGenomes-Gn; EAM_0052.
DR   EnsemblGenomes-Gn; EAM_0284.
DR   EnsemblGenomes-Gn; EAM_0285.
DR   EnsemblGenomes-Gn; EAM_0290.
DR   EnsemblGenomes-Gn; EAM_0291.
DR   EnsemblGenomes-Gn; EAM_0297.
DR   EnsemblGenomes-Gn; EAM_0310.
DR   EnsemblGenomes-Gn; EAM_0400.
DR   EnsemblGenomes-Gn; EAM_0442.
DR   EnsemblGenomes-Gn; EAM_0534.
DR   EnsemblGenomes-Gn; EAM_0562.
DR   EnsemblGenomes-Gn; EAM_0605.
DR   EnsemblGenomes-Gn; EAM_0805.
DR   EnsemblGenomes-Gn; EAM_0852.
DR   EnsemblGenomes-Gn; EAM_1052.
DR   EnsemblGenomes-Gn; EAM_1110.
DR   EnsemblGenomes-Gn; EAM_1264.
DR   EnsemblGenomes-Gn; EAM_1334.
DR   EnsemblGenomes-Gn; EAM_1383.
DR   EnsemblGenomes-Gn; EAM_1531.
DR   EnsemblGenomes-Gn; EAM_1535.
DR   EnsemblGenomes-Gn; EAM_1553.
DR   EnsemblGenomes-Gn; EAM_1643.
DR   EnsemblGenomes-Gn; EAM_1671.
DR   EnsemblGenomes-Gn; EAM_1682.
DR   EnsemblGenomes-Gn; EAM_1773.
DR   EnsemblGenomes-Gn; EAM_1830.
DR   EnsemblGenomes-Gn; EAM_1900.
DR   EnsemblGenomes-Gn; EAM_2054.
DR   EnsemblGenomes-Gn; EAM_2063.
DR   EnsemblGenomes-Gn; EAM_2107.
DR   EnsemblGenomes-Gn; EAM_2188.
DR   EnsemblGenomes-Gn; EAM_2241.
DR   EnsemblGenomes-Gn; EAM_2255.
DR   EnsemblGenomes-Gn; EAM_2278.
DR   EnsemblGenomes-Gn; EAM_2458.
DR   EnsemblGenomes-Gn; EAM_2463.
DR   EnsemblGenomes-Gn; EAM_2509.
DR   EnsemblGenomes-Gn; EAM_2523.
DR   EnsemblGenomes-Gn; EAM_2534.
DR   EnsemblGenomes-Gn; EAM_2622.
DR   EnsemblGenomes-Gn; EAM_2623.
DR   EnsemblGenomes-Gn; EAM_2748.
DR   EnsemblGenomes-Gn; EAM_2802.
DR   EnsemblGenomes-Gn; EAM_2889.
DR   EnsemblGenomes-Gn; EAM_2939.
DR   EnsemblGenomes-Gn; EAM_3023.
DR   EnsemblGenomes-Gn; EAM_3027.
DR   EnsemblGenomes-Gn; EAM_3062.
DR   EnsemblGenomes-Gn; EAM_3148.
DR   EnsemblGenomes-Gn; EAM_3231.
DR   EnsemblGenomes-Gn; EAM_3321.
DR   EnsemblGenomes-Gn; EAM_3345.
DR   EnsemblGenomes-Gn; EAM_3354.
DR   EnsemblGenomes-Gn; EAM_3369.
DR   EnsemblGenomes-Gn; EAM_3404.
DR   EnsemblGenomes-Gn; EAM_3407.
DR   EnsemblGenomes-Gn; EAM_r001.
DR   EnsemblGenomes-Gn; EAM_r002.
DR   EnsemblGenomes-Gn; EAM_r003.
DR   EnsemblGenomes-Gn; EAM_r004.
DR   EnsemblGenomes-Gn; EAM_r005.
DR   EnsemblGenomes-Gn; EAM_r006.
DR   EnsemblGenomes-Gn; EAM_r007.
DR   EnsemblGenomes-Gn; EAM_r008.
DR   EnsemblGenomes-Gn; EAM_r009.
DR   EnsemblGenomes-Gn; EAM_r010.
DR   EnsemblGenomes-Gn; EAM_r011.
DR   EnsemblGenomes-Gn; EAM_r012.
DR   EnsemblGenomes-Gn; EAM_r013.
DR   EnsemblGenomes-Gn; EAM_r014.
DR   EnsemblGenomes-Gn; EAM_r015.
DR   EnsemblGenomes-Gn; EAM_r016.
DR   EnsemblGenomes-Gn; EAM_r017.
DR   EnsemblGenomes-Gn; EAM_r018.
DR   EnsemblGenomes-Gn; EAM_r019.
DR   EnsemblGenomes-Gn; EAM_r020.
DR   EnsemblGenomes-Gn; EAM_r021.
DR   EnsemblGenomes-Gn; EAM_r022.
DR   EnsemblGenomes-Gn; EAM_t001.
DR   EnsemblGenomes-Gn; EAM_t002.
DR   EnsemblGenomes-Gn; EAM_t003.
DR   EnsemblGenomes-Gn; EAM_t004.
DR   EnsemblGenomes-Gn; EAM_t005.
DR   EnsemblGenomes-Gn; EAM_t006.
DR   EnsemblGenomes-Gn; EAM_t007.
DR   EnsemblGenomes-Gn; EAM_t008.
DR   EnsemblGenomes-Gn; EAM_t009.
DR   EnsemblGenomes-Gn; EAM_t010.
DR   EnsemblGenomes-Gn; EAM_t011.
DR   EnsemblGenomes-Gn; EAM_t012.
DR   EnsemblGenomes-Gn; EAM_t013.
DR   EnsemblGenomes-Gn; EAM_t014.
DR   EnsemblGenomes-Gn; EAM_t015.
DR   EnsemblGenomes-Gn; EAM_t016.
DR   EnsemblGenomes-Gn; EAM_t017.
DR   EnsemblGenomes-Gn; EAM_t018.
DR   EnsemblGenomes-Gn; EAM_t019.
DR   EnsemblGenomes-Gn; EAM_t020.
DR   EnsemblGenomes-Gn; EAM_t021.
DR   EnsemblGenomes-Gn; EAM_t022.
DR   EnsemblGenomes-Gn; EAM_t023.
DR   EnsemblGenomes-Gn; EAM_t024.
DR   EnsemblGenomes-Gn; EAM_t025.
DR   EnsemblGenomes-Gn; EAM_t026.
DR   EnsemblGenomes-Gn; EAM_t027.
DR   EnsemblGenomes-Gn; EAM_t028.
DR   EnsemblGenomes-Gn; EAM_t029.
DR   EnsemblGenomes-Gn; EAM_t030.
DR   EnsemblGenomes-Gn; EAM_t031.
DR   EnsemblGenomes-Gn; EAM_t032.
DR   EnsemblGenomes-Gn; EAM_t033.
DR   EnsemblGenomes-Gn; EAM_t034.
DR   EnsemblGenomes-Gn; EAM_t035.
DR   EnsemblGenomes-Gn; EAM_t036.
DR   EnsemblGenomes-Gn; EAM_t037.
DR   EnsemblGenomes-Gn; EAM_t038.
DR   EnsemblGenomes-Gn; EAM_t039.
DR   EnsemblGenomes-Gn; EAM_t040.
DR   EnsemblGenomes-Gn; EAM_t041.
DR   EnsemblGenomes-Gn; EAM_t042.
DR   EnsemblGenomes-Gn; EAM_t043.
DR   EnsemblGenomes-Gn; EAM_t044.
DR   EnsemblGenomes-Gn; EAM_t045.
DR   EnsemblGenomes-Gn; EAM_t046.
DR   EnsemblGenomes-Gn; EAM_t047.
DR   EnsemblGenomes-Gn; EAM_t048.
DR   EnsemblGenomes-Gn; EAM_t049.
DR   EnsemblGenomes-Gn; EAM_t050.
DR   EnsemblGenomes-Gn; EAM_t051.
DR   EnsemblGenomes-Gn; EAM_t052.
DR   EnsemblGenomes-Gn; EAM_t053.
DR   EnsemblGenomes-Gn; EAM_t054.
DR   EnsemblGenomes-Gn; EAM_t055.
DR   EnsemblGenomes-Gn; EAM_t056.
DR   EnsemblGenomes-Gn; EAM_t057.
DR   EnsemblGenomes-Gn; EAM_t058.
DR   EnsemblGenomes-Gn; EAM_t059.
DR   EnsemblGenomes-Gn; EAM_t060.
DR   EnsemblGenomes-Gn; EAM_t061.
DR   EnsemblGenomes-Gn; EAM_t062.
DR   EnsemblGenomes-Gn; EAM_t063.
DR   EnsemblGenomes-Gn; EAM_t064.
DR   EnsemblGenomes-Gn; EAM_t065.
DR   EnsemblGenomes-Gn; EAM_t066.
DR   EnsemblGenomes-Gn; EAM_t067.
DR   EnsemblGenomes-Gn; EAM_t068.
DR   EnsemblGenomes-Gn; EAM_t069.
DR   EnsemblGenomes-Gn; EAM_t070.
DR   EnsemblGenomes-Gn; EAM_t071.
DR   EnsemblGenomes-Gn; EAM_t072.
DR   EnsemblGenomes-Gn; EAM_t073.
DR   EnsemblGenomes-Gn; EAM_t074.
DR   EnsemblGenomes-Gn; EAM_t075.
DR   EnsemblGenomes-Gn; EAM_t076.
DR   EnsemblGenomes-Gn; EAM_t077.
DR   EnsemblGenomes-Gn; EAM_t078.
DR   EnsemblGenomes-Gn; EBG00001056697.
DR   EnsemblGenomes-Gn; EBG00001056700.
DR   EnsemblGenomes-Gn; EBG00001056701.
DR   EnsemblGenomes-Gn; EBG00001056704.
DR   EnsemblGenomes-Gn; EBG00001056705.
DR   EnsemblGenomes-Gn; EBG00001056707.
DR   EnsemblGenomes-Gn; EBG00001056709.
DR   EnsemblGenomes-Gn; EBG00001056711.
DR   EnsemblGenomes-Gn; EBG00001056713.
DR   EnsemblGenomes-Gn; EBG00001056715.
DR   EnsemblGenomes-Gn; EBG00001056717.
DR   EnsemblGenomes-Gn; EBG00001056718.
DR   EnsemblGenomes-Gn; EBG00001056719.
DR   EnsemblGenomes-Gn; EBG00001056721.
DR   EnsemblGenomes-Gn; EBG00001056724.
DR   EnsemblGenomes-Gn; EBG00001056726.
DR   EnsemblGenomes-Gn; EBG00001056728.
DR   EnsemblGenomes-Gn; EBG00001056730.
DR   EnsemblGenomes-Gn; EBG00001056733.
DR   EnsemblGenomes-Gn; EBG00001056735.
DR   EnsemblGenomes-Gn; EBG00001056737.
DR   EnsemblGenomes-Gn; EBG00001056739.
DR   EnsemblGenomes-Gn; EBG00001056741.
DR   EnsemblGenomes-Gn; EBG00001056743.
DR   EnsemblGenomes-Gn; EBG00001056745.
DR   EnsemblGenomes-Gn; EBG00001056747.
DR   EnsemblGenomes-Gn; EBG00001056749.
DR   EnsemblGenomes-Gn; EBG00001056751.
DR   EnsemblGenomes-Gn; EBG00001056752.
DR   EnsemblGenomes-Gn; EBG00001056754.
DR   EnsemblGenomes-Gn; EBG00001056757.
DR   EnsemblGenomes-Gn; EBG00001056759.
DR   EnsemblGenomes-Gn; EBG00001056761.
DR   EnsemblGenomes-Gn; EBG00001056763.
DR   EnsemblGenomes-Gn; EBG00001056765.
DR   EnsemblGenomes-Gn; EBG00001056767.
DR   EnsemblGenomes-Gn; EBG00001056769.
DR   EnsemblGenomes-Gn; EBG00001056771.
DR   EnsemblGenomes-Gn; EBG00001056773.
DR   EnsemblGenomes-Gn; EBG00001056775.
DR   EnsemblGenomes-Gn; EBG00001056777.
DR   EnsemblGenomes-Gn; EBG00001056779.
DR   EnsemblGenomes-Gn; EBG00001056781.
DR   EnsemblGenomes-Gn; EBG00001056782.
DR   EnsemblGenomes-Gn; EBG00001056784.
DR   EnsemblGenomes-Gn; EBG00001056786.
DR   EnsemblGenomes-Gn; EBG00001056788.
DR   EnsemblGenomes-Gn; EBG00001056789.
DR   EnsemblGenomes-Gn; EBG00001056791.
DR   EnsemblGenomes-Gn; EBG00001056794.
DR   EnsemblGenomes-Gn; EBG00001056796.
DR   EnsemblGenomes-Gn; EBG00001056798.
DR   EnsemblGenomes-Gn; EBG00001056801.
DR   EnsemblGenomes-Gn; EBG00001056803.
DR   EnsemblGenomes-Gn; EBG00001056805.
DR   EnsemblGenomes-Gn; EBG00001056807.
DR   EnsemblGenomes-Gn; EBG00001056809.
DR   EnsemblGenomes-Gn; EBG00001056810.
DR   EnsemblGenomes-Gn; EBG00001056811.
DR   EnsemblGenomes-Gn; EBG00001056812.
DR   EnsemblGenomes-Gn; EBG00001056813.
DR   EnsemblGenomes-Gn; EBG00001056814.
DR   EnsemblGenomes-Gn; EBG00001056815.
DR   EnsemblGenomes-Gn; EBG00001056816.
DR   EnsemblGenomes-Gn; EBG00001056817.
DR   EnsemblGenomes-Gn; EBG00001056818.
DR   EnsemblGenomes-Gn; EBG00001056819.
DR   EnsemblGenomes-Gn; EBG00001056820.
DR   EnsemblGenomes-Gn; EBG00001056821.
DR   EnsemblGenomes-Gn; EBG00001056822.
DR   EnsemblGenomes-Gn; EBG00001056823.
DR   EnsemblGenomes-Gn; EBG00001056824.
DR   EnsemblGenomes-Gn; EBG00001056825.
DR   EnsemblGenomes-Gn; EBG00001056826.
DR   EnsemblGenomes-Gn; EBG00001056827.
DR   EnsemblGenomes-Gn; EBG00001056828.
DR   EnsemblGenomes-Gn; EBG00001056829.
DR   EnsemblGenomes-Gn; EBG00001056830.
DR   EnsemblGenomes-Gn; EBG00001056831.
DR   EnsemblGenomes-Gn; EBG00001056832.
DR   EnsemblGenomes-Gn; EBG00001056833.
DR   EnsemblGenomes-Gn; EBG00001056834.
DR   EnsemblGenomes-Gn; EBG00001056835.
DR   EnsemblGenomes-Gn; EBG00001056836.
DR   EnsemblGenomes-Gn; EBG00001056837.
DR   EnsemblGenomes-Gn; EBG00001056838.
DR   EnsemblGenomes-Gn; EBG00001056839.
DR   EnsemblGenomes-Gn; EBG00001056840.
DR   EnsemblGenomes-Gn; EBG00001056841.
DR   EnsemblGenomes-Gn; EBG00001056842.
DR   EnsemblGenomes-Gn; EBG00001056843.
DR   EnsemblGenomes-Gn; EBG00001056844.
DR   EnsemblGenomes-Gn; EBG00001056845.
DR   EnsemblGenomes-Gn; EBG00001056846.
DR   EnsemblGenomes-Gn; EBG00001056847.
DR   EnsemblGenomes-Gn; EBG00001056848.
DR   EnsemblGenomes-Gn; EBG00001056849.
DR   EnsemblGenomes-Gn; EBG00001056850.
DR   EnsemblGenomes-Gn; EBG00001056851.
DR   EnsemblGenomes-Gn; EBG00001056852.
DR   EnsemblGenomes-Gn; EBG00001056853.
DR   EnsemblGenomes-Gn; EBG00001056854.
DR   EnsemblGenomes-Gn; EBG00001056855.
DR   EnsemblGenomes-Gn; EBG00001056856.
DR   EnsemblGenomes-Gn; EBG00001056857.
DR   EnsemblGenomes-Gn; EBG00001056858.
DR   EnsemblGenomes-Gn; EBG00001056859.
DR   EnsemblGenomes-Gn; EBG00001056860.
DR   EnsemblGenomes-Gn; EBG00001056861.
DR   EnsemblGenomes-Gn; EBG00001056862.
DR   EnsemblGenomes-Gn; EBG00001056863.
DR   EnsemblGenomes-Gn; EBG00001056864.
DR   EnsemblGenomes-Gn; EBG00001056865.
DR   EnsemblGenomes-Gn; EBG00001056866.
DR   EnsemblGenomes-Gn; EBG00001056867.
DR   EnsemblGenomes-Gn; EBG00001056868.
DR   EnsemblGenomes-Gn; EBG00001056869.
DR   EnsemblGenomes-Gn; EBG00001056870.
DR   EnsemblGenomes-Gn; EBG00001056871.
DR   EnsemblGenomes-Gn; EBG00001056872.
DR   EnsemblGenomes-Gn; EBG00001056873.
DR   EnsemblGenomes-Gn; EBG00001056874.
DR   EnsemblGenomes-Gn; EBG00001056875.
DR   EnsemblGenomes-Gn; EBG00001056876.
DR   EnsemblGenomes-Gn; EBG00001056877.
DR   EnsemblGenomes-Gn; EBG00001056878.
DR   EnsemblGenomes-Gn; EBG00001056879.
DR   EnsemblGenomes-Gn; EBG00001056880.
DR   EnsemblGenomes-Gn; EBG00001056881.
DR   EnsemblGenomes-Gn; EBG00001056882.
DR   EnsemblGenomes-Gn; EBG00001056883.
DR   EnsemblGenomes-Gn; EBG00001056884.
DR   EnsemblGenomes-Gn; EBG00001056885.
DR   EnsemblGenomes-Gn; EBG00001056886.
DR   EnsemblGenomes-Gn; EBG00001056887.
DR   EnsemblGenomes-Gn; EBG00001056888.
DR   EnsemblGenomes-Gn; EBG00001056889.
DR   EnsemblGenomes-Gn; EBG00001056890.
DR   EnsemblGenomes-Gn; EBG00001056891.
DR   EnsemblGenomes-Gn; EBG00001056892.
DR   EnsemblGenomes-Gn; EBG00001056893.
DR   EnsemblGenomes-Gn; EBG00001056894.
DR   EnsemblGenomes-Gn; EBG00001056895.
DR   EnsemblGenomes-Gn; EBG00001056896.
DR   EnsemblGenomes-Gn; EBG00001056897.
DR   EnsemblGenomes-Gn; EBG00001056898.
DR   EnsemblGenomes-Gn; EBG00001056899.
DR   EnsemblGenomes-Gn; EBG00001056900.
DR   EnsemblGenomes-Gn; EBG00001056901.
DR   EnsemblGenomes-Gn; EBG00001056902.
DR   EnsemblGenomes-Tr; EAM_0023.
DR   EnsemblGenomes-Tr; EAM_0052.
DR   EnsemblGenomes-Tr; EAM_0284.
DR   EnsemblGenomes-Tr; EAM_0285.
DR   EnsemblGenomes-Tr; EAM_0290.
DR   EnsemblGenomes-Tr; EAM_0291.
DR   EnsemblGenomes-Tr; EAM_0297.
DR   EnsemblGenomes-Tr; EAM_0310.
DR   EnsemblGenomes-Tr; EAM_0400.
DR   EnsemblGenomes-Tr; EAM_0442.
DR   EnsemblGenomes-Tr; EAM_0534.
DR   EnsemblGenomes-Tr; EAM_0562.
DR   EnsemblGenomes-Tr; EAM_0605.
DR   EnsemblGenomes-Tr; EAM_0805.
DR   EnsemblGenomes-Tr; EAM_0852.
DR   EnsemblGenomes-Tr; EAM_1110.
DR   EnsemblGenomes-Tr; EAM_1264.
DR   EnsemblGenomes-Tr; EAM_1383.
DR   EnsemblGenomes-Tr; EAM_1531.
DR   EnsemblGenomes-Tr; EAM_1535.
DR   EnsemblGenomes-Tr; EAM_1553.
DR   EnsemblGenomes-Tr; EAM_1643.
DR   EnsemblGenomes-Tr; EAM_1671.
DR   EnsemblGenomes-Tr; EAM_1682.
DR   EnsemblGenomes-Tr; EAM_2054.
DR   EnsemblGenomes-Tr; EAM_2063.
DR   EnsemblGenomes-Tr; EAM_2107.
DR   EnsemblGenomes-Tr; EAM_2188.
DR   EnsemblGenomes-Tr; EAM_2241.
DR   EnsemblGenomes-Tr; EAM_2255.
DR   EnsemblGenomes-Tr; EAM_2278.
DR   EnsemblGenomes-Tr; EAM_2458.
DR   EnsemblGenomes-Tr; EAM_2509.
DR   EnsemblGenomes-Tr; EAM_2622.
DR   EnsemblGenomes-Tr; EAM_2623.
DR   EnsemblGenomes-Tr; EAM_2889.
DR   EnsemblGenomes-Tr; EAM_3023.
DR   EnsemblGenomes-Tr; EAM_3027.
DR   EnsemblGenomes-Tr; EAM_3062.
DR   EnsemblGenomes-Tr; EAM_3148.
DR   EnsemblGenomes-Tr; EAM_3231.
DR   EnsemblGenomes-Tr; EAM_3321.
DR   EnsemblGenomes-Tr; EAM_3345.
DR   EnsemblGenomes-Tr; EAM_3354.
DR   EnsemblGenomes-Tr; EAM_3404.
DR   EnsemblGenomes-Tr; EAM_3407.
DR   EnsemblGenomes-Tr; EAM_r001-1.
DR   EnsemblGenomes-Tr; EAM_r002-1.
DR   EnsemblGenomes-Tr; EAM_r003-1.
DR   EnsemblGenomes-Tr; EAM_r004-1.
DR   EnsemblGenomes-Tr; EAM_r005-1.
DR   EnsemblGenomes-Tr; EAM_r006-1.
DR   EnsemblGenomes-Tr; EAM_r007-1.
DR   EnsemblGenomes-Tr; EAM_r008-1.
DR   EnsemblGenomes-Tr; EAM_r009-1.
DR   EnsemblGenomes-Tr; EAM_r010-1.
DR   EnsemblGenomes-Tr; EAM_r011-1.
DR   EnsemblGenomes-Tr; EAM_r012-1.
DR   EnsemblGenomes-Tr; EAM_r013-1.
DR   EnsemblGenomes-Tr; EAM_r014-1.
DR   EnsemblGenomes-Tr; EAM_r015-1.
DR   EnsemblGenomes-Tr; EAM_r016-1.
DR   EnsemblGenomes-Tr; EAM_r017-1.
DR   EnsemblGenomes-Tr; EAM_r018-1.
DR   EnsemblGenomes-Tr; EAM_r019-1.
DR   EnsemblGenomes-Tr; EAM_r020-1.
DR   EnsemblGenomes-Tr; EAM_r021-1.
DR   EnsemblGenomes-Tr; EAM_r022-1.
DR   EnsemblGenomes-Tr; EAM_t001-1.
DR   EnsemblGenomes-Tr; EAM_t002-1.
DR   EnsemblGenomes-Tr; EAM_t003-1.
DR   EnsemblGenomes-Tr; EAM_t004-1.
DR   EnsemblGenomes-Tr; EAM_t005-1.
DR   EnsemblGenomes-Tr; EAM_t006-1.
DR   EnsemblGenomes-Tr; EAM_t007-1.
DR   EnsemblGenomes-Tr; EAM_t008-1.
DR   EnsemblGenomes-Tr; EAM_t009-1.
DR   EnsemblGenomes-Tr; EAM_t010-1.
DR   EnsemblGenomes-Tr; EAM_t011-1.
DR   EnsemblGenomes-Tr; EAM_t012-1.
DR   EnsemblGenomes-Tr; EAM_t013-1.
DR   EnsemblGenomes-Tr; EAM_t014-1.
DR   EnsemblGenomes-Tr; EAM_t015-1.
DR   EnsemblGenomes-Tr; EAM_t016-1.
DR   EnsemblGenomes-Tr; EAM_t017-1.
DR   EnsemblGenomes-Tr; EAM_t018-1.
DR   EnsemblGenomes-Tr; EAM_t019-1.
DR   EnsemblGenomes-Tr; EAM_t020-1.
DR   EnsemblGenomes-Tr; EAM_t021-1.
DR   EnsemblGenomes-Tr; EAM_t022-1.
DR   EnsemblGenomes-Tr; EAM_t023-1.
DR   EnsemblGenomes-Tr; EAM_t024-1.
DR   EnsemblGenomes-Tr; EAM_t025-1.
DR   EnsemblGenomes-Tr; EAM_t026-1.
DR   EnsemblGenomes-Tr; EAM_t027-1.
DR   EnsemblGenomes-Tr; EAM_t028-1.
DR   EnsemblGenomes-Tr; EAM_t029-1.
DR   EnsemblGenomes-Tr; EAM_t030-1.
DR   EnsemblGenomes-Tr; EAM_t031-1.
DR   EnsemblGenomes-Tr; EAM_t032-1.
DR   EnsemblGenomes-Tr; EAM_t033-1.
DR   EnsemblGenomes-Tr; EAM_t034-1.
DR   EnsemblGenomes-Tr; EAM_t035-1.
DR   EnsemblGenomes-Tr; EAM_t036-1.
DR   EnsemblGenomes-Tr; EAM_t037-1.
DR   EnsemblGenomes-Tr; EAM_t038-1.
DR   EnsemblGenomes-Tr; EAM_t039-1.
DR   EnsemblGenomes-Tr; EAM_t040-1.
DR   EnsemblGenomes-Tr; EAM_t041-1.
DR   EnsemblGenomes-Tr; EAM_t042-1.
DR   EnsemblGenomes-Tr; EAM_t043-1.
DR   EnsemblGenomes-Tr; EAM_t044-1.
DR   EnsemblGenomes-Tr; EAM_t045-1.
DR   EnsemblGenomes-Tr; EAM_t046-1.
DR   EnsemblGenomes-Tr; EAM_t047-1.
DR   EnsemblGenomes-Tr; EAM_t048-1.
DR   EnsemblGenomes-Tr; EAM_t049-1.
DR   EnsemblGenomes-Tr; EAM_t050-1.
DR   EnsemblGenomes-Tr; EAM_t051-1.
DR   EnsemblGenomes-Tr; EAM_t052-1.
DR   EnsemblGenomes-Tr; EAM_t053-1.
DR   EnsemblGenomes-Tr; EAM_t054-1.
DR   EnsemblGenomes-Tr; EAM_t055-1.
DR   EnsemblGenomes-Tr; EAM_t056-1.
DR   EnsemblGenomes-Tr; EAM_t057-1.
DR   EnsemblGenomes-Tr; EAM_t058-1.
DR   EnsemblGenomes-Tr; EAM_t059-1.
DR   EnsemblGenomes-Tr; EAM_t060-1.
DR   EnsemblGenomes-Tr; EAM_t061-1.
DR   EnsemblGenomes-Tr; EAM_t062-1.
DR   EnsemblGenomes-Tr; EAM_t063-1.
DR   EnsemblGenomes-Tr; EAM_t064-1.
DR   EnsemblGenomes-Tr; EAM_t065-1.
DR   EnsemblGenomes-Tr; EAM_t066-1.
DR   EnsemblGenomes-Tr; EAM_t067-1.
DR   EnsemblGenomes-Tr; EAM_t068-1.
DR   EnsemblGenomes-Tr; EAM_t069-1.
DR   EnsemblGenomes-Tr; EAM_t070-1.
DR   EnsemblGenomes-Tr; EAM_t071-1.
DR   EnsemblGenomes-Tr; EAM_t072-1.
DR   EnsemblGenomes-Tr; EAM_t073-1.
DR   EnsemblGenomes-Tr; EAM_t074-1.
DR   EnsemblGenomes-Tr; EAM_t075-1.
DR   EnsemblGenomes-Tr; EAM_t076-1.
DR   EnsemblGenomes-Tr; EAM_t077-1.
DR   EnsemblGenomes-Tr; EAM_t078-1.
DR   EnsemblGenomes-Tr; EBT00001659588.
DR   EnsemblGenomes-Tr; EBT00001659589.
DR   EnsemblGenomes-Tr; EBT00001659590.
DR   EnsemblGenomes-Tr; EBT00001659591.
DR   EnsemblGenomes-Tr; EBT00001659592.
DR   EnsemblGenomes-Tr; EBT00001659593.
DR   EnsemblGenomes-Tr; EBT00001659594.
DR   EnsemblGenomes-Tr; EBT00001659595.
DR   EnsemblGenomes-Tr; EBT00001659596.
DR   EnsemblGenomes-Tr; EBT00001659597.
DR   EnsemblGenomes-Tr; EBT00001659598.
DR   EnsemblGenomes-Tr; EBT00001659599.
DR   EnsemblGenomes-Tr; EBT00001659600.
DR   EnsemblGenomes-Tr; EBT00001659601.
DR   EnsemblGenomes-Tr; EBT00001659602.
DR   EnsemblGenomes-Tr; EBT00001659603.
DR   EnsemblGenomes-Tr; EBT00001659604.
DR   EnsemblGenomes-Tr; EBT00001659605.
DR   EnsemblGenomes-Tr; EBT00001659606.
DR   EnsemblGenomes-Tr; EBT00001659607.
DR   EnsemblGenomes-Tr; EBT00001659608.
DR   EnsemblGenomes-Tr; EBT00001659609.
DR   EnsemblGenomes-Tr; EBT00001659610.
DR   EnsemblGenomes-Tr; EBT00001659611.
DR   EnsemblGenomes-Tr; EBT00001659612.
DR   EnsemblGenomes-Tr; EBT00001659613.
DR   EnsemblGenomes-Tr; EBT00001659614.
DR   EnsemblGenomes-Tr; EBT00001659615.
DR   EnsemblGenomes-Tr; EBT00001659616.
DR   EnsemblGenomes-Tr; EBT00001659617.
DR   EnsemblGenomes-Tr; EBT00001659618.
DR   EnsemblGenomes-Tr; EBT00001659619.
DR   EnsemblGenomes-Tr; EBT00001659620.
DR   EnsemblGenomes-Tr; EBT00001659621.
DR   EnsemblGenomes-Tr; EBT00001659622.
DR   EnsemblGenomes-Tr; EBT00001659623.
DR   EnsemblGenomes-Tr; EBT00001659624.
DR   EnsemblGenomes-Tr; EBT00001659625.
DR   EnsemblGenomes-Tr; EBT00001659626.
DR   EnsemblGenomes-Tr; EBT00001659627.
DR   EnsemblGenomes-Tr; EBT00001659628.
DR   EnsemblGenomes-Tr; EBT00001659629.
DR   EnsemblGenomes-Tr; EBT00001659630.
DR   EnsemblGenomes-Tr; EBT00001659631.
DR   EnsemblGenomes-Tr; EBT00001659632.
DR   EnsemblGenomes-Tr; EBT00001659633.
DR   EnsemblGenomes-Tr; EBT00001659634.
DR   EnsemblGenomes-Tr; EBT00001659635.
DR   EnsemblGenomes-Tr; EBT00001659636.
DR   EnsemblGenomes-Tr; EBT00001659637.
DR   EnsemblGenomes-Tr; EBT00001659638.
DR   EnsemblGenomes-Tr; EBT00001659639.
DR   EnsemblGenomes-Tr; EBT00001659640.
DR   EnsemblGenomes-Tr; EBT00001659641.
DR   EnsemblGenomes-Tr; EBT00001659642.
DR   EnsemblGenomes-Tr; EBT00001659643.
DR   EnsemblGenomes-Tr; EBT00001659644.
DR   EnsemblGenomes-Tr; EBT00001659645.
DR   EnsemblGenomes-Tr; EBT00001659646.
DR   EnsemblGenomes-Tr; EBT00001659647.
DR   EnsemblGenomes-Tr; EBT00001659648.
DR   EnsemblGenomes-Tr; EBT00001659649.
DR   EnsemblGenomes-Tr; EBT00001659650.
DR   EnsemblGenomes-Tr; EBT00001659651.
DR   EnsemblGenomes-Tr; EBT00001659652.
DR   EnsemblGenomes-Tr; EBT00001659653.
DR   EnsemblGenomes-Tr; EBT00001659654.
DR   EnsemblGenomes-Tr; EBT00001659655.
DR   EnsemblGenomes-Tr; EBT00001659656.
DR   EnsemblGenomes-Tr; EBT00001659657.
DR   EnsemblGenomes-Tr; EBT00001659658.
DR   EnsemblGenomes-Tr; EBT00001659659.
DR   EnsemblGenomes-Tr; EBT00001659660.
DR   EnsemblGenomes-Tr; EBT00001659661.
DR   EnsemblGenomes-Tr; EBT00001659662.
DR   EnsemblGenomes-Tr; EBT00001659663.
DR   EnsemblGenomes-Tr; EBT00001659664.
DR   EnsemblGenomes-Tr; EBT00001659665.
DR   EnsemblGenomes-Tr; EBT00001659666.
DR   EnsemblGenomes-Tr; EBT00001659667.
DR   EnsemblGenomes-Tr; EBT00001659668.
DR   EnsemblGenomes-Tr; EBT00001659669.
DR   EnsemblGenomes-Tr; EBT00001659670.
DR   EnsemblGenomes-Tr; EBT00001659671.
DR   EnsemblGenomes-Tr; EBT00001659672.
DR   EnsemblGenomes-Tr; EBT00001659673.
DR   EnsemblGenomes-Tr; EBT00001659674.
DR   EnsemblGenomes-Tr; EBT00001659675.
DR   EnsemblGenomes-Tr; EBT00001659676.
DR   EnsemblGenomes-Tr; EBT00001659677.
DR   EnsemblGenomes-Tr; EBT00001659678.
DR   EnsemblGenomes-Tr; EBT00001659679.
DR   EnsemblGenomes-Tr; EBT00001659680.
DR   EnsemblGenomes-Tr; EBT00001659681.
DR   EnsemblGenomes-Tr; EBT00001659682.
DR   EnsemblGenomes-Tr; EBT00001659683.
DR   EnsemblGenomes-Tr; EBT00001659684.
DR   EnsemblGenomes-Tr; EBT00001659685.
DR   EnsemblGenomes-Tr; EBT00001659686.
DR   EnsemblGenomes-Tr; EBT00001659687.
DR   EnsemblGenomes-Tr; EBT00001659688.
DR   EnsemblGenomes-Tr; EBT00001659689.
DR   EnsemblGenomes-Tr; EBT00001659690.
DR   EnsemblGenomes-Tr; EBT00001659691.
DR   EnsemblGenomes-Tr; EBT00001659692.
DR   EnsemblGenomes-Tr; EBT00001659693.
DR   EnsemblGenomes-Tr; EBT00001659694.
DR   EnsemblGenomes-Tr; EBT00001659695.
DR   EnsemblGenomes-Tr; EBT00001659696.
DR   EnsemblGenomes-Tr; EBT00001659697.
DR   EnsemblGenomes-Tr; EBT00001659698.
DR   EnsemblGenomes-Tr; EBT00001659699.
DR   EnsemblGenomes-Tr; EBT00001659700.
DR   EnsemblGenomes-Tr; EBT00001659701.
DR   EnsemblGenomes-Tr; EBT00001659702.
DR   EnsemblGenomes-Tr; EBT00001659703.
DR   EnsemblGenomes-Tr; EBT00001659704.
DR   EnsemblGenomes-Tr; EBT00001659705.
DR   EnsemblGenomes-Tr; EBT00001659706.
DR   EnsemblGenomes-Tr; EBT00001659707.
DR   EnsemblGenomes-Tr; EBT00001659708.
DR   EnsemblGenomes-Tr; EBT00001659709.
DR   EnsemblGenomes-Tr; EBT00001659710.
DR   EnsemblGenomes-Tr; EBT00001659711.
DR   EnsemblGenomes-Tr; EBT00001659712.
DR   EnsemblGenomes-Tr; EBT00001659713.
DR   EnsemblGenomes-Tr; EBT00001659714.
DR   EnsemblGenomes-Tr; EBT00001659715.
DR   EnsemblGenomes-Tr; EBT00001659716.
DR   EnsemblGenomes-Tr; EBT00001659717.
DR   EnsemblGenomes-Tr; EBT00001659718.
DR   EnsemblGenomes-Tr; EBT00001659719.
DR   EnsemblGenomes-Tr; EBT00001659720.
DR   EnsemblGenomes-Tr; EBT00001659721.
DR   EnsemblGenomes-Tr; EBT00001659722.
DR   EnsemblGenomes-Tr; EBT00001659723.
DR   EnsemblGenomes-Tr; EBT00001659724.
DR   EnsemblGenomes-Tr; EBT00001659725.
DR   EnsemblGenomes-Tr; EBT00001659726.
DR   EnsemblGenomes-Tr; EBT00001659727.
DR   EnsemblGenomes-Tr; EBT00001659728.
DR   EnsemblGenomes-Tr; EBT00001659729.
DR   EnsemblGenomes-Tr; EBT00001659730.
DR   EnsemblGenomes-Tr; EBT00001659731.
DR   EnsemblGenomes-Tr; EBT00001659732.
DR   EnsemblGenomes-Tr; EBT00001659733.
DR   EnsemblGenomes-Tr; EBT00001659734.
DR   EnsemblGenomes-Tr; EBT00001659735.
DR   EnsemblGenomes-Tr; EBT00001659736.
DR   EnsemblGenomes-Tr; EBT00001659737.
DR   EuropePMC; PMC2838050; 20118253.
DR   EuropePMC; PMC2897811; 20565991.
DR   EuropePMC; PMC3187075; 21821744.
DR   EuropePMC; PMC3264070; 22123252.
DR   EuropePMC; PMC3295760; 22412891.
DR   EuropePMC; PMC3624556; 23378513.
DR   EuropePMC; PMC3650540; 23475975.
DR   EuropePMC; PMC4340641; 25662737.
DR   EuropePMC; PMC6423407; 30930874.
DR   RFAM; RF00001; 5S_rRNA.
DR   RFAM; RF00005; tRNA.
DR   RFAM; RF00010; RNaseP_bact_a.
DR   RFAM; RF00013; 6S.
DR   RFAM; RF00018; CsrB.
DR   RFAM; RF00021; Spot_42.
DR   RFAM; RF00022; GcvB.
DR   RFAM; RF00023; tmRNA.
DR   RFAM; RF00034; RprA.
DR   RFAM; RF00040; rne5.
DR   RFAM; RF00050; FMN.
DR   RFAM; RF00057; RyhB.
DR   RFAM; RF00059; TPP.
DR   RFAM; RF00078; MicA.
DR   RFAM; RF00079; OmrA-B.
DR   RFAM; RF00081; ArcZ.
DR   RFAM; RF00082; SraG.
DR   RFAM; RF00083; GlmZ_SraJ.
DR   RFAM; RF00101; SraC_RyeA.
DR   RFAM; RF00110; RybB.
DR   RFAM; RF00111; RyeB.
DR   RFAM; RF00114; S15.
DR   RFAM; RF00127; t44.
DR   RFAM; RF00128; GlmY_tke1.
DR   RFAM; RF00140; Alpha_RBS.
DR   RFAM; RF00168; Lysine.
DR   RFAM; RF00169; Bacteria_small_SRP.
DR   RFAM; RF00177; SSU_rRNA_bacteria.
DR   RFAM; RF00368; sroB.
DR   RFAM; RF00382; DnaX.
DR   RFAM; RF00391; RtT.
DR   RFAM; RF00506; Thr_leader.
DR   RFAM; RF00512; Leu_leader.
DR   RFAM; RF00514; His_leader.
DR   RFAM; RF00552; rncO.
DR   RFAM; RF00630; P26.
DR   RFAM; RF01055; MOCO_RNA_motif.
DR   RFAM; RF01118; PK-G12rRNA.
DR   RFAM; RF01396; isrN.
DR   RFAM; RF01707; JUMPstart.
DR   RFAM; RF01734; crcB.
DR   RFAM; RF01748; nuoG.
DR   RFAM; RF01766; cspA.
DR   RFAM; RF01769; greA.
DR   RFAM; RF01770; rimP.
DR   RFAM; RF01794; sok.
DR   RFAM; RF01796; frnS.
DR   RFAM; RF01830; StyR-44.
DR   RFAM; RF01854; Bacteria_large_SRP.
DR   RFAM; RF01859; Phe_leader.
DR   RFAM; RF01959; SSU_rRNA_archaea.
DR   RFAM; RF02029; sraA.
DR   RFAM; RF02030; tp2.
DR   RFAM; RF02031; tpke11.
DR   RFAM; RF02194; HPnc0260.
DR   SILVA-LSU; FN666575.
DR   SILVA-SSU; FN666575.
DR   StrainInfo; 115074; 0.
FH   Key             Location/Qualifiers
FT   source          join(1..341072,352324..1933121,1940575..3805874)
FT                   /organism="Erwinia amylovora ATCC 49946"
FT                   /focus
FT                   /strain="ATCC 49946"
FT                   /mol_type="genomic DNA"
FT                   /db_xref="taxon:716540"
FT   source          341073..352323
FT                   /organism="unidentified phage"
FT                   /mol_type="genomic DNA"
FT                   /proviral
FT                   /db_xref="taxon:38018"
FT   source          1933122..1940574
FT                   /organism="unidentified phage"
FT                   /mol_type="genomic DNA"
FT                   /proviral
FT                   /db_xref="taxon:38018"
FT   repeat_region   1..34
FT                   /rpt_family="EAM_chromosome.con.162"
FT                   /note="Forward repeat found by REPuter:
FT                   aaaggcgatcgctgcccgatcgcctccctgttca"
FT   CDS_pept        complement(32..472)
FT                   /transl_table=11
FT                   /gene="mioC"
FT                   /locus_tag="EAM_0001"
FT                   /product="putative flavoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0001"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44676"
FT                   /protein_id="CBJ44676.1"
FT   misc_feature    complement(59..457)
FT                   /note="HMMPfam hit to PF00258, Flavodoxin, score 9.2e-36"
FT   CDS_pept        complement(708..1169)
FT                   /transl_table=11
FT                   /gene="asnC"
FT                   /locus_tag="EAM_0002"
FT                   /product="AsnC-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0002"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44677"
FT                   /protein_id="CBJ44677.1"
FT   misc_feature    complement(735..959)
FT                   /note="HMMPfam hit to PF01037, AsnC family, score 1e-19"
FT   misc_feature    complement(1017..1097)
FT                   /note="PS00519 Bacterial regulatory proteins, asnC family
FT                   signature."
FT   misc_feature    complement(1035..1100)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1631.000, SD 4.74 at aa 24-45, sequence
FT   CDS_pept        complement(1287..3425)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0003"
FT                   /product="putative methyltransferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0003"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44678"
FT                   /protein_id="CBJ44678.1"
FT                   TARKFQHSVAQLTLWRKR"
FT   misc_feature    complement(1512..1886)
FT                   /note="HMMPfam hit to PF08241, Methyltransferase
FT                   domain,score 9.7e-10"
FT   misc_feature    complement(1518..1886)
FT                   /note="HMMPfam hit to PF08242, Methyltransferase
FT                   domain,score 3e-14"
FT   misc_feature    complement(2049..2819)
FT                   /note="HMMPfam hit to PF03781, Domain of unknown function
FT                   (DUF323), score 6.1e-12"
FT   misc_feature    complement(2766..2789)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(3510..4970)
FT                   /transl_table=11
FT                   /gene="viaA"
FT                   /locus_tag="EAM_0004"
FT                   /product="putative stimulator of RavA ATPase activity (VWA
FT                   domain protein interacting with AAA ATPase)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0004"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44679"
FT                   /protein_id="CBJ44679.1"
FT   CDS_pept        complement(4967..6460)
FT                   /transl_table=11
FT                   /gene="ravA"
FT                   /locus_tag="EAM_0005"
FT                   /product="ATPase RavA (Regulatory ATPase variant A)"
FT                   /EC_number="3.6.3.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0005"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44680"
FT                   /protein_id="CBJ44680.1"
FT   misc_feature    complement(5924..6340)
FT                   /note="HMMPfam hit to PF07728, ATPase family associated
FT                   with various cellul, score 1.8e-41"
FT   CDS_pept        6718..8586
FT                   /transl_table=11
FT                   /gene="kup"
FT                   /locus_tag="EAM_0006"
FT                   /product="low affinity potassium transport system protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0006"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44681"
FT                   /protein_id="CBJ44681.1"
FT   misc_feature    6718..6783
FT                   /note="Signal peptide predicted for EAM_0006 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.979) with cleavage site
FT                   probability 0.977 between residues 22 and 23"
FT   misc_feature    join(6736..6804,6862..6930,7015..7074,7117..7185,
FT                   7219..7287,7345..7413,7450..7518,7576..7644,7717..7785,
FT                   7813..7881,7900..7968,7981..8037)
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0006 by TMHMM2.0 at aa 7-29, 49-71, 100-119,
FT                   134-156,168-190, 210-232, 245-267, 287-309, 334-356,
FT                   366-388,395-417 and 422-440"
FT   misc_feature    6754..8583
FT                   /note="HMMPfam hit to PF02705, K+ potassium
FT                   transporter,score 4.6e-298"
FT   CDS_pept        complement(8691..14945)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0007"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /note="Similar to upstream CDSs EAM_0008 and EAM_0009"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0007"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44682"
FT                   /protein_id="CBJ44682.1"
FT   misc_feature    complement(9531..9554)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(11166..11243)
FT                   /note="PS01159 WW/rsp5/WWP domain signature."
FT   CDS_pept        complement(15308..21607)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0008"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /note="Similar to EAM_0007 and EAM_0009"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0008"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44683"
FT                   /protein_id="CBJ44683.1"
FT   misc_feature    complement(21500..21535)
FT                   /note="PS00141 Eukaryotic and viral aspartyl proteases
FT                   active site."
FT   CDS_pept        complement(21769..27714)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0009"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /note="Similar to EAM_0008 and EAM_0009"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0009"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44684"
FT                   /protein_id="CBJ44684.1"
FT   misc_feature    complement(22813..22890)
FT                   /note="PS01159 WW/rsp5/WWP domain signature."
FT   CDS_pept        27991..28389
FT                   /transl_table=11
FT                   /locus_tag="EAM_0010"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0010"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44685"
FT                   /protein_id="CBJ44685.1"
FT   misc_feature    27991..28377
FT                   /note="HMMPfam hit to PF04076, Domain unknown function
FT                   (DUF388), score 1.8e-51"
FT   misc_feature    27991..28050
FT                   /note="Signal peptide predicted for EAM_0010 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.990 between residues 20 and 21"
FT   misc_feature    28177..28380
FT                   /note="HMMPfam hit to PF01336, OB-fold nucleic acid binding
FT                   domain, score 0.055"
FT   CDS_pept        complement(28396..29277)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0011"
FT                   /product="LysR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0011"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44686"
FT                   /protein_id="CBJ44686.1"
FT                   AVHHLVTNLTEA"
FT   misc_feature    complement(28402..29022)
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 2.4e-38"
FT   misc_feature    complement(29092..29271)
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 5.6e-23"
FT   misc_feature    complement(29137..29229)
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    complement(29167..29232)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1936.000, SD 5.78 at aa 16-37, sequence
FT   CDS_pept        29382..30164
FT                   /transl_table=11
FT                   /gene="budA"
FT                   /locus_tag="EAM_0012"
FT                   /product="acetolactate decarboxylase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0012"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44687"
FT                   /protein_id="CBJ44687.1"
FT   misc_feature    29439..30131
FT                   /note="HMMPfam hit to PF03306, Alpha-acetolactate
FT                   decarboxylase, score 1.8e-129"
FT   CDS_pept        30183..31862
FT                   /transl_table=11
FT                   /gene="budB"
FT                   /locus_tag="EAM_0013"
FT                   /product="acetolactate synthase, catabolic"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0013"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44688"
FT                   /protein_id="CBJ44688.1"
FT   misc_feature    30213..30722
FT                   /note="HMMPfam hit to PF02776, Thiamine pyrophosphate
FT                   enzyme, N-termina, score 2.9e-74"
FT   misc_feature    30768..31247
FT                   /note="HMMPfam hit to PF00205, Thiamine pyrophosphate
FT                   enzyme, central d, score 2.1e-46"
FT   misc_feature    31359..31799
FT                   /note="HMMPfam hit to PF02775, Thiamine pyrophosphate
FT                   enzyme, C-termina, score 3.1e-51"
FT   misc_feature    31470..31529
FT                   /note="PS00187 Thiamine pyrophosphate enzymes signature."
FT   CDS_pept        complement(32071..32403)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0014"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0014"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44689"
FT                   /protein_id="CBJ44689.1"
FT                   HLFKKQ"
FT   CDS_pept        33153..33572
FT                   /transl_table=11
FT                   /gene="rbsD"
FT                   /locus_tag="EAM_0015"
FT                   /product="high affinity ribose transport protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0015"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44690"
FT                   /protein_id="CBJ44690.1"
FT   misc_feature    33153..33569
FT                   /note="HMMPfam hit to PF05025, RbsD / FucU transport
FT                   protein family, score 4.9e-72"
FT   CDS_pept        33580..35085
FT                   /transl_table=11
FT                   /gene="rbsA"
FT                   /locus_tag="EAM_0016"
FT                   /product="ribose transport system, ATP-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0016"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44691"
FT                   /protein_id="CBJ44691.1"
FT   misc_feature    33667..34230
FT                   /note="HMMPfam hit to PF00005, ABC transporter, score
FT                   1.6e-42"
FT   misc_feature    33688..33711
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    34411..34992
FT                   /note="HMMPfam hit to PF00005, ABC transporter, score
FT                   3.6e-29"
FT   misc_feature    34765..34809
FT                   /note="PS00211 ABC transporters family signature."
FT   CDS_pept        35088..36056
FT                   /transl_table=11
FT                   /gene="rbsC"
FT                   /locus_tag="EAM_0017"
FT                   /product="ribose transport system, permease protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0017"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44692"
FT                   /protein_id="CBJ44692.1"
FT   misc_feature    35088..35213
FT                   /note="Signal peptide predicted for EAM_0017 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.556 between residues 42 and 43"
FT   misc_feature    join(35151..35219,35280..35348,35376..35444,35463..35531,
FT                   35589..35657,35748..35816,35910..35978)
FT                   /note="7 probable transmembrane helices predicted for
FT                   EAM_0017 by TMHMM2.0 at aa 22-44, 65-87, 97-119,
FT                   126-148,168-190, 221-243 and 275-297"
FT   misc_feature    35220..36029
FT                   /note="HMMPfam hit to PF02653, Branched-chain amino acid
FT                   transport syst, score 5e-73"
FT   CDS_pept        36206..37087
FT                   /transl_table=11
FT                   /gene="rbsB"
FT                   /locus_tag="EAM_0018"
FT                   /product="D-ribose-binding periplasmic protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0018"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44693"
FT                   /protein_id="CBJ44693.1"
FT                   AINPVELKLVTR"
FT   misc_feature    36206..36274
FT                   /note="Signal peptide predicted for EAM_0018 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.997 between residues 23 and 24"
FT   misc_feature    36275..37081
FT                   /note="HMMPfam hit to PF00532, Periplasmic binding proteins
FT                   and sugar b, score 4.5e-13"
FT   misc_feature    36872..36895
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        37149..38078
FT                   /transl_table=11
FT                   /gene="rbsK"
FT                   /locus_tag="EAM_0019"
FT                   /product="ribokinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0019"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44694"
FT                   /protein_id="CBJ44694.1"
FT   misc_feature    37158..38042
FT                   /note="HMMPfam hit to PF00294, pfkB family carbohydrate
FT                   kinase, score 2.6e-90"
FT   misc_feature    37269..37343
FT                   /note="PS00583 pfkB family of carbohydrate kinases
FT                   signature 1."
FT   misc_feature    37488..38033
FT                   /note="HMMPfam hit to PF08543, Phosphomethylpyrimidine
FT                   kinase, score 6.1e-05"
FT   misc_feature    37893..37934
FT                   /note="PS00584 pfkB family of carbohydrate kinases
FT                   signature 2."
FT   CDS_pept        38081..39082
FT                   /transl_table=11
FT                   /gene="rbsR"
FT                   /locus_tag="EAM_0020"
FT                   /product="ribose operon repressor (LacI-family
FT                   transcriptional regulator)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0020"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44695"
FT                   /protein_id="CBJ44695.1"
FT   misc_feature    38084..38161
FT                   /note="HMMPfam hit to PF00356, Bacterial regulatory
FT                   proteins, lacI fami, score 3.5e-13"
FT   misc_feature    38084..38149
FT                   /note="Predicted helix-turn-helix motif with score
FT                   2162.000, SD 6.55 at aa 2-23, sequence
FT   misc_feature    38090..38146
FT                   /note="PS00356 Bacterial regulatory proteins, lacI family
FT                   signature."
FT   misc_feature    38255..39064
FT                   /note="HMMPfam hit to PF00532, Periplasmic binding proteins
FT                   and sugar b, score 2.6e-17"
FT   CDS_pept        complement(39079..40473)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0021"
FT                   /product="major facilitator superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0021"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44696"
FT                   /protein_id="CBJ44696.1"
FT                   DRKKKT"
FT   misc_feature    complement(join(39130..39198,39226..39294,39355..39423,
FT                   39436..39504,39538..39606,39619..39687,39745..39813,
FT                   39823..39891,39928..39996,40009..40077,40102..40158,
FT                   40168..40236,40273..40341,40369..40437))
FT                   /note="14 probable transmembrane helices predicted for
FT                   EAM_0021 by TMHMM2.0 at aa 13-35, 45-67, 80-102,
FT                   106-124,133-155, 160-182, 195-217, 221-243, 263-285,
FT                   290-312,324-346, 351-373, 394-416 and 426-448"
FT   misc_feature    complement(39232..40431)
FT                   /note="HMMPfam hit to PF07690, Major Facilitator
FT                   Superfamily, score 8.1e-47"
FT   misc_feature    complement(40405..40473)
FT                   /note="Signal peptide predicted for EAM_0021 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.999) with cleavage site
FT                   probability 0.641 between residues 23 and 24"
FT   rRNA            41021..42578
FT                   /gene="16S rRNA"
FT                   /locus_tag="EAM_r001"
FT                   /note="rRNA"
FT   tRNA            42637..42710
FT                   /gene="tRNA-Ile"
FT                   /locus_tag="EAM_t001"
FT                   /product="transfer RNA-Ile"
FT                   /anticodon="(pos:42671..42673,aa:Ile)"
FT                   /note="tRNA Ile anticodon GAT, Cove score 70.86"
FT   tRNA            42862..42934
FT                   /gene="tRNA-Ala"
FT                   /locus_tag="EAM_t002"
FT                   /product="transfer RNA-Ala"
FT                   /anticodon="(pos:42895..42897,aa:Ala)"
FT                   /note="tRNA Ala anticodon TGC, Cove score 74.29"
FT   rRNA            43324..46195
FT                   /gene="23S rRNA"
FT                   /locus_tag="EAM_r002"
FT                   /note="rRNA"
FT   rRNA            46392..46525
FT                   /gene="5S rRNA"
FT                   /locus_tag="EAM_r003"
FT                   /note="rRNA"
FT   CDS_pept        complement(46580..47170)
FT                   /transl_table=11
FT                   /gene="mobA"
FT                   /locus_tag="EAM_0022"
FT                   /product="molybdopterin-guanine dinucleotide biosynthesis
FT                   protein A"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0022"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44697"
FT                   /protein_id="CBJ44697.1"
FT   misc_feature    complement(47144..47161)
FT                   /note="PS00343 Gram-positive cocci surface proteins
FT                   'anchoring' hexapeptide."
FT   CDS_pept        join(47219..47290,47294..47488)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0023"
FT                   /product="conserved hypothetical protein (pseudogene)"
FT                   /db_xref="PSEUDO:CBJ44698.1"
FT   misc_feature    join(47219..47290,47294..47482)
FT                   /note="HMMPfam hit to PF06288, Protein of unknown function
FT                   (DUF1040), score 2.6e-36"
FT   CDS_pept        47568..48560
FT                   /transl_table=11
FT                   /gene="rdoA"
FT                   /locus_tag="EAM_0024"
FT                   /product="putative phosphotransferase/kinase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0024"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44699"
FT                   /protein_id="CBJ44699.1"
FT   misc_feature    47655..48365
FT                   /note="HMMPfam hit to PF01636, Phosphotransferase enzyme
FT                   family, score 5.6e-39"
FT   CDS_pept        48611..49240
FT                   /transl_table=11
FT                   /gene="dsbA"
FT                   /locus_tag="EAM_0025"
FT                   /product="thiol:disulfide interchange protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0025"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44700"
FT                   /protein_id="CBJ44700.1"
FT   misc_feature    48611..48667
FT                   /note="Signal peptide predicted for EAM_0025 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.986 between residues 19 and 20"
FT   misc_feature    48728..49207
FT                   /note="HMMPfam hit to PF01323, DSBA-like thioredoxin
FT                   domain, score 6e-43"
FT   misc_feature    48731..48787
FT                   /note="PS00194 Thioredoxin family active site."
FT   CDS_pept        49651..52440
FT                   /transl_table=11
FT                   /gene="polA"
FT                   /locus_tag="EAM_0026"
FT                   /product="DNA polymerase I"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0026"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44701"
FT                   /protein_id="CBJ44701.1"
FT   misc_feature    49669..50157
FT                   /note="HMMPfam hit to PF02739, 5'-3' exonuclease,N-terminal
FT                   resolvase-, score 9.6e-93"
FT   misc_feature    50161..50481
FT                   /note="HMMPfam hit to PF01367, 5'-3' exonuclease,C-terminal
FT                   SAM fold, score 1.1e-49"
FT   misc_feature    50638..51201
FT                   /note="HMMPfam hit to PF01612, 3'-5' exonuclease, score
FT                   2.1e-56"
FT   misc_feature    51289..52434
FT                   /note="HMMPfam hit to PF00476, DNA polymerase family
FT                   A,score 9.5e-209"
FT   misc_feature    51910..51969
FT                   /note="PS00447 DNA polymerase family A signature."
FT   CDS_pept        complement(52933..53571)
FT                   /transl_table=11
FT                   /gene="engB"
FT                   /locus_tag="EAM_0027"
FT                   /product="conserved hypothetical protein"
FT                   /product="probable GTP-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0027"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44702"
FT                   /protein_id="CBJ44702.1"
FT   misc_feature    complement(53119..53484)
FT                   /note="HMMPfam hit to PF01926, GTPase of unknown
FT                   function,score 3.4e-26"
FT   misc_feature    complement(53443..53466)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        54122..54643
FT                   /transl_table=11
FT                   /locus_tag="EAM_0028"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0028"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44703"
FT                   /protein_id="CBJ44703.1"
FT                   DMYRLLKGNH"
FT   misc_feature    54122..54637
FT                   /note="HMMPfam hit to PF04220, Protein of unknown
FT                   function,DUF414, score 3.7e-54"
FT   CDS_pept        54899..56272
FT                   /transl_table=11
FT                   /gene="hemN"
FT                   /locus_tag="EAM_0029"
FT                   /product="oxygen-independent coproporphyrinogen III
FT                   oxidase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0029"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44704"
FT                   /protein_id="CBJ44704.1"
FT   misc_feature    55064..55585
FT                   /note="HMMPfam hit to PF04055, Radical SAM
FT                   superfamily,score 4.5e-22"
FT   misc_feature    55829..56191
FT                   /note="HMMPfam hit to PF06969, HemN C-terminal region,score
FT                   6.5e-53"
FT   CDS_pept        complement(56331..57740)
FT                   /transl_table=11
FT                   /gene="glnG"
FT                   /locus_tag="EAM_0030"
FT                   /product="nitrogen regulation protein NR(I) (two-component
FT                   system response regulator)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0030"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44705"
FT                   /protein_id="CBJ44705.1"
FT                   LTRKLKELGME"
FT   misc_feature    complement(56343..56465)
FT                   /note="HMMPfam hit to PF02954, Bacterial regulatory
FT                   protein, Fis fam, score 3.6e-16"
FT   misc_feature    complement(56349..56414)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1763.000, SD 5.19 at aa 443-464, sequence
FT   misc_feature    complement(56658..57323)
FT                   /note="HMMPfam hit to PF00158, Sigma-54 interaction
FT                   domain,score 2.6e-144"
FT   misc_feature    complement(56814..57254)
FT                   /note="HMMPfam hit to PF07728, ATPase family associated
FT                   with various, score 0.0004"
FT   misc_feature    complement(57018..57065)
FT                   /note="PS00676 Sigma-54 interaction domain ATP-binding
FT                   region B signature."
FT   misc_feature    complement(57210..57251)
FT                   /note="PS00675 Sigma-54 interaction domain ATP-binding
FT                   region A signature."
FT   misc_feature    complement(57393..57731)
FT                   /note="HMMPfam hit to PF00072, Response regulator receiver
FT                   domain, score 6e-41"
FT   CDS_pept        complement(57748..58797)
FT                   /transl_table=11
FT                   /gene="glnL"
FT                   /locus_tag="EAM_0031"
FT                   /product="nitrogen regulation two-component sensor kinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0031"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44706"
FT                   /protein_id="CBJ44706.1"
FT                   FSVYLPIRQ"
FT   misc_feature    complement(57754..58101)
FT                   /note="HMMPfam hit to PF02518, Histidine kinase-, DNA
FT                   gyrase B-, and HSP90, score 5.4e-28"
FT   misc_feature    complement(58216..58413)
FT                   /note="HMMPfam hit to PF00512, His Kinase A
FT                   (phosphoacceptor) domain, score 3.8e-15"
FT   CDS_pept        complement(58989..60398)
FT                   /transl_table=11
FT                   /gene="glnA"
FT                   /locus_tag="EAM_0032"
FT                   /product="glutamine synthetase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0032"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44707"
FT                   /protein_id="CBJ44707.1"
FT                   HPVEFELYYSV"
FT   misc_feature    complement(59205..59243)
FT                   /note="PS00182 Glutamine synthetase class-I adenylation
FT                   site."
FT   misc_feature    complement(59250..60095)
FT                   /note="HMMPfam hit to PF00120, Glutamine
FT                   synthetase,catalytic domain, score 9.5e-176"
FT   misc_feature    complement(59577..59624)
FT                   /note="PS00181 Glutamine synthetase putative ATP-binding
FT                   region signature."
FT   misc_feature    complement(60114..60359)
FT                   /note="HMMPfam hit to PF03951, Glutamine
FT                   synthetase,beta-Grasp domain, score 4.7e-49"
FT   misc_feature    complement(60195..60251)
FT                   /note="PS00180 Glutamine synthetase signature 1."
FT   CDS_pept        60835..62658
FT                   /transl_table=11
FT                   /gene="typA"
FT                   /locus_tag="EAM_0033"
FT                   /product="GTP-binding protein (tyrosine phosphorylated
FT                   protein A)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0033"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44708"
FT                   /protein_id="CBJ44708.1"
FT   misc_feature    60841..61428
FT                   /note="HMMPfam hit to PF00009, Elongation factor Tu GTP
FT                   binding domain, score 2.4e-74"
FT   misc_feature    60868..60891
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    60964..61011
FT                   /note="PS00301 GTP-binding elongation factors signature."
FT   misc_feature    61489..61701
FT                   /note="HMMPfam hit to PF03144, Elongation factor Tu
FT                   domain,score 3.5e-14"
FT   misc_feature    62017..62283
FT                   /note="HMMPfam hit to PF00679, Elongation factor G
FT                   C-terminus, score 3.9e-20"
FT   CDS_pept        62858..63469
FT                   /transl_table=11
FT                   /locus_tag="EAM_0034"
FT                   /product="putative phosphatase"
FT                   /EC_number="3.1.3.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0034"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44709"
FT                   /protein_id="CBJ44709.1"
FT   misc_feature    62858..63418
FT                   /note="HMMPfam hit to PF00702, haloacid dehalogenase-like
FT                   hydrolase, score 8.4e-18"
FT   misc_feature    63344..63430
FT                   /note="PS00402 Binding-protein-dependent transport systems
FT                   inner membrane comp. sign."
FT   CDS_pept        63473..64345
FT                   /transl_table=11
FT                   /gene="rbn"
FT                   /locus_tag="EAM_0035"
FT                   /product="tRNA-processing ribonuclease BN"
FT                   /EC_number="3.1.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0035"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44710"
FT                   /protein_id="CBJ44710.1"
FT                   EQERENEDP"
FT   misc_feature    63548..64300
FT                   /note="HMMPfam hit to PF03631, Ribonuclease BN-like
FT                   family,score 2.8e-67"
FT   misc_feature    join(63581..63649,63758..63826,63884..63952,63995..64063,
FT                   64100..64168,64196..64264)
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0035 by TMHMM2.0 at aa 37-59, 96-118, 138-160,
FT                   175-197,210-232 and 242-264"
FT   CDS_pept        64342..64779
FT                   /transl_table=11
FT                   /gene="dtd"
FT                   /locus_tag="EAM_0036"
FT                   /product="D-tyrosyl-tRNA(Tyr) deacylase"
FT                   /EC_number="3.1.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0036"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44711"
FT                   /protein_id="CBJ44711.1"
FT   misc_feature    64423..64776
FT                   /note="HMMPfam hit to PF02580, D-Tyr-tRNA(Tyr)
FT                   deacylase,score 1.2e-75"
FT   CDS_pept        64839..65777
FT                   /transl_table=11
FT                   /locus_tag="EAM_0037"
FT                   /product="putative acetyltransferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0037"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44712"
FT                   /protein_id="CBJ44712.1"
FT   misc_feature    64977..65207
FT                   /note="HMMPfam hit to PF00583, Acetyltransferase (GNAT)
FT                   family, score 2.8e-14"
FT   misc_feature    65109..65174
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1005.000, SD 2.61 at aa 91-112, sequence
FT   misc_feature    65442..65510
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0037 by TMHMM2.0 at aa 202-224"
FT   CDS_pept        complement(65785..66651)
FT                   /transl_table=11
FT                   /gene="rluF"
FT                   /locus_tag="EAM_0038"
FT                   /product="ribosomal large subunit pseudouridine synthase F"
FT                   /EC_number="5.4.99.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0038"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44713"
FT                   /protein_id="CBJ44713.1"
FT                   GRKKKGR"
FT   misc_feature    complement(66067..66450)
FT                   /note="HMMPfam hit to PF00849, RNA pseudouridylate
FT                   synthase, score 1.4e-26"
FT   misc_feature    complement(66298..66342)
FT                   /note="PS01149 Rsu family of pseudouridine synthase
FT                   signature."
FT   misc_feature    complement(66496..66633)
FT                   /note="HMMPfam hit to PF01479, S4 domain, score 3.1e-10"
FT   CDS_pept        complement(66734..68416)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0039"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0039"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44714"
FT                   /protein_id="CBJ44714.1"
FT   misc_feature    complement(66737..68416)
FT                   /note="HMMPfam hit to PF05170, AsmA family, score 1.6e-131"
FT   misc_feature    complement(67136..67156)
FT                   /note="PS00340 Growth factor and cytokines receptors family
FT                   signature 2."
FT   misc_feature    complement(68330..68398)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0039 by TMHMM2.0 at aa 7-29"
FT   misc_feature    complement(68354..68416)
FT                   /note="Signal peptide predicted for EAM_0039 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.994) with cleavage site
FT                   probability 0.271 between residues 21 and 22"
FT   CDS_pept        complement(68539..69927)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0040"
FT                   /product="putative purine permease"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0040"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44715"
FT                   /protein_id="CBJ44715.1"
FT                   PTEK"
FT   misc_feature    complement(join(68554..68613,68641..68709,68728..68796,
FT                   68824..68892,69079..69147,69205..69273,69292..69351,
FT                   69394..69462,69481..69549,69733..69801))
FT                   /note="10 probable transmembrane helices predicted for
FT                   EAM_0040 by TMHMM2.0 at aa 43-65, 127-149, 156-178,193-212,
FT                   219-241, 261-283, 346-368, 378-400, 407-429 and 439-458"
FT   misc_feature    complement(68644..69831)
FT                   /note="HMMPfam hit to PF00860, Permease family, score
FT                   1.4e-154"
FT   misc_feature    complement(68743..68805)
FT                   /note="PS01116 Xanthine/uracil permeases family signature."
FT   CDS_pept        complement(70166..72247)
FT                   /transl_table=11
FT                   /gene="recG"
FT                   /locus_tag="EAM_0041"
FT                   /product="ATP-dependent DNA helicase"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0041"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44716"
FT                   /protein_id="CBJ44716.1"
FT   misc_feature    complement(70481..70714)
FT                   /note="HMMPfam hit to PF00271, Helicase conserved
FT                   C-terminal domain, score 9.1e-23"
FT   misc_feature    complement(70934..71440)
FT                   /note="HMMPfam hit to PF00270, DEAD/DEAH box helicase,score
FT                   1.8e-32"
FT   misc_feature    complement(71339..71362)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(71840..72064)
FT                   /note="HMMPfam hit to PF01336, OB-fold nucleic acid binding
FT                   domain, score 1.6e-12"
FT   CDS_pept        complement(72247..72942)
FT                   /transl_table=11
FT                   /gene="trmH"
FT                   /gene_synonym="spoU"
FT                   /locus_tag="EAM_0042"
FT                   /product="tRNA (guanosine-2'-O)-methyltransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0042"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44717"
FT                   /protein_id="CBJ44717.1"
FT                   AAMQSKARK"
FT   misc_feature    complement(72466..72888)
FT                   /note="HMMPfam hit to PF00588, SpoU rRNA Methylase
FT                   family,score 7.3e-51"
FT   misc_feature    complement(72667..72705)
FT                   /note="PS00196 Type-1 copper (blue) proteins signature."
FT   CDS_pept        complement(73037..75160)
FT                   /transl_table=11
FT                   /gene="spoT"
FT                   /locus_tag="EAM_0043"
FT                   /product="guanosine-3',5'-bis(diphosphate)
FT                   3'-pyrophosphohydrolase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0043"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44718"
FT                   /protein_id="CBJ44718.1"
FT                   VMPDVIKVHRNRN"
FT   misc_feature    complement(73820..73999)
FT                   /note="HMMPfam hit to PF02824, TGS domain, score 3.6e-27"
FT   misc_feature    complement(74126..74458)
FT                   /note="HMMPfam hit to PF04607, Region found in RelA / SpoT
FT                   proteins, score 2.1e-46"
FT   misc_feature    complement(74729..75028)
FT                   /note="HMMPfam hit to PF01966, HD domain, score 2e-19"
FT   CDS_pept        complement(75180..75455)
FT                   /transl_table=11
FT                   /gene="rpoZ"
FT                   /locus_tag="EAM_0044"
FT                   /product="DNA-directed RNA polymerase omega chain"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0044"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44719"
FT                   /protein_id="CBJ44719.1"
FT   misc_feature    complement(75261..75422)
FT                   /note="HMMPfam hit to PF01192, RNA polymerase Rpb6, score
FT                   2e-23"
FT   CDS_pept        complement(75512..76135)
FT                   /transl_table=11
FT                   /gene="gmk"
FT                   /locus_tag="EAM_0045"
FT                   /product="guanylate kinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0045"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44720"
FT                   /protein_id="CBJ44720.1"
FT   misc_feature    complement(75701..76015)
FT                   /note="HMMPfam hit to PF00625, Guanylate kinase, score
FT                   3.1e-59"
FT   misc_feature    complement(75965..76018)
FT                   /note="PS00856 Guanylate kinase signature."
FT   misc_feature    complement(76082..76105)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        76395..78059
FT                   /transl_table=11
FT                   /locus_tag="EAM_0046"
FT                   /product="putative DNA ligase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0046"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44721"
FT                   /protein_id="CBJ44721.1"
FT   misc_feature    76395..76445
FT                   /note="Signal peptide predicted for EAM_0046 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.840) with cleavage site
FT                   probability 0.756 between residues 17 and 18"
FT   misc_feature    76467..77312
FT                   /note="HMMPfam hit to PF01653, NAD-dependent DNA ligase
FT                   adenylation, score 1.2e-47"
FT   misc_feature    76758..76847
FT                   /note="PS01055 NAD-dependent DNA ligase signature 1."
FT   misc_feature    77316..77552
FT                   /note="HMMPfam hit to PF03120, NAD-dependent DNA ligase
FT                   OB-fold doma, score 1.3e-11"
FT   misc_feature    77349..77396
FT                   /note="PS01056 NAD-dependent DNA ligase signature 2."
FT   CDS_pept        complement(78077..78694)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0047"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0047"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44722"
FT                   /protein_id="CBJ44722.1"
FT   misc_feature    complement(join(78128..78196,78209..78277,78296..78364,
FT                   78374..78433,78452..78505,78548..78607,78626..78685))
FT                   /note="7 probable transmembrane helices predicted for
FT                   EAM_0047 by TMHMM2.0 at aa 4-23, 30-49, 64-81,
FT                   88-107,111-133, 140-162 and 167-189"
FT   misc_feature    complement(78176..78430)
FT                   /note="HMMPfam hit to PF03458, UPF0126 domain, score 2e-35"
FT   misc_feature    complement(78431..78688)
FT                   /note="HMMPfam hit to PF03458, UPF0126 domain, score
FT                   4.3e-38"
FT   CDS_pept        79160..79804
FT                   /transl_table=11
FT                   /locus_tag="EAM_0048"
FT                   /product="two-component response regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0048"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44723"
FT                   /protein_id="CBJ44723.1"
FT   misc_feature    79172..79525
FT                   /note="HMMPfam hit to PF00072, Response regulator receiver
FT                   domain, score 2.6e-08"
FT   misc_feature    79610..79783
FT                   /note="HMMPfam hit to PF00196, Bacterial regulatory
FT                   proteins, luxR fami, score 5.7e-15"
FT   misc_feature    79664..79729
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1248.000, SD 3.44 at aa 169-190, sequence
FT   CDS_pept        complement(80155..81519)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0049"
FT                   /product="major facilitator superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0049"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44724"
FT                   /protein_id="CBJ44724.1"
FT   misc_feature    complement(join(80398..80457,80485..80553,80590..80658,
FT                   80671..80730,80749..80817,80845..80913,80989..81048,
FT                   81061..81129,81163..81231,81244..81303,81322..81390,
FT                   81433..81501))
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0049 by TMHMM2.0 at aa 7-29, 44-66, 73-92,
FT                   97-119,131-153, 158-177, 203-225, 235-257, 264-283,
FT                   288-310,323-345 and 355-374"
FT   misc_feature    complement(80473..81489)
FT                   /note="HMMPfam hit to PF07690, Major Facilitator
FT                   Superfamily, score 8.5e-31"
FT   misc_feature    complement(81406..81519)
FT                   /note="Signal peptide predicted for EAM_0049 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.769) with cleavage site
FT                   probability 0.257 between residues 38 and 39"
FT   CDS_pept        complement(81685..82023)
FT                   /transl_table=11
FT                   /gene="phnA"
FT                   /locus_tag="EAM_0050"
FT                   /product="probable phosphonoacetate hydrolase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0050"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44725"
FT                   /protein_id="CBJ44725.1"
FT                   KSEFVKKN"
FT   misc_feature    complement(81730..81894)
FT                   /note="HMMPfam hit to PF03831, PhnA protein, score 3.6e-36"
FT   misc_feature    complement(81928..82017)
FT                   /note="HMMPfam hit to PF08274, PhnA Zinc-Ribbon, score
FT                   1.5e-11"
FT   CDS_pept        complement(82354..82680)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0051"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0051"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44726"
FT                   /protein_id="CBJ44726.1"
FT                   SESK"
FT   CDS_pept        join(83254..83409,83409..84434)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0052"
FT                   /product="putative reverse transcriptase (pseudogene)"
FT                   /db_xref="PSEUDO:CBJ44727.1"
FT   CDS_pept        84424..85086
FT                   /transl_table=11
FT                   /locus_tag="EAM_0053"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0053"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44728"
FT                   /protein_id="CBJ44728.1"
FT   misc_feature    join(84442..84510,84625..84693)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0053 by TMHMM2.0 at aa 7-29 and 68-90"
FT   CDS_pept        85215..86822
FT                   /transl_table=11
FT                   /locus_tag="EAM_0054"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0054"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44729"
FT                   /protein_id="CBJ44729.1"
FT                   MYSNLSQRGLTVTVASAK"
FT   CDS_pept        86985..87341
FT                   /transl_table=11
FT                   /locus_tag="EAM_0055"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0055"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44730"
FT                   /protein_id="CBJ44730.1"
FT                   SRLLSTEIWSVHSS"
FT   repeat_region   87362..87391
FT                   /rpt_family="EAM_chromosome.con.22"
FT                   /note="Forward repeat found by REPuter:
FT                   tgtagtggcatagtgaatttggccacctga"
FT   misc_feature    87392..95537
FT                   /note="possible degenerate mobile element"
FT   CDS_pept        87433..87867
FT                   /transl_table=11
FT                   /locus_tag="EAM_0056"
FT                   /product="transposase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0056"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44731"
FT                   /protein_id="CBJ44731.1"
FT   misc_feature    87448..87693
FT                   /note="HMMPfam hit to PF01527, Transposase, score 2.2e-16"
FT   misc_feature    87508..87573
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1288.000, SD 3.57 at aa 26-47, sequence
FT   misc_feature    87763..87831
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0056 by TMHMM2.0 at aa 111-133"
FT   CDS_pept        87873..88283
FT                   /transl_table=11
FT                   /locus_tag="EAM_0057"
FT                   /product="putative transposase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0057"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44732"
FT                   /protein_id="CBJ44732.1"
FT   CDS_pept        complement(88526..89119)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0058"
FT                   /product="putative mobilization protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0058"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44733"
FT                   /protein_id="CBJ44733.1"
FT   CDS_pept        complement(89129..89521)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0059"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0059"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44734"
FT                   /protein_id="CBJ44734.1"
FT   CDS_pept        90287..91405
FT                   /transl_table=11
FT                   /locus_tag="EAM_0060"
FT                   /product="putative modification methylase
FT                   (cytosine-specific DNA methylase)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0060"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44735"
FT                   /protein_id="CBJ44735.1"
FT   misc_feature    90311..91294
FT                   /note="HMMPfam hit to PF00145, C-5 cytosine-specific DNA
FT                   methylase, score 3.5e-80"
FT   misc_feature    90494..90532
FT                   /note="PS00094 C-5 cytosine-specific DNA methylases active
FT                   site."
FT   misc_feature    91232..91288
FT                   /note="PS00095 C-5 cytosine-specific DNA methylases
FT                   C-terminal signature."
FT   CDS_pept        91418..93022
FT                   /transl_table=11
FT                   /locus_tag="EAM_0061"
FT                   /product="putative restriction enzyme"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0061"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44736"
FT                   /protein_id="CBJ44736.1"
FT                   KQLFMDILDEEFKDEIK"
FT   misc_feature    92252..92740
FT                   /note="HMMPfam hit to PF07728, ATPase family associated
FT                   with various cellul, score 1.2e-12"
FT   CDS_pept        93022..94296
FT                   /transl_table=11
FT                   /locus_tag="EAM_0062"
FT                   /product="putative restriction enzyme"
FT                   /product="mcrbc 5-methylcytosine restriction system
FT                   component-like"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0062"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44737"
FT                   /protein_id="CBJ44737.1"
FT   CDS_pept        complement(94314..95537)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0063"
FT                   /product="putative integrase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0063"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44738"
FT                   /protein_id="CBJ44738.1"
FT                   RAIIYKSN"
FT   misc_feature    complement(94371..94895)
FT                   /note="HMMPfam hit to PF00589, Phage integrase family,score
FT                   3.8e-06"
FT   CDS_pept        complement(95736..96599)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0064"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0064"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44739"
FT                   /protein_id="CBJ44739.1"
FT                   QIQNIE"
FT   misc_feature    complement(95739..96002)
FT                   /note="HMMPfam hit to PF08340, Domain of unknown function
FT                   (DUF1732), score 4.3e-57"
FT   misc_feature    complement(96135..96596)
FT                   /note="HMMPfam hit to PF03755, YicC-like family, N-terminal
FT                   region, score 2.7e-79"
FT   CDS_pept        96750..97178
FT                   /transl_table=11
FT                   /locus_tag="EAM_0065"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0065"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44740"
FT                   /protein_id="CBJ44740.1"
FT   misc_feature    96750..96821
FT                   /note="Signal peptide predicted for EAM_0065 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.309 between residues 24 and 25"
FT   misc_feature    96771..96803
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(97213..98397)
FT                   /transl_table=11
FT                   /gene="nupC"
FT                   /locus_tag="EAM_0066"
FT                   /product="nucleoside permease"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0066"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44741"
FT                   /protein_id="CBJ44741.1"
FT   misc_feature    complement(97216..97818)
FT                   /note="HMMPfam hit to PF07662, Na+ dependent nucleoside
FT                   transporter C, score 9.8e-95"
FT   misc_feature    complement(join(97219..97287,97324..97392,97486..97554,
FT                   97588..97656,97762..97821,98074..98142,98236..98304,
FT                   98329..98388))
FT                   /note="8 probable transmembrane helices predicted for
FT                   EAM_0066 by TMHMM2.0 at aa 4-23, 32-54, 86-108,
FT                   193-212,248-270, 282-304, 336-358 and 371-393"
FT   misc_feature    complement(97819..98127)
FT                   /note="HMMPfam hit to PF07670, Nucleoside recognition,score
FT                   3e-13"
FT   misc_feature    complement(98149..98394)
FT                   /note="HMMPfam hit to PF01773, Na+ dependent nucleoside
FT                   transporter N, score 5.9e-21"
FT   misc_feature    complement(98329..98397)
FT                   /note="Signal peptide predicted for EAM_0066 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.989) with cleavage site
FT                   probability 0.425 between residues 23 and 24"
FT   CDS_pept        98609..99325
FT                   /transl_table=11
FT                   /gene="rph"
FT                   /locus_tag="EAM_0067"
FT                   /product="ribonuclease PH"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0067"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44742"
FT                   /protein_id="CBJ44742.1"
FT                   GGIDTLVAAQKAALTH"
FT   misc_feature    98636..99037
FT                   /note="HMMPfam hit to PF01138, 3' exoribonuclease
FT                   family,domain, score 1.6e-55"
FT   misc_feature    98954..98992
FT                   /note="PS01277 Ribonuclease PH signature."
FT   misc_feature    99077..99280
FT                   /note="HMMPfam hit to PF03725, 3' exoribonuclease
FT                   family,domain, score 5.5e-23"
FT   CDS_pept        99381..100022
FT                   /transl_table=11
FT                   /gene="pyrE"
FT                   /locus_tag="EAM_0068"
FT                   /product="orotate phosphoribosyltransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0068"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44743"
FT                   /protein_id="CBJ44743.1"
FT   misc_feature    99483..99890
FT                   /note="HMMPfam hit to PF00156, Phosphoribosyl transferase
FT                   domain, score 8.1e-29"
FT   misc_feature    99738..99776
FT                   /note="PS00103 Purine/pyrimidine phosphoribosyl
FT                   transferases signature."
FT   CDS_pept        complement(100096..100692)
FT                   /transl_table=11
FT                   /gene="slmA"
FT                   /locus_tag="EAM_0069"
FT                   /product="TetR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0069"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44744"
FT                   /protein_id="CBJ44744.1"
FT   misc_feature    complement(100507..100650)
FT                   /note="HMMPfam hit to PF00440, Bacterial regulatory
FT                   proteins, tetR family, score 7e-10"
FT   misc_feature    complement(100519..100611)
FT                   /note="PS01081 Bacterial regulatory proteins, tetR family
FT                   signature."
FT   misc_feature    complement(100534..100599)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1937.000, SD 5.78 at aa 32-53, sequence
FT   CDS_pept        complement(100806..101261)
FT                   /transl_table=11
FT                   /gene="dut"
FT                   /locus_tag="EAM_0070"
FT                   /product="deoxyuridine 5'-triphosphate nucleotidohydrolase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0070"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44745"
FT                   /protein_id="CBJ44745.1"
FT   misc_feature    complement(100815..101219)
FT                   /note="HMMPfam hit to PF00692, dUTPase, score 3.2e-52"
FT   CDS_pept        complement(101242..102456)
FT                   /transl_table=11
FT                   /gene="coaBC"
FT                   /locus_tag="EAM_0071"
FT                   /product="coenzyme A biosynthesis bifunctional protein
FT                   CoaBC (DNA/pantothenate metabolism flavoprotein) [includes:
FT                   phosphopantothenoylcysteine decarboxylase (ec;
FT                   phosphopantothenate--cysteine ligase (ec]"
FT                   /EC_number=""
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0071"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44746"
FT                   /protein_id="CBJ44746.1"
FT                   EKNRR"
FT   misc_feature    complement(101362..101898)
FT                   /note="HMMPfam hit to PF04127, DNA / pantothenate
FT                   metabolism flavoprote, score 1.2e-35"
FT   misc_feature    complement(102085..102438)
FT                   /note="HMMPfam hit to PF02441, Flavoprotein, score 4.6e-50"
FT   CDS_pept        102651..103322
FT                   /transl_table=11
FT                   /gene="radC"
FT                   /locus_tag="EAM_0072"
FT                   /product="DNA repair protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0072"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44747"
FT                   /protein_id="CBJ44747.1"
FT                   M"
FT   misc_feature    102945..103319
FT                   /note="HMMPfam hit to PF04002, RadC, DNA repair
FT                   protein,score 2.1e-70"
FT   misc_feature    103164..103181
FT                   /note="PS01302 DNA repair protein radC family signature."
FT   CDS_pept        103619..103855
FT                   /transl_table=11
FT                   /gene="rpmB"
FT                   /locus_tag="EAM_0073"
FT                   /product="50S ribosomal protein L28"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0073"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44748"
FT                   /protein_id="CBJ44748.1"
FT   misc_feature    103625..103807
FT                   /note="HMMPfam hit to PF00830, Ribosomal L28 family, score
FT                   7.8e-37"
FT   CDS_pept        103872..104039
FT                   /transl_table=11
FT                   /gene="rpmG"
FT                   /locus_tag="EAM_0074"
FT                   /product="50S ribosomal subunit protein L33"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0074"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44749"
FT                   /protein_id="CBJ44749.1"
FT                   HVIYKEAKIK"
FT   misc_feature    103887..104030
FT                   /note="HMMPfam hit to PF00471, Ribosomal protein L33, score
FT                   1.5e-24"
FT   misc_feature    103932..103991
FT                   /note="PS00582 Ribosomal protein L33 signature."
FT   CDS_pept        104148..104957
FT                   /transl_table=11
FT                   /gene="mutM"
FT                   /locus_tag="EAM_0075"
FT                   /product="formamidopyrimidine-DNA glycosylase
FT                   [DNA-(apurinic or apyrimidinic site) lyase]"
FT                   /EC_number=""
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0075"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44750"
FT                   /protein_id="CBJ44750.1"
FT   misc_feature    104151..104489
FT                   /note="HMMPfam hit to PF01149, Formamidopyrimidine-DNA
FT                   glycosylase N-, score 4.4e-58"
FT   misc_feature    104532..104810
FT                   /note="HMMPfam hit to PF06831, Formamidopyrimidine-DNA
FT                   glycosylase H2, score 2e-45"
FT   CDS_pept        complement(104967..105443)
FT                   /transl_table=11
FT                   /gene="coaD"
FT                   /locus_tag="EAM_0076"
FT                   /product="phosphopantetheine adenylyltransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0076"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44751"
FT                   /protein_id="CBJ44751.1"
FT   misc_feature    complement(105039..105428)
FT                   /note="HMMPfam hit to PF01467, Cytidylyltransferase, score
FT                   1e-34"
FT   CDS_pept        complement(105440..106216)
FT                   /transl_table=11
FT                   /gene="kdtX"
FT                   /gene_synonym="waaE"
FT                   /locus_tag="EAM_0077"
FT                   /product="lipopolysaccharide core biosynthesis glycosyl
FT                   transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0077"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44752"
FT                   /protein_id="CBJ44752.1"
FT   misc_feature    complement(105680..106195)
FT                   /note="HMMPfam hit to PF00535, Glycosyl transferase
FT                   family,score 4.3e-17"
FT   CDS_pept        complement(106217..107491)
FT                   /transl_table=11
FT                   /gene="kdtA"
FT                   /locus_tag="EAM_0078"
FT                   /product="3-deoxy-D-manno-octulosonic-acid transferase"
FT                   /EC_number="2.-.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0078"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44753"
FT                   /protein_id="CBJ44753.1"
FT   misc_feature    complement(106292..106801)
FT                   /note="HMMPfam hit to PF00534, Glycosyl transferases
FT                   group,score 7e-05"
FT   misc_feature    complement(106856..107404)
FT                   /note="HMMPfam hit to
FT                   PF04413,3-Deoxy-D-manno-octulosonic-acid tran, score
FT                   4.8e-102"
FT   CDS_pept        107859..108872
FT                   /transl_table=11
FT                   /gene="waaQ"
FT                   /locus_tag="EAM_0079"
FT                   /product="putative heptosyl transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0079"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44754"
FT                   /protein_id="CBJ44754.1"
FT   misc_feature    108087..108863
FT                   /note="HMMPfam hit to PF01075, Glycosyltransferase
FT                   family,score 9.3e-10"
FT   CDS_pept        complement(108869..109966)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0080"
FT                   /product="glycosyl transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0080"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44755"
FT                   /protein_id="CBJ44755.1"
FT   misc_feature    complement(108908..109411)
FT                   /note="HMMPfam hit to PF00534, Glycosyl transferases
FT                   group,score 2e-25"
FT   misc_feature    complement(109514..109537)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(109969..111096)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0081"
FT                   /product="glycosyl transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0081"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44756"
FT                   /protein_id="CBJ44756.1"
FT   misc_feature    complement(110038..110523)
FT                   /note="HMMPfam hit to PF00534, Glycosyl transferases
FT                   group,score 4.9e-29"
FT   CDS_pept        complement(111093..112166)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0082"
FT                   /product="glycosyl transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0082"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44757"
FT                   /protein_id="CBJ44757.1"
FT                   DAIPVETVLNAARRLLA"
FT   misc_feature    complement(111147..111911)
FT                   /note="HMMPfam hit to PF01075, Glycosyltransferase
FT                   family,score 2e-49"
FT   CDS_pept        112327..113283
FT                   /transl_table=11
FT                   /locus_tag="EAM_0083"
FT                   /product="putative lipopolysaccahride biosynthesis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0083"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44758"
FT                   /protein_id="CBJ44758.1"
FT   CDS_pept        113285..114388
FT                   /transl_table=11
FT                   /locus_tag="EAM_0084"
FT                   /product="glycosyl transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0084"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44759"
FT                   /protein_id="CBJ44759.1"
FT   misc_feature    113582..114319
FT                   /note="HMMPfam hit to PF01075, Glycosyltransferase
FT                   family,score 3.7e-09"
FT   CDS_pept        complement(114401..115381)
FT                   /transl_table=11
FT                   /gene="wabM"
FT                   /locus_tag="EAM_0085"
FT                   /product="glycosyl transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0085"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44760"
FT                   /protein_id="CBJ44760.1"
FT   misc_feature    complement(114842..115357)
FT                   /note="HMMPfam hit to PF00535, Glycosyl transferase
FT                   family,score 5.9e-32"
FT   CDS_pept        complement(115375..116619)
FT                   /transl_table=11
FT                   /gene="waaL"
FT                   /locus_tag="EAM_0086"
FT                   /product="O-antigen ligase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0086"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44761"
FT                   /protein_id="CBJ44761.1"
FT                   LSMKKNQTVAEQPIC"
FT   misc_feature    complement(join(115414..115482,115540..115608,
FT                   115876..115929,115999..116067,116086..116145,
FT                   116188..116256,116281..116349,116377..116436,
FT                   116455..116514,116542..116595))
FT                   /note="10 probable transmembrane helices predicted for
FT                   EAM_0086 by TMHMM2.0 at aa 9-26, 36-55, 62-81,
FT                   91-113,122-144, 159-178, 185-207, 231-248, 338-360 and
FT                   380-402"
FT   CDS_pept        complement(116639..117805)
FT                   /transl_table=11
FT                   /gene="wabK"
FT                   /locus_tag="EAM_0087"
FT                   /product="glycosyl transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0087"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44762"
FT                   /protein_id="CBJ44762.1"
FT   misc_feature    complement(116714..117313)
FT                   /note="HMMPfam hit to PF00534, Glycosyl transferases
FT                   group,score 8.8e-13"
FT   CDS_pept        complement(117802..118767)
FT                   /transl_table=11
FT                   /gene="waaC"
FT                   /gene_synonym="rfaC"
FT                   /locus_tag="EAM_0088"
FT                   /product="lipopolysaccharide heptosyltransferase-1"
FT                   /EC_number="2.-.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0088"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44763"
FT                   /protein_id="CBJ44763.1"
FT   misc_feature    complement(117832..118545)
FT                   /note="HMMPfam hit to PF01075, Glycosyltransferase
FT                   family,score 4.4e-91"
FT   CDS_pept        complement(118768..119814)
FT                   /transl_table=11
FT                   /gene="waaF"
FT                   /gene_synonym="rfaF"
FT                   /locus_tag="EAM_0089"
FT                   /product="ADP-heptose-LPS heptosyltransferase II"
FT                   /EC_number="2.-.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0089"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44764"
FT                   /protein_id="CBJ44764.1"
FT                   MLHPTSGV"
FT   misc_feature    complement(118843..119610)
FT                   /note="HMMPfam hit to PF01075, Glycosyltransferase
FT                   family,score 6.4e-109"
FT   CDS_pept        complement(119829..120761)
FT                   /transl_table=11
FT                   /gene="waaD"
FT                   /gene_synonym="rfaD"
FT                   /gene_synonym="hldD"
FT                   /locus_tag="EAM_0090"
FT                   /product="ADP-L-Glycero-D-mannoheptose-6-epimerase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0090"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44765"
FT                   /protein_id="CBJ44765.1"
FT   misc_feature    complement(119850..120761)
FT                   /note="HMMPfam hit to PF04321, RmlD substrate binding
FT                   domain, score 0.001"
FT   misc_feature    complement(119964..120755)
FT                   /note="HMMPfam hit to PF01073, 3-beta hydroxysteroid
FT                   dehydrogenase/iso, score 3e-06"
FT   misc_feature    complement(120054..120758)
FT                   /note="HMMPfam hit to PF01370, NAD dependent
FT                   epimerase/dehydratase fam, score 6.2e-51"
FT   misc_feature    complement(120099..120752)
FT                   /note="HMMPfam hit to PF07993, Male sterility protein,score
FT                   0.0022"
FT   CDS_pept        complement(120943..121869)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0091"
FT                   /product="putative exported polysaccharide deacetylase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0091"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44766"
FT                   /protein_id="CBJ44766.1"
FT   misc_feature    complement(121156..121791)
FT                   /note="HMMPfam hit to PF04748, Divergent polysaccharide
FT                   deacetylase, score 6.1e-107"
FT   misc_feature    complement(121804..121869)
FT                   /note="Signal peptide predicted for EAM_0091 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.994) with cleavage site
FT                   probability 0.964 between residues 22 and 23"
FT   CDS_pept        complement(121876..123165)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0092"
FT                   /product="putative exported peptidase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0092"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44767"
FT                   /protein_id="CBJ44767.1"
FT   misc_feature    complement(121897..122184)
FT                   /note="HMMPfam hit to PF01551, Peptidase family M23, score
FT                   6.3e-41"
FT   misc_feature    complement(123037..123105)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0092 by TMHMM2.0 at aa 21-43"
FT   misc_feature    complement(123040..123165)
FT                   /note="Signal peptide predicted for EAM_0092 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.998 between residues 42 and 43"
FT   CDS_pept        123535..123966
FT                   /transl_table=11
FT                   /locus_tag="EAM_0093"
FT                   /product="putative rhodanese-like protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0093"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44768"
FT                   /protein_id="CBJ44768.1"
FT   misc_feature    123553..123621
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0093 by TMHMM2.0 at aa 7-29"
FT   misc_feature    123655..123939
FT                   /note="HMMPfam hit to PF00581, Rhodanese-like domain, score
FT                   3.5e-14"
FT   CDS_pept        124005..124256
FT                   /transl_table=11
FT                   /gene="grxC"
FT                   /locus_tag="EAM_0094"
FT                   /product="glutaredoxin 3"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0094"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44769"
FT                   /protein_id="CBJ44769.1"
FT   misc_feature    124014..124193
FT                   /note="HMMPfam hit to PF00462, Glutaredoxin, score 5.7e-28"
FT   misc_feature    124020..124070
FT                   /note="PS00195 Glutaredoxin active site."
FT   CDS_pept        124339..124800
FT                   /transl_table=11
FT                   /gene="secB"
FT                   /locus_tag="EAM_0095"
FT                   /product="protein-export protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0095"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44770"
FT                   /protein_id="CBJ44770.1"
FT   misc_feature    124339..124776
FT                   /note="HMMPfam hit to PF02556, Preprotein translocase
FT                   subunit SecB, score 5.2e-93"
FT   CDS_pept        124800..125819
FT                   /transl_table=11
FT                   /gene="gpsA"
FT                   /locus_tag="EAM_0096"
FT                   /product="glycerol-3-phosphate dehydrogenase [NAD(P)+]"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0096"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44771"
FT                   /protein_id="CBJ44771.1"
FT   misc_feature    124800..124862
FT                   /note="Signal peptide predicted for EAM_0096 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.974) with cleavage site
FT                   probability 0.943 between residues 21 and 22"
FT   misc_feature    124815..125294
FT                   /note="HMMPfam hit to PF01210, NAD-dependent
FT                   glycerol-3-phosphate deh, score 1.6e-73"
FT   misc_feature    124821..125282
FT                   /note="HMMPfam hit to PF02558, Ketopantoate reductase
FT                   PanE/ApbA, score 0.00039"
FT   misc_feature    125346..125780
FT                   /note="HMMPfam hit to PF07479, NAD-dependent
FT                   glycerol-3-phosphate deh, score 2.6e-78"
FT   misc_feature    125373..125438
FT                   /note="PS00957 NAD-dependent glycerol-3-phosphate
FT                   dehydrogenase signature."
FT   CDS_pept        125882..126700
FT                   /transl_table=11
FT                   /gene="cysE"
FT                   /locus_tag="EAM_0097"
FT                   /product="serine acetyltransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0097"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44772"
FT                   /protein_id="CBJ44772.1"
FT   misc_feature    125903..126217
FT                   /note="HMMPfam hit to PF06426, Serine
FT                   acetyltransferase,N-terminal, score 3.2e-61"
FT   misc_feature    126377..126430
FT                   /note="HMMPfam hit to PF00132, Bacterial transferase
FT                   hexapeptide (three rep, score 0.8"
FT   misc_feature    126455..126508
FT                   /note="HMMPfam hit to PF00132, Bacterial transferase
FT                   hexapeptide (three rep, score 9.7"
FT   misc_feature    126482..126568
FT                   /note="PS00101 Hexapeptide-repeat containing-transferases
FT                   signature."
FT   misc_feature    126509..126562
FT                   /note="HMMPfam hit to PF00132, Bacterial transferase
FT                   hexapeptide (three rep, score 2.1"
FT   CDS_pept        complement(126799..127269)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0098"
FT                   /product="putative RNA-methyltransferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0098"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44773"
FT                   /protein_id="CBJ44773.1"
FT   misc_feature    complement(126847..127269)
FT                   /note="HMMPfam hit to PF00588, SpoU rRNA Methylase
FT                   family,score 4.2e-39"
FT   CDS_pept        complement(127308..128687)
FT                   /transl_table=11
FT                   /gene="cpxA"
FT                   /locus_tag="EAM_0099"
FT                   /product="two-component sensor kinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0099"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44774"
FT                   /protein_id="CBJ44774.1"
FT                   E"
FT   misc_feature    complement(127326..127655)
FT                   /note="HMMPfam hit to PF02518, Histidine kinase-, DNA
FT                   gyrase B-, and HSP90, score 3.9e-37"
FT   misc_feature    complement(127788..127976)
FT                   /note="HMMPfam hit to PF00512, His Kinase A
FT                   (phosphoacceptor) domain, score 1.1e-17"
FT   misc_feature    complement(127986..128198)
FT                   /note="HMMPfam hit to PF00672, HAMP domain, score 3.6e-14"
FT   misc_feature    complement(join(128127..128195,128607..128675))
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0099 by TMHMM2.0 at aa 5-27 and 165-187"
FT   misc_feature    complement(128610..128687)
FT                   /note="Signal peptide predicted for EAM_0099 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.850) with cleavage site
FT                   probability 0.365 between residues 26 and 27"
FT   CDS_pept        complement(128684..129385)
FT                   /transl_table=11
FT                   /gene="cpxR"
FT                   /locus_tag="EAM_0100"
FT                   /product="two-component response regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0100"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44775"
FT                   /protein_id="CBJ44775.1"
FT                   RGRGYLMVSAT"
FT   misc_feature    complement(128699..128929)
FT                   /note="HMMPfam hit to PF00486, Transcriptional regulatory
FT                   protein, C te, score 7e-23"
FT   misc_feature    complement(129050..129382)
FT                   /note="HMMPfam hit to PF00072, Response regulator receiver
FT                   domain, score 3.1e-40"
FT   CDS_pept        129538..130047
FT                   /transl_table=11
FT                   /gene="cpxP"
FT                   /locus_tag="EAM_0101"
FT                   /product="extracytoplasmic stress protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0101"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44776"
FT                   /protein_id="CBJ44776.1"
FT                   STDSTP"
FT   misc_feature    129538..129612
FT                   /note="Signal peptide predicted for EAM_0101 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.566 between residues 25 and 26"
FT   misc_feature    129556..129624
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0101 by TMHMM2.0 at aa 7-29"
FT   CDS_pept        130191..131093
FT                   /transl_table=11
FT                   /gene="fieF"
FT                   /locus_tag="EAM_0102"
FT                   /product="ferrous-iron efflux pump"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0102"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44777"
FT                   /protein_id="CBJ44777.1"
FT   misc_feature    130191..130313
FT                   /note="Signal peptide predicted for EAM_0102 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.998) with cleavage site
FT                   probability 0.952 between residues 41 and 42"
FT   misc_feature    join(130224..130292,130302..130370,130428..130496,
FT                   130539..130607,130662..130715,130728..130787)
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0102 by TMHMM2.0 at aa 12-34, 38-60, 80-102,
FT                   117-139,158-175 and 180-199"
FT   misc_feature    130227..131063
FT                   /note="HMMPfam hit to PF01545, Cation efflux family, score
FT                   9.8e-100"
FT   CDS_pept        131299..132261
FT                   /transl_table=11
FT                   /gene="pfkA"
FT                   /locus_tag="EAM_0103"
FT                   /product="6-phosphofructokinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0103"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44778"
FT                   /protein_id="CBJ44778.1"
FT   misc_feature    131305..132132
FT                   /note="HMMPfam hit to PF00365, Phosphofructokinase, score
FT                   1.2e-181"
FT   misc_feature    132028..132084
FT                   /note="PS00433 Phosphofructokinase signature."
FT   CDS_pept        132405..133394
FT                   /transl_table=11
FT                   /gene="sbp"
FT                   /locus_tag="EAM_0104"
FT                   /product="sulfate-binding protein precursor (sulfate
FT                   starvation-induced protein)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0104"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44779"
FT                   /protein_id="CBJ44779.1"
FT   misc_feature    132405..132461
FT                   /note="Signal peptide predicted for EAM_0104 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 1.000 between residues 19 and 20"
FT   misc_feature    132420..133220
FT                   /note="HMMPfam hit to PF01547, Bacterial extracellular
FT                   solute-binding prot, score 1.2e-10"
FT   misc_feature    132837..132863
FT                   /note="PS00757 Prokaryotic sulfate-binding proteins
FT                   signature 2."
FT   CDS_pept        133580..134335
FT                   /transl_table=11
FT                   /gene="cdh"
FT                   /locus_tag="EAM_0105"
FT                   /product="CDP-diacylglycerol pyrophosphatase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0105"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44780"
FT                   /protein_id="CBJ44780.1"
FT   misc_feature    133589..134332
FT                   /note="HMMPfam hit to PF02611, CDP-diacylglycerol
FT                   pyrophosphatase, score 2e-76"
FT   misc_feature    133598..133666
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0105 by TMHMM2.0 at aa 7-29"
FT   CDS_pept        complement(134420..135442)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0106"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0106"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44781"
FT                   /protein_id="CBJ44781.1"
FT                   "
FT   misc_feature    complement(134465..135262)
FT                   /note="HMMPfam hit to PF03631, Ribonuclease BN-like
FT                   family,score 2e-27"
FT   misc_feature    complement(join(134483..134551,134594..134662,
FT                   134696..134764,134822..134890,134978..135046,
FT                   135155..135223))
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0106 by TMHMM2.0 at aa 74-96, 133-155, 185-207,227-249,
FT                   261-283 and 298-320"
FT   CDS_pept        complement(135903..136754)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0107"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0107"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44782"
FT                   /protein_id="CBJ44782.1"
FT                   QV"
FT   misc_feature    complement(135918..136745)
FT                   /note="HMMPfam hit to PF02567, Phenazine biosynthesis-like
FT                   protein, score 6.6e-64"
FT   misc_feature    complement(136503..136535)
FT                   /note="PS00178 Aminoacyl-transfer RNA synthetases class-I
FT                   signature."
FT   CDS_pept        complement(137006..137218)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0108"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0108"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44783"
FT                   /protein_id="CBJ44783.1"
FT   CDS_pept        complement(137364..138926)
FT                   /transl_table=11
FT                   /gene="mqo"
FT                   /locus_tag="EAM_0109"
FT                   /product="malate:quinone oxidoreductase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0109"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44784"
FT                   /protein_id="CBJ44784.1"
FT                   IGK"
FT   misc_feature    complement(137436..138911)
FT                   /note="HMMPfam hit to PF06039, Malate:quinone
FT                   oxidoreductase (Mqo), score 0"
FT   misc_feature    complement(137571..138896)
FT                   /note="HMMPfam hit to PF01266, FAD dependent
FT                   oxidoreductase, score 3.8e-05"
FT   CDS_pept        139070..139354
FT                   /transl_table=11
FT                   /locus_tag="EAM_0110"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0110"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44785"
FT                   /protein_id="CBJ44785.1"
FT   CDS_pept        complement(139323..140090)
FT                   /transl_table=11
FT                   /gene="tpiA"
FT                   /locus_tag="EAM_0111"
FT                   /product="triosephosphate isomerase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0111"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44786"
FT                   /protein_id="CBJ44786.1"
FT   misc_feature    complement(139353..140081)
FT                   /note="HMMPfam hit to PF00121, Triosephosphate
FT                   isomerase,score 1.1e-136"
FT   misc_feature    complement(139566..139598)
FT                   /note="PS00171 Triosephosphate isomerase active site."
FT   misc_feature    complement(139674..139697)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(140208..140801)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0112"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0112"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44787"
FT                   /protein_id="CBJ44787.1"
FT   misc_feature    complement(140211..140801)
FT                   /note="HMMPfam hit to PF07305, Protein of unknown function
FT                   (DUF1454), score 1.3e-99"
FT   misc_feature    complement(140736..140801)
FT                   /note="Signal peptide predicted for EAM_0112 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.737 between residues 22 and 23"
FT   misc_feature    complement(140739..140771)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        140892..141335
FT                   /transl_table=11
FT                   /locus_tag="EAM_0113"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0113"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44788"
FT                   /protein_id="CBJ44788.1"
FT   misc_feature    140892..141017
FT                   /note="Signal peptide predicted for EAM_0113 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.944) with cleavage site
FT                   probability 0.595 between residues 42 and 43"
FT   misc_feature    140907..141296
FT                   /note="HMMPfam hit to PF05656, Protein of unknown function
FT                   (DUF805), score 1.2e-32"
FT   misc_feature    join(140949..141017,141027..141080,141114..141173,
FT                   141186..141254)
FT                   /note="4 probable transmembrane helices predicted for
FT                   EAM_0113 by TMHMM2.0 at aa 20-42, 46-63, 75-94 and 99-121"
FT   CDS_pept        complement(141326..142072)
FT                   /transl_table=11
FT                   /gene="fpr"
FT                   /locus_tag="EAM_0114"
FT                   /product="ferredoxin--NADP reductase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0114"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44789"
FT                   /protein_id="CBJ44789.1"
FT   misc_feature    complement(141404..141745)
FT                   /note="HMMPfam hit to PF00175, Oxidoreductase NAD-binding
FT                   domain, score 1.3e-18"
FT   misc_feature    complement(141776..142057)
FT                   /note="HMMPfam hit to PF00970, Oxidoreductase FAD-binding
FT                   domain, score 1.5e-06"
FT   misc_feature    complement(141992..142072)
FT                   /note="PS00430 TonB-dependent receptor proteins signature
FT                   1."
FT   CDS_pept        142382..143560
FT                   /transl_table=11
FT                   /gene="emrD"
FT                   /locus_tag="EAM_0115"
FT                   /product="multidrug resistance protein D (major facilitator
FT                   superfamily protein)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0115"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44790"
FT                   /protein_id="CBJ44790.1"
FT   misc_feature    142382..142450
FT                   /note="Signal peptide predicted for EAM_0115 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.997) with cleavage site
FT                   probability 0.844 between residues 23 and 24"
FT   misc_feature    join(142406..142474,142586..142654,142673..142741,
FT                   142784..142852,142871..142930,143015..143083,
FT                   143102..143170,143198..143266,143285..143353,
FT                   143465..143533)
FT                   /note="10 probable transmembrane helices predicted for
FT                   EAM_0115 by TMHMM2.0 at aa 9-31, 69-91, 98-120,
FT                   135-157,164-183, 212-234, 241-263, 273-295, 302-324 and
FT                   362-384"
FT   misc_feature    142418..143458
FT                   /note="HMMPfam hit to PF07690, Major Facilitator
FT                   Superfamily, score 1.8e-42"
FT   CDS_pept        complement(143602..144612)
FT                   /transl_table=11
FT                   /gene="glpX"
FT                   /locus_tag="EAM_0116"
FT                   /product="fructose-1,6-bisphosphatase class II"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0116"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44791"
FT                   /protein_id="CBJ44791.1"
FT   misc_feature    complement(143647..144609)
FT                   /note="HMMPfam hit to PF03320, Bacterial
FT                   fructose-1,6-bisphosphatase, gl, score 2.3e-225"
FT   CDS_pept        144825..145826
FT                   /transl_table=11
FT                   /locus_tag="EAM_0117"
FT                   /product="putative transport protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0117"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44792"
FT                   /protein_id="CBJ44792.1"
FT   misc_feature    144825..144959
FT                   /note="Signal peptide predicted for EAM_0117 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.875) with cleavage site
FT                   probability 0.808 between residues 45 and 46"
FT   misc_feature    join(144885..144938,144951..145019,145056..145124,
FT                   145140..145208,145227..145295,145338..145406,
FT                   145440..145508,145536..145604,145665..145733)
FT                   /note="9 probable transmembrane helices predicted for
FT                   EAM_0117 by TMHMM2.0 at aa 21-38, 43-65, 78-100,
FT                   106-128,135-157, 172-194, 206-228, 238-260 and 281-303"
FT   misc_feature    144969..145529
FT                   /note="HMMPfam hit to PF01758, Sodium Bile acid symporter
FT                   family, score 0.0014"
FT   CDS_pept        complement(145873..147387)
FT                   /transl_table=11
FT                   /gene="glpK"
FT                   /locus_tag="EAM_0118"
FT                   /product="glycerol kinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0118"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44793"
FT                   /protein_id="CBJ44793.1"
FT   misc_feature    complement(145942..146619)
FT                   /note="HMMPfam hit to PF02782, FGGY family of carbohydrate
FT                   kinases, C-termi, score 2.6e-102"
FT   misc_feature    complement(146236..146298)
FT                   /note="PS00445 FGGY family of carbohydrate kinases
FT                   signature 2."
FT   misc_feature    complement(146626..147369)
FT                   /note="HMMPfam hit to PF00370, FGGY family of carbohydrate
FT                   kinases, N-termi, score 3.2e-128"
FT   misc_feature    complement(146941..146979)
FT                   /note="PS00933 FGGY family of carbohydrate kinases
FT                   signature 1."
FT   CDS_pept        complement(147431..148264)
FT                   /transl_table=11
FT                   /gene="glpF"
FT                   /locus_tag="EAM_0119"
FT                   /product="glycerol uptake facilitator protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0119"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44794"
FT                   /protein_id="CBJ44794.1"
FT   misc_feature    complement(join(147497..147565,147662..147730,
FT                   147767..147835,147938..148006,148064..148132,
FT                   148160..148228))
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0119 by TMHMM2.0 at aa 13-35, 45-67, 87-109,
FT                   144-166,179-201 and 234-256"
FT   misc_feature    complement(147509..148261)
FT                   /note="HMMPfam hit to PF00230, Major intrinsic
FT                   protein,score 2.9e-96"
FT   misc_feature    complement(148040..148066)
FT                   /note="PS00221 MIP family signature."
FT   misc_feature    complement(148178..148210)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        148704..148943
FT                   /transl_table=11
FT                   /locus_tag="EAM_0120"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0120"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44795"
FT                   /protein_id="CBJ44795.1"
FT   misc_feature    148704..148940
FT                   /note="HMMPfam hit to PF06005, Protein of unknown function
FT                   (DUF904), score 3.6e-42"
FT   CDS_pept        complement(149021..149506)
FT                   /transl_table=11
FT                   /gene="rraA"
FT                   /locus_tag="EAM_0121"
FT                   /product="regulator of ribonuclease activity A"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0121"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44796"
FT                   /protein_id="CBJ44796.1"
FT   misc_feature    complement(149048..149506)
FT                   /note="HMMPfam hit to PF03737, Demethylmenaquinone
FT                   methyltransferase, score 7.1e-74"
FT   CDS_pept        complement(149686..151017)
FT                   /transl_table=11
FT                   /gene="hslU"
FT                   /locus_tag="EAM_0122"
FT                   /product="ATP-dependent Hsl protease ATP-binding subunit
FT                   (heat shock protein)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0122"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44797"
FT                   /protein_id="CBJ44797.1"
FT   misc_feature    complement(150031..150510)
FT                   /note="HMMPfam hit to PF07724, ATPase family associated
FT                   with various cellul, score 1.8e-55"
FT   misc_feature    complement(150826..150849)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(151030..151560)
FT                   /transl_table=11
FT                   /gene="hslV"
FT                   /locus_tag="EAM_0123"
FT                   /product="ATP-dependent protease (heat shock protein)"
FT                   /EC_number="3.4.25.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0123"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44798"
FT                   /protein_id="CBJ44798.1"
FT                   NHNLTIEELPSKA"
FT   misc_feature    complement(151045..151560)
FT                   /note="HMMPfam hit to PF00227, Proteasome A-type and
FT                   B-type, score 7.7e-35"
FT   CDS_pept        complement(151651..152538)
FT                   /transl_table=11
FT                   /gene="ftsN"
FT                   /locus_tag="EAM_0124"
FT                   /product="cell division protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0124"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44799"
FT                   /protein_id="CBJ44799.1"
FT                   GSGHSNCIPVAAGG"
FT   misc_feature    complement(151663..151881)
FT                   /note="HMMPfam hit to PF05036, Sporulation related
FT                   domain,score 7.1e-18"
FT   misc_feature    complement(152374..152442)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0124 by TMHMM2.0 at aa 33-55"
FT   CDS_pept        complement(152709..153746)
FT                   /transl_table=11
FT                   /gene="cytR"
FT                   /locus_tag="EAM_0125"
FT                   /product="transcriptional repressor (LacI-family
FT                   transcriptional regulator)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0125"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44800"
FT                   /protein_id="CBJ44800.1"
FT                   LRDCD"
FT   misc_feature    complement(152742..153548)
FT                   /note="HMMPfam hit to PF00532, Periplasmic binding proteins
FT                   and sugar b, score 1.1e-16"
FT   misc_feature    complement(153642..153719)
FT                   /note="HMMPfam hit to PF00356, Bacterial regulatory
FT                   proteins, lacI fami, score 7.6e-12"
FT   misc_feature    complement(153654..153719)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1739.000, SD 5.11 at aa 10-31, sequence
FT   misc_feature    complement(153657..153713)
FT                   /note="PS00356 Bacterial regulatory proteins, lacI family
FT                   signature."
FT   CDS_pept        complement(153955..156153)
FT                   /transl_table=11
FT                   /gene="priA"
FT                   /locus_tag="EAM_0126"
FT                   /product="primosomal protein N' (ATP-dependent helicase)"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0126"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44801"
FT                   /protein_id="CBJ44801.1"
FT   misc_feature    complement(154387..154659)
FT                   /note="HMMPfam hit to PF00271, Helicase conserved
FT                   C-terminal domain, score 0.00047"
FT   misc_feature    complement(155053..155556)
FT                   /note="HMMPfam hit to PF00270, DEAD/DEAH box helicase,score
FT                   4.2e-28"
FT   misc_feature    complement(155071..155568)
FT                   /note="HMMPfam hit to PF04851, Type III restriction
FT                   enzyme,res subunit, score 4.8e-08"
FT   misc_feature    complement(155461..155484)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        156370..156582
FT                   /transl_table=11
FT                   /gene="rpmE"
FT                   /locus_tag="EAM_0127"
FT                   /product="50S ribosomal protein L31"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0127"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44802"
FT                   /protein_id="CBJ44802.1"
FT   misc_feature    156370..156570
FT                   /note="HMMPfam hit to PF01197, Ribosomal protein L31, score
FT                   4.5e-43"
FT   misc_feature    156478..156495
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   misc_feature    156490..156546
FT                   /note="PS01143 Ribosomal protein L31 signature."
FT   misc_feature    156604..157963
FT                   /note="unique vs ECA"
FT   CDS_pept        156613..156852
FT                   /transl_table=11
FT                   /locus_tag="EAM_0128"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0128"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44803"
FT                   /protein_id="CBJ44803.1"
FT   CDS_pept        156904..157131
FT                   /transl_table=11
FT                   /locus_tag="EAM_0129"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0129"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44804"
FT                   /protein_id="CBJ44804.1"
FT   misc_feature    156904..157038
FT                   /note="Signal peptide predicted for EAM_0129 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.968) with cleavage site
FT                   probability 0.896 between residues 45 and 46"
FT   misc_feature    156937..157005
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0129 by TMHMM2.0 at aa 12-34"
FT   CDS_pept        157136..157387
FT                   /transl_table=11
FT                   /locus_tag="EAM_0130"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0130"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44805"
FT                   /protein_id="CBJ44805.1"
FT   CDS_pept        157684..157800
FT                   /transl_table=11
FT                   /locus_tag="EAM_0131"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0131"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44806"
FT                   /protein_id="CBJ44806.1"
FT   misc_feature    157702..157761
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0131 by TMHMM2.0 at aa 7-26"
FT   misc_feature    157708..157740
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(157972..158289)
FT                   /transl_table=11
FT                   /gene="metJ"
FT                   /locus_tag="EAM_0132"
FT                   /product="repressor of the methionine regulon"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0132"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44807"
FT                   /protein_id="CBJ44807.1"
FT                   Y"
FT   misc_feature    complement(157975..158286)
FT                   /note="HMMPfam hit to PF01340, Met Apo-repressor,
FT                   MetJ,score 1.2e-84"
FT   CDS_pept        158533..159693
FT                   /transl_table=11
FT                   /gene="metB"
FT                   /locus_tag="EAM_0133"
FT                   /product="cystathionine gamma-synthase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0133"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44808"
FT                   /protein_id="CBJ44808.1"
FT   misc_feature    158548..159675
FT                   /note="HMMPfam hit to PF01053, Cys/Met metabolism
FT                   PLP-dependent enzy, score 1.8e-203"
FT   misc_feature    159100..159144
FT                   /note="PS00868 Cys/Met metabolism enzymes
FT                   pyridoxal-phosphate attachment site."
FT   CDS_pept        159696..162131
FT                   /transl_table=11
FT                   /gene="metL"
FT                   /locus_tag="EAM_0134"
FT                   /product="bifunctional aspartokinase/homoserine
FT                   dehydrogenase II [includes: aspartokinase II; homoserine
FT                   dehydrogenase I]"
FT                   /EC_number=""
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0134"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44809"
FT                   /protein_id="CBJ44809.1"
FT   misc_feature    159729..160559
FT                   /note="HMMPfam hit to PF00696, Amino acid kinase
FT                   family,score 3.8e-39"
FT   misc_feature    159738..159764
FT                   /note="PS00324 Aspartokinase signature."
FT   misc_feature    160332..160397
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1009.000, SD 2.62 at aa 213-234, sequence
FT   misc_feature    161091..161498
FT                   /note="HMMPfam hit to PF03447, Homoserine dehydrogenase,NAD
FT                   binding d, score 2.5e-36"
FT   misc_feature    161520..162110
FT                   /note="HMMPfam hit to PF00742, Homoserine
FT                   dehydrogenase,score 3e-99"
FT   misc_feature    161658..161726
FT                   /note="PS01042 Homoserine dehydrogenase signature."
FT   CDS_pept        162385..163290
FT                   /transl_table=11
FT                   /gene="metF"
FT                   /locus_tag="EAM_0135"
FT                   /product="5,10 methylenetetrahydrofolate reductase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0135"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44810"
FT                   /protein_id="CBJ44810.1"
FT   misc_feature    162415..163257
FT                   /note="HMMPfam hit to PF02219, Methylenetetrahydrofolate
FT                   reductase, score 2.5e-162"
FT   CDS_pept        complement(163581..166232)
FT                   /transl_table=11
FT                   /gene="ppc"
FT                   /locus_tag="EAM_0136"
FT                   /product="phosphoenolpyruvate carboxylase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0136"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44811"
FT                   /protein_id="CBJ44811.1"
FT                   IAGVAAGMRNTG"
FT   misc_feature    complement(163584..166232)
FT                   /note="HMMPfam hit to PF00311, Phosphoenolpyruvate
FT                   carboxylase, score 1.5e-222"
FT   misc_feature    complement(164586..164624)
FT                   /note="PS00393 Phosphoenolpyruvate carboxylase active site
FT                   2."
FT   misc_feature    complement(165798..165833)
FT                   /note="PS00781 Phosphoenolpyruvate carboxylase active site
FT                   1."
FT   CDS_pept        complement(166469..167620)
FT                   /transl_table=11
FT                   /gene="argE"
FT                   /locus_tag="EAM_0137"
FT                   /product="acetylornithine deacetylase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0137"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44812"
FT                   /protein_id="CBJ44812.1"
FT   misc_feature    complement(166484..167395)
FT                   /note="HMMPfam hit to PF01546, Peptidase family
FT                   M20/M25/M40, score 1.3e-41"
FT   misc_feature    complement(166751..167092)
FT                   /note="HMMPfam hit to PF07687, Peptidase dimerisation
FT                   domain, score 1e-32"
FT   misc_feature    complement(167180..167293)
FT                   /note="PS00759 ArgE / dapE / ACY1 / CPG2 / yscS family
FT                   signature 2."
FT   misc_feature    complement(167369..167398)
FT                   /note="PS00758 ArgE / dapE / ACY1 / CPG2 / yscS family
FT                   signature 1."
FT   CDS_pept        167786..168565
FT                   /transl_table=11
FT                   /gene="argB"
FT                   /locus_tag="EAM_0138"
FT                   /product="acetylglutamate kinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0138"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44813"
FT                   /protein_id="CBJ44813.1"
FT   misc_feature    167792..168493
FT                   /note="HMMPfam hit to PF00696, Amino acid kinase
FT                   family,score 1.1e-41"
FT   CDS_pept        168595..169809
FT                   /transl_table=11
FT                   /gene="argG"
FT                   /locus_tag="EAM_0139"
FT                   /product="argininosuccinate synthase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0139"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44814"
FT                   /protein_id="CBJ44814.1"
FT                   LNEKK"
FT   misc_feature    168622..169797
FT                   /note="HMMPfam hit to PF00764, Arginosuccinate
FT                   synthase,score 1.6e-174"
FT   misc_feature    168628..168654
FT                   /note="PS00564 Argininosuccinate synthase signature 1."
FT   misc_feature    168958..168993
FT                   /note="PS00565 Argininosuccinate synthase signature 2."
FT   CDS_pept        169902..171275
FT                   /transl_table=11
FT                   /gene="argH"
FT                   /locus_tag="EAM_0140"
FT                   /product="argininosuccinate lyase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0140"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44815"
FT                   /protein_id="CBJ44815.1"
FT   misc_feature    169917..170804
FT                   /note="HMMPfam hit to PF00206, Lyase, score 3.8e-137"
FT   misc_feature    170727..170756
FT                   /note="PS00163 Fumarate lyases signature."
FT   CDS_pept        complement(171326..172057)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0141"
FT                   /product="hybrid peroxiredoxin hyprx5 (thioredoxin
FT                   reductase)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0141"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44816"
FT                   /protein_id="CBJ44816.1"
FT   misc_feature    complement(171365..171541)
FT                   /note="HMMPfam hit to PF00462, Glutaredoxin, score 8.6e-22"
FT   misc_feature    complement(171485..171535)
FT                   /note="PS00195 Glutaredoxin active site."
FT   misc_feature    complement(171569..172045)
FT                   /note="HMMPfam hit to PF08534, Redoxin, score 1.1e-39"
FT   misc_feature    complement(171596..172027)
FT                   /note="HMMPfam hit to PF00578, AhpC/TSA family, score
FT                   5.2e-05"
FT   CDS_pept        172192..173097
FT                   /transl_table=11
FT                   /gene="oxyR"
FT                   /locus_tag="EAM_0142"
FT                   /product="hydrogen peroxide-inducible genes activator
FT                   (LysR-family transcriptional regulator)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0142"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44817"
FT                   /protein_id="CBJ44817.1"
FT   misc_feature    172198..172377
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 9.8e-22"
FT   misc_feature    172237..172302
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1816.000, SD 5.37 at aa 16-37, sequence
FT   misc_feature    172240..172332
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    172447..173073
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 4.5e-58"
FT   CDS_pept        complement(173089..174489)
FT                   /transl_table=11
FT                   /gene="sthA"
FT                   /gene_synonym="udhA"
FT                   /locus_tag="EAM_0143"
FT                   /product="soluble pyridine nucleotide transhydrogenase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0143"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44818"
FT                   /protein_id="CBJ44818.1"
FT                   LNGLNRLF"
FT   misc_feature    complement(173116..173454)
FT                   /note="HMMPfam hit to PF02852, Pyridine
FT                   nucleotide-disulphide oxidored, score 4.4e-39"
FT   misc_feature    complement(173542..174468)
FT                   /note="HMMPfam hit to PF07992, Pyridine
FT                   nucleotide-disulphide oxidored, score 5.2e-44"
FT   misc_feature    complement(173680..173958)
FT                   /note="HMMPfam hit to PF00070, Pyridine
FT                   nucleotide-disulphide oxidored, score 3.5e-27"
FT   misc_feature    complement(174193..174258)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1019.000, SD 2.66 at aa 78-99, sequence
FT   CDS_pept        174682..175338
FT                   /transl_table=11
FT                   /locus_tag="EAM_0144"
FT                   /product="TetR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0144"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44819"
FT                   /protein_id="CBJ44819.1"
FT   misc_feature    174724..174867
FT                   /note="HMMPfam hit to PF00440, Bacterial regulatory
FT                   proteins, tetR family, score 1e-10"
FT   misc_feature    174775..174840
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1615.000, SD 4.69 at aa 32-53, sequence
FT   CDS_pept        175335..175688
FT                   /transl_table=11
FT                   /locus_tag="EAM_0145"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0145"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44820"
FT                   /protein_id="CBJ44820.1"
FT                   FWIGMRLKRYSST"
FT   misc_feature    175335..175415
FT                   /note="Signal peptide predicted for EAM_0145 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.991) with cleavage site
FT                   probability 0.947 between residues 27 and 28"
FT   misc_feature    175353..175685
FT                   /note="HMMPfam hit to PF07226, Protein of unknown function
FT                   (DUF1422), score 1.9e-46"
FT   misc_feature    join(175371..175466,175524..175583,175602..175661)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0145 by TMHMM2.0 at aa 13-44, 64-83 and 90-109"
FT   CDS_pept        complement(175788..176891)
FT                   /transl_table=11
FT                   /gene="trmA"
FT                   /locus_tag="EAM_0146"
FT                   /product="tRNA (uracil-5)-methyltransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0146"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44821"
FT                   /protein_id="CBJ44821.1"
FT   misc_feature    complement(175794..176864)
FT                   /note="HMMPfam hit to PF05958, tRNA
FT                   (Uracil-5-)-methyltransferase, score 7.6e-270"
FT   misc_feature    complement(175818..175850)
FT                   /note="PS01231 RNA methyltransferase trmA family signature
FT                   2."
FT   misc_feature    complement(175908..175997)
FT                   /note="PS01230 RNA methyltransferase trmA family signature
FT                   1."
FT   CDS_pept        177095..177946
FT                   /transl_table=11
FT                   /gene="murI"
FT                   /locus_tag="EAM_0147"
FT                   /product="glutamate racemase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0147"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44822"
FT                   /protein_id="CBJ44822.1"
FT                   AL"
FT   misc_feature    177161..177814
FT                   /note="HMMPfam hit to PF01177, Asp/Glu/Hydantoin
FT                   racemase,score 1.3e-88"
FT   misc_feature    177359..177385
FT                   /note="PS00923 Aspartate and glutamate racemases signature
FT                   1."
FT   misc_feature    177692..177724
FT                   /note="PS00924 Aspartate and glutamate racemases signature
FT                   2."
FT   rRNA            178350..179907
FT                   /gene="16S rRNA"
FT                   /locus_tag="EAM_r004"
FT                   /note="rRNA"
FT   tRNA            179966..180038
FT                   /gene="tRNA-Glu"
FT                   /locus_tag="EAM_t003"
FT                   /product="transfer RNA-Glu"
FT                   /anticodon="(pos:180000..180002,aa:Glu)"
FT                   /note="tRNA Glu anticodon TTC, Cove score 52.04"
FT   rRNA            180305..183262
FT                   /gene="23S rRNA"
FT                   /locus_tag="EAM_r005"
FT                   /note="rRNA"
FT   rRNA            183459..183592
FT                   /gene="5S rRNA"
FT                   /locus_tag="EAM_r006"
FT                   /note="rRNA"
FT   tRNA            183687..183760
FT                   /gene="tRNA-Asp"
FT                   /locus_tag="EAM_t004"
FT                   /product="transfer RNA-Asp"
FT                   /anticodon="(pos:183721..183723,aa:Asp)"
FT                   /note="tRNA Asp anticodon GTC, Cove score 78.67"
FT   tRNA            183771..183843
FT                   /gene="tRNA-Trp"
FT                   /locus_tag="EAM_t005"
FT                   /product="transfer RNA-Trp"
FT                   /anticodon="(pos:183804..183806,aa:Trp)"
FT                   /note="tRNA Trp anticodon CCA, Cove score 57.70"
FT   CDS_pept        complement(183964..184791)
FT                   /transl_table=11
FT                   /gene="hdfR"
FT                   /locus_tag="EAM_0148"
FT                   /product="H-NS-dependent flhD regulator (LysR-family
FT                   transcriptional regulator)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0148"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44823"
FT                   /protein_id="CBJ44823.1"
FT   misc_feature    complement(183967..184542)
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 1.2e-11"
FT   misc_feature    complement(184606..184785)
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 4.1e-20"
FT   misc_feature    complement(184651..184743)
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    complement(184681..184746)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1427.000, SD 4.05 at aa 16-37, sequence
FT   CDS_pept        184912..185250
FT                   /transl_table=11
FT                   /locus_tag="EAM_0149"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0149"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44824"
FT                   /protein_id="CBJ44824.1"
FT                   EDYSDSDD"
FT   misc_feature    184912..185241
FT                   /note="HMMPfam hit to PF04219, Protein of unknown
FT                   function,DUF, score 5.4e-50"
FT   CDS_pept        complement(185282..186802)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0150"
FT                   /product="putative magnesium chelatase family protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0150"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44825"
FT                   /protein_id="CBJ44825.1"
FT   misc_feature    complement(185405..185470)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1158.000, SD 3.13 at aa 445-466, sequence
FT   misc_feature    complement(185624..186238)
FT                   /note="HMMPfam hit to PF01078, Magnesium chelatase, subunit
FT                   ChlI, score 1.6e-137"
FT   misc_feature    complement(185642..186169)
FT                   /note="HMMPfam hit to PF07728, ATPase family associated
FT                   with various ce, score 2.3e-05"
FT   misc_feature    complement(186131..186154)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(186236..186253)
FT                   /note="PS00343 Gram-positive cocci surface proteins
FT                   'anchoring' hexapeptide."
FT   CDS_pept        187376..189022
FT                   /transl_table=11
FT                   /gene="ilvG"
FT                   /locus_tag="EAM_0151"
FT                   /product="acetolactate synthase isozyme II large subunit"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0151"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44826"
FT                   /protein_id="CBJ44826.1"
FT   misc_feature    187376..187885
FT                   /note="HMMPfam hit to PF02776, Thiamine pyrophosphate
FT                   enzyme, N-termina, score 5.3e-101"
FT   misc_feature    187553..187645
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    187928..188377
FT                   /note="HMMPfam hit to PF00205, Thiamine pyrophosphate
FT                   enzyme, central d, score 1.5e-60"
FT   misc_feature    188495..188941
FT                   /note="HMMPfam hit to PF02775, Thiamine pyrophosphate
FT                   enzyme, C-termina, score 7.6e-73"
FT   misc_feature    188606..188665
FT                   /note="PS00187 Thiamine pyrophosphate enzymes signature."
FT   CDS_pept        189019..189276
FT                   /transl_table=11
FT                   /gene="ilvM"
FT                   /locus_tag="EAM_0152"
FT                   /product="acetolactate synthase isozyme II small subunit"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0152"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44827"
FT                   /protein_id="CBJ44827.1"
FT   CDS_pept        189295..190221
FT                   /transl_table=11
FT                   /gene="ilvE"
FT                   /locus_tag="EAM_0153"
FT                   /product="branched-chain amino acid aminotransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0153"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44828"
FT                   /protein_id="CBJ44828.1"
FT   misc_feature    189325..190161
FT                   /note="HMMPfam hit to PF01063, Aminotransferase class
FT                   IV,score 2.3e-136"
FT   misc_feature    189871..189960
FT                   /note="PS00770 Aminotransferases class-IV signature."
FT   CDS_pept        190287..192137
FT                   /transl_table=11
FT                   /gene="ilvD"
FT                   /locus_tag="EAM_0154"
FT                   /product="dihydroxy-acid dehydratase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0154"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44829"
FT                   /protein_id="CBJ44829.1"
FT   misc_feature    190386..192116
FT                   /note="HMMPfam hit to PF00920, Dehydratase family, score 0"
FT   misc_feature    190650..190682
FT                   /note="PS00886 Dihydroxy-acid and 6-phosphogluconate
FT                   dehydratases signature 1."
FT   misc_feature    190722..190745
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    191811..191846
FT                   /note="PS00887 Dihydroxy-acid and 6-phosphogluconate
FT                   dehydratases signature 2."
FT   CDS_pept        192143..193687
FT                   /transl_table=11
FT                   /gene="ilvA"
FT                   /locus_tag="EAM_0155"
FT                   /product="threonine dehydratase biosynthetic (threonin
FT                   deaminase)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0155"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44830"
FT                   /protein_id="CBJ44830.1"
FT   misc_feature    192215..193093
FT                   /note="HMMPfam hit to PF00291, Pyridoxal-phosphate
FT                   dependent enzyme, score 6.1e-98"
FT   misc_feature    192299..192340
FT                   /note="PS00165 Serine/threonine dehydratases
FT                   pyridoxal-phosphate attachment site."
FT   misc_feature    193127..193399
FT                   /note="HMMPfam hit to PF00585, C-terminal regulatory domain
FT                   of Threon, score 7.5e-43"
FT   misc_feature    193412..193678
FT                   /note="HMMPfam hit to PF00585, C-terminal regulatory domain
FT                   of Threon, score 4.1e-42"
FT   CDS_pept        complement(193684..194565)
FT                   /transl_table=11
FT                   /gene="ilvY"
FT                   /locus_tag="EAM_0156"
FT                   /product="LysR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0156"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44831"
FT                   /protein_id="CBJ44831.1"
FT                   MEPLIDAFWKLL"
FT   misc_feature    complement(193687..194310)
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 1.7e-31"
FT   misc_feature    complement(194380..194559)
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 2.7e-21"
FT   misc_feature    complement(194425..194517)
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    complement(194455..194520)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1925.000, SD 5.74 at aa 16-37, sequence
FT   CDS_pept        194731..196209
FT                   /transl_table=11
FT                   /gene="ilvC"
FT                   /locus_tag="EAM_0157"
FT                   /product="ketol-acid reductoisomerase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0157"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44832"
FT                   /protein_id="CBJ44832.1"
FT   misc_feature    194830..195342
FT                   /note="HMMPfam hit to PF07991, Acetohydroxy acid
FT                   isomeroreductase, catalyti, score 8.5e-85"
FT   misc_feature    195358..196188
FT                   /note="HMMPfam hit to PF01450, Acetohydroxy acid
FT                   isomeroreductase, catalyti, score 2.1e-130"
FT   CDS_pept        complement(196268..196549)
FT                   /transl_table=11
FT                   /gene="ppiC"
FT                   /locus_tag="EAM_0158"
FT                   /product="peptidyl-prolyl cis-trans isomerase C"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0158"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44833"
FT                   /protein_id="CBJ44833.1"
FT   misc_feature    complement(196277..196525)
FT                   /note="HMMPfam hit to PF00639, PPIC-type PPIASE
FT                   domain,score 4.8e-37"
FT   misc_feature    complement(196397..196459)
FT                   /note="PS01096 PpiC-type peptidyl-prolyl cis-trans
FT                   isomerase signature."
FT   CDS_pept        196638..198656
FT                   /transl_table=11
FT                   /gene="rep"
FT                   /locus_tag="EAM_0159"
FT                   /product="ATP-dependent DNA helicase"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0159"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44834"
FT                   /protein_id="CBJ44834.1"
FT   misc_feature    196644..198089
FT                   /note="HMMPfam hit to PF00580, UvrD/REP helicase, score
FT                   2.6e-220"
FT   misc_feature    196701..196724
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(198689..200173)
FT                   /transl_table=11
FT                   /gene="gppA"
FT                   /locus_tag="EAM_0160"
FT                   /product="guanosine-5'-triphosphate,3'-diphosphate
FT                   pyrophosphatase (guanosine pentaphosphatase)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0160"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44835"
FT                   /protein_id="CBJ44835.1"
FT   misc_feature    complement(199265..200113)
FT                   /note="HMMPfam hit to PF02541, Ppx/GppA phosphatase
FT                   family,score 1.9e-122"
FT   CDS_pept        complement(200180..201472)
FT                   /transl_table=11
FT                   /gene="rhlB"
FT                   /locus_tag="EAM_0161"
FT                   /product="ATP-dependent RNA helicase"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0161"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44836"
FT                   /protein_id="CBJ44836.1"
FT   misc_feature    complement(200420..200650)
FT                   /note="HMMPfam hit to PF00271, Helicase conserved
FT                   C-terminal domain, score 9.8e-34"
FT   misc_feature    complement(200849..201376)
FT                   /note="HMMPfam hit to PF00270, DEAD/DEAH box helicase,score
FT                   6.6e-59"
FT   misc_feature    complement(200960..200986)
FT                   /note="PS00039 DEAD-box subfamily ATP-dependent helicases
FT                   signature."
FT   misc_feature    complement(201293..201316)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        201602..201931
FT                   /transl_table=11
FT                   /gene="trxA"
FT                   /locus_tag="EAM_0162"
FT                   /product="thioredoxin"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0162"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44837"
FT                   /protein_id="CBJ44837.1"
FT                   NANLG"
FT   misc_feature    201611..201922
FT                   /note="HMMPfam hit to PF00085, Thioredoxin, score 2.7e-52"
FT   misc_feature    201674..201730
FT                   /note="PS00194 Thioredoxin family active site."
FT   CDS_pept        202300..203559
FT                   /transl_table=11
FT                   /gene="rho"
FT                   /locus_tag="EAM_0163"
FT                   /product="transcription termination factor Rho"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0163"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44838"
FT                   /protein_id="CBJ44838.1"
FT   misc_feature    202312..202440
FT                   /note="HMMPfam hit to PF07498, Rho termination
FT                   factor,N-terminal domai, score 2.8e-20"
FT   misc_feature    202444..202677
FT                   /note="HMMPfam hit to PF07497, Rho termination
FT                   factor,RNA-binding doma, score 4.1e-58"
FT   misc_feature    202456..202647
FT                   /note="HMMPfam hit to PF08206, Ribonuclease B OB
FT                   domain,score 0.00098"
FT   misc_feature    202729..202803
FT                   /note="PS00464 Ribosomal protein L22 signature."
FT   misc_feature    202768..203394
FT                   /note="HMMPfam hit to PF00006, ATP synthase alpha/beta
FT                   family, nucleoti, score 6.5e-76"
FT   misc_feature    202831..202854
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    203851..216652
FT                   /note="LPS biosynthesis locus"
FT   CDS_pept        203851..204957
FT                   /transl_table=11
FT                   /gene="wecA"
FT                   /gene_synonym="rfe"
FT                   /locus_tag="EAM_0164"
FT                   /product="undecaprenyl-phosphate
FT                   alpha-N-acetylglucosaminyltransferase"
FT                   /EC_number="2.7.8.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0164"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44839"
FT                   /protein_id="CBJ44839.1"
FT   misc_feature    203851..203931
FT                   /note="Signal peptide predicted for EAM_0164 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.961) with cleavage site
FT                   probability 0.430 between residues 27 and 28"
FT   misc_feature    join(203878..203922,203983..204045,204058..204117,
FT                   204163..204231,204241..204309,204328..204387,
FT                   204400..204468,204487..204546,204574..204633,
FT                   204730..204798,204811..204864)
FT                   /note="11 probable transmembrane helices predicted for
FT                   EAM_0164 by TMHMM2.0 at aa 10-24, 45-65, 70-89,
FT                   105-127,131-153, 160-179, 184-206, 213-232, 242-261,
FT                   294-316 and 321-338"
FT   misc_feature    204067..204558
FT                   /note="HMMPfam hit to PF00953, Glycosyl transferase
FT                   family,score 1.2e-09"
FT   CDS_pept        204984..206012
FT                   /transl_table=11
FT                   /gene="wzzE"
FT                   /locus_tag="EAM_0165"
FT                   /product="lipopolysaccharide biosynthesis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0165"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44840"
FT                   /protein_id="CBJ44840.1"
FT                   RR"
FT   misc_feature    205008..205310
FT                   /note="HMMPfam hit to PF02706, Chain length determinant
FT                   protein, score 0.00011"
FT   misc_feature    join(205041..205109,205935..205994)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0165 by TMHMM2.0 at aa 20-42 and 318-337"
FT   CDS_pept        206062..207183
FT                   /transl_table=11
FT                   /gene="wecB"
FT                   /gene_synonym="rffE"
FT                   /locus_tag="EAM_0166"
FT                   /product="UDP-N-acetylglucosamine 2-epimerase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0166"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44841"
FT                   /protein_id="CBJ44841.1"
FT   misc_feature    206122..207171
FT                   /note="HMMPfam hit to PF02350, UDP-N-acetylglucosamine
FT                   2-epimerase, score 1.2e-189"
FT   CDS_pept        207188..208450
FT                   /transl_table=11
FT                   /gene="wecC"
FT                   /gene_synonym="rffD"
FT                   /locus_tag="EAM_0167"
FT                   /product="putative UDP-glucose/GDP-mannose dehydrogenase"
FT                   /product="UDP-N-acetyl-D-mannosamine dehydrogenase
FT                   (UDP-ManNA dehydrogenase)"
FT                   /EC_number="1.1.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0167"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44842"
FT                   /protein_id="CBJ44842.1"
FT   misc_feature    207188..207256
FT                   /note="Signal peptide predicted for EAM_0167 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.942) with cleavage site
FT                   probability 0.701 between residues 23 and 24"
FT   misc_feature    207197..207778
FT                   /note="HMMPfam hit to PF03721, UDP-glucose/GDP-mannose
FT                   dehydrogenase, score 7.9e-86"
FT   misc_feature    207230..207262
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   misc_feature    207800..208078
FT                   /note="HMMPfam hit to PF00984, UDP-glucose/GDP-mannose
FT                   dehydrogenase, score 2.9e-46"
FT   misc_feature    208157..208447
FT                   /note="HMMPfam hit to PF03720, UDP-glucose/GDP-mannose
FT                   dehydrogenase, score 8.3e-21"
FT   CDS_pept        208447..209535
FT                   /transl_table=11
FT                   /gene="rffG"
FT                   /locus_tag="EAM_0168"
FT                   /product="dTDP-glucose 4,6-dehydratase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0168"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44843"
FT                   /protein_id="CBJ44843.1"
FT   misc_feature    208450..208983
FT                   /note="HMMPfam hit to PF00106, short chain
FT                   dehydrogenase,score 1.8e-05"
FT   misc_feature    208453..209445
FT                   /note="HMMPfam hit to PF04321, RmlD substrate binding
FT                   domain, score 7.6e-07"
FT   misc_feature    208456..209361
FT                   /note="HMMPfam hit to PF02719, Polysaccharide biosynthesis
FT                   protein, score 1.4e-06"
FT   misc_feature    208456..209202
FT                   /note="HMMPfam hit to PF01370, NAD dependent
FT                   epimerase/dehydratase f, score 7.7e-90"
FT   misc_feature    208459..209274
FT                   /note="HMMPfam hit to PF01073, 3-beta hydroxysteroid
FT                   dehydrogenase/i, score 5.9e-08"
FT   misc_feature    208462..209154
FT                   /note="HMMPfam hit to PF07993, Male sterility protein,score
FT                   1.7e-08"
FT   CDS_pept        209532..210413
FT                   /transl_table=11
FT                   /gene="rffH"
FT                   /gene_synonym="rmlA2"
FT                   /locus_tag="EAM_0169"
FT                   /product="glucose-1-phosphate thymidylyltransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0169"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44844"
FT                   /protein_id="CBJ44844.1"
FT                   LSDLLHVRPRQY"
FT   misc_feature    209535..210251
FT                   /note="HMMPfam hit to PF00483, Nucleotidyl
FT                   transferase,score 5e-107"
FT   CDS_pept        210481..211092
FT                   /transl_table=11
FT                   /gene="rffC"
FT                   /locus_tag="EAM_0170"
FT                   /product="lipopolysaccharide biosynthesis protein"
FT                   /EC_number="2.3.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0170"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44845"
FT                   /protein_id="CBJ44845.1"
FT   misc_feature    210811..211050
FT                   /note="HMMPfam hit to PF00583, Acetyltransferase (GNAT)
FT                   family, score 6.8e-15"
FT   CDS_pept        211089..212219
FT                   /transl_table=11
FT                   /gene="rffA"
FT                   /locus_tag="EAM_0171"
FT                   /product="lipopolysaccharide biosynthesis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0171"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44846"
FT                   /protein_id="CBJ44846.1"
FT   misc_feature    211095..212147
FT                   /note="HMMPfam hit to PF00155, Aminotransferase class I and
FT                   II, score 0.00011"
FT   misc_feature    211107..212204
FT                   /note="HMMPfam hit to PF01041, DegT/DnrJ/EryC1/StrS
FT                   aminotransferase, score 2.2e-83"
FT   misc_feature    211119..211982
FT                   /note="HMMPfam hit to PF01212, Beta-eliminating lyase,score
FT                   0.0027"
FT   CDS_pept        212221..213471
FT                   /transl_table=11
FT                   /gene="wzxE"
FT                   /locus_tag="EAM_0172"
FT                   /product="O-antigen translocase in LPS biosyntesis
FT                   (flippase)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0172"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44847"
FT                   /protein_id="CBJ44847.1"
FT                   AYFALCAGVFIIYRRRV"
FT   misc_feature    join(212257..212325,212353..212421,212458..212526,
FT                   212569..212637,212656..212724,212737..212805,
FT                   212866..212934,213010..213069,213106..213174,
FT                   213217..213285,213304..213372,213385..213453)
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0172 by TMHMM2.0 at aa 13-35, 45-67, 80-102,
FT                   117-139,146-168, 173-195, 216-238, 264-283, 296-318,
FT                   333-355,362-384 and 389-411"
FT   CDS_pept        213468..214544
FT                   /transl_table=11
FT                   /gene="rffT"
FT                   /gene_synonym="wecF"
FT                   /locus_tag="EAM_0173"
FT                   /product="conserved hypothetical protein"
FT                   /product="4-alpha-l-fucosyltransferase"
FT                   /EC_number="2.4.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0173"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44848"
FT                   /protein_id="CBJ44848.1"
FT                   GYLAGWRQALRLAEGDNA"
FT   misc_feature    213468..214541
FT                   /note="HMMPfam hit to PF07429, 4-alpha-L-fucosyltransferase
FT                   (Fuc4NAc, score 7e-176"
FT   CDS_pept        214541..215899
FT                   /transl_table=11
FT                   /gene="wzyE"
FT                   /locus_tag="EAM_0174"
FT                   /product="putative ECA polymerase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0174"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44849"
FT                   /protein_id="CBJ44849.1"
FT   misc_feature    214541..215896
FT                   /note="HMMPfam hit to PF06899, WzyE protein, score 0"
FT   misc_feature    214541..214720
FT                   /note="Signal peptide predicted for EAM_0174 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.846) with cleavage site
FT                   probability 0.616 between residues 60 and 61"
FT   misc_feature    join(214550..214618,214652..214720,214748..214807,
FT                   214868..214936,214994..215062,215081..215140,
FT                   215150..215209,215213..215272,215549..215617,
FT                   215678..215731,215759..215827)
FT                   /note="11 probable transmembrane helices predicted for
FT                   EAM_0174 by TMHMM2.0 at aa 4-26, 38-60, 70-89,
FT                   110-132,152-174, 181-200, 204-223, 225-244, 337-359,
FT                   380-397 and 407-429"
FT   misc_feature    214748..214780
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        215912..216652
FT                   /transl_table=11
FT                   /gene="wecG"
FT                   /gene_synonym="rffM"
FT                   /locus_tag="EAM_0175"
FT                   /product="probable UDP-N-acetyl-D-mannosaminuronic acid
FT                   transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0175"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44850"
FT                   /protein_id="CBJ44850.1"
FT   misc_feature    216089..216604
FT                   /note="HMMPfam hit to PF03808, Glycosyl transferase
FT                   WecB/TagA/CpsF f, score 9.3e-80"
FT   tRNA            216832..216905
FT                   /gene="tRNA-Arg"
FT                   /locus_tag="EAM_t006"
FT                   /product="transfer RNA-Arg"
FT                   /anticodon="(pos:216866..216868,aa:Arg)"
FT                   /note="tRNA Arg anticodon CCG, Cove score 78.95"
FT   tRNA            216984..217056
FT                   /gene="tRNA-His"
FT                   /locus_tag="EAM_t007"
FT                   /product="transfer RNA-His"
FT                   /anticodon="(pos:217017..217019,aa:His)"
FT                   /note="tRNA His anticodon GTG, Cove score 69.99"
FT   tRNA            217073..217156
FT                   /gene="tRNA-Leu"
FT                   /locus_tag="EAM_t008"
FT                   /product="transfer RNA-Leu"
FT                   /anticodon="(pos:217107..217109,aa:Leu)"
FT                   /note="tRNA Leu anticodon CAG, Cove score 48.35"
FT   tRNA            217188..217261
FT                   /gene="tRNA-Pro"
FT                   /locus_tag="EAM_t009"
FT                   /product="transfer RNA-Pro"
FT                   /anticodon="(pos:217222..217224,aa:Pro)"
FT                   /note="tRNA Pro anticodon TGG, Cove score 63.52"
FT   tRNA            217550..217623
FT                   /gene="tRNA-Pro"
FT                   /locus_tag="EAM_t010"
FT                   /product="transfer RNA-Pro"
FT                   /anticodon="(pos:217584..217586,aa:Pro)"
FT                   /note="tRNA Pro anticodon TGG, Cove score 63.52"
FT   CDS_pept        218456..218608
FT                   /transl_table=11
FT                   /locus_tag="EAM_0176"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0176"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44851"
FT                   /protein_id="CBJ44851.1"
FT                   LLIKR"
FT   CDS_pept        complement(219135..220325)
FT                   /transl_table=11
FT                   /gene="hemY"
FT                   /locus_tag="EAM_0177"
FT                   /product="Porphyrin biosynthetic protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0177"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44852"
FT                   /protein_id="CBJ44852.1"
FT   misc_feature    complement(219243..219344)
FT                   /note="HMMPfam hit to PF07719, Tetratricopeptide
FT                   repeat,score 2.5e-05"
FT   misc_feature    complement(219837..219866)
FT                   /note="PS00215 Mitochondrial energy transfer proteins
FT                   signature."
FT   misc_feature    complement(219927..220325)
FT                   /note="HMMPfam hit to PF07219, HemY protein
FT                   N-terminus,score 2.9e-61"
FT   misc_feature    complement(join(220140..220208,220245..220313))
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0177 by TMHMM2.0 at aa 5-27 and 40-62"
FT   misc_feature    complement(220257..220325)
FT                   /note="Signal peptide predicted for EAM_0177 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.945) with cleavage site
FT                   probability 0.315 between residues 23 and 24"
FT   CDS_pept        complement(220328..221467)
FT                   /transl_table=11
FT                   /gene="hemX"
FT                   /locus_tag="EAM_0178"
FT                   /product="putative uroporphyrin-III C-methyltransferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0178"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44853"
FT                   /protein_id="CBJ44853.1"
FT   misc_feature    complement(220355..221446)
FT                   /note="HMMPfam hit to PF04375, HemX, score 1.2e-151"
FT   misc_feature    complement(221297..221365)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0178 by TMHMM2.0 at aa 35-57"
FT   CDS_pept        complement(221616..222353)
FT                   /transl_table=11
FT                   /gene="hemD"
FT                   /locus_tag="EAM_0179"
FT                   /product="uroporphyrinogen III synthase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0179"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44854"
FT                   /protein_id="CBJ44854.1"
FT   misc_feature    complement(221622..222326)
FT                   /note="HMMPfam hit to PF02602, Uroporphyrinogen-III
FT                   synthase HemD, score 3e-40"
FT   CDS_pept        complement(222350..223291)
FT                   /transl_table=11
FT                   /gene="hemC"
FT                   /locus_tag="EAM_0180"
FT                   /product="porphobilinogen deaminase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0180"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44855"
FT                   /protein_id="CBJ44855.1"
FT   misc_feature    complement(222398..222619)
FT                   /note="HMMPfam hit to PF03900, Porphobilinogen
FT                   deaminase,C-terminal, score 1.1e-33"
FT   misc_feature    complement(222551..222601)
FT                   /note="PS00533 Porphobilinogen deaminase cofactor-binding
FT                   site."
FT   misc_feature    complement(222641..223279)
FT                   /note="HMMPfam hit to PF01379, Porphobilinogen
FT                   deaminase,dipyrometh, score 4.2e-133"
FT   CDS_pept        223584..226139
FT                   /transl_table=11
FT                   /gene="cyaA"
FT                   /locus_tag="EAM_0181"
FT                   /product="adenylate cyclase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0181"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44856"
FT                   /protein_id="CBJ44856.1"
FT   misc_feature    223584..226073
FT                   /note="HMMPfam hit to PF01295, Adenylate cyclase,
FT                   class-I,score 0"
FT   misc_feature    224307..224342
FT                   /note="PS01092 Adenylate cyclases class-I signature 1."
FT   misc_feature    225375..225419
FT                   /note="PS01093 Adenylate cyclases class-I signature 2."
FT   CDS_pept        226244..226444
FT                   /transl_table=11
FT                   /locus_tag="EAM_0182"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0182"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44857"
FT                   /protein_id="CBJ44857.1"
FT   misc_feature    226244..226312
FT                   /note="Signal peptide predicted for EAM_0182 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.663) with cleavage site
FT                   probability 0.245 between residues 23 and 24"
FT   misc_feature    226271..226303
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        226472..227296
FT                   /transl_table=11
FT                   /gene="dapF"
FT                   /locus_tag="EAM_0183"
FT                   /product="diaminopimelate epimerase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0183"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44858"
FT                   /protein_id="CBJ44858.1"
FT   misc_feature    226478..226843
FT                   /note="HMMPfam hit to PF01678, Diaminopimelate
FT                   epimerase,score 4.1e-51"
FT   misc_feature    226661..226705
FT                   /note="PS01326 Diaminopimelate epimerase signature."
FT   misc_feature    226922..227272
FT                   /note="HMMPfam hit to PF01678, Diaminopimelate
FT                   epimerase,score 3e-51"
FT   CDS_pept        227293..228003
FT                   /transl_table=11
FT                   /locus_tag="EAM_0184"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0184"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44859"
FT                   /protein_id="CBJ44859.1"
FT                   LMLPQLLSRWIERE"
FT   misc_feature    227323..227994
FT                   /note="HMMPfam hit to PF04340, Protein of unknown
FT                   function,DUF484, score 2.4e-91"
FT   CDS_pept        228000..228908
FT                   /transl_table=11
FT                   /gene="xerC"
FT                   /locus_tag="EAM_0185"
FT                   /product="tyrosine recombinase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0185"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44860"
FT                   /protein_id="CBJ44860.1"
FT   misc_feature    228030..228281
FT                   /note="HMMPfam hit to PF02899, Phage integrase, N-terminal
FT                   SAM-like, score 5.4e-27"
FT   misc_feature    228372..228863
FT                   /note="HMMPfam hit to PF00589, Phage integrase family,score
FT                   1.2e-55"
FT   CDS_pept        228908..229624
FT                   /transl_table=11
FT                   /locus_tag="EAM_0186"
FT                   /product="putative hydrolase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0186"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44861"
FT                   /protein_id="CBJ44861.1"
FT                   LPTLEISQLASLTALI"
FT   misc_feature    228935..229537
FT                   /note="HMMPfam hit to PF00702, haloacid dehalogenase-like
FT                   hydrolase, score 1.5e-22"
FT   CDS_pept        229682..231844
FT                   /transl_table=11
FT                   /gene="uvrD"
FT                   /locus_tag="EAM_0187"
FT                   /product="DNA helicase II"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0187"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44862"
FT                   /protein_id="CBJ44862.1"
FT   misc_feature    229709..231151
FT                   /note="HMMPfam hit to PF00580, UvrD/REP helicase, score
FT                   3.6e-221"
FT   misc_feature    229766..229789
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        232144..233103
FT                   /transl_table=11
FT                   /gene="corA"
FT                   /locus_tag="EAM_0188"
FT                   /product="magnesium and cobalt transport protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0188"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44863"
FT                   /protein_id="CBJ44863.1"
FT   misc_feature    232219..233100
FT                   /note="HMMPfam hit to PF01544, CorA-like Mg2+ transporter
FT                   protein, score 7.4e-88"
FT   misc_feature    join(232915..232971,233014..233082)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0188 by TMHMM2.0 at aa 258-276 and 291-313"
FT   CDS_pept        complement(233123..233593)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0189"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0189"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44864"
FT                   /protein_id="CBJ44864.1"
FT   misc_feature    complement(233153..233425)
FT                   /note="HMMPfam hit to PF03061, Thioesterase
FT                   superfamily,score 6.7e-11"
FT   CDS_pept        233766..234644
FT                   /transl_table=11
FT                   /gene="pldA"
FT                   /locus_tag="EAM_0190"
FT                   /product="detergent-resistant phospholipase A"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0190"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44865"
FT                   /protein_id="CBJ44865.1"
FT                   VGVGVTLNDLF"
FT   misc_feature    233766..233825
FT                   /note="Signal peptide predicted for EAM_0190 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.999 between residues 20 and 21"
FT   misc_feature    233829..234632
FT                   /note="HMMPfam hit to PF02253, Phospholipase A1, score
FT                   3e-154"
FT   CDS_pept        234707..236539
FT                   /transl_table=11
FT                   /gene="recQ"
FT                   /locus_tag="EAM_0191"
FT                   /product="ATP-dependent DNA helicase"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0191"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44866"
FT                   /protein_id="CBJ44866.1"
FT   misc_feature    234785..235282
FT                   /note="HMMPfam hit to PF00270, DEAD/DEAH box helicase,score
FT                   4.4e-34"
FT   misc_feature    235469..235699
FT                   /note="HMMPfam hit to PF00271, Helicase conserved
FT                   C-terminal domain, score 1.1e-29"
FT   misc_feature    236294..236536
FT                   /note="HMMPfam hit to PF00570, HRDC domain, score 3.5e-32"
FT   CDS_pept        complement(236599..237222)
FT                   /transl_table=11
FT                   /gene="rhtB"
FT                   /locus_tag="EAM_0192"
FT                   /product="homoserine/homoserine lactone efflux protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0192"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44867"
FT                   /protein_id="CBJ44867.1"
FT   misc_feature    complement(join(236605..236658,236716..236784,
FT                   236812..236880,237025..237093,237136..237204))
FT                   /note="5 probable transmembrane helices predicted for
FT                   EAM_0192 by TMHMM2.0 at aa 7-29, 44-66, 115-137, 147-169
FT                   and 189-206"
FT   misc_feature    complement(236611..237183)
FT                   /note="HMMPfam hit to PF01810, LysE type translocator,score
FT                   4.1e-54"
FT   misc_feature    complement(237151..237222)
FT                   /note="Signal peptide predicted for EAM_0192 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.848) with cleavage site
FT                   probability 0.479 between residues 24 and 25"
FT   CDS_pept        237334..238326
FT                   /transl_table=11
FT                   /gene="pldB"
FT                   /locus_tag="EAM_0193"
FT                   /product="lysophospholipase L2"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0193"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44868"
FT                   /protein_id="CBJ44868.1"
FT   misc_feature    237577..238296
FT                   /note="HMMPfam hit to PF00561, alpha/beta hydrolase
FT                   fold,score 1.2e-30"
FT   CDS_pept        238387..239187
FT                   /transl_table=11
FT                   /locus_tag="EAM_0194"
FT                   /product="putative hydrolase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0194"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44869"
FT                   /protein_id="CBJ44869.1"
FT   misc_feature    238387..239166
FT                   /note="HMMPfam hit to PF05116, Sucrose-6F-phosphate
FT                   phosphohydrolase, score 8e-05"
FT   misc_feature    238390..239091
FT                   /note="HMMPfam hit to PF00702, haloacid dehalogenase-like
FT                   hydrolase, score 3.4e-05"
FT   misc_feature    238396..238431
FT                   /note="PS01228 Hypothetical cof family signature 1."
FT   misc_feature    238399..239166
FT                   /note="HMMPfam hit to PF08282, haloacid dehalogenase-like
FT                   hydrolase, score 4.1e-69"
FT   misc_feature    239020..239088
FT                   /note="PS01229 Hypothetical cof family signature 2."
FT   CDS_pept        complement(239362..240693)
FT                   /transl_table=11
FT                   /gene="glpT"
FT                   /locus_tag="EAM_0195"
FT                   /product="glycerol-3-phosphate transporter"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0195"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44870"
FT                   /protein_id="CBJ44870.1"
FT   misc_feature    complement(join(239398..239466,239476..239544,
FT                   239578..239646,239674..239742,239761..239820,
FT                   239878..239937,240076..240135,240148..240216,
FT                   240271..240339,240349..240417,240436..240504,
FT                   240562..240615))
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0195 by TMHMM2.0 at aa 27-44, 64-86, 93-115,
FT                   119-141,160-182, 187-206, 253-272, 292-311, 318-340,
FT                   350-372,384-406 and 410-432"
FT   misc_feature    complement(239470..240597)
FT                   /note="HMMPfam hit to PF07690, Major Facilitator
FT                   Superfamily, score 2.4e-51"
FT   misc_feature    complement(240190..240240)
FT                   /note="PS00942 glpT family of transporters signature."
FT   CDS_pept        complement(241080..241550)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0196"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0196"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44871"
FT                   /protein_id="CBJ44871.1"
FT   misc_feature    complement(241092..241295)
FT                   /note="HMMPfam hit to PF07308, Protein of unknown function
FT                   (DUF1456), score 1.4e-30"
FT   misc_feature    complement(241341..241544)
FT                   /note="HMMPfam hit to PF07308, Protein of unknown function
FT                   (DUF1456), score 5.5e-34"
FT   CDS_pept        complement(241654..242592)
FT                   /transl_table=11
FT                   /gene="metR"
FT                   /locus_tag="EAM_0197"
FT                   /product="LysR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0197"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44872"
FT                   /protein_id="CBJ44872.1"
FT   misc_feature    complement(241723..242343)
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 3.2e-46"
FT   misc_feature    complement(242404..242583)
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 4.4e-17"
FT   misc_feature    complement(242449..242541)
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    complement(242479..242544)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1726.000, SD 5.07 at aa 17-38, sequence
FT   CDS_pept        242743..245016
FT                   /transl_table=11
FT                   /gene="metE"
FT                   /locus_tag="EAM_0198"
FT                   /product="5-methyltetrahydropteroyltriglutamate--homocyst
FT                   eine methyltransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0198"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44873"
FT                   /protein_id="CBJ44873.1"
FT                   AQKA"
FT   misc_feature    242752..243690
FT                   /note="HMMPfam hit to PF08267, Cobalamin-independent
FT                   synthase, N-termina, score 3.4e-199"
FT   misc_feature    244021..244992
FT                   /note="HMMPfam hit to PF01717, Cobalamin-independent
FT                   synthase, Catalytic, score 7.1e-230"
FT   CDS_pept        complement(245076..245918)
FT                   /transl_table=11
FT                   /gene="ysgA"
FT                   /locus_tag="EAM_0199"
FT                   /product="putative hydrolase"
FT                   /product="putative carboxymethylenebutenolidase
FT                   (dienelacton hydrolase)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0199"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44874"
FT                   /protein_id="CBJ44874.1"
FT   misc_feature    complement(245094..245768)
FT                   /note="HMMPfam hit to PF01738, Dienelactone hydrolase
FT                   family, score 4e-98"
FT   CDS_pept        246203..246967
FT                   /transl_table=11
FT                   /gene="udp"
FT                   /locus_tag="EAM_0200"
FT                   /product="uridine phosphorylase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0200"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44875"
FT                   /protein_id="CBJ44875.1"
FT   misc_feature    246260..246949
FT                   /note="HMMPfam hit to PF01048, Phosphorylase family, score
FT                   5.6e-101"
FT   misc_feature    246398..246445
FT                   /note="PS01232 Purine and other phosphorylases family 1
FT                   signature."
FT   CDS_pept        247142..248617
FT                   /transl_table=11
FT                   /gene="rmuC"
FT                   /locus_tag="EAM_0201"
FT                   /product="DNA recombination protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0201"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44876"
FT                   /protein_id="CBJ44876.1"
FT   misc_feature    247142..247237
FT                   /note="Signal peptide predicted for EAM_0201 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.917) with cleavage site
FT                   probability 0.892 between residues 32 and 33"
FT   misc_feature    247154..247213
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0201 by TMHMM2.0 at aa 5-24"
FT   misc_feature    247649..248560
FT                   /note="HMMPfam hit to PF02646, RmuC family, score 4.9e-146"
FT   CDS_pept        248752..249507
FT                   /transl_table=11
FT                   /gene="ubiE"
FT                   /locus_tag="EAM_0202"
FT                   /product="ubiquinone/menaquinone biosynthesis
FT                   methyltransferase"
FT                   /EC_number="2.1.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0202"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44877"
FT                   /protein_id="CBJ44877.1"
FT   misc_feature    248791..249501
FT                   /note="HMMPfam hit to PF01209, ubiE/COQ5 methyltransferase
FT                   family, score 2.3e-158"
FT   misc_feature    248857..248904
FT                   /note="PS01183 ubiE/COQ5 methyltransferase family signature
FT                   1."
FT   misc_feature    248953..249255
FT                   /note="HMMPfam hit to PF08241, Methyltransferase
FT                   domain,score 1.2e-27"
FT   misc_feature    248953..249249
FT                   /note="HMMPfam hit to PF08242, Methyltransferase
FT                   domain,score 1.8e-12"
FT   misc_feature    249223..249267
FT                   /note="PS01184 ubiE/COQ5 methyltransferase family signature
FT                   2."
FT   CDS_pept        249520..250125
FT                   /transl_table=11
FT                   /locus_tag="EAM_0203"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0203"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44878"
FT                   /protein_id="CBJ44878.1"
FT   misc_feature    249547..250113
FT                   /note="HMMPfam hit to PF06843, Protein of unknown function
FT                   (DUF1243), score 1.4e-72"
FT   CDS_pept        250122..251759
FT                   /transl_table=11
FT                   /gene="ubiB"
FT                   /gene_synonym="aarF"
FT                   /locus_tag="EAM_0204"
FT                   /product="probable ubiquinone biosynthesis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0204"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44879"
FT                   /protein_id="CBJ44879.1"
FT   misc_feature    250452..250814
FT                   /note="HMMPfam hit to PF03109, ABC1 family, score 1e-52"
FT   misc_feature    join(251613..251672,251691..251744)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0204 by TMHMM2.0 at aa 498-517 and 524-541"
FT   CDS_pept        251879..252136
FT                   /transl_table=11
FT                   /gene="tatA"
FT                   /locus_tag="EAM_0205"
FT                   /product="sec-independent protein translocase protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0205"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44880"
FT                   /protein_id="CBJ44880.1"
FT   misc_feature    251888..252043
FT                   /note="HMMPfam hit to PF02416, mttA/Hcf106 family, score
FT                   4.1e-13"
FT   misc_feature    251888..251941
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0205 by TMHMM2.0 at aa 4-21"
FT   CDS_pept        252140..252679
FT                   /transl_table=11
FT                   /gene="tatB"
FT                   /locus_tag="EAM_0206"
FT                   /product="sec-independent protein translocase protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0206"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44881"
FT                   /protein_id="CBJ44881.1"
FT                   VAPRASATSTLPGDER"
FT   misc_feature    252149..252202
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0206 by TMHMM2.0 at aa 4-21"
FT   CDS_pept        252682..253443
FT                   /transl_table=11
FT                   /gene="tatC"
FT                   /locus_tag="EAM_0207"
FT                   /product="sec-independent protein translocase protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0207"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44882"
FT                   /protein_id="CBJ44882.1"
FT   misc_feature    252733..253344
FT                   /note="HMMPfam hit to PF00902, Sec-independent protein
FT                   translocase protein, score 5.5e-98"
FT   misc_feature    join(252739..252807,252901..252969,253027..253095,
FT                   253153..253221,253258..253317,253327..253395)
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0207 by TMHMM2.0 at aa 20-42, 74-96, 116-138,
FT                   158-180,193-212 and 216-238"
FT   misc_feature    253141..253200
FT                   /note="PS01218 Uncharacterized protein family UPF0032
FT                   signature."
FT   CDS_pept        253519..254298
FT                   /transl_table=11
FT                   /gene="tatD"
FT                   /locus_tag="EAM_0208"
FT                   /product="deoxyribonuclease"
FT                   /EC_number="3.1.21.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0208"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44883"
FT                   /db_xref="GOA:D4ICL5"
FT                   /db_xref="InterPro:IPR001130"
FT                   /db_xref="InterPro:IPR018228"
FT                   /db_xref="InterPro:IPR024918"
FT                   /db_xref="InterPro:IPR032466"
FT                   /db_xref="UniProtKB/Swiss-Prot:D4ICL5"
FT                   /protein_id="CBJ44883.1"
FT   misc_feature    253519..254292
FT                   /note="HMMPfam hit to PF01026, TatD related DNase, score
FT                   2.2e-95"
FT   misc_feature    253888..253920
FT                   /note="PS01090 Uncharacterized protein family UPF0006
FT                   signature 2."
FT   misc_feature    254086..254136
FT                   /note="PS01091 Uncharacterized protein family UPF0006
FT                   signature 3."
FT   CDS_pept        complement(254327..254827)
FT                   /transl_table=11
FT                   /gene="rfaH"
FT                   /locus_tag="EAM_0209"
FT                   /product="transcriptional activator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0209"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44884"
FT                   /protein_id="CBJ44884.1"
FT                   PAP"
FT   misc_feature    complement(254555..254824)
FT                   /note="HMMPfam hit to PF02357, Transcription termination
FT                   factor nusG, score 6.9e-25"
FT   CDS_pept        255077..256561
FT                   /transl_table=11
FT                   /gene="ubiD"
FT                   /locus_tag="EAM_0210"
FT                   /product="3-octaprenyl-4-hydroxybenzoate carboxy-lyase"
FT                   /EC_number="4.1.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0210"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44885"
FT                   /protein_id="CBJ44885.1"
FT   misc_feature    255104..256378
FT                   /note="HMMPfam hit to
FT                   PF01977,3-octaprenyl-4-hydroxybenzoate carboxy-lyase, score
FT                   1.4e-241"
FT   CDS_pept        256606..257307
FT                   /transl_table=11
FT                   /gene="fre"
FT                   /locus_tag="EAM_0211"
FT                   /product="NAD(P)H-flavin reductase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0211"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44886"
FT                   /protein_id="CBJ44886.1"
FT                   ARMFGDAFAFI"
FT   misc_feature    256618..256896
FT                   /note="HMMPfam hit to PF00970, Oxidoreductase FAD-binding
FT                   domain, score 5.8e-05"
FT   misc_feature    256924..257241
FT                   /note="HMMPfam hit to PF00175, Oxidoreductase NAD-binding
FT                   domain, score 2.8e-31"
FT   CDS_pept        complement(257412..258575)
FT                   /transl_table=11
FT                   /gene="fadA"
FT                   /locus_tag="EAM_0212"
FT                   /product="3-ketoacyl-CoA thiolase (fatty oxidation complex
FT                   beta subunit)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0212"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44887"
FT                   /protein_id="CBJ44887.1"
FT   misc_feature    complement(257418..257795)
FT                   /note="HMMPfam hit to PF02803, Thiolase, C-terminal
FT                   domain,score 4.3e-80"
FT   misc_feature    complement(257433..257474)
FT                   /note="PS00099 Thiolases active site."
FT   misc_feature    complement(257529..257579)
FT                   /note="PS00737 Thiolases signature 2."
FT   misc_feature    complement(257814..258575)
FT                   /note="HMMPfam hit to PF00108, Thiolase, N-terminal
FT                   domain,score 9.3e-138"
FT   misc_feature    complement(258261..258317)
FT                   /note="PS00098 Thiolases acyl-enzyme intermediate
FT                   signature."
FT   CDS_pept        complement(258586..260772)
FT                   /transl_table=11
FT                   /gene="fadB"
FT                   /locus_tag="EAM_0213"
FT                   /product="fatty oxidation complex subunit alpha [includes:
FT                   enoyl-CoA hydratase; delta(3)-cis-delta(2)-trans-enoyl-CoA
FT                   isomerase; 3-hydroxyacyl-CoA dehydrogenase; 3
FT                   hydroxybutyryl-CoA epimerase]"
FT                   /EC_number=""
FT                   /EC_number=""
FT                   /EC_number=""
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0213"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44888"
FT                   /protein_id="CBJ44888.1"
FT   misc_feature    complement(258631..258894)
FT                   /note="HMMPfam hit to PF00725, 3-hydroxyacyl-CoA
FT                   dehydrogenase, C-terminal, score 0.0008"
FT   misc_feature    complement(258997..259287)
FT                   /note="HMMPfam hit to PF00725, 3-hydroxyacyl-CoA
FT                   dehydrogenase, C-terminal, score 1.6e-31"
FT   misc_feature    complement(259222..259296)
FT                   /note="PS00067 3-hydroxyacyl-CoA dehydrogenase signature."
FT   misc_feature    complement(259291..259836)
FT                   /note="HMMPfam hit to PF02737, 3-hydroxyacyl-CoA
FT                   dehydrogenase, NAD binding, score 4.5e-84"
FT   misc_feature    complement(260206..260721)
FT                   /note="HMMPfam hit to PF00378, Enoyl-CoA
FT                   hydratase/isomerase family, score 2.2e-79"
FT   misc_feature    complement(260395..260457)
FT                   /note="PS00166 Enoyl-CoA hydratase/isomerase signature."
FT   CDS_pept        260958..262289
FT                   /transl_table=11
FT                   /gene="pepQ"
FT                   /locus_tag="EAM_0214"
FT                   /product="proline dipeptidase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0214"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44889"
FT                   /protein_id="CBJ44889.1"
FT   misc_feature    261459..262271
FT                   /note="HMMPfam hit to PF00557, metallopeptidase family
FT                   M24,score 7.8e-79"
FT   misc_feature    261960..261998
FT                   /note="PS00491 Aminopeptidase P and proline dipeptidase
FT                   signature."
FT   CDS_pept        262289..262900
FT                   /transl_table=11
FT                   /locus_tag="EAM_0215"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0215"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44890"
FT                   /protein_id="CBJ44890.1"
FT   misc_feature    262337..262666
FT                   /note="HMMPfam hit to PF01205, Uncharacterized protein
FT                   family UPF0029, score 4.6e-59"
FT   misc_feature    262526..262615
FT                   /note="PS00910 Uncharacterized protein family UPF0029
FT                   signature."
FT   CDS_pept        262929..264380
FT                   /transl_table=11
FT                   /gene="trkH"
FT                   /locus_tag="EAM_0216"
FT                   /product="trk system potassium uptake protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0216"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44891"
FT                   /protein_id="CBJ44891.1"
FT   misc_feature    262929..263012
FT                   /note="Signal peptide predicted for EAM_0216 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.824) with cleavage site
FT                   probability 0.455 between residues 28 and 29"
FT   misc_feature    join(262953..263021,263031..263099,263133..263201,
FT                   263325..263393,263481..263549,263640..263708,
FT                   263745..263813,263922..263990,264114..264182,
FT                   264195..264260,264294..264362)
FT                   /note="11 probable transmembrane helices predicted for
FT                   EAM_0216 by TMHMM2.0 at aa 9-31, 35-57, 69-91,
FT                   133-155,185-207, 238-260, 273-295, 332-354, 396-418,
FT                   423-444 and 456-478"
FT   misc_feature    263382..264371
FT                   /note="HMMPfam hit to PF02386, Cation transport
FT                   protein,score 3.4e-117"
FT   CDS_pept        264395..264931
FT                   /transl_table=11
FT                   /gene="hemG"
FT                   /locus_tag="EAM_0217"
FT                   /product="protoporphyrinogen oxidase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0217"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44892"
FT                   /protein_id="CBJ44892.1"
FT                   SRFAHEFAELSSKLQ"
FT   misc_feature    264407..264457
FT                   /note="PS00201 Flavodoxin signature."
FT   rRNA            265340..266897
FT                   /gene="16S rRNA"
FT                   /locus_tag="EAM_r007"
FT                   /note="rRNA"
FT   tRNA            266970..267041
FT                   /gene="tRNA-Glu"
FT                   /locus_tag="EAM_t011"
FT                   /product="transfer RNA-Glu"
FT                   /anticodon="(pos:267003..267005,aa:Glu)"
FT                   /note="tRNA Glu anticodon TTC, Cove score 66.42"
FT   rRNA            267441..270398
FT                   /gene="23S rRNA"
FT                   /locus_tag="EAM_r008"
FT                   /note="rRNA"
FT   rRNA            270595..270728
FT                   /gene="5S rRNA"
FT                   /locus_tag="EAM_r009"
FT                   /note="rRNA"
FT   CDS_pept        271427..272464
FT                   /transl_table=11
FT                   /gene="murB"
FT                   /locus_tag="EAM_0218"
FT                   /product="UDP-N-acetylenolpyruvoylglucosamine reductase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0218"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44893"
FT                   /protein_id="CBJ44893.1"
FT                   VEAIA"
FT   misc_feature    271484..271885
FT                   /note="HMMPfam hit to PF01565, FAD binding domain, score
FT                   9.9e-16"
FT   misc_feature    272042..272425
FT                   /note="HMMPfam hit to
FT                   PF02873,UDP-N-acetylenolpyruvoylglucosamine red, score
FT                   9.4e-60"
FT   CDS_pept        272461..273423
FT                   /transl_table=11
FT                   /gene="birA"
FT                   /locus_tag="EAM_0219"
FT                   /product="bifunctional protein BirA [includes: biotin
FT                   operon repressor; biotin-[acetyl-CoA-carboxylase]
FT                   synthetase]"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0219"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44894"
FT                   /protein_id="CBJ44894.1"
FT   misc_feature    272476..272637
FT                   /note="HMMPfam hit to PF08279, HTH domain, score 7.2e-11"
FT   misc_feature    272518..272583
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1593.000, SD 4.61 at aa 20-41, sequence
FT   misc_feature    272707..273000
FT                   /note="HMMPfam hit to PF03099, Biotin/lipoate A/B protein
FT                   ligase famil, score 1.7e-24"
FT   misc_feature    273271..273411
FT                   /note="HMMPfam hit to PF02237, Biotin protein ligase C
FT                   terminal domain, score 4.4e-10"
FT   CDS_pept        complement(273450..274400)
FT                   /transl_table=11
FT                   /gene="coaA"
FT                   /locus_tag="EAM_0220"
FT                   /product="pantothenate kinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0220"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44895"
FT                   /protein_id="CBJ44895.1"
FT   misc_feature    complement(273525..274133)
FT                   /note="HMMPfam hit to PF00485, Phosphoribulokinase /
FT                   Uridine kinase family, score 7.8e-07"
FT   misc_feature    complement(274095..274118)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   tRNA            274890..274962
FT                   /gene="tRNA-Thr"
FT                   /locus_tag="EAM_t012"
FT                   /product="transfer RNA-Thr"
FT                   /anticodon="(pos:274923..274925,aa:Thr)"
FT                   /note="tRNA Thr anticodon TGT, Cove score 79.95"
FT   tRNA            274978..275059
FT                   /gene="tRNA-Tyr"
FT                   /locus_tag="EAM_t013"
FT                   /product="transfer RNA-Tyr"
FT                   /anticodon="(pos:275012..275014,aa:Tyr)"
FT                   /note="tRNA Tyr anticodon GTA, Cove score 46.46"
FT   tRNA            275280..275351
FT                   /gene="tRNA-Gly"
FT                   /locus_tag="EAM_t014"
FT                   /product="transfer RNA-Gly"
FT                   /anticodon="(pos:275313..275315,aa:Gly)"
FT                   /note="tRNA Gly anticodon TCC, Cove score 63.24"
FT   tRNA            275361..275433
FT                   /gene="tRNA-Thr"
FT                   /locus_tag="EAM_t015"
FT                   /product="transfer RNA-Thr"
FT                   /anticodon="(pos:275394..275396,aa:Thr)"
FT                   /note="tRNA Thr anticodon GGT, Cove score 79.16"
FT   CDS_pept        275550..276734
FT                   /transl_table=11
FT                   /gene="tufB"
FT                   /locus_tag="EAM_0221"
FT                   /product="elongation factor Tu"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0221"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44896"
FT                   /protein_id="CBJ44896.1"
FT   misc_feature    275577..276161
FT                   /note="HMMPfam hit to PF00009, Elongation factor Tu GTP
FT                   binding domain, score 4.8e-96"
FT   misc_feature    275604..275627
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    275700..275747
FT                   /note="PS00301 GTP-binding elongation factors signature."
FT   misc_feature    276222..276431
FT                   /note="HMMPfam hit to PF03144, Elongation factor Tu
FT                   domain,score 1.6e-26"
FT   misc_feature    276444..276728
FT                   /note="HMMPfam hit to PF03143, Elongation factor Tu
FT                   C-terminal domain, score 2.6e-60"
FT   CDS_pept        277004..277387
FT                   /transl_table=11
FT                   /gene="secE"
FT                   /locus_tag="EAM_0222"
FT                   /product="preprotein translocase SecE subunit"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0222"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44897"
FT                   /protein_id="CBJ44897.1"
FT   misc_feature    join(277049..277111,277124..277192,277283..277351)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0222 by TMHMM2.0 at aa 21-41, 46-68 and 99-121"
FT   misc_feature    277202..277372
FT                   /note="HMMPfam hit to PF00584, SecE/Sec61-gamma subunits of
FT                   protein translo, score 3.7e-26"
FT   misc_feature    277214..277300
FT                   /note="PS01067 Protein secE/sec61-gamma signature."
FT   CDS_pept        277389..277934
FT                   /transl_table=11
FT                   /gene="nusG"
FT                   /locus_tag="EAM_0223"
FT                   /product="transcription antitermination protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0223"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44898"
FT                   /protein_id="CBJ44898.1"
FT                   IFGRATPVELDFGQVEKG"
FT   misc_feature    277407..277706
FT                   /note="HMMPfam hit to PF02357, Transcription termination
FT                   factor nusG, score 5.9e-57"
FT   misc_feature    277770..277883
FT                   /note="HMMPfam hit to PF00467, KOW motif, score 1.5e-11"
FT   misc_feature    277878..277907
FT                   /note="PS01014 Transcription termination factor nusG
FT                   signature."
FT   CDS_pept        278128..278556
FT                   /transl_table=11
FT                   /gene="rplK"
FT                   /locus_tag="EAM_0224"
FT                   /product="50S ribosomal subunit protein L11"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0224"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44899"
FT                   /protein_id="CBJ44899.1"
FT   misc_feature    278149..278328
FT                   /note="HMMPfam hit to PF03946, Ribosomal protein
FT                   L11,N-terminal dom, score 1.2e-38"
FT   misc_feature    278341..278547
FT                   /note="HMMPfam hit to PF00298, Ribosomal protein L11, RNA
FT                   binding do, score 1.4e-38"
FT   misc_feature    278506..278553
FT                   /note="PS00359 Ribosomal protein L11 signature."
FT   CDS_pept        278560..279264
FT                   /transl_table=11
FT                   /gene="rplA"
FT                   /locus_tag="EAM_0225"
FT                   /product="50S ribosomal subunit protein L1"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0225"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44900"
FT                   /protein_id="CBJ44900.1"
FT                   AVDQAGLNASAS"
FT   misc_feature    278602..279222
FT                   /note="HMMPfam hit to PF00687, Ribosomal protein L1p/L10e
FT                   family, score 1.5e-135"
FT   misc_feature    278920..278976
FT                   /note="PS01199 Ribosomal protein L1 signature."
FT   CDS_pept        279610..280113
FT                   /transl_table=11
FT                   /gene="rplJ"
FT                   /locus_tag="EAM_0226"
FT                   /product="50S ribosomal subunit protein L10"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0226"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44901"
FT                   /protein_id="CBJ44901.1"
FT                   AAAA"
FT   misc_feature    279616..279912
FT                   /note="HMMPfam hit to PF00466, Ribosomal protein L10, score
FT                   1.6e-36"
FT   misc_feature    279694..279735
FT                   /note="PS01109 Ribosomal protein L10 signature."
FT   CDS_pept        280181..280546
FT                   /transl_table=11
FT                   /gene="rplL"
FT                   /locus_tag="EAM_0227"
FT                   /product="50S ribosomal subunit protein L7/L12"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0227"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44902"
FT                   /protein_id="CBJ44902.1"
FT                   EALKKVLEEAGAEVEVK"
FT   misc_feature    280340..280543
FT                   /note="HMMPfam hit to PF00542, Ribosomal protein L7/L12
FT                   C-terminal dom, score 7.3e-36"
FT   CDS_pept        280881..284909
FT                   /transl_table=11
FT                   /gene="rpoB"
FT                   /locus_tag="EAM_0228"
FT                   /product="DNA-directed RNA polymerase beta-subunit"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0228"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44903"
FT                   /protein_id="CBJ44903.1"
FT   misc_feature    280959..282407
FT                   /note="HMMPfam hit to PF04563, RNA polymerase beta
FT                   subunit,score 3e-35"
FT   misc_feature    281331..282242
FT                   /note="HMMPfam hit to PF04561, RNA polymerase Rpb2,
FT                   domain,score 2.3e-06"
FT   misc_feature    282417..282626
FT                   /note="HMMPfam hit to PF04565, RNA polymerase Rpb2,
FT                   domain,score 1.8e-43"
FT   misc_feature    283023..284672
FT                   /note="HMMPfam hit to PF00562, RNA polymerase Rpb2,
FT                   domain,score 3.5e-187"
FT   misc_feature    284067..284105
FT                   /note="PS01166 RNA polymerases beta chain signature."
FT   misc_feature    284676..284906
FT                   /note="HMMPfam hit to PF04560, RNA polymerase Rpb2,
FT                   domain,score 4.1e-52"
FT   CDS_pept        284995..289218
FT                   /transl_table=11
FT                   /gene="rpoC"
FT                   /locus_tag="EAM_0229"
FT                   /product="DNA-directed RNA polymerase beta' subunit"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0229"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44904"
FT                   /protein_id="CBJ44904.1"
FT                   GRDDE"
FT   misc_feature    285034..286020
FT                   /note="HMMPfam hit to PF04997, RNA polymerase Rpb1,
FT                   domain,score 3.4e-159"
FT   misc_feature    286024..286452
FT                   /note="HMMPfam hit to PF00623, RNA polymerase Rpb1,
FT                   domain,score 2.9e-83"
FT   misc_feature    286459..286926
FT                   /note="HMMPfam hit to PF04983, RNA polymerase Rpb1,
FT                   domain,score 7e-51"
FT   misc_feature    287011..287286
FT                   /note="HMMPfam hit to PF05000, RNA polymerase Rpb1,
FT                   domain,score 4e-31"
FT   misc_feature    287290..288960
FT                   /note="HMMPfam hit to PF04998, RNA polymerase Rpb1,
FT                   domain,score 3.7e-105"
FT   CDS_pept        complement(289423..290022)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0230"
FT                   /product="pentapeptide repeat protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0230"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44905"
FT                   /protein_id="CBJ44905.1"
FT   misc_feature    complement(289534..289653)
FT                   /note="HMMPfam hit to PF00805, Pentapeptide repeats (8
FT                   copies), score 3.7e-08"
FT   misc_feature    complement(289837..289956)
FT                   /note="HMMPfam hit to PF00805, Pentapeptide repeats (8
FT                   copies), score 0.084"
FT   misc_feature    290948..298036
FT                   /note="Fimbrial operon 1. Unique vs ECA"
FT   CDS_pept        290948..291502
FT                   /transl_table=11
FT                   /locus_tag="EAM_0231"
FT                   /product="fimbrial protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0231"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44906"
FT                   /protein_id="CBJ44906.1"
FT   misc_feature    290948..291007
FT                   /note="Signal peptide predicted for EAM_0231 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.977) with cleavage site
FT                   probability 0.586 between residues 20 and 21"
FT   misc_feature    290960..291028
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0231 by TMHMM2.0 at aa 5-27"
FT   CDS_pept        291514..293961
FT                   /transl_table=11
FT                   /locus_tag="EAM_0232"
FT                   /product="Fimbrial outer membrane usher protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0232"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44907"
FT                   /protein_id="CBJ44907.1"
FT                   TCE"
FT   misc_feature    291514..291618
FT                   /note="Signal peptide predicted for EAM_0232 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.924) with cleavage site
FT                   probability 0.866 between residues 35 and 36"
FT   misc_feature    291550..291618
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0232 by TMHMM2.0 at aa 13-35"
FT   misc_feature    291622..293922
FT                   /note="HMMPfam hit to PF00577, Fimbrial Usher protein,score
FT                   2.5e-220"
FT   misc_feature    292204..292227
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    292399..292431
FT                   /note="PS01151 Fimbrial biogenesis outer membrane usher
FT                   protein signature."
FT   CDS_pept        293954..294724
FT                   /transl_table=11
FT                   /locus_tag="EAM_0233"
FT                   /product="Fimbrial chaperone protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0233"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44908"
FT                   /protein_id="CBJ44908.1"
FT   misc_feature    293954..294064
FT                   /note="Signal peptide predicted for EAM_0233 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.729 between residues 37 and 38"
FT   misc_feature    294056..294406
FT                   /note="HMMPfam hit to PF00345, Gram-negative pili assembly
FT                   chaperone, score 1e-55"
FT   misc_feature    294278..294331
FT                   /note="PS00635 Gram-negative pili assembly chaperone
FT                   signature."
FT   misc_feature    294416..294703
FT                   /note="HMMPfam hit to PF02753, Gram-negative pili assembly
FT                   chaperone, score 2.1e-08"
FT   CDS_pept        294736..295251
FT                   /transl_table=11
FT                   /locus_tag="EAM_0234"
FT                   /product="fimbrial protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0234"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44909"
FT                   /protein_id="CBJ44909.1"
FT                   QVEGEQAS"
FT   misc_feature    294736..294810
FT                   /note="Signal peptide predicted for EAM_0234 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.985) with cleavage site
FT                   probability 0.954 between residues 25 and 26"
FT   misc_feature    294748..294807
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0234 by TMHMM2.0 at aa 5-24"
FT   CDS_pept        295451..296227
FT                   /transl_table=11
FT                   /locus_tag="EAM_0235"
FT                   /product="fimbrial protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0235"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44910"
FT                   /protein_id="CBJ44910.1"
FT   misc_feature    295451..295513
FT                   /note="Signal peptide predicted for EAM_0235 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.762 between residues 21 and 22"
FT   misc_feature    295529..296224
FT                   /note="HMMPfam hit to PF02432, Fimbrial, major and minor
FT                   subunit, score 1.2e-27"
FT   CDS_pept        296462..297250
FT                   /transl_table=11
FT                   /locus_tag="EAM_0236"
FT                   /product="fimbrial protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0236"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44911"
FT                   /protein_id="CBJ44911.1"
FT   misc_feature    296462..296533
FT                   /note="Signal peptide predicted for EAM_0236 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.981) with cleavage site
FT                   probability 0.744 between residues 24 and 25"
FT   misc_feature    296543..297247
FT                   /note="HMMPfam hit to PF02432, Fimbrial, major and minor
FT                   subunit, score 1.6e-80"
FT   CDS_pept        297275..298036
FT                   /transl_table=11
FT                   /locus_tag="EAM_0237"
FT                   /product="fimbrial protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0237"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44912"
FT                   /protein_id="CBJ44912.1"
FT   misc_feature    297275..297334
FT                   /note="Signal peptide predicted for EAM_0237 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.733 between residues 20 and 21"
FT   misc_feature    297356..298033
FT                   /note="HMMPfam hit to PF02432, Fimbrial, major and minor
FT                   subunit, score 2.7e-74"
FT   misc_feature    297638..297655
FT                   /note="PS00343 Gram-positive cocci surface proteins
FT                   'anchoring' hexapeptide."
FT   CDS_pept        complement(298180..299121)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0238"
FT                   /product="outer membrane protease"
FT                   /EC_number="3.4.23.-"
FT                   /note="Also similar to EAM_0740 and EAM_0742"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0238"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44913"
FT                   /protein_id="CBJ44913.1"
FT   misc_feature    complement(298183..299064)
FT                   /note="HMMPfam hit to PF01278, Omptin family, score
FT                   6.5e-145"
FT   misc_feature    complement(298987..299010)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(299062..299121)
FT                   /note="Signal peptide predicted for EAM_0238 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.795 between residues 20 and 21"
FT   CDS_pept        complement(299897..300541)
FT                   /transl_table=11
FT                   /gene="thiE"
FT                   /locus_tag="EAM_0239"
FT                   /product="thiamine-phosphate pyrophosphorylase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0239"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44914"
FT                   /protein_id="CBJ44914.1"
FT   misc_feature    complement(299975..300499)
FT                   /note="HMMPfam hit to PF02581, Thiamine monophosphate
FT                   synthase/TENI, score 2.1e-72"
FT   CDS_pept        complement(300538..302472)
FT                   /transl_table=11
FT                   /gene="thiC"
FT                   /locus_tag="EAM_0240"
FT                   /product="thiamine biosynthesis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0240"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44915"
FT                   /protein_id="CBJ44915.1"
FT                   DSPTPEEKV"
FT   misc_feature    complement(300673..302025)
FT                   /note="HMMPfam hit to PF01964, ThiC family, score 0"
FT   CDS_pept        complement(302790..303296)
FT                   /transl_table=11
FT                   /gene="rsd"
FT                   /locus_tag="EAM_0241"
FT                   /product="regulator of sigma D"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0241"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44916"
FT                   /protein_id="CBJ44916.1"
FT                   LARPA"
FT   misc_feature    complement(302799..303296)
FT                   /note="HMMPfam hit to PF04353, Regulator of RNA polymerase
FT                   sigma(70) subuni, score 9.3e-57"
FT   CDS_pept        303367..304149
FT                   /transl_table=11
FT                   /gene="nudC"
FT                   /locus_tag="EAM_0242"
FT                   /product="NADH pyrophosphatase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0242"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44917"
FT                   /protein_id="CBJ44917.1"
FT   misc_feature    303745..304107
FT                   /note="HMMPfam hit to PF00293, NUDIX domain, score 2e-24"
FT   misc_feature    303841..303900
FT                   /note="PS00893 mutT domain signature."
FT   CDS_pept        304348..305415
FT                   /transl_table=11
FT                   /gene="hemE"
FT                   /locus_tag="EAM_0243"
FT                   /product="uroporphyrinogen decarboxylase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0243"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44918"
FT                   /protein_id="CBJ44918.1"
FT                   FVEAVHRLSRPYHLG"
FT   misc_feature    304357..305391
FT                   /note="HMMPfam hit to PF01208, Uroporphyrinogen
FT                   decarboxylase (URO-D), score 6.6e-206"
FT   misc_feature    304411..304440
FT                   /note="PS00906 Uroporphyrinogen decarboxylase signature 1."
FT   misc_feature    304774..304821
FT                   /note="PS00907 Uroporphyrinogen decarboxylase signature 2."
FT   CDS_pept        305450..306115
FT                   /transl_table=11
FT                   /gene="nfi"
FT                   /locus_tag="EAM_0244"
FT                   /product="endonuclease V"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0244"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44919"
FT                   /protein_id="CBJ44919.1"
FT   misc_feature    305474..306076
FT                   /note="HMMPfam hit to PF04493, Endonuclease V, score 2e-91"
FT   CDS_pept        306183..306773
FT                   /transl_table=11
FT                   /locus_tag="EAM_0245"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0245"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44920"
FT                   /protein_id="CBJ44920.1"
FT   misc_feature    306186..306764
FT                   /note="HMMPfam hit to PF04222, Protein of unknown
FT                   function,DUF, score 1.6e-149"
FT   CDS_pept        306962..307234
FT                   /transl_table=11
FT                   /gene="hupA"
FT                   /locus_tag="EAM_0246"
FT                   /product="histone like DNA-binding protein HU-alpha"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0246"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44921"
FT                   /protein_id="CBJ44921.1"
FT   misc_feature    306962..307231
FT                   /note="HMMPfam hit to PF00216, Bacterial DNA-binding
FT                   protein, score 2e-49"
FT   CDS_pept        307368..308036
FT                   /transl_table=11
FT                   /locus_tag="EAM_0247"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0247"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44922"
FT                   /protein_id="CBJ44922.1"
FT                   "
FT   misc_feature    307368..308033
FT                   /note="HMMPfam hit to PF07356, Protein of unknown function
FT                   (DUF1481), score 3.2e-68"
FT   misc_feature    307368..307445
FT                   /note="Signal peptide predicted for EAM_0247 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.997) with cleavage site
FT                   probability 0.836 between residues 26 and 27"
FT   misc_feature    307401..307433
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(308111..309391)
FT                   /transl_table=11
FT                   /gene="purD"
FT                   /locus_tag="EAM_0248"
FT                   /product="phosphoribosylglycineamide synthetase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0248"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44923"
FT                   /protein_id="CBJ44923.1"
FT   misc_feature    complement(308123..308404)
FT                   /note="HMMPfam hit to PF02843, Phosphoribosylglycinamide
FT                   synthetase, C d, score 5.2e-49"
FT   misc_feature    complement(308501..308524)
FT                   /note="PS00184 Phosphoribosylglycinamide synthetase
FT                   signature."
FT   misc_feature    complement(308504..309085)
FT                   /note="HMMPfam hit to PF01071, Phosphoribosylglycinamide
FT                   synthetase, ATP, score 4.5e-130"
FT   misc_feature    complement(308510..309085)
FT                   /note="HMMPfam hit to PF02655, ATP-grasp domain, score
FT                   0.0008"
FT   misc_feature    complement(309086..309391)
FT                   /note="HMMPfam hit to PF02844, Phosphoribosylglycinamide
FT                   synthetase, N d, score 3.7e-61"
FT   CDS_pept        complement(309406..310995)
FT                   /transl_table=11
FT                   /gene="purH"
FT                   /locus_tag="EAM_0249"
FT                   /product="bifunctional purine biosynthesis protein PurH
FT                   [includes phosphoribosylaminoimidazolecarboxamide
FT                   formyltransferase; IMP cyclohydrolase]"
FT                   /EC_number=""
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0249"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44924"
FT                   /protein_id="CBJ44924.1"
FT                   AMIFTDMRHFRH"
FT   misc_feature    complement(309613..310587)
FT                   /note="HMMPfam hit to PF01808, AICARFT/IMPCHase
FT                   bienzyme,score 1.8e-216"
FT   misc_feature    complement(310600..310941)
FT                   /note="HMMPfam hit to PF02142, MGS-like domain, score
FT                   9.3e-64"
FT   rRNA            311610..313167
FT                   /gene="16S rRNA"
FT                   /locus_tag="EAM_r010"
FT                   /note="rRNA"
FT   tRNA            313226..313299
FT                   /gene="tRNA-Ile"
FT                   /locus_tag="EAM_t016"
FT                   /product="transfer RNA-Ile"
FT                   /anticodon="(pos:313260..313262,aa:Ile)"
FT                   /note="tRNA Ile anticodon GAT, Cove score 70.86"
FT   tRNA            313455..313527
FT                   /gene="tRNA-Ala"
FT                   /locus_tag="EAM_t017"
FT                   /product="transfer RNA-Ala"
FT                   /anticodon="(pos:313488..313490,aa:Ala)"
FT                   /note="tRNA Ala anticodon TGC, Cove score 74.29"
FT   rRNA            313917..316788
FT                   /gene="23S rRNA"
FT                   /locus_tag="EAM_r011"
FT                   /note="rRNA"
FT   rRNA            316979..317112
FT                   /gene="5S rRNA"
FT                   /locus_tag="EAM_r012"
FT                   /note="rRNA"
FT   CDS_pept        317367..318296
FT                   /transl_table=11
FT                   /gene="metA"
FT                   /locus_tag="EAM_0250"
FT                   /product="homoserine O-succinyltransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0250"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44925"
FT                   /protein_id="CBJ44925.1"
FT   misc_feature    317370..318263
FT                   /note="HMMPfam hit to PF04204, Homoserine
FT                   O-succinyltransferase, score 1.1e-200"
FT   CDS_pept        complement(318835..318987)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0251"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0251"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44926"
FT                   /protein_id="CBJ44926.1"
FT                   QVLTL"
FT   CDS_pept        319283..320908
FT                   /transl_table=11
FT                   /locus_tag="EAM_0252"
FT                   /product="putative transporter"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0252"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44927"
FT                   /protein_id="CBJ44927.1"
FT   misc_feature    join(319292..319360,319418..319486,319577..319645,
FT                   319679..319747,319805..319873,319886..319954,
FT                   319997..320065,320102..320170)
FT                   /note="8 probable transmembrane helices predicted for
FT                   EAM_0252 by TMHMM2.0 at aa 4-26, 46-68, 99-121,
FT                   133-155,175-197, 202-224, 239-261 and 274-296"
FT   misc_feature    319319..319792
FT                   /note="HMMPfam hit to PF02690, Na+/Pi-cotransporter, score
FT                   1.4e-57"
FT   CDS_pept        complement(321026..322378)
FT                   /transl_table=11
FT                   /gene="lysC"
FT                   /locus_tag="EAM_0253"
FT                   /product="lysine-sensitive aspartokinase III"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0253"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44928"
FT                   /protein_id="CBJ44928.1"
FT   misc_feature    complement(321218..321451)
FT                   /note="HMMPfam hit to PF01842, ACT domain, score 0.00026"
FT   misc_feature    complement(321542..322369)
FT                   /note="HMMPfam hit to PF00696, Amino acid kinase
FT                   family,score 3.9e-59"
FT   misc_feature    complement(322298..322348)
FT                   /note="PS00237 G-protein coupled receptors signature."
FT   misc_feature    complement(322334..322360)
FT                   /note="PS00324 Aspartokinase signature."
FT   CDS_pept        323036..324679
FT                   /transl_table=11
FT                   /gene="pgi"
FT                   /locus_tag="EAM_0254"
FT                   /product="glucose-6-phosphate isomerase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0254"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44929"
FT                   /protein_id="CBJ44929.1"
FT   misc_feature    323189..324655
FT                   /note="HMMPfam hit to PF00342, Phosphoglucose
FT                   isomerase,score 0"
FT   misc_feature    323825..323866
FT                   /note="PS00765 Phosphoglucose isomerase signature 1."
FT   misc_feature    324521..324574
FT                   /note="PS00174 Phosphoglucose isomerase signature 2."
FT   CDS_pept        325352..325612
FT                   /transl_table=11
FT                   /locus_tag="EAM_0255"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0255"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44930"
FT                   /protein_id="CBJ44930.1"
FT   misc_feature    325352..325417
FT                   /note="Signal peptide predicted for EAM_0255 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.998 between residues 22 and 23"
FT   misc_feature    join(325364..325432,325475..325543)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0255 by TMHMM2.0 at aa 5-27 and 42-64"
FT   CDS_pept        325691..326338
FT                   /transl_table=11
FT                   /locus_tag="EAM_0256"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0256"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44931"
FT                   /protein_id="CBJ44931.1"
FT   misc_feature    325691..325735
FT                   /note="Signal peptide predicted for EAM_0256 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.996) with cleavage site
FT                   probability 0.695 between residues 15 and 16"
FT   misc_feature    325706..325738
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        326335..327090
FT                   /transl_table=11
FT                   /locus_tag="EAM_0257"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0257"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44932"
FT                   /protein_id="CBJ44932.1"
FT   misc_feature    326335..326397
FT                   /note="Signal peptide predicted for EAM_0257 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.987 between residues 21 and 22"
FT   misc_feature    326353..327087
FT                   /note="HMMPfam hit to PF06251, Protein of unknown function
FT                   (DUF1017), score 1.5e-65"
FT   CDS_pept        327090..329183
FT                   /transl_table=11
FT                   /locus_tag="EAM_0258"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0258"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44933"
FT                   /protein_id="CBJ44933.1"
FT                   SYR"
FT   misc_feature    327090..327155
FT                   /note="Signal peptide predicted for EAM_0258 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.898 between residues 22 and 23"
FT   misc_feature    327105..329180
FT                   /note="HMMPfam hit to PF06082, Bacterial putative
FT                   lipoprotein (DUF940), score 0"
FT   misc_feature    327105..327137
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        329398..329814
FT                   /transl_table=11
FT                   /gene="psiE"
FT                   /locus_tag="EAM_0259"
FT                   /product="putative phosphate starvation-inducible membrane
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0259"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44934"
FT                   /protein_id="CBJ44934.1"
FT   misc_feature    329398..329811
FT                   /note="HMMPfam hit to
FT                   PF06146,Phosphate-starvation-inducible E, score 2.9e-57"
FT   misc_feature    join(329434..329502,329566..329634,329653..329712,
FT                   329740..329793)
FT                   /note="4 probable transmembrane helices predicted for
FT                   EAM_0259 by TMHMM2.0 at aa 13-35, 57-79, 86-105 and
FT                   115-132"
FT   misc_feature    329455..329487
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        329952..330476
FT                   /transl_table=11
FT                   /gene="ubiC"
FT                   /locus_tag="EAM_0260"
FT                   /product="chorismate--pyruvate lyase"
FT                   /EC_number="4.1.3.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0260"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44935"
FT                   /protein_id="CBJ44935.1"
FT                   PLYESLAKGEQ"
FT   misc_feature    329973..330464
FT                   /note="HMMPfam hit to PF04345, Chorismate lyase, score
FT                   4e-27"
FT   CDS_pept        330478..331341
FT                   /transl_table=11
FT                   /gene="ubiA"
FT                   /locus_tag="EAM_0261"
FT                   /product="4-hydroxybenzoate octaprenyltransferase"
FT                   /EC_number="2.5.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0261"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44936"
FT                   /protein_id="CBJ44936.1"
FT                   GVALSL"
FT   misc_feature    join(330538..330606,330619..330687,330769..330837,
FT                   330895..330963,330976..331044,331162..331230,
FT                   331267..331335)
FT                   /note="7 probable transmembrane helices predicted for
FT                   EAM_0261 by TMHMM2.0 at aa 21-43, 48-70, 98-120,
FT                   140-162,167-189, 229-251 and 264-286"
FT   misc_feature    330550..331338
FT                   /note="HMMPfam hit to PF01040, UbiA prenyltransferase
FT                   family, score 1.4e-77"
FT   misc_feature    330676..330744
FT                   /note="PS00943 UbiA prenyltransferase family signature."
FT   misc_feature    331180..331257
FT                   /note="PS00217 Sugar transport proteins signature 2."
FT   CDS_pept        complement(331420..333852)
FT                   /transl_table=11
FT                   /gene="plsB"
FT                   /locus_tag="EAM_0262"
FT                   /product="glycerol-3-phosphate acyltransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0262"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44937"
FT                   /protein_id="CBJ44937.1"
FT   misc_feature    complement(331747..331779)
FT                   /note="PS00626 Regulator of chromosome condensation (RCC1)
FT                   signature 2."
FT   misc_feature    complement(332566..333000)
FT                   /note="HMMPfam hit to PF01553, Acyltransferase, score
FT                   4.8e-41"
FT   CDS_pept        333971..334336
FT                   /transl_table=11
FT                   /gene="dgkA"
FT                   /locus_tag="EAM_0263"
FT                   /product="diacylglycerol kinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0263"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44938"
FT                   /protein_id="CBJ44938.1"
FT                   TLLLAVFVWIMLLVPRL"
FT   misc_feature    333992..334327
FT                   /note="HMMPfam hit to PF01219, Prokaryotic diacylglycerol
FT                   kinase, score 4.1e-55"
FT   misc_feature    join(334058..334117,334130..334198,334259..334327)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0263 by TMHMM2.0 at aa 30-49, 54-76 and 97-119"
FT   misc_feature    334178..334213
FT                   /note="PS01069 Prokaryotic diacylglycerol kinase
FT                   signature."
FT   CDS_pept        334446..335054
FT                   /transl_table=11
FT                   /gene="lexA"
FT                   /locus_tag="EAM_0264"
FT                   /product="LexA repressor"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0264"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44939"
FT                   /protein_id="CBJ44939.1"
FT   misc_feature    334446..334640
FT                   /note="HMMPfam hit to PF01726, LexA DNA binding
FT                   domain,score 8.2e-38"
FT   misc_feature    334785..334991
FT                   /note="HMMPfam hit to PF00717, Peptidase S24-like, score
FT                   3.7e-21"
FT   CDS_pept        335247..336569
FT                   /transl_table=11
FT                   /gene="dinF"
FT                   /locus_tag="EAM_0265"
FT                   /product="DNA-damage-inducible membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0265"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44940"
FT                   /protein_id="CBJ44940.1"
FT   misc_feature    join(335280..335339,335367..335435,335493..335561,
FT                   335652..335711,335730..335789,335799..335867,
FT                   335967..336035,336045..336113,336201..336269,
FT                   336312..336380,336399..336458,336471..336530)
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0265 by TMHMM2.0 at aa 12-31, 41-63, 83-105,
FT                   136-155,162-181, 185-207, 241-263, 267-289, 319-341,
FT                   356-378,385-404 and 409-428"
FT   misc_feature    335295..335780
FT                   /note="HMMPfam hit to PF01554, MatE, score 6.2e-36"
FT   CDS_pept        336783..336992
FT                   /transl_table=11
FT                   /locus_tag="EAM_0266"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0266"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44941"
FT                   /protein_id="CBJ44941.1"
FT   misc_feature    336792..336950
FT                   /note="HMMPfam hit to PF05532, CsbD-like, score 1.3e-21"
FT   CDS_pept        complement(337074..337583)
FT                   /transl_table=11
FT                   /gene="zur"
FT                   /locus_tag="EAM_0267"
FT                   /product="zinc uptake regulation protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0267"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44942"
FT                   /protein_id="CBJ44942.1"
FT                   SKKRGR"
FT   misc_feature    complement(337170..337535)
FT                   /note="HMMPfam hit to PF01475, Ferric uptake regulator
FT                   family, score 2e-06"
FT   CDS_pept        338058..339290
FT                   /transl_table=11
FT                   /gene="traF"
FT                   /locus_tag="EAM_0268"
FT                   /product="putative plasmid transfer protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0268"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44943"
FT                   /protein_id="CBJ44943.1"
FT                   WGAVAQLNFTF"
FT   misc_feature    338058..338144
FT                   /note="Signal peptide predicted for EAM_0268 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.996 between residues 29 and 30"
FT   CDS_pept        339739..340071
FT                   /transl_table=11
FT                   /locus_tag="EAM_0269"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0269"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44944"
FT                   /protein_id="CBJ44944.1"
FT                   YEPSWW"
FT   CDS_pept        340467..340628
FT                   /transl_table=11
FT                   /locus_tag="EAM_0270"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0270"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44945"
FT                   /protein_id="CBJ44945.1"
FT                   RRRCREAA"
FT   CDS_pept        complement(340765..341016)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0271"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0271"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44946"
FT                   /protein_id="CBJ44946.1"
FT   CDS_pept        complement(341046..341210)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0272"
FT                   /product="putative phage protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0272"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44947"
FT                   /protein_id="CBJ44947.1"
FT                   LMASHGVSA"
FT   CDS_pept        341305..341835
FT                   /transl_table=11
FT                   /locus_tag="EAM_0273"
FT                   /product="putative phage protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0273"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44948"
FT                   /protein_id="CBJ44948.1"
FT                   IATATKNSGDKNA"
FT   misc_feature    341305..341799
FT                   /note="HMMPfam hit to PF06914, Protein of unknown function
FT                   (DUF1277), score 2.2e-29"
FT   misc_feature    341680..341697
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   CDS_pept        341828..342190
FT                   /transl_table=11
FT                   /locus_tag="EAM_0274"
FT                   /product="putative phage antitermination protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0274"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44949"
FT                   /protein_id="CBJ44949.1"
FT                   FIEGCLSMLDVRLEME"
FT   misc_feature    341828..342187
FT                   /note="HMMPfam hit to PF06530, Phage antitermination
FT                   protein Q, score 1.2e-46"
FT   misc_feature    341828..341839
FT                   /note="PS00228 Tubulin-beta mRNA autoregulation signal."
FT   misc_feature    342062..342127
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1524.000, SD 4.38 at aa 79-100, sequence
FT   CDS_pept        complement(342232..342621)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0275"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0275"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44950"
FT                   /protein_id="CBJ44950.1"
FT   misc_feature    complement(join(342238..342306,342409..342477,
FT                   342535..342603))
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0275 by TMHMM2.0 at aa 7-29, 49-71 and 106-128"
FT   misc_feature    complement(342418..342465)
FT                   /note="PS00225 Crystallins beta and gamma 'Greek key' motif
FT                   signature."
FT   misc_feature    complement(342532..342621)
FT                   /note="Signal peptide predicted for EAM_0275 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.982) with cleavage site
FT                   probability 0.892 between residues 30 and 31"
FT   CDS_pept        complement(342734..343219)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0276"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0276"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44951"
FT                   /protein_id="CBJ44951.1"
FT   misc_feature    complement(join(342740..342808,342917..342976,
FT                   343037..343105))
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0276 by TMHMM2.0 at aa 39-61, 82-101 and 138-160"
FT   CDS_pept        complement(343281..343610)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0277"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0277"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44952"
FT                   /protein_id="CBJ44952.1"
FT                   EKIQL"
FT   misc_feature    complement(join(343308..343376,343479..343547))
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0277 by TMHMM2.0 at aa 22-44 and 79-101"
FT   CDS_pept        complement(343681..344691)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0278"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0278"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44953"
FT                   /protein_id="CBJ44953.1"
FT   misc_feature    complement(join(343723..343791,343810..343878))
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0278 by TMHMM2.0 at aa 272-294 and 301-323"
FT   CDS_pept        complement(344745..344969)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0279"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0279"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44954"
FT                   /protein_id="CBJ44954.1"
FT   CDS_pept        345068..345652
FT                   /transl_table=11
FT                   /locus_tag="EAM_0280"
FT                   /product="putative DNA methylase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0280"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44955"
FT                   /protein_id="CBJ44955.1"
FT   misc_feature    345071..345640
FT                   /note="HMMPfam hit to PF01555, DNA methylase, score
FT                   1.3e-12"
FT   CDS_pept        complement(345707..346120)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0281"
FT                   /product="putative phage protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0281"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44956"
FT                   /protein_id="CBJ44956.1"
FT   misc_feature    complement(345974..346117)
FT                   /note="HMMPfam hit to PF03681, Uncharacterised protein
FT                   family (UPF0150), score 1.1e-15"
FT   CDS_pept        346521..346913
FT                   /transl_table=11
FT                   /locus_tag="EAM_0282"
FT                   /product="putative phage holin"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0282"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44957"
FT                   /protein_id="CBJ44957.1"
FT   misc_feature    346521..346829
FT                   /note="HMMPfam hit to PF05106, Phage holin family (Lysis
FT                   protein S), score 1.7e-12"
FT   misc_feature    join(346578..346646,346743..346811,346854..346907)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0282 by TMHMM2.0 at aa 20-42, 75-97 and 112-129"
FT   CDS_pept        <346889..347026
FT                   /transl_table=11
FT                   /locus_tag="EAM_0283"
FT                   /product="putative phage protein (partial)"
FT                   /note="submitted with /partial"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0283"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44958"
FT                   /protein_id="CBJ44958.1"
FT                   "
FT   misc_feature    346899..346910
FT                   /note="PS00294 Prenyl group binding site (CAAX box)."
FT   CDS_pept        join(347026..347190,347190..347309,347313..347621)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0284"
FT                   /product="putative bacteriophage baseplate assembly
FT                   protein"
FT                   /db_xref="PSEUDO:CBJ44959.1"
FT   misc_feature    join(347080..347190,347190..347309,347313..347576)
FT                   /note="HMMPfam hit to PF06890, Bacteriophage Mu Gp45
FT                   protein, score 5.3e-50"
FT   CDS_pept        347714..348004
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0285"
FT                   /product="putative phage tail fiber assembly protein"
FT                   /db_xref="PSEUDO:CBJ44960.1"
FT   CDS_pept        complement(348008..349450)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0286"
FT                   /product="putative phage protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0286"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44961"
FT                   /protein_id="CBJ44961.1"
FT   misc_feature    complement(join(348425..348493,348536..348604,
FT                   348623..348691,348809..348868,348905..348973,
FT                   349031..349099,349184..349243,349358..349426))
FT                   /note="8 probable transmembrane helices predicted for
FT                   EAM_0286 by TMHMM2.0 at aa 9-31, 70-89, 118-140,
FT                   160-182,195-214, 254-276, 283-305 and 320-342"
FT   CDS_pept        complement(349451..350374)
FT                   /transl_table=11
FT                   /gene="gtrB"
FT                   /locus_tag="EAM_0287"
FT                   /product="putative phage-encoded bactoprenol glucosyl
FT                   transferase"
FT                   /EC_number="2.4.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0287"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44962"
FT                   /protein_id="CBJ44962.1"
FT   misc_feature    complement(join(349517..349585,349628..349696))
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0287 by TMHMM2.0 at aa 227-249 and 264-286"
FT   misc_feature    complement(349766..349789)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(349871..350365)
FT                   /note="HMMPfam hit to PF00535, Glycosyl transferase
FT                   family,score 1.2e-28"
FT   CDS_pept        complement(350340..350732)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0288"
FT                   /product="putative phage-encoded bactoprenol-linked glucose
FT                   transferase (flippase)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0288"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44963"
FT                   /protein_id="CBJ44963.1"
FT   misc_feature    complement(join(350385..350453,350481..350537,
FT                   350574..350633,350646..350714))
FT                   /note="4 probable transmembrane helices predicted for
FT                   EAM_0288 by TMHMM2.0 at aa 7-29, 34-53, 66-84 and 94-116"
FT   misc_feature    complement(350385..350714)
FT                   /note="HMMPfam hit to PF04138, GtrA-like protein, score
FT                   6.7e-13"
FT   CDS_pept        complement(350783..350965)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0289"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0289"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44964"
FT                   /protein_id="CBJ44964.1"
FT                   QASAIPLKLDLKMSI"
FT   CDS_pept        complement(join(350946..351170,351174..351182))
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0290"
FT                   /product="putative DNA-damage-inducible protein"
FT                   /db_xref="PSEUDO:CBJ44965.1"
FT   misc_feature    complement(350952..351146)
FT                   /note="HMMPfam hit to PF06183, DinI-like family, score
FT                   9.6e-21"
FT   misc_feature    complement(351120..351182)
FT                   /note="Signal peptide predicted for EAM_0290 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.768) with cleavage site
FT                   probability 0.732 between residues 21 and 22"
FT   CDS_pept        complement(join(351234..351392,351392..351505,
FT                   351505..352323))
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0291"
FT                   /product="integrase"
FT                   /db_xref="PSEUDO:CBJ44966.1"
FT   misc_feature    complement(join(351276..351392,351392..351505,
FT                   351505..351741))
FT                   /note="HMMPfam hit to PF00589, Phage integrase family,score
FT                   5.1e-09"
FT   CDS_pept        352414..353463
FT                   /transl_table=11
FT                   /gene="dusA"
FT                   /locus_tag="EAM_0292"
FT                   /product="tRNA-dihydrouridine synthase A"
FT                   /EC_number="1.-.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0292"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44967"
FT                   /protein_id="CBJ44967.1"
FT                   VAEKVPADS"
FT   misc_feature    352498..353439
FT                   /note="HMMPfam hit to PF01207, Dihydrouridine synthase
FT                   (Dus), score 4e-131"
FT   misc_feature    352735..352791
FT                   /note="PS01136 Uncharacterized protein family UPF0034
FT                   signature."
FT   CDS_pept        353620..353853
FT                   /transl_table=11
FT                   /locus_tag="EAM_0293"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0293"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44968"
FT                   /protein_id="CBJ44968.1"
FT   misc_feature    353620..353745
FT                   /note="Signal peptide predicted for EAM_0293 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.942) with cleavage site
FT                   probability 0.378 between residues 42 and 43"
FT   misc_feature    join(353638..353706,353734..353802)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0293 by TMHMM2.0 at aa 7-29 and 39-61"
FT   CDS_pept        353888..354007
FT                   /transl_table=11
FT                   /locus_tag="EAM_0294"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0294"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44969"
FT                   /protein_id="CBJ44969.1"
FT   CDS_pept        complement(354080..355060)
FT                   /transl_table=11
FT                   /gene="qor"
FT                   /locus_tag="EAM_0295"
FT                   /product="quinone oxidoreductase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0295"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44970"
FT                   /protein_id="CBJ44970.1"
FT   misc_feature    complement(354221..354646)
FT                   /note="HMMPfam hit to PF00107, Zinc-binding
FT                   dehydrogenase,score 6.8e-32"
FT   misc_feature    complement(354578..354643)
FT                   /note="PS01162 Quinone oxidoreductase / zeta-crystallin
FT                   signature."
FT   misc_feature    complement(354737..354979)
FT                   /note="HMMPfam hit to PF08240, Alcohol dehydrogenase
FT                   GroES-like domain, score 3.8e-15"
FT   CDS_pept        355160..356575
FT                   /transl_table=11
FT                   /gene="dnaB"
FT                   /locus_tag="EAM_0296"
FT                   /product="replicative DNA helicase"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0296"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44971"
FT                   /protein_id="CBJ44971.1"
FT                   RFDNYAGPQYDDE"
FT   misc_feature    355235..355543
FT                   /note="HMMPfam hit to PF00772, DnaB-like helicase N
FT                   terminal domain, score 2.3e-53"
FT   misc_feature    355766..356365
FT                   /note="HMMPfam hit to PF03796, DnaB-like helicase C
FT                   terminal domain, score 4.2e-137"
FT   misc_feature    355850..355873
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    356255..356320
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1279.000, SD 3.54 at aa 366-387, sequence
FT   CDS_pept        join(356674..356742,356744..357154)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0297"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="PSEUDO:CBJ44972.1"
FT   misc_feature    356840..357085
FT                   /note="HMMPfam hit to PF02588, Uncharacterized BCR, YitT
FT                   family COG1284, score 1.1e-07"
FT   CDS_pept        357178..358371
FT                   /transl_table=11
FT                   /gene="tyrB"
FT                   /locus_tag="EAM_0298"
FT                   /product="aromatic-amino-acid aminotransferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0298"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44973"
FT                   /protein_id="CBJ44973.1"
FT   misc_feature    357253..358356
FT                   /note="HMMPfam hit to PF00155, Aminotransferase class I and
FT                   II, score 1.9e-113"
FT   misc_feature    357907..357948
FT                   /note="PS00105 Aminotransferases class-I
FT                   pyridoxal-phosphate attachment site."
FT   CDS_pept        358486..358905
FT                   /transl_table=11
FT                   /locus_tag="EAM_0299"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0299"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44974"
FT                   /protein_id="CBJ44974.1"
FT   misc_feature    358534..358893
FT                   /note="HMMPfam hit to PF01894, Uncharacterised protein
FT                   family UPF0047, score 7.5e-51"
FT   CDS_pept        358908..359225
FT                   /transl_table=11
FT                   /locus_tag="EAM_0300"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0300"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44975"
FT                   /protein_id="CBJ44975.1"
FT                   R"
FT   misc_feature    358914..359219
FT                   /note="HMMPfam hit to PF04237, Protein of unknown function
FT                   (DUF419), score 1.4e-22"
FT   misc_feature    359278..365218
FT                   /note="unique vs ECA"
FT   CDS_pept        complement(359460..363545)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0301"
FT                   /product="putative invasin"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0301"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44976"
FT                   /protein_id="CBJ44976.1"
FT                   NWFGSGSAINKPYVDIIK"
FT   misc_feature    complement(360333..360356)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(360543..360791)
FT                   /note="HMMPfam hit to PF02368, no description, score 0.29"
FT   misc_feature    complement(360804..361067)
FT                   /note="HMMPfam hit to PF02368, no description, score 0.029"
FT   misc_feature    complement(361068..361352)
FT                   /note="HMMPfam hit to PF02369, Bacterial Ig-like domain
FT                   (group 1), score 0.0081"
FT   misc_feature    complement(363285..363350)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1133.000, SD 3.05 at aa 66-87, sequence
FT   misc_feature    complement(363432..363545)
FT                   /note="Signal peptide predicted for EAM_0301 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.810) with cleavage site
FT                   probability 0.549 between residues 38 and 39"
FT   CDS_pept        complement(363742..364143)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0302"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0302"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44977"
FT                   /protein_id="CBJ44977.1"
FT   misc_feature    complement(363964..364017)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0302 by TMHMM2.0 at aa 43-60"
FT   CDS_pept        complement(364140..364340)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0303"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0303"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44978"
FT                   /protein_id="CBJ44978.1"
FT   CDS_pept        complement(364710..364895)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0304"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0304"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44979"
FT                   /protein_id="CBJ44979.1"
FT                   TRIMLHHADLALPIQK"
FT   CDS_pept        complement(365005..365157)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0305"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0305"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44980"
FT                   /protein_id="CBJ44980.1"
FT                   LRLHA"
FT   CDS_pept        complement(365281..366333)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0306"
FT                   /product="putative zinc-binding alcohol dehydrogenase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0306"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44981"
FT                   /protein_id="CBJ44981.1"
FT                   FVIDISSLRA"
FT   misc_feature    complement(365404..365811)
FT                   /note="HMMPfam hit to PF00107, Zinc-binding
FT                   dehydrogenase,score 1.5e-35"
FT   misc_feature    complement(365713..365799)
FT                   /note="PS00065 D-isomer specific 2-hydroxyacid
FT                   dehydrogenases NAD-binding signature."
FT   misc_feature    complement(365899..366252)
FT                   /note="HMMPfam hit to PF08240, Alcohol dehydrogenase
FT                   GroES-like domain, score 5e-31"
FT   misc_feature    complement(366205..366222)
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   CDS_pept        complement(366617..369445)
FT                   /transl_table=11
FT                   /gene="uvrA"
FT                   /locus_tag="EAM_0307"
FT                   /product="excinuclease ABC subunit A"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0307"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44982"
FT                   /protein_id="CBJ44982.1"
FT                   HTARFLKPLLEQ"
FT   misc_feature    complement(366722..367549)
FT                   /note="HMMPfam hit to PF00005, ABC transporter, score
FT                   1.3e-42"
FT   misc_feature    complement(366914..366958)
FT                   /note="PS00211 ABC transporters family signature."
FT   misc_feature    complement(367505..367528)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(367943..367987)
FT                   /note="PS00211 ABC transporters family signature."
FT   misc_feature    complement(368213..368230)
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   misc_feature    complement(369332..369355)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        369698..370249
FT                   /transl_table=11
FT                   /gene="ssb"
FT                   /locus_tag="EAM_0308"
FT                   /product="single-strand binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0308"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44983"
FT                   /protein_id="CBJ44983.1"
FT   misc_feature    369713..370036
FT                   /note="HMMPfam hit to PF00436, Single-strand binding
FT                   protein family, score 5.9e-36"
FT   misc_feature    369713..369751
FT                   /note="PS00735 Single-strand binding protein family
FT                   signature 1."
FT   misc_feature    369854..369883
FT                   /note="PS00736 Single-strand binding protein family
FT                   signature 2."
FT   CDS_pept        370690..372336
FT                   /transl_table=11
FT                   /locus_tag="EAM_0309"
FT                   /product="putative activator or transporter protein of
FT                   haemolysin-like protein"
FT                   /product="two-partner secretion protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0309"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44984"
FT                   /protein_id="CBJ44984.1"
FT   misc_feature    370897..371124
FT                   /note="HMMPfam hit to PF08479, POTRA domain,
FT                   ShlB-type,score 0.00075"
FT   misc_feature    371146..372327
FT                   /note="HMMPfam hit to PF03865, Haemolysin
FT                   secretion/activation protein ShlB, score 1.8e-08"
FT   CDS_pept        join(372381..373001,373003..373146)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0310"
FT                   /product="putative haemagglutinin/hemolysin/adhesin
FT                   (pseudogene)"
FT   misc_feature    372430..376453
FT                   /note="unique vs ECA"
FT   CDS_pept        complement(373338..373718)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0311"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0311"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44986"
FT                   /protein_id="CBJ44986.1"
FT   misc_feature    complement(373614..373682)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0311 by TMHMM2.0 at aa 13-35"
FT   CDS_pept        373900..374349
FT                   /transl_table=11
FT                   /locus_tag="EAM_0312"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0312"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44987"
FT                   /protein_id="CBJ44987.1"
FT   misc_feature    373900..373956
FT                   /note="Signal peptide predicted for EAM_0312 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.846 between residues 19 and 20"
FT   CDS_pept        374359..374511
FT                   /transl_table=11
FT                   /locus_tag="EAM_0313"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0313"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44988"
FT                   /protein_id="CBJ44988.1"
FT                   TAALH"
FT   CDS_pept        complement(375043..375435)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0314"
FT                   /product="putative transposase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0314"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44989"
FT                   /protein_id="CBJ44989.1"
FT   misc_feature    complement(375196..375429)
FT                   /note="HMMPfam hit to PF01527, Transposase, score 8.7e-13"
FT   misc_feature    complement(375307..375372)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1290.000, SD 3.58 at aa 22-43, sequence
FT   CDS_pept        375932..376087
FT                   /transl_table=11
FT                   /locus_tag="EAM_0315"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0315"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44990"
FT                   /protein_id="CBJ44990.1"
FT                   EKVPHR"
FT   CDS_pept        complement(376528..376953)
FT                   /transl_table=11
FT                   /gene="soxS"
FT                   /locus_tag="EAM_0316"
FT                   /product="AraC-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0316"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44991"
FT                   /protein_id="CBJ44991.1"
FT   misc_feature    complement(376642..376776)
FT                   /note="HMMPfam hit to PF00165, Bacterial regulatory
FT                   helix-turn-helix protei, score 8.3e-14"
FT   misc_feature    complement(376657..376785)
FT                   /note="PS00041 Bacterial regulatory proteins, araC family
FT                   signature."
FT   misc_feature    complement(376792..376926)
FT                   /note="HMMPfam hit to PF00165, Bacterial regulatory
FT                   helix-turn-helix protei, score 4.9e-09"
FT   misc_feature    complement(376828..376893)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1570.000, SD 4.53 at aa 21-42, sequence
FT   CDS_pept        377056..377523
FT                   /transl_table=11
FT                   /gene="soxR"
FT                   /locus_tag="EAM_0317"
FT                   /product="redox-sensitive transcriptional activator
FT                   (MerR-family transcriptional regulator)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0317"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44992"
FT                   /protein_id="CBJ44992.1"
FT   misc_feature    377092..377157
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1453.000, SD 4.14 at aa 13-34, sequence
FT   misc_feature    377095..377205
FT                   /note="HMMPfam hit to PF00376, MerR family regulatory
FT                   protein, score 1.9e-11"
FT   misc_feature    377101..377169
FT                   /note="PS00552 Bacterial regulatory proteins, merR family
FT                   signature."
FT   CDS_pept        377564..378229
FT                   /transl_table=11
FT                   /locus_tag="EAM_0318"
FT                   /product="putative glutathione S-transferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0318"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44993"
FT                   /protein_id="CBJ44993.1"
FT   misc_feature    377564..377788
FT                   /note="HMMPfam hit to PF02798, Glutathione
FT                   S-transferase,N-terminal domain, score 6.6e-13"
FT   CDS_pept        378696..380045
FT                   /transl_table=11
FT                   /locus_tag="EAM_0319"
FT                   /product="putative permease"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0319"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44994"
FT                   /protein_id="CBJ44994.1"
FT   misc_feature    378771..379925
FT                   /note="HMMPfam hit to PF00860, Permease family, score
FT                   2.3e-99"
FT   misc_feature    join(378780..378848,378861..378929,378948..379016,
FT                   379029..379097,379131..379190,379218..379286,
FT                   379299..379367,379425..379493,379698..379766,
FT                   379776..379829,379866..379934,379977..380036)
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0319 by TMHMM2.0 at aa 29-51, 56-78, 85-107,
FT                   112-134,146-165, 175-197, 202-224, 244-266, 335-357,
FT                   361-378,391-413 and 428-447"
FT   misc_feature    379086..379952
FT                   /note="HMMPfam hit to PF00916, Sulfate transporter
FT                   family,score 0.00014"
FT   misc_feature    379671..379694
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        380211..381860
FT                   /transl_table=11
FT                   /locus_tag="EAM_0320"
FT                   /product="putative Na(+)/H(+) exchanger"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0320"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44995"
FT                   /protein_id="CBJ44995.1"
FT   misc_feature    380211..380270
FT                   /note="Signal peptide predicted for EAM_0320 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.960) with cleavage site
FT                   probability 0.744 between residues 20 and 21"
FT   misc_feature    join(380220..380288,380292..380360,380463..380531,
FT                   380550..380618,380685..380753,380772..380840,
FT                   380898..380966,381021..381089,381147..381215,
FT                   381291..381359,381402..381470)
FT                   /note="11 probable transmembrane helices predicted for
FT                   EAM_0320 by TMHMM2.0 at aa 4-26, 28-50, 85-107,
FT                   114-136,159-181, 188-210, 230-252, 271-293, 313-335,
FT                   361-383 and 398-420"
FT   misc_feature    380229..381476
FT                   /note="HMMPfam hit to PF00999, Sodium/hydrogen exchanger
FT                   family, score 1.5e-77"
FT   CDS_pept        complement(381910..382812)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0321"
FT                   /product="LysR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0321"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44996"
FT                   /protein_id="CBJ44996.1"
FT   misc_feature    complement(381937..382557)
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 2.9e-46"
FT   misc_feature    complement(382627..382806)
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 1.9e-22"
FT   misc_feature    complement(382672..382764)
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    complement(382702..382767)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1900.000, SD 5.66 at aa 16-37, sequence
FT   CDS_pept        382921..383349
FT                   /transl_table=11
FT                   /locus_tag="EAM_0322"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0322"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44997"
FT                   /protein_id="CBJ44997.1"
FT   misc_feature    join(382957..383016,383044..383112,383131..383199,
FT                   383227..383286)
FT                   /note="4 probable transmembrane helices predicted for
FT                   EAM_0322 by TMHMM2.0 at aa 13-32, 42-64, 71-93 and 103-122"
FT   misc_feature    382972..383301
FT                   /note="HMMPfam hit to PF03788, LrgA family, score 9.9e-38"
FT   CDS_pept        383342..384040
FT                   /transl_table=11
FT                   /locus_tag="EAM_0323"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0323"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44998"
FT                   /protein_id="CBJ44998.1"
FT                   AIGHMMWATS"
FT   misc_feature    join(383351..383398,383432..383500,383528..383596,
FT                   383609..383677,383786..383854,383948..384016)
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0323 by TMHMM2.0 at aa 4-19, 31-53, 63-85,
FT                   90-112,149-171 and 203-225"
FT   misc_feature    383381..384025
FT                   /note="HMMPfam hit to PF04172, LrgB-like family, score
FT                   1.4e-103"
FT   CDS_pept        384181..384726
FT                   /transl_table=11
FT                   /locus_tag="EAM_0324"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0324"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ44999"
FT                   /protein_id="CBJ44999.1"
FT                   RKDNVVADGPYVGAALHF"
FT   misc_feature    384181..384723
FT                   /note="HMMPfam hit to PF07437, YfaZ precursor, score
FT                   7.4e-47"
FT   misc_feature    384181..384246
FT                   /note="Signal peptide predicted for EAM_0324 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.995 between residues 22 and 23"
FT   CDS_pept        complement(384788..386446)
FT                   /transl_table=11
FT                   /gene="actP"
FT                   /locus_tag="EAM_0325"
FT                   /product="cation/acetate symporter"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0325"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45000"
FT                   /protein_id="CBJ45000.1"
FT   misc_feature    complement(join(384890..384958,384986..385054,
FT                   385088..385156,385169..385228,385289..385357,
FT                   385454..385522,385583..385651,385739..385807,
FT                   385826..385894,385937..386005,386066..386134,
FT                   386147..386215,386276..386344))
FT                   /note="13 probable transmembrane helices predicted for
FT                   EAM_0325 by TMHMM2.0 at aa 35-57, 78-100, 105-127,
FT                   148-170,185-207, 214-236, 266-288, 309-331, 364-386,
FT                   407-426,431-453, 465-487 and 497-519"
FT   misc_feature    complement(385028..385090)
FT                   /note="PS00457 Sodium:solute symporter family signature 2."
FT   misc_feature    complement(385034..386254)
FT                   /note="HMMPfam hit to PF00474, Sodium:solute symporter
FT                   family, score 2.9e-185"
FT   misc_feature    complement(385832..385909)
FT                   /note="PS00456 Sodium:solute symporter family signature 1."
FT   misc_feature    complement(386387..386446)
FT                   /note="Signal peptide predicted for EAM_0325 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 1.000 between residues 20 and 21"
FT   CDS_pept        complement(386443..386754)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0326"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0326"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45001"
FT                   /protein_id="CBJ45001.1"
FT   misc_feature    complement(386446..386754)
FT                   /note="HMMPfam hit to PF04341, Protein of unknown
FT                   function,DUF485, score 1e-52"
FT   misc_feature    complement(join(386503..386571,386614..386682))
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0326 by TMHMM2.0 at aa 25-47 and 62-84"
FT   CDS_pept        complement(386917..388872)
FT                   /transl_table=11
FT                   /gene="acs"
FT                   /locus_tag="EAM_0327"
FT                   /product="acetyl-coenzyme A synthetase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0327"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45002"
FT                   /protein_id="CBJ45002.1"
FT                   GVVDKLLEEKLSIKMP"
FT   misc_feature    complement(387232..388548)
FT                   /note="HMMPfam hit to PF00501, AMP-binding enzyme, score
FT                   1.7e-138"
FT   misc_feature    complement(388057..388092)
FT                   /note="PS00455 Putative AMP-binding domain signature."
FT   misc_feature    complement(388534..388572)
FT                   /note="PS00018 EF-hand calcium-binding domain."
FT   CDS_pept        389379..390680
FT                   /transl_table=11
FT                   /gene="gltP"
FT                   /locus_tag="EAM_0328"
FT                   /product="proton glutamate symport protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0328"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45003"
FT                   /protein_id="CBJ45003.1"
FT   misc_feature    389379..389462
FT                   /note="Signal peptide predicted for EAM_0328 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.915) with cleavage site
FT                   probability 0.601 between residues 28 and 29"
FT   misc_feature    join(389397..389465,389523..389591,389628..389696,
FT                   389856..389915,389994..390062,390075..390143,
FT                   390354..390422,390465..390533)
FT                   /note="8 probable transmembrane helices predicted for
FT                   EAM_0328 by TMHMM2.0 at aa 7-29, 49-71, 84-106,
FT                   160-179,206-228, 233-255, 326-348 and 363-385"
FT   misc_feature    389400..390611
FT                   /note="HMMPfam hit to PF00375, Sodium:dicarboxylate
FT                   symporter family, score 5.4e-216"
FT   misc_feature    389505..389552
FT                   /note="PS00713 Sodium:dicarboxylate symporter family
FT                   signature 1."
FT   misc_feature    390294..390365
FT                   /note="PS00714 Sodium:dicarboxylate symporter family
FT                   signature 2."
FT   CDS_pept        391033..392577
FT                   /transl_table=11
FT                   /gene="aer"
FT                   /locus_tag="EAM_0329"
FT                   /product="aerotaxis receptor"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0329"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45004"
FT                   /protein_id="CBJ45004.1"
FT   misc_feature    391060..391386
FT                   /note="HMMPfam hit to PF00989, PAS fold, score 2.3e-05"
FT   misc_feature    391120..391395
FT                   /note="HMMPfam hit to PF08447, PAS fold, score 8.4e-16"
FT   misc_feature    join(391531..391599,391609..391668)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0329 by TMHMM2.0 at aa 167-189 and 193-212"
FT   misc_feature    391612..391821
FT                   /note="HMMPfam hit to PF00672, HAMP domain, score 0.00041"
FT   misc_feature    391912..392574
FT                   /note="HMMPfam hit to PF00015, Methyl-accepting chemotaxis
FT                   protein (MCP) s, score 1.7e-74"
FT   CDS_pept        complement(392617..392829)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0330"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0330"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45005"
FT                   /protein_id="CBJ45005.1"
FT   CDS_pept        393375..398123
FT                   /transl_table=11
FT                   /locus_tag="EAM_0331"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /note="similar to EAM_1732 (32.9% id) and EAM_0606 (27.8%
FT                   id)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0331"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45006"
FT                   /protein_id="CBJ45006.1"
FT                   LTT"
FT   CDS_pept        complement(398292..398831)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0332"
FT                   /product="putative DNA-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0332"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45007"
FT                   /protein_id="CBJ45007.1"
FT                   LKVQQFCRALTSGHAD"
FT   misc_feature    complement(398529..398594)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1049.000, SD 2.76 at aa 80-101, sequence
FT   CDS_pept        complement(398854..399084)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0333"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0333"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45008"
FT                   /protein_id="CBJ45008.1"
FT   CDS_pept        complement(399212..400456)
FT                   /transl_table=11
FT                   /gene="sbmA"
FT                   /locus_tag="EAM_0334"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0334"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45009"
FT                   /protein_id="CBJ45009.1"
FT                   VPDNQTPVTQGAKHL"
FT   misc_feature    complement(join(399386..399454,399464..399520,
FT                   399662..399730,399758..399826,399953..400021,
FT                   400121..400189,400208..400276,400364..400432))
FT                   /note="8 probable transmembrane helices predicted for
FT                   EAM_0334 by TMHMM2.0 at aa 9-31, 61-83, 90-112,
FT                   146-168,211-233, 243-265, 313-331 and 335-357"
FT   misc_feature    complement(399938..400336)
FT                   /note="HMMPfam hit to PF05992, SbmA/BacA-like family, score
FT                   1.9e-60"
FT   misc_feature    complement(400382..400456)
FT                   /note="Signal peptide predicted for EAM_0334 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.992) with cleavage site
FT                   probability 0.681 between residues 25 and 26"
FT   CDS_pept        400903..403359
FT                   /transl_table=11
FT                   /locus_tag="EAM_0335"
FT                   /product="putative signal transduction protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0335"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45010"
FT                   /protein_id="CBJ45010.1"
FT                   RRLKEF"
FT   misc_feature    401299..401640
FT                   /note="HMMPfam hit to PF00989, PAS fold, score 6.7e-08"
FT   misc_feature    401725..402060
FT                   /note="HMMPfam hit to PF00989, PAS fold, score 3.6e-05"
FT   misc_feature    402088..402573
FT                   /note="HMMPfam hit to PF00990, GGDEF domain, score 2.4e-64"
FT   misc_feature    402613..403326
FT                   /note="HMMPfam hit to PF00563, EAL domain, score 7.3e-116"
FT   CDS_pept        403617..404354
FT                   /transl_table=11
FT                   /locus_tag="EAM_0336"
FT                   /product="putative gluconate 2-dehydrogenase subunit"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0336"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45011"
FT                   /protein_id="CBJ45011.1"
FT   misc_feature    403617..403742
FT                   /note="Signal peptide predicted for EAM_0336 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.999) with cleavage site
FT                   probability 0.785 between residues 42 and 43"
FT   misc_feature    403674..403742
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0336 by TMHMM2.0 at aa 20-42"
FT   CDS_pept        404357..406141
FT                   /transl_table=11
FT                   /locus_tag="EAM_0337"
FT                   /product="gluconate 2-dehydrogenase flavoprotein subunit"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0337"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45012"
FT                   /protein_id="CBJ45012.1"
FT                   AKAIREQYLKNPGPLVQA"
FT   misc_feature    404357..404425
FT                   /note="Signal peptide predicted for EAM_0337 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.732) with cleavage site
FT                   probability 0.731 between residues 23 and 24"
FT   misc_feature    404378..405451
FT                   /note="HMMPfam hit to PF00732, GMC oxidoreductase, score
FT                   5e-05"
FT   misc_feature    404636..404653
FT                   /note="PS00343 Gram-positive cocci surface proteins
FT                   'anchoring' hexapeptide."
FT   CDS_pept        406152..407468
FT                   /transl_table=11
FT                   /locus_tag="EAM_0338"
FT                   /product="gluconate 2-dehydrogenase cytochrome C subunit"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0338"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45013"
FT                   /protein_id="CBJ45013.1"
FT   misc_feature    406152..406211
FT                   /note="Signal peptide predicted for EAM_0338 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.988 between residues 20 and 21"
FT   misc_feature    406269..406286
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   misc_feature    406713..406730
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   misc_feature    407091..407357
FT                   /note="HMMPfam hit to PF00034, Cytochrome c, score 2.5e-08"
FT   misc_feature    407124..407141
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   CDS_pept        408089..409204
FT                   /transl_table=11
FT                   /locus_tag="EAM_0339"
FT                   /product="putative membrane-associated acyltransferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0339"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45014"
FT                   /protein_id="CBJ45014.1"
FT   misc_feature    408089..408196
FT                   /note="Signal peptide predicted for EAM_0339 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.713) with cleavage site
FT                   probability 0.698 between residues 36 and 37"
FT   misc_feature    408113..409150
FT                   /note="HMMPfam hit to PF01757, Acyltransferase family,score
FT                   1.8e-15"
FT   misc_feature    join(408122..408181,408224..408292,408350..408409,
FT                   408491..408559,408572..408634,408677..408745,
FT                   408770..408838,408851..408904,408938..409006,
FT                   409064..409132)
FT                   /note="10 probable transmembrane helices predicted for
FT                   EAM_0339 by TMHMM2.0 at aa 12-31, 46-68, 88-107,
FT                   135-157,162-182, 197-219, 228-250, 255-272, 284-306 and
FT                   326-348"
FT   CDS_pept        complement(409462..409788)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0340"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0340"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45015"
FT                   /protein_id="CBJ45015.1"
FT                   RIMR"
FT   CDS_pept        <409986..410294
FT                   /transl_table=11
FT                   /locus_tag="EAM_0341"
FT                   /product="putative integrase (partial)"
FT                   /note="submitted with /partial"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0341"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45016"
FT                   /protein_id="CBJ45016.1"
FT   CDS_pept        complement(410359..411267)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0342"
FT                   /product="LysR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0342"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45017"
FT                   /protein_id="CBJ45017.1"
FT   misc_feature    complement(410365..410997)
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 5.5e-51"
FT   misc_feature    complement(411067..411231)
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 2e-17"
FT   misc_feature    complement(411112..411204)
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    complement(411142..411207)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1380.000, SD 3.89 at aa 21-42, sequence
FT   CDS_pept        411364..412434
FT                   /transl_table=11
FT                   /locus_tag="EAM_0343"
FT                   /product="putative NAD dependent epimerase/dehydratase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0343"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45018"
FT                   /protein_id="CBJ45018.1"
FT                   FALFDRLKAEKLIPHA"
FT   misc_feature    411364..411420
FT                   /note="Signal peptide predicted for EAM_0343 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.994) with cleavage site
FT                   probability 0.990 between residues 19 and 20"
FT   misc_feature    411376..412089
FT                   /note="HMMPfam hit to PF01370, NAD dependent
FT                   epimerase/dehydratase family, score 5.4e-06"
FT   CDS_pept        412573..413352
FT                   /transl_table=11
FT                   /locus_tag="EAM_0344"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0344"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45019"
FT                   /protein_id="CBJ45019.1"
FT   CDS_pept        complement(413435..414340)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0345"
FT                   /product="LysR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0345"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45020"
FT                   /protein_id="CBJ45020.1"
FT   misc_feature    complement(413453..414073)
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 6.2e-42"
FT   misc_feature    complement(414143..414322)
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 7e-14"
FT   misc_feature    complement(414188..414280)
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    complement(414218..414283)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1718.000, SD 5.04 at aa 20-41, sequence
FT   CDS_pept        complement(414495..414854)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0346"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0346"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45021"
FT                   /protein_id="CBJ45021.1"
FT                   RSEMHFHPLAQSDIF"
FT   CDS_pept        complement(415122..415748)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0347"
FT                   /product="putative amino acid efflux protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0347"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45022"
FT                   /protein_id="CBJ45022.1"
FT   misc_feature    complement(join(415128..415196,415233..415301,
FT                   415329..415397,415482..415550,415563..415631,
FT                   415668..415736))
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0347 by TMHMM2.0 at aa 5-27, 40-62, 67-89,
FT                   118-140,150-172 and 185-207"
FT   misc_feature    complement(415128..415709)
FT                   /note="HMMPfam hit to PF01810, LysE type translocator,score
FT                   1.2e-32"
FT   CDS_pept        complement(415858..416079)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0348"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0348"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45023"
FT                   /protein_id="CBJ45023.1"
FT   misc_feature    complement(415978..416046)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0348 by TMHMM2.0 at aa 12-34"
FT   CDS_pept        416409..418019
FT                   /transl_table=11
FT                   /gene="treF"
FT                   /locus_tag="EAM_0349"
FT                   /product="cytoplasmic trehalase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0349"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45024"
FT                   /protein_id="CBJ45024.1"
FT   misc_feature    416577..418010
FT                   /note="HMMPfam hit to PF01204, Trehalase, score 4.8e-218"
FT   misc_feature    416862..416903
FT                   /note="PS00927 Trehalase signature 1."
FT   misc_feature    417744..417773
FT                   /note="PS00928 Trehalase signature 2."
FT   CDS_pept        complement(418726..419910)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0350"
FT                   /product="putative O-glycosyl hydrolase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0350"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45025"
FT                   /protein_id="CBJ45025.1"
FT   misc_feature    complement(418735..419472)
FT                   /note="HMMPfam hit to PF00756, Putative esterase, score
FT                   2.4e-07"
FT   misc_feature    complement(419560..419802)
FT                   /note="HMMPfam hit to PF02922, Isoamylase N-terminal
FT                   domain, score 0.03"
FT   misc_feature    complement(419824..419892)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0350 by TMHMM2.0 at aa 7-29"
FT   misc_feature    complement(419842..419910)
FT                   /note="Signal peptide predicted for EAM_0350 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.991 between residues 23 and 24"
FT   CDS_pept        420100..421437
FT                   /transl_table=11
FT                   /locus_tag="EAM_0351"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0351"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45026"
FT                   /protein_id="CBJ45026.1"
FT   misc_feature    421102..421422
FT                   /note="HMMPfam hit to PF07063, Protein of unknown function
FT                   (DUF1338), score 2e-47"
FT   CDS_pept        complement(421434..422246)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0352"
FT                   /product="putative hydrolase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0352"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45027"
FT                   /protein_id="CBJ45027.1"
FT   misc_feature    complement(421473..422234)
FT                   /note="HMMPfam hit to PF08282, haloacid dehalogenase-like
FT                   hydrolase, score 4.4e-64"
FT   misc_feature    complement(421482..422246)
FT                   /note="HMMPfam hit to PF05116, Sucrose-6F-phosphate
FT                   phosphohydrolase, score 2.8e-05"
FT   misc_feature    complement(421542..422243)
FT                   /note="HMMPfam hit to PF00702, haloacid dehalogenase-like
FT                   hydrolase, score 5.9e-08"
FT   misc_feature    complement(421545..421613)
FT                   /note="PS01229 Hypothetical cof family signature 2."
FT   misc_feature    complement(421602..421634)
FT                   /note="PS00639 Eukaryotic thiol (cysteine) proteases
FT                   histidine active site."
FT   CDS_pept        422462..423310
FT                   /transl_table=11
FT                   /gene="hchA"
FT                   /locus_tag="EAM_0353"
FT                   /product="chaperone protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0353"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45028"
FT                   /protein_id="CBJ45028.1"
FT                   S"
FT   misc_feature    422798..423295
FT                   /note="HMMPfam hit to PF01965, DJ-1/PfpI family, score
FT                   0.0013"
FT   CDS_pept        423514..424638
FT                   /transl_table=11
FT                   /locus_tag="EAM_0354"
FT                   /product="putative NADH:flavin oxidoreductase/NADH oxidase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0354"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45029"
FT                   /protein_id="CBJ45029.1"
FT   misc_feature    423526..424566
FT                   /note="HMMPfam hit to PF00724, NADH:flavin oxidoreductase /
FT                   NADH oxidas, score 9.5e-89"
FT   CDS_pept        424654..424968
FT                   /transl_table=11
FT                   /locus_tag="EAM_0355"
FT                   /product="putative transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0355"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45030"
FT                   /protein_id="CBJ45030.1"
FT                   "
FT   CDS_pept        complement(425058..425846)
FT                   /transl_table=11
FT                   /gene="gdh"
FT                   /locus_tag="EAM_0356"
FT                   /product="putative glucose 1-dehydrogenase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0356"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45031"
FT                   /protein_id="CBJ45031.1"
FT   misc_feature    complement(425313..425825)
FT                   /note="HMMPfam hit to PF00106, short chain
FT                   dehydrogenase,score 3.4e-26"
FT   misc_feature    complement(425325..425411)
FT                   /note="PS00061 Short-chain dehydrogenases/reductases family
FT                   signature."
FT   CDS_pept        complement(426206..426586)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0357"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0357"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45032"
FT                   /protein_id="CBJ45032.1"
FT   misc_feature    complement(426524..426586)
FT                   /note="Signal peptide predicted for EAM_0357 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.997 between residues 21 and 22"
FT   CDS_pept        427050..429167
FT                   /transl_table=11
FT                   /gene="FoxR"
FT                   /locus_tag="EAM_0358"
FT                   /product="ferrioxamine TonB-dependent receptor"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0358"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45033"
FT                   /protein_id="CBJ45033.1"
FT                   RTVMATVGYDF"
FT   misc_feature    427050..427154
FT                   /note="PS00430 TonB-dependent receptor proteins signature
FT                   1."
FT   misc_feature    427077..427145
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0358 by TMHMM2.0 at aa 70-92"
FT   misc_feature    427230..427553
FT                   /note="HMMPfam hit to PF07715, TonB-dependent Receptor Plug
FT                   Domain, score 2e-23"
FT   misc_feature    428457..429164
FT                   /note="HMMPfam hit to PF00593, TonB dependent
FT                   receptor,score 6.6e-24"
FT   misc_feature    429111..429164
FT                   /note="PS01156 TonB-dependent receptor proteins signature
FT                   2."
FT   CDS_pept        complement(429247..431601)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0359"
FT                   /product="putative siderophore biosynthesis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0359"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45034"
FT                   /protein_id="CBJ45034.1"
FT   misc_feature    complement(429256..430617)
FT                   /note="HMMPfam hit to PF04183, IucA / IucC family, score
FT                   5.8e-175"
FT   misc_feature    complement(431392..431424)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(431603..432895)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0360"
FT                   /product="putative siderophore biosynthesis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0360"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45035"
FT                   /protein_id="CBJ45035.1"
FT   misc_feature    complement(432830..432862)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(432906..434459)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0361"
FT                   /product="putative decarboxylase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0361"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45036"
FT                   /protein_id="CBJ45036.1"
FT                   "
FT   misc_feature    complement(433146..434276)
FT                   /note="HMMPfam hit to PF00282, Pyridoxal-dependent
FT                   decarboxylase conse, score 1.3e-38"
FT   misc_feature    435524..480981
FT                   /note="Type 6 secretion system 1"
FT   CDS_pept        435524..437143
FT                   /transl_table=11
FT                   /locus_tag="EAM_0362"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0362"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45037"
FT                   /protein_id="CBJ45037.1"
FT   misc_feature    join(436688..436756,436925..436993)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0362 by TMHMM2.0 at aa 389-411 and 468-490"
FT   CDS_pept        437148..438425
FT                   /transl_table=11
FT                   /locus_tag="EAM_0363"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0363"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45038"
FT                   /protein_id="CBJ45038.1"
FT   CDS_pept        438449..438880
FT                   /transl_table=11
FT                   /locus_tag="EAM_0364"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0364"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45039"
FT                   /protein_id="CBJ45039.1"
FT   CDS_pept        439105..440211
FT                   /transl_table=11
FT                   /locus_tag="EAM_0365"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0365"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45040"
FT                   /protein_id="CBJ45040.1"
FT   CDS_pept        440278..445242
FT                   /transl_table=11
FT                   /locus_tag="EAM_0366"
FT                   /product="RHS-family protein (putative nematicidal
FT                   protein)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0366"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45041"
FT                   /protein_id="CBJ45041.1"
FT                   PHPTPPIPNISQTFYP"
FT   misc_feature    440668..440790
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 2.8"
FT   misc_feature    441517..441609
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 6.4"
FT   misc_feature    442621..442734
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.017"
FT   misc_feature    442846..442959
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.11"
FT   misc_feature    443101..443223
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 6.9"
FT   misc_feature    443236..443334
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.91"
FT   misc_feature    443524..443664
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.045"
FT   misc_feature    443776..443865
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 1.2"
FT   misc_feature    443878..443991
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 1.9"
FT   misc_feature    444031..444081
FT                   /note="PS00237 G-protein coupled receptors signature."
FT   misc_feature    444319..444393
FT                   /note="PS00583 pfkB family of carbohydrate kinases
FT                   signature 1."
FT   misc_feature    join(444376..444444,444463..444531,444574..444633)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0366 by TMHMM2.0 at aa 1367-1389, 1396-1418 and
FT                   1433-1452"
FT   CDS_pept        446034..446531
FT                   /transl_table=11
FT                   /locus_tag="EAM_0367"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0367"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45042"
FT                   /protein_id="CBJ45042.1"
FT                   NA"
FT   misc_feature    446040..446513
FT                   /note="HMMPfam hit to PF05591, Protein of unknown function
FT                   (DUF770), score 3.9e-74"
FT   CDS_pept        446566..448113
FT                   /transl_table=11
FT                   /locus_tag="EAM_0368"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0368"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45043"
FT                   /protein_id="CBJ45043.1"
FT   misc_feature    446683..448101
FT                   /note="HMMPfam hit to PF05943, Protein of unknown function
FT                   (DUF877), score 5.3e-293"
FT   CDS_pept        448131..449480
FT                   /transl_table=11
FT                   /locus_tag="EAM_0369"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0369"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45044"
FT                   /protein_id="CBJ45044.1"
FT   misc_feature    448140..449474
FT                   /note="HMMPfam hit to PF05936, Bacterial protein of unknown
FT                   function (DUF87, score 2.5e-127"
FT   CDS_pept        449477..450154
FT                   /transl_table=11
FT                   /locus_tag="EAM_0370"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0370"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45045"
FT                   /protein_id="CBJ45045.1"
FT                   LRR"
FT   misc_feature    450044..450112
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0370 by TMHMM2.0 at aa 190-212"
FT   CDS_pept        450154..451809
FT                   /transl_table=11
FT                   /locus_tag="EAM_0371"
FT                   /product="putative outer membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0371"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45046"
FT                   /protein_id="CBJ45046.1"
FT   misc_feature    join(450172..450240,450250..450306,451099..451167)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0371 by TMHMM2.0 at aa 7-29, 33-51 and 316-338"
FT   misc_feature    451444..451734
FT                   /note="HMMPfam hit to PF00691, OmpA family, score 1.8e-20"
FT   CDS_pept        451842..452333
FT                   /transl_table=11
FT                   /locus_tag="EAM_0372"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0372"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45047"
FT                   /protein_id="CBJ45047.1"
FT                   "
FT   misc_feature    451851..452282
FT                   /note="HMMPfam hit to PF05638, Protein of unknown function
FT                   (DUF796), score 1.2e-61"
FT   CDS_pept        452504..455164
FT                   /transl_table=11
FT                   /gene="clpB"
FT                   /locus_tag="EAM_0373"
FT                   /product="putative ATPase/chaperone"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0373"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45048"
FT                   /protein_id="CBJ45048.1"
FT                   IVLAFDSVSAKSDKT"
FT   misc_feature    452570..452728
FT                   /note="HMMPfam hit to PF02861, Clp amino terminal
FT                   domain,score 0.0074"
FT   misc_feature    452882..452947
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1321.000, SD 3.69 at aa 127-148, sequence
FT   misc_feature    453209..453793
FT                   /note="HMMPfam hit to PF00004, ATPase family associated
FT                   with various cellul, score 1.2e-07"
FT   misc_feature    453224..453247
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    453488..453526
FT                   /note="PS00870 Chaperonins clpA/B signature 1."
FT   misc_feature    454328..454831
FT                   /note="HMMPfam hit to PF07724, ATPase family associated
FT                   with various cellul, score 3.8e-80"
FT   misc_feature    454340..454846
FT                   /note="HMMPfam hit to PF07728, ATPase family associated
FT                   with various cellul, score 4e-05"
FT   misc_feature    454355..454378
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    454976..454993
FT                   /note="PS00343 Gram-positive cocci surface proteins
FT                   'anchoring' hexapeptide."
FT   CDS_pept        455250..455459
FT                   /transl_table=11
FT                   /locus_tag="EAM_0374"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0374"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45049"
FT                   /protein_id="CBJ45049.1"
FT   CDS_pept        455605..457962
FT                   /transl_table=11
FT                   /locus_tag="EAM_0375"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0375"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45050"
FT                   /protein_id="CBJ45050.1"
FT   misc_feature    456748..457005
FT                   /note="HMMPfam hit to PF04524, Protein of unknown
FT                   function,DUF586, score 2.3e-10"
FT   misc_feature    456961..456981
FT                   /note="PS00307 Legume lectins beta-chain signature."
FT   CDS_pept        458046..458576
FT                   /transl_table=11
FT                   /locus_tag="EAM_0376"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0376"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45051"
FT                   /protein_id="CBJ45051.1"
FT                   RIYSRRSGNFKSL"
FT   CDS_pept        458715..458984
FT                   /transl_table=11
FT                   /locus_tag="EAM_0377"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0377"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45052"
FT                   /protein_id="CBJ45052.1"
FT   CDS_pept        458987..460195
FT                   /transl_table=11
FT                   /locus_tag="EAM_0378"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0378"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45053"
FT                   /protein_id="CBJ45053.1"
FT                   GNV"
FT   misc_feature    join(459047..459115,459128..459187)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0378 by TMHMM2.0 at aa 21-43 and 48-67"
FT   CDS_pept        460188..463559
FT                   /transl_table=11
FT                   /locus_tag="EAM_0379"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0379"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45054"
FT                   /protein_id="CBJ45054.1"
FT                   LPESIFSVGKARRQKE"
FT   misc_feature    460188..460292
FT                   /note="Signal peptide predicted for EAM_0379 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.999) with cleavage site
FT                   probability 0.974 between residues 35 and 36"
FT   misc_feature    join(460212..460280,460323..460391,461283..461351)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0379 by TMHMM2.0 at aa 9-31, 46-68 and 366-388"
FT   misc_feature    461430..462386
FT                   /note="HMMPfam hit to PF06761, ImcF-related, score 8.7e-71"
FT   misc_feature    462363..462386
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    462720..463109
FT                   /note="HMMPfam hit to PF06744, Protein of unknown function
FT                   (DUF1215), score 2.3e-37"
FT   CDS_pept        463556..465163
FT                   /transl_table=11
FT                   /locus_tag="EAM_0380"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0380"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45055"
FT                   /protein_id="CBJ45055.1"
FT                   LLAGLIAIDPARAMVLCG"
FT   misc_feature    463760..463945
FT                   /note="HMMPfam hit to PF06812, ImpA-related
FT                   N-terminal,score 3.2e-16"
FT   CDS_pept        465318..467087
FT                   /transl_table=11
FT                   /locus_tag="EAM_0381"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0381"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45056"
FT                   /protein_id="CBJ45056.1"
FT                   LRWNEIHSQHVPG"
FT   misc_feature    465321..467084
FT                   /note="HMMPfam hit to PF05947, Bacterial protein of unknown
FT                   function (DUF87, score 2.9e-197"
FT   CDS_pept        467051..468133
FT                   /transl_table=11
FT                   /locus_tag="EAM_0382"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0382"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45057"
FT                   /protein_id="CBJ45057.1"
FT   misc_feature    467099..468016
FT                   /note="HMMPfam hit to PF06996, Protein of unknown function
FT                   (DUF1305), score 5.1e-49"
FT   CDS_pept        468159..468683
FT                   /transl_table=11
FT                   /locus_tag="EAM_0383"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0383"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45058"
FT                   /protein_id="CBJ45058.1"
FT                   DGWLSLVPLKE"
FT   misc_feature    468159..468236
FT                   /note="Signal peptide predicted for EAM_0383 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.921 between residues 26 and 27"
FT   misc_feature    468189..468221
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        468688..471000
FT                   /transl_table=11
FT                   /locus_tag="EAM_0384"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0384"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45059"
FT                   /protein_id="CBJ45059.1"
FT                   CLMDAAMNGTPVVLRGN"
FT   CDS_pept        471002..471556
FT                   /transl_table=11
FT                   /locus_tag="EAM_0385"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0385"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45060"
FT                   /protein_id="CBJ45060.1"
FT   CDS_pept        471556..472338
FT                   /transl_table=11
FT                   /locus_tag="EAM_0386"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0386"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45061"
FT                   /protein_id="CBJ45061.1"
FT   CDS_pept        472460..472876
FT                   /transl_table=11
FT                   /locus_tag="EAM_0387"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0387"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45062"
FT                   /protein_id="CBJ45062.1"
FT   CDS_pept        472932..473495
FT                   /transl_table=11
FT                   /locus_tag="EAM_0388"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0388"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45063"
FT                   /protein_id="CBJ45063.1"
FT   CDS_pept        473540..474283
FT                   /transl_table=11
FT                   /locus_tag="EAM_0389"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0389"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45064"
FT                   /protein_id="CBJ45064.1"
FT   CDS_pept        474387..474785
FT                   /transl_table=11
FT                   /locus_tag="EAM_0390"
FT                   /product="putative conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0390"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45065"
FT                   /protein_id="CBJ45065.1"
FT   CDS_pept        474817..475401
FT                   /transl_table=11
FT                   /locus_tag="EAM_0391"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0391"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45066"
FT                   /protein_id="CBJ45066.1"
FT   CDS_pept        475575..475964
FT                   /transl_table=11
FT                   /locus_tag="EAM_0393"
FT                   /product="putative exported protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0393"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45067"
FT                   /protein_id="CBJ45067.1"
FT   misc_feature    475575..475670
FT                   /note="Signal peptide predicted for EAM_0393 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.999) with cleavage site
FT                   probability 0.858 between residues 32 and 33"
FT   misc_feature    475602..475670
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0393 by TMHMM2.0 at aa 10-32"
FT   CDS_pept        476019..476195
FT                   /transl_table=11
FT                   /locus_tag="EAM_0394"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0394"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45068"
FT                   /protein_id="CBJ45068.1"
FT                   VVKVLDKARMVGI"
FT   CDS_pept        476226..477116
FT                   /transl_table=11
FT                   /locus_tag="EAM_0395"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0395"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45069"
FT                   /protein_id="CBJ45069.1"
FT                   IVHFLFVRLFKIDKY"
FT   CDS_pept        477131..477304
FT                   /transl_table=11
FT                   /locus_tag="EAM_0396"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0396"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45070"
FT                   /protein_id="CBJ45070.1"
FT                   SISSWRRIGNSA"
FT   CDS_pept        477605..477799
FT                   /transl_table=11
FT                   /locus_tag="EAM_0397"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0397"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45071"
FT                   /protein_id="CBJ45071.1"
FT   CDS_pept        477848..478300
FT                   /transl_table=11
FT                   /locus_tag="EAM_0398"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0398"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45072"
FT                   /protein_id="CBJ45072.1"
FT   misc_feature    477863..478234
FT                   /note="HMMPfam hit to PF07025, Protein of unknown function
FT                   (DUF1316), score 8.5e-29"
FT   CDS_pept        478345..479745
FT                   /transl_table=11
FT                   /locus_tag="EAM_0399"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0399"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45073"
FT                   /protein_id="CBJ45073.1"
FT                   ETTILATE"
FT   misc_feature    478462..478647
FT                   /note="HMMPfam hit to PF06812, ImpA-related
FT                   N-terminal,score 3.3e-20"
FT   misc_feature    478681..478746
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1049.000, SD 2.76 at aa 113-134, sequence
FT   CDS_pept        join(479795..480004,480075..480224,480227..480577,
FT                   480579..480719,480721..480981)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0400"
FT                   /product="putative plasmid-related protein"
FT                   /db_xref="PSEUDO:CBJ45074.1"
FT   misc_feature    479918..479995
FT                   /note="PS00217 Sugar transport proteins signature 2."
FT   misc_feature    join(480542..480577,480579..480623)
FT                   /note="PS01159 WW/rsp5/WWP domain signature."
FT   misc_feature    480784..480807
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        481916..483082
FT                   /transl_table=11
FT                   /locus_tag="EAM_0401"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0401"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45075"
FT                   /protein_id="CBJ45075.1"
FT   CDS_pept        483968..484549
FT                   /transl_table=11
FT                   /locus_tag="EAM_0402"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0402"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45076"
FT                   /protein_id="CBJ45076.1"
FT   CDS_pept        484646..485701
FT                   /transl_table=11
FT                   /locus_tag="EAM_0403"
FT                   /product="putative methyltransferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0403"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45077"
FT                   /protein_id="CBJ45077.1"
FT                   FNFFVLETPDI"
FT   misc_feature    484715..484762
FT                   /note="PS00038 Myc-type, 'helix-loop-helix' dimerization
FT                   domain signature."
FT   misc_feature    485168..485485
FT                   /note="HMMPfam hit to PF08242, Methyltransferase
FT                   domain,score 1.4e-08"
FT   misc_feature    485168..485458
FT                   /note="HMMPfam hit to PF08241, Methyltransferase
FT                   domain,score 1.4e-05"
FT   CDS_pept        485742..487007
FT                   /transl_table=11
FT                   /locus_tag="EAM_0404"
FT                   /product="putative histidyl-tRNA Synthetase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0404"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45078"
FT                   /protein_id="CBJ45078.1"
FT   CDS_pept        487004..487918
FT                   /transl_table=11
FT                   /locus_tag="EAM_0405"
FT                   /product="putative ketopantoate reductase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0405"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45079"
FT                   /protein_id="CBJ45079.1"
FT   misc_feature    487004..487060
FT                   /note="Signal peptide predicted for EAM_0405 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.822) with cleavage site
FT                   probability 0.257 between residues 19 and 20"
FT   misc_feature    487019..487444
FT                   /note="HMMPfam hit to PF02558, Ketopantoate reductase
FT                   PanE/ApbA, score 8.3e-06"
FT   misc_feature    487067..487099
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   misc_feature    487544..487906
FT                   /note="HMMPfam hit to PF08546, Ketopantoate reductase
FT                   PanE/ApbA C terminal, score 3.7e-05"
FT   CDS_pept        complement(487944..489263)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0406"
FT                   /product="putative histidyl-tRNA synthetase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0406"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45080"
FT                   /protein_id="CBJ45080.1"
FT   misc_feature    complement(488703..489188)
FT                   /note="HMMPfam hit to PF00587, tRNA synthetase class II
FT                   core domain (G,, score 2.8e-25"
FT   misc_feature    complement(488853..488906)
FT                   /note="PS00179 Aminoacyl-transfer RNA synthetases class-II
FT                   signature 1."
FT   CDS_pept        complement(489400..490653)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0407"
FT                   /product="putative phosphoribosylamine--glycine ligase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0407"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45081"
FT                   /protein_id="CBJ45081.1"
FT                   GNIELEGKQYRTDMSPFF"
FT   misc_feature    complement(489760..490338)
FT                   /note="HMMPfam hit to PF01071, Phosphoribosylglycinamide
FT                   synthetase, ATP-gr, score 2.4e-35"
FT   CDS_pept        complement(490650..491573)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0408"
FT                   /product="putative pantoate--beta-alanine ligase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0408"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45082"
FT                   /protein_id="CBJ45082.1"
FT   misc_feature    complement(490764..491561)
FT                   /note="HMMPfam hit to PF02569, Pantoate-beta-alanine
FT                   ligase, score 2.9e-13"
FT   CDS_pept        complement(491635..493224)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0409"
FT                   /product="putative asparagine synthetase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0409"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45083"
FT                   /protein_id="CBJ45083.1"
FT                   LNTSTLISAITN"
FT   misc_feature    complement(491863..491886)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(491914..492600)
FT                   /note="HMMPfam hit to PF00733, Asparagine synthase, score
FT                   1.8e-37"
FT   misc_feature    complement(492748..493221)
FT                   /note="HMMPfam hit to PF00310, Glutamine amidotransferases
FT                   class-II, score 6.1e-08"
FT   CDS_pept        complement(493466..493870)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0410"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0410"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45084"
FT                   /protein_id="CBJ45084.1"
FT   misc_feature    complement(493526..493729)
FT                   /note="HMMPfam hit to PF07883, Cupin domain, score 6e-08"
FT   misc_feature    complement(493631..493654)
FT                   /note="PS00030 Eukaryotic putative RNA-binding region RNP-1
FT                   signature."
FT   CDS_pept        494249..495505
FT                   /transl_table=11
FT                   /locus_tag="EAM_0411"
FT                   /product="major facilitator superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0411"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45085"
FT                   /protein_id="CBJ45085.1"
FT   misc_feature    join(494321..494389,494417..494485,494519..494572,
FT                   494582..494635,494696..494764,494792..494860,
FT                   494921..494989,495047..495115,495149..495196,
FT                   495224..495292,495326..495385,495413..495466)
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0411 by TMHMM2.0 at aa 25-47, 57-79, 91-108,
FT                   112-129,150-172, 182-204, 225-247, 267-289, 301-316,
FT                   326-348,360-379 and 389-406"
FT   misc_feature    494330..495397
FT                   /note="HMMPfam hit to PF07690, Major Facilitator
FT                   Superfamily, score 1.6e-41"
FT   misc_feature    494483..494533
FT                   /note="PS00216 Sugar transport proteins signature 1."
FT   CDS_pept        <495907..496053
FT                   /transl_table=11
FT                   /locus_tag="EAM_0412"
FT                   /product="putative integrase (partial)"
FT                   /note="submitted with /partial"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0412"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45086"
FT                   /protein_id="CBJ45086.1"
FT                   GSF"
FT   tRNA            complement(496323..496395)
FT                   /gene="tRNA-Phe"
FT                   /locus_tag="EAM_t018"
FT                   /product="transfer RNA-Phe"
FT                   /anticodon="(pos:496360..496362,aa:Phe)"
FT                   /note="tRNA Phe anticodon GAA, Cove score 75.98"
FT   CDS_pept        complement(496506..497102)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0413"
FT                   /product="putative regulatory protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0413"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45087"
FT                   /protein_id="CBJ45087.1"
FT   misc_feature    complement(496896..496943)
FT                   /note="PS00225 Crystallins beta and gamma 'Greek key' motif
FT                   signature."
FT   CDS_pept        complement(497119..498834)
FT                   /transl_table=11
FT                   /gene="dsbD"
FT                   /locus_tag="EAM_0414"
FT                   /product="thiol:disulfide interchange protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0414"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45088"
FT                   /protein_id="CBJ45088.1"
FT   misc_feature    complement(497347..497403)
FT                   /note="PS00194 Thioredoxin family active site."
FT   misc_feature    complement(join(497599..497667,497686..497754,
FT                   497782..497850,497869..497937,498028..498096,
FT                   498130..498198,498256..498324))
FT                   /note="7 probable transmembrane helices predicted for
FT                   EAM_0414 by TMHMM2.0 at aa 171-193, 213-235,
FT                   247-269,300-322, 329-351, 361-383 and 390-412"
FT   misc_feature    complement(497683..498309)
FT                   /note="HMMPfam hit to PF02683, Cytochrome C biogenesis
FT                   protein transmembran, score 6.8e-08"
FT   misc_feature    complement(498766..498834)
FT                   /note="Signal peptide predicted for EAM_0414 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.999) with cleavage site
FT                   probability 0.958 between residues 23 and 24"
FT   CDS_pept        complement(499039..500340)
FT                   /transl_table=11
FT                   /gene="dcuA"
FT                   /locus_tag="EAM_0415"
FT                   /product="anaerobic C4-dicarboxylate transporter"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0415"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45089"
FT                   /protein_id="CBJ45089.1"
FT   misc_feature    complement(join(499045..499113,499198..499266,
FT                   499303..499356,499423..499491,499510..499563,
FT                   499606..499665,499786..499854,499882..499950,
FT                   500011..500079,500137..500205,500224..500283))
FT                   /note="11 probable transmembrane helices predicted for
FT                   EAM_0415 by TMHMM2.0 at aa 20-39, 46-68, 88-110,
FT                   131-153,163-185, 226-245, 260-277, 284-306, 329-346,
FT                   359-381 and 410-432"
FT   misc_feature    complement(499246..500328)
FT                   /note="HMMPfam hit to PF03605, Anaerobic c4-dicarboxylate
FT                   membrane transpo, score 5.1e-217"
FT   misc_feature    complement(499837..499860)
FT                   /note="PS00030 Eukaryotic putative RNA-binding region RNP-1
FT                   signature."
FT   CDS_pept        complement(500578..502014)
FT                   /transl_table=11
FT                   /gene="aspA"
FT                   /locus_tag="EAM_0416"
FT                   /product="aspartate ammonia-lyase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0416"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45090"
FT                   /protein_id="CBJ45090.1"
FT   misc_feature    complement(500980..501978)
FT                   /note="HMMPfam hit to PF00206, Lyase, score 4.4e-163"
FT   misc_feature    complement(501028..501057)
FT                   /note="PS00163 Fumarate lyases signature."
FT   CDS_pept        502382..502840
FT                   /transl_table=11
FT                   /gene="fxsA"
FT                   /locus_tag="EAM_0417"
FT                   /product="protein FxsA (suppressor of F exclusion of phage
FT                   T7)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0417"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45091"
FT                   /protein_id="CBJ45091.1"
FT   misc_feature    join(502391..502444,502457..502525,502616..502684)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0417 by TMHMM2.0 at aa 4-21, 26-48 and 79-101"
FT   misc_feature    502397..502768
FT                   /note="HMMPfam hit to PF04186, FxsA cytoplasmic membrane
FT                   protein, score 4.5e-47"
FT   CDS_pept        503059..503352
FT                   /transl_table=11
FT                   /gene="groS"
FT                   /locus_tag="EAM_0418"
FT                   /product="10 kDa chaperonin"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0418"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45092"
FT                   /protein_id="CBJ45092.1"
FT   misc_feature    503062..503343
FT                   /note="HMMPfam hit to PF00166, Chaperonin 10 Kd
FT                   subunit,score 5.3e-41"
FT   misc_feature    503065..503139
FT                   /note="PS00681 Chaperonins cpn10 signature."
FT   CDS_pept        503389..505035
FT                   /transl_table=11
FT                   /gene="groL"
FT                   /locus_tag="EAM_0419"
FT                   /product="60 kDa chaperonin"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0419"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45093"
FT                   /protein_id="CBJ45093.1"
FT   misc_feature    503455..504963
FT                   /note="HMMPfam hit to PF00118, TCP-1/cpn60 chaperonin
FT                   family, score 9.3e-187"
FT   misc_feature    504601..504636
FT                   /note="PS00296 Chaperonins cpn60 signature."
FT   CDS_pept        505185..505571
FT                   /transl_table=11
FT                   /locus_tag="EAM_0420"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0420"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45094"
FT                   /protein_id="CBJ45094.1"
FT   misc_feature    505185..505295
FT                   /note="Signal peptide predicted for EAM_0420 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.878) with cleavage site
FT                   probability 0.511 between residues 37 and 38"
FT   misc_feature    505227..505295
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0420 by TMHMM2.0 at aa 15-37"
FT   misc_feature    505248..505280
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(505632..506660)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0421"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0421"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45095"
FT                   /protein_id="CBJ45095.1"
FT                   QE"
FT   misc_feature    complement(505848..506321)
FT                   /note="HMMPfam hit to PF04055, Radical SAM
FT                   superfamily,score 1.4e-10"
FT   CDS_pept        506702..507268
FT                   /transl_table=11
FT                   /gene="efp"
FT                   /locus_tag="EAM_0422"
FT                   /product="elongation factor P"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0422"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45096"
FT                   /protein_id="CBJ45096.1"
FT   misc_feature    506714..506887
FT                   /note="HMMPfam hit to PF08207, Elongation factor P (EF-P)
FT                   KOW-like domain, score 1e-29"
FT   misc_feature    506906..507070
FT                   /note="HMMPfam hit to PF01132, Elongation factor P (EF-P)
FT                   OB domain, score 1.3e-29"
FT   misc_feature    507155..507214
FT                   /note="PS01275 Elongation factor P signature."
FT   CDS_pept        507379..508047
FT                   /transl_table=11
FT                   /gene="avrRpt2"
FT                   /locus_tag="EAM_0423"
FT                   /product="cysteine protease avirulence protein AvrRpt2
FT                   precursor (avirulence protein avrrpt2)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0423"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45097"
FT                   /protein_id="CBJ45097.1"
FT                   "
FT   misc_feature    507487..507519
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        508348..508485
FT                   /transl_table=11
FT                   /gene="ecnB"
FT                   /locus_tag="EAM_0424"
FT                   /product="entericidin B"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0424"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45098"
FT                   /protein_id="CBJ45098.1"
FT                   "
FT   misc_feature    508348..508413
FT                   /note="Signal peptide predicted for EAM_0424 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.991 between residues 22 and 23"
FT   misc_feature    508354..508479
FT                   /note="HMMPfam hit to PF08085, Entericidin EcnA/B
FT                   family,score 3.3e-20"
FT   misc_feature    508366..508434
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0424 by TMHMM2.0 at aa 7-29"
FT   misc_feature    508384..508416
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(508531..509061)
FT                   /transl_table=11
FT                   /gene="blc"
FT                   /locus_tag="EAM_0425"
FT                   /product="outer membrane lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0425"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45099"
FT                   /protein_id="CBJ45099.1"
FT                   AVDKLIWIDQRQA"
FT   misc_feature    complement(508537..508947)
FT                   /note="HMMPfam hit to PF00061, Lipocalin / cytosolic
FT                   fatty-acid binding, score 0.0019"
FT   misc_feature    complement(508543..508965)
FT                   /note="HMMPfam hit to PF08212, Lipocalin-like domain, score
FT                   3.6e-66"
FT   misc_feature    complement(508927..508974)
FT                   /note="PS00225 Crystallins beta and gamma 'Greek key' motif
FT                   signature."
FT   misc_feature    complement(508927..508968)
FT                   /note="PS00213 Lipocalin signature."
FT   misc_feature    complement(508981..509061)
FT                   /note="Signal peptide predicted for EAM_0425 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.306 between residues 27 and 28"
FT   misc_feature    complement(509005..509037)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        509245..510222
FT                   /transl_table=11
FT                   /gene="poxA"
FT                   /locus_tag="EAM_0426"
FT                   /product="putative lysyl-tRNA synthetase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0426"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45100"
FT                   /protein_id="CBJ45100.1"
FT   misc_feature    509245..510219
FT                   /note="HMMPfam hit to PF00152, tRNA synthetases class II
FT                   (D, K and N), score 1.6e-76"
FT   misc_feature    509539..509592
FT                   /note="PS00179 Aminoacyl-transfer RNA synthetases class-II
FT                   signature 1."
FT   misc_feature    510136..510165
FT                   /note="PS00339 Aminoacyl-transfer RNA synthetases class-II
FT                   signature 2."
FT   CDS_pept        complement(510318..513653)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0427"
FT                   /product="putative mechanosensitive ion channel protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0427"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45101"
FT                   /protein_id="CBJ45101.1"
FT                   SGGV"
FT   misc_feature    complement(510417..511019)
FT                   /note="HMMPfam hit to PF00924, Mechanosensitive ion
FT                   channel, score 5.8e-70"
FT   misc_feature    complement(join(510852..510920,510948..511007,
FT                   511098..511166,511224..511292,511488..511556,
FT                   511569..511637,511698..511760,511788..511856,
FT                   511917..511985,512013..512081,512166..512219))
FT                   /note="11 probable transmembrane helices predicted for
FT                   EAM_0427 by TMHMM2.0 at aa 479-496, 525-547,
FT                   557-579,600-622, 632-652, 673-695, 700-722, 788-810,
FT                   830-852,883-902 and 912-934"
FT   misc_feature    complement(513594..513653)
FT                   /note="Signal peptide predicted for EAM_0427 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.995) with cleavage site
FT                   probability 0.979 between residues 20 and 21"
FT   CDS_pept        complement(513664..514563)
FT                   /transl_table=11
FT                   /gene="psd"
FT                   /locus_tag="EAM_0428"
FT                   /product="phosphatidylserine decarboxylase proenzyme
FT                   [contains phosphatidylserine decarboxylase alpha chain;
FT                   phosphatidylserin decarboxylase beta chain]"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0428"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45102"
FT                   /protein_id="CBJ45102.1"
FT                   PLATALQKESAEDVLHHP"
FT   misc_feature    complement(513709..514377)
FT                   /note="HMMPfam hit to PF02666, Phosphatidylserine
FT                   decarboxylase, score 2.7e-105"
FT   CDS_pept        complement(514660..515721)
FT                   /transl_table=11
FT                   /gene="engC"
FT                   /locus_tag="EAM_0429"
FT                   /product="probable GTPase precursor"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0429"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45103"
FT                   /protein_id="CBJ45103.1"
FT                   QAKTRRSFSADKE"
FT   misc_feature    complement(514717..515601)
FT                   /note="HMMPfam hit to PF03193, Protein of unknown
FT                   function,DUF258, score 1.6e-142"
FT   misc_feature    complement(515065..515088)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        515813..516376
FT                   /transl_table=11
FT                   /gene="orn"
FT                   /locus_tag="EAM_0430"
FT                   /product="oligoribonuclease"
FT                   /EC_number="3.1.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0430"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45104"
FT                   /protein_id="CBJ45104.1"
FT   misc_feature    515834..516325
FT                   /note="HMMPfam hit to PF00929, Exonuclease, score 7.4e-38"
FT   tRNA            516555..516627
FT                   /gene="tRNA-Gly"
FT                   /locus_tag="EAM_t019"
FT                   /product="transfer RNA-Gly"
FT                   /anticodon="(pos:516588..516590,aa:Gly)"
FT                   /note="tRNA Gly anticodon GCC, Cove score 71.11"
FT   tRNA            516658..516730
FT                   /gene="tRNA-Gly"
FT                   /locus_tag="EAM_t020"
FT                   /product="transfer RNA-Gly"
FT                   /anticodon="(pos:516691..516693,aa:Gly)"
FT                   /note="tRNA Gly anticodon GCC, Cove score 71.11"
FT   tRNA            517131..517203
FT                   /gene="tRNA-Gly"
FT                   /locus_tag="EAM_t021"
FT                   /product="transfer RNA-Gly"
FT                   /anticodon="(pos:517164..517166,aa:Gly)"
FT                   /note="tRNA Gly anticodon GCC, Cove score 71.11"
FT   CDS_pept        517899..519419
FT                   /transl_table=11
FT                   /locus_tag="EAM_0431"
FT                   /product="putative sugar kinase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0431"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45105"
FT                   /protein_id="CBJ45105.1"
FT   misc_feature    517998..518495
FT                   /note="HMMPfam hit to PF03853, YjeF-related protein
FT                   N-terminus, score 7.5e-56"
FT   misc_feature    518667..519383
FT                   /note="HMMPfam hit to PF01256, Carbohydrate kinase, score
FT                   3.2e-93"
FT   misc_feature    518676..518717
FT                   /note="PS00147 Arginase family signature 1."
FT   misc_feature    519207..519239
FT                   /note="PS01050 Uncharacterized protein family UPF0031
FT                   signature 2."
FT   CDS_pept        519416..519892
FT                   /transl_table=11
FT                   /locus_tag="EAM_0432"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0432"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45106"
FT                   /protein_id="CBJ45106.1"
FT   misc_feature    519455..519823
FT                   /note="HMMPfam hit to PF02367, Uncharacterised P-loop
FT                   hydrolase UPF0079, score 1.6e-59"
FT   misc_feature    519518..519541
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    519889..519954
FT                   /note="Signal peptide predicted for EAM_0433 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.994 between residues 22 and 23"
FT   CDS_pept        519892..521547
FT                   /transl_table=11
FT                   /gene="amiB"
FT                   /locus_tag="EAM_0433"
FT                   /product="N-acetylmuramoyl-L-alanine amidase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0433"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45107"
FT                   /protein_id="CBJ45107.1"
FT   misc_feature    520441..521103
FT                   /note="HMMPfam hit to PF01520, N-acetylmuramoyl-L-alanine
FT                   amidase, score 3.3e-100"
FT   misc_feature    521233..521361
FT                   /note="HMMPfam hit to PF01476, LysM domain, score 1.9e-17"
FT   misc_feature    521410..521538
FT                   /note="HMMPfam hit to PF01476, LysM domain, score 6.2e-16"
FT   misc_feature    521428..521493
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1474.000, SD 4.21 at aa 514-535, sequence
FT   CDS_pept        521562..523403
FT                   /transl_table=11
FT                   /gene="mutL"
FT                   /locus_tag="EAM_0434"
FT                   /product="DNA mismatch repair protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0434"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45108"
FT                   /protein_id="CBJ45108.1"
FT   misc_feature    521613..521906
FT                   /note="HMMPfam hit to PF02518, Histidine kinase-, DNA
FT                   gyrase B-, and, score 2.6e-06"
FT   misc_feature    521838..521858
FT                   /note="PS00058 DNA mismatch repair proteins mutL / hexB /
FT                   PMS1 signature."
FT   misc_feature    522210..522551
FT                   /note="HMMPfam hit to PF01119, DNA mismatch repair
FT                   protein,C-termina, score 8e-40"
FT   CDS_pept        523396..524346
FT                   /transl_table=11
FT                   /gene="miaA"
FT                   /locus_tag="EAM_0435"
FT                   /product="tRNA delta-2-isopentenylpyrophosphate
FT                   transferase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0435"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45109"
FT                   /protein_id="CBJ45109.1"
FT   misc_feature    523444..523467
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    523525..524289
FT                   /note="HMMPfam hit to PF01715, IPP transferase, score
FT                   2.4e-150"
FT   CDS_pept        524449..524760
FT                   /transl_table=11
FT                   /gene="hfq"
FT                   /locus_tag="EAM_0436"
FT                   /product="protein Hfq (host factor-I protein)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0436"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45110"
FT                   /protein_id="CBJ45110.1"
FT   misc_feature    524461..524640
FT                   /note="HMMPfam hit to PF01423, LSM domain, score 1.2e-11"
FT   CDS_pept        524991..526271
FT                   /transl_table=11
FT                   /gene="hflX"
FT                   /locus_tag="EAM_0437"
FT                   /product="GTP-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0437"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45111"
FT                   /protein_id="CBJ45111.1"
FT   misc_feature    525582..525950
FT                   /note="HMMPfam hit to PF01926, GTPase of unknown
FT                   function,score 1.2e-39"
FT   misc_feature    525600..525623
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        526389..527642
FT                   /transl_table=11
FT                   /gene="hflK"
FT                   /locus_tag="EAM_0438"
FT                   /product="protein hflk"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0438"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45112"
FT                   /protein_id="CBJ45112.1"
FT                   DQRRVNAQRSDTQREGRE"
FT   misc_feature    526611..526679
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0438 by TMHMM2.0 at aa 75-97"
FT   misc_feature    526665..527195
FT                   /note="HMMPfam hit to PF01145, SPFH domain / Band, score
FT                   8.2e-49"
FT   CDS_pept        527646..528650
FT                   /transl_table=11
FT                   /gene="hflC"
FT                   /locus_tag="EAM_0439"
FT                   /product="protein HflC"
FT                   /EC_number="3.4.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0439"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45113"
FT                   /protein_id="CBJ45113.1"
FT   misc_feature    527646..527714
FT                   /note="Signal peptide predicted for EAM_0439 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.984) with cleavage site
FT                   probability 0.628 between residues 23 and 24"
FT   misc_feature    527658..527717
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0439 by TMHMM2.0 at aa 5-24"
FT   misc_feature    527700..528377
FT                   /note="HMMPfam hit to PF01145, SPFH domain / Band, score
FT                   4.6e-60"
FT   CDS_pept        528787..528927
FT                   /transl_table=11
FT                   /locus_tag="EAM_0440"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0440"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45114"
FT                   /protein_id="CBJ45114.1"
FT                   G"
FT   misc_feature    528847..528915
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0440 by TMHMM2.0 at aa 21-43"
FT   CDS_pept        529049..530347
FT                   /transl_table=11
FT                   /gene="purA"
FT                   /locus_tag="EAM_0441"
FT                   /product="adenylosuccinate synthetase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0441"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45115"
FT                   /protein_id="CBJ45115.1"
FT   misc_feature    529058..530323
FT                   /note="HMMPfam hit to PF00709, Adenylosuccinate
FT                   synthetase,score 0"
FT   misc_feature    529079..529102
FT                   /note="PS01266 Adenylosuccinate synthetase GTP-binding
FT                   site."
FT   misc_feature    529445..529480
FT                   /note="PS00513 Adenylosuccinate synthetase active site."
FT   CDS_pept        join(530545..530634,530636..530797)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0442"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="PSEUDO:CBJ45116.1"
FT   CDS_pept        530814..533246
FT                   /transl_table=11
FT                   /gene="rnr"
FT                   /locus_tag="EAM_0443"
FT                   /product="ribonuclease R (RNase R)"
FT                   /EC_number="3.1.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0443"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45117"
FT                   /protein_id="CBJ45117.1"
FT   misc_feature    530877..531068
FT                   /note="HMMPfam hit to PF08461, Ribonuclease R winged-helix
FT                   domain, score 1.9e-23"
FT   misc_feature    531072..531245
FT                   /note="HMMPfam hit to PF08206, Ribonuclease B OB
FT                   domain,score 6.5e-27"
FT   misc_feature    531273..531452
FT                   /note="HMMPfam hit to PF08206, Ribonuclease B OB
FT                   domain,score 0.00021"
FT   misc_feature    531594..532271
FT                   /note="HMMPfam hit to PF00773, RNB-like protein, score
FT                   2e-106"
FT   misc_feature    532476..532550
FT                   /note="PS01175 Ribonuclease II family signature."
FT   misc_feature    532734..532991
FT                   /note="HMMPfam hit to PF00575, S1 RNA binding domain, score
FT                   5e-19"
FT   CDS_pept        533324..534061
FT                   /transl_table=11
FT                   /gene="rlmB"
FT                   /locus_tag="EAM_0444"
FT                   /product="23S rRNA (guanosine-2'-O-)-methyltransferase"
FT                   /EC_number="2.1.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0444"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45118"
FT                   /protein_id="CBJ45118.1"
FT   misc_feature    533333..533563
FT                   /note="HMMPfam hit to PF08032, RNA 2'-O ribose
FT                   methyltransferase subs, score 2.2e-20"
FT   misc_feature    533606..534031
FT                   /note="HMMPfam hit to PF00588, SpoU rRNA Methylase
FT                   family,score 8.9e-63"
FT   CDS_pept        complement(534127..534495)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0445"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0445"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45119"
FT                   /protein_id="CBJ45119.1"
FT                   WYGSAILYGPAGAATRAN"
FT   misc_feature    complement(534157..534453)
FT                   /note="HMMPfam hit to PF07338, Protein of unknown function
FT                   (DUF1471), score 1.3e-07"
FT   misc_feature    complement(534355..534495)
FT                   /note="Signal peptide predicted for EAM_0445 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.995) with cleavage site
FT                   probability 0.976 between residues 47 and 48"
FT   misc_feature    complement(534406..534438)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(534497..536431)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0446"
FT                   /product="methyl-accepting chemotaxis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0446"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45120"
FT                   /protein_id="CBJ45120.1"
FT                   RVKVFRVRS"
FT   misc_feature    complement(534503..535171)
FT                   /note="HMMPfam hit to PF00015, Methyl-accepting chemotaxis
FT                   protein (MCP) s, score 1.5e-68"
FT   misc_feature    complement(535262..535471)
FT                   /note="HMMPfam hit to PF00672, HAMP domain, score 3.3e-13"
FT   misc_feature    complement(join(535412..535480,536321..536389))
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0446 by TMHMM2.0 at aa 15-37 and 318-340"
FT   misc_feature    complement(536318..536431)
FT                   /note="Signal peptide predicted for EAM_0446 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.781 between residues 38 and 39"
FT   CDS_pept        536625..537383
FT                   /transl_table=11
FT                   /locus_tag="EAM_0447"
FT                   /product="putative esterase"
FT                   /EC_number="3.1.-.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0447"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45121"
FT                   /protein_id="CBJ45121.1"
FT   misc_feature    536667..537350
FT                   /note="HMMPfam hit to
FT                   PF02230,Phospholipase/Carboxylesterase, score 1.5e-05"
FT   CDS_pept        537591..537986
FT                   /transl_table=11
FT                   /gene="rpsF"
FT                   /locus_tag="EAM_0448"
FT                   /product="30S ribosomal protein S6"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0448"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45122"
FT                   /protein_id="CBJ45122.1"
FT   misc_feature    537594..537866
FT                   /note="HMMPfam hit to PF01250, Ribosomal protein S6, score
FT                   8.3e-48"
FT   misc_feature    537717..537746
FT                   /note="PS01048 Ribosomal protein S6 signature."
FT   CDS_pept        537992..538309
FT                   /transl_table=11
FT                   /gene="priB"
FT                   /locus_tag="EAM_0449"
FT                   /product="primosomal replication protein N"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0449"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45123"
FT                   /protein_id="CBJ45123.1"
FT                   D"
FT   misc_feature    537998..538294
FT                   /note="HMMPfam hit to PF00436, Single-strand binding
FT                   protein family, score 6e-17"
FT   CDS_pept        538314..538541
FT                   /transl_table=11
FT                   /gene="rpsR"
FT                   /locus_tag="EAM_0450"
FT                   /product="30s ribosomal subunit protein S18"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0450"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45124"
FT                   /protein_id="CBJ45124.1"
FT   misc_feature    538356..538517
FT                   /note="HMMPfam hit to PF01084, Ribosomal protein S18, score
FT                   1.3e-32"
FT   misc_feature    538374..538445
FT                   /note="PS00057 Ribosomal protein S18 signature."
FT   CDS_pept        538580..539032
FT                   /transl_table=11
FT                   /gene="rplI"
FT                   /locus_tag="EAM_0451"
FT                   /product="50S ribosomal subunit protein L9"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0451"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45125"
FT                   /protein_id="CBJ45125.1"
FT   misc_feature    538580..538723
FT                   /note="HMMPfam hit to PF01281, Ribosomal protein
FT                   L9,N-terminal domai, score 1.3e-27"
FT   misc_feature    538616..538699
FT                   /note="PS00651 Ribosomal protein L9 signature."
FT   misc_feature    538763..539026
FT                   /note="HMMPfam hit to PF03948, Ribosomal protein
FT                   L9,C-terminal domai, score 1.5e-44"
FT   CDS_pept        complement(539083..539748)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0452"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0452"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45126"
FT                   /protein_id="CBJ45126.1"
FT   misc_feature    complement(539086..539340)
FT                   /note="HMMPfam hit to PF04225, Opacity-associated protein A
FT                   LysM-like domai, score 3.1e-49"
FT   misc_feature    complement(539470..539559)
FT                   /note="HMMPfam hit to PF08525, Opacity-associated protein A
FT                   N-terminal moti, score 1e-08"
FT   CDS_pept        539957..540577
FT                   /transl_table=11
FT                   /gene="fklB"
FT                   /locus_tag="EAM_0453"
FT                   /product="FkbP-type peptidyl-prolyl cis-trans isomerase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0453"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45127"
FT                   /protein_id="CBJ45127.1"
FT   misc_feature    540290..540565
FT                   /note="HMMPfam hit to PF00254, FKBP-type peptidyl-prolyl
FT                   cis-trans isomeras, score 1.9e-45"
FT   misc_feature    540329..540376
FT                   /note="PS00453 FKBP-type peptidyl-prolyl cis-trans
FT                   isomerase signature 1."
FT   CDS_pept        complement(540630..542564)
FT                   /transl_table=11
FT                   /gene="cpdB"
FT                   /locus_tag="EAM_0454"
FT                   /product="2',3'-cyclic-nucleotide 2'-phosphodiesterase
FT                   precursor"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0454"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45128"
FT                   /protein_id="CBJ45128.1"
FT                   GFAIYQLKL"
FT   misc_feature    complement(540900..541502)
FT                   /note="HMMPfam hit to PF02872, 5'-nucleotidase, C-terminal
FT                   domain, score 8.7e-61"
FT   misc_feature    complement(541782..542495)
FT                   /note="HMMPfam hit to PF00149, Calcineurin-like
FT                   phosphoesterase, score 1.5e-15"
FT   misc_feature    complement(542205..542240)
FT                   /note="PS00786 5'-nucleotidase signature 2."
FT   misc_feature    complement(542508..542564)
FT                   /note="Signal peptide predicted for EAM_0454 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.998 between residues 19 and 20"
FT   misc_feature    complement(542514..542546)
FT                   /note="PS00435 Peroxidases proximal heme-ligand signature."
FT   CDS_pept        542803..543543
FT                   /transl_table=11
FT                   /gene="cysQ"
FT                   /locus_tag="EAM_0455"
FT                   /product="cysQ protein (Inositol monophosphatase family
FT                   protein)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0455"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45129"
FT                   /protein_id="CBJ45129.1"
FT   misc_feature    542803..543540
FT                   /note="HMMPfam hit to PF00459, Inositol monophosphatase
FT                   family, score 7.5e-66"
FT   misc_feature    543040..543081
FT                   /note="PS00629 Inositol monophosphatase family signature
FT                   1."
FT   CDS_pept        543680..543889
FT                   /transl_table=11
FT                   /locus_tag="EAM_0456"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0456"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45130"
FT                   /protein_id="CBJ45130.1"
FT   CDS_pept        544080..544286
FT                   /transl_table=11
FT                   /locus_tag="EAM_0457"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0457"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45131"
FT                   /protein_id="CBJ45131.1"
FT   misc_feature    544080..544283
FT                   /note="HMMPfam hit to PF06526, Protein of unknown function
FT                   (DUF1107), score 7.8e-44"
FT   CDS_pept        complement(544334..545662)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0458"
FT                   /product="putative transporter"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0458"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45132"
FT                   /protein_id="CBJ45132.1"
FT   misc_feature    complement(544385..544627)
FT                   /note="HMMPfam hit to PF03471, Transporter associated
FT                   domain, score 2.3e-21"
FT   misc_feature    complement(544664..545017)
FT                   /note="HMMPfam hit to PF00571, CBS domain pair, score
FT                   2.2e-16"
FT   misc_feature    complement(545072..545656)
FT                   /note="HMMPfam hit to PF01595, Domain of unknown function
FT                   DUF21, score 1.9e-66"
FT   misc_feature    complement(join(545171..545239,545300..545368,
FT                   545426..545494,545582..545650))
FT                   /note="4 probable transmembrane helices predicted for
FT                   EAM_0458 by TMHMM2.0 at aa 5-27, 57-79, 99-121 and 142-164"
FT   misc_feature    complement(545585..545662)
FT                   /note="Signal peptide predicted for EAM_0458 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.993) with cleavage site
FT                   probability 0.500 between residues 26 and 27"
FT   CDS_pept        546261..548012
FT                   /transl_table=11
FT                   /locus_tag="EAM_0459"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0459"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45133"
FT                   /protein_id="CBJ45133.1"
FT                   IGLGPEL"
FT   misc_feature    546261..546335
FT                   /note="Signal peptide predicted for EAM_0459 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.994) with cleavage site
FT                   probability 0.984 between residues 25 and 26"
FT   misc_feature    546843..547067
FT                   /note="HMMPfam hit to PF07244, Surface antigen variable
FT                   number repeat, score 1.7e-09"
FT   misc_feature    547146..548009
FT                   /note="HMMPfam hit to PF01103, Surface antigen, score
FT                   1.4e-80"
FT   misc_feature    547791..547829
FT                   /note="PS00213 Lipocalin signature."
FT   CDS_pept        548009..551782
FT                   /transl_table=11
FT                   /locus_tag="EAM_0460"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0460"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45134"
FT                   /protein_id="CBJ45134.1"
FT   misc_feature    548009..548128
FT                   /note="Signal peptide predicted for EAM_0460 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.936) with cleavage site
FT                   probability 0.400 between residues 40 and 41"
FT   misc_feature    548027..548095
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0460 by TMHMM2.0 at aa 7-29"
FT   misc_feature    548048..548080
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   misc_feature    548141..548182
FT                   /note="PS00213 Lipocalin signature."
FT   misc_feature    550739..551779
FT                   /note="HMMPfam hit to PF04357, Family of unknown function
FT                   (DUF490), score 2.6e-155"
FT   CDS_pept        551785..552135
FT                   /transl_table=11
FT                   /locus_tag="EAM_0461"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0461"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45135"
FT                   /protein_id="CBJ45135.1"
FT                   SGDWLQKDAAAQ"
FT   misc_feature    551812..552120
FT                   /note="HMMPfam hit to PF03674, Uncharacterised protein
FT                   family (UPF0131), score 2e-37"
FT   CDS_pept        complement(552244..552774)
FT                   /transl_table=11
FT                   /gene="ppa"
FT                   /locus_tag="EAM_0462"
FT                   /product="inorganic pyrophosphatase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0462"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45136"
FT                   /protein_id="CBJ45136.1"
FT                   AEIVSSFERAAKK"
FT   misc_feature    complement(552250..552726)
FT                   /note="HMMPfam hit to PF00719, Inorganic
FT                   pyrophosphatase,score 3.4e-57"
FT   misc_feature    complement(552559..552579)
FT                   /note="PS00387 Inorganic pyrophosphatase signature."
FT   CDS_pept        553163..554728
FT                   /transl_table=11
FT                   /locus_tag="EAM_0463"
FT                   /product="methyl-accepting chemotaxis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0463"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45137"
FT                   /protein_id="CBJ45137.1"
FT                   TQLA"
FT   misc_feature    553163..553249
FT                   /note="Signal peptide predicted for EAM_0463 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.999) with cleavage site
FT                   probability 0.811 between residues 29 and 30"
FT   misc_feature    join(553190..553258,553733..553801)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0463 by TMHMM2.0 at aa 10-32 and 191-213"
FT   misc_feature    553748..553957
FT                   /note="HMMPfam hit to PF00672, HAMP domain, score 1.8e-14"
FT   misc_feature    554048..554716
FT                   /note="HMMPfam hit to PF00015, Methyl-accepting chemotaxis
FT                   protein (MCP) s, score 2.1e-97"
FT   CDS_pept        complement(554822..555820)
FT                   /transl_table=11
FT                   /gene="fbp"
FT                   /locus_tag="EAM_0464"
FT                   /product="fructose-1,6-bisphosphatase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0464"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45138"
FT                   /protein_id="CBJ45138.1"
FT   misc_feature    complement(554834..555817)
FT                   /note="HMMPfam hit to PF00316,
FT                   Fructose-1-6-bisphosphatase,score 2.9e-207"
FT   misc_feature    complement(554981..555019)
FT                   /note="PS00124 Fructose-1-6-bisphosphatase active site."
FT   CDS_pept        555993..557345
FT                   /transl_table=11
FT                   /gene="mpl"
FT                   /locus_tag="EAM_0465"
FT                   /product="UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-me
FT                   so-diaminopimelat ligase (murein peptide ligase"
FT                   /EC_number="6.3.2.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0465"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45139"
FT                   /protein_id="CBJ45139.1"
FT   misc_feature    555993..556064
FT                   /note="Signal peptide predicted for EAM_0465 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.970) with cleavage site
FT                   probability 0.849 between residues 24 and 25"
FT   misc_feature    555996..556301
FT                   /note="HMMPfam hit to PF01225, Mur ligase family, catalytic
FT                   domain, score 5.1e-30"
FT   misc_feature    556308..556865
FT                   /note="HMMPfam hit to PF08245, Mur ligase middle
FT                   domain,score 2.4e-08"
FT   misc_feature    556923..557168
FT                   /note="HMMPfam hit to PF02875, Mur ligase family, glutamate
FT                   ligase doma, score 2.8e-06"
FT   CDS_pept        complement(557445..557987)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0466"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0466"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45140"
FT                   /protein_id="CBJ45140.1"
FT                   PKAYRQIFQYLRELAEA"
FT   misc_feature    complement(557448..557963)
FT                   /note="HMMPfam hit to PF04751, Protein of unknown function
FT                   (DUF615), score 5.5e-108"
FT   CDS_pept        558149..559489
FT                   /transl_table=11
FT                   /gene="pmbA"
FT                   /locus_tag="EAM_0467"
FT                   /product="protein PmbA"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0467"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45141"
FT                   /protein_id="CBJ45141.1"
FT   misc_feature    558236..559117
FT                   /note="HMMPfam hit to PF01523, Putative modulator of DNA
FT                   gyrase, score 2.1e-94"
FT   CDS_pept        complement(559675..560343)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0468"
FT                   /product="hypothetical protein"
FT                   /note="weakly similar to the listed database entry"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0468"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45142"
FT                   /protein_id="CBJ45142.1"
FT                   "
FT   CDS_pept        560769..561113
FT                   /transl_table=11
FT                   /locus_tag="EAM_0469"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0469"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45143"
FT                   /protein_id="CBJ45143.1"
FT                   SVHFEVAKEN"
FT   misc_feature    560844..561101
FT                   /note="HMMPfam hit to PF00874, PRD domain, score 7.5e-10"
FT   CDS_pept        561129..561488
FT                   /transl_table=11
FT                   /locus_tag="EAM_0470"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0470"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45144"
FT                   /protein_id="CBJ45144.1"
FT                   ELGERLLQAWHKKQS"
FT   CDS_pept        561488..561787
FT                   /transl_table=11
FT                   /locus_tag="EAM_0471"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0471"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45145"
FT                   /protein_id="CBJ45145.1"
FT   CDS_pept        561822..562598
FT                   /transl_table=11
FT                   /locus_tag="EAM_0472"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0472"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45146"
FT                   /protein_id="CBJ45146.1"
FT   misc_feature    561822..561911
FT                   /note="Signal peptide predicted for EAM_0472 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.907) with cleavage site
FT                   probability 0.515 between residues 30 and 31"
FT   misc_feature    join(561825..561893,561984..562052,562152..562220,
FT                   562248..562316,562350..562418,562461..562517)
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0472 by TMHMM2.0 at aa 2-24, 55-77, 111-133,
FT                   143-165,177-199 and 214-232"
FT   CDS_pept        562612..563256
FT                   /transl_table=11
FT                   /locus_tag="EAM_0473"
FT                   /product="Putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0473"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45147"
FT                   /protein_id="CBJ45147.1"
FT   misc_feature    join(562654..562722,562783..562836,562864..562932,
FT                   562945..563013,563092..563160,563173..563241)
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0473 by TMHMM2.0 at aa 15-37, 58-75, 85-107,
FT                   112-134,161-183 and 188-210"
FT   CDS_pept        563302..564435
FT                   /transl_table=11
FT                   /locus_tag="EAM_0474"
FT                   /product="putative amidohydrolase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0474"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45148"
FT                   /protein_id="CBJ45148.1"
FT   misc_feature    563440..564291
FT                   /note="HMMPfam hit to PF01979, Amidohydrolase family, score
FT                   0.0023"
FT   CDS_pept        564419..565540
FT                   /transl_table=11
FT                   /locus_tag="EAM_0475"
FT                   /product="possible beta-eliminating lyase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0475"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45149"
FT                   /protein_id="CBJ45149.1"
FT   misc_feature    564455..565474
FT                   /note="HMMPfam hit to PF03841, L-seryl-tRNA selenium
FT                   transferase, score 7.6e-07"
FT   misc_feature    564593..565333
FT                   /note="HMMPfam hit to PF01212, Beta-eliminating lyase,score
FT                   0.00013"
FT   misc_feature    565466..565495
FT                   /note="PS00339 Aminoacyl-transfer RNA synthetases class-II
FT                   signature 2."
FT   CDS_pept        565537..566277
FT                   /transl_table=11
FT                   /locus_tag="EAM_0476"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0476"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45150"
FT                   /protein_id="CBJ45150.1"
FT   misc_feature    565558..566211
FT                   /note="HMMPfam hit to PF07071, Protein of unknown function
FT                   (DUF1341), score 5e-147"
FT   CDS_pept        566386..568323
FT                   /transl_table=11
FT                   /locus_tag="EAM_0477"
FT                   /product="probable transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0477"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45151"
FT                   /protein_id="CBJ45151.1"
FT                   RFPGGTCGAG"
FT   misc_feature    566404..566574
FT                   /note="HMMPfam hit to PF08279, HTH domain, score 4.2e-13"
FT   misc_feature    566443..566508
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1799.000, SD 5.31 at aa 20-41, sequence
FT   misc_feature    566508..566704
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1799.000, SD 5.31 at aa 107-41, sequence
FT                   TRFLTSAFSL"
FT   misc_feature    566569..566883
FT                   /note="HMMPfam hit to PF05043, Mga helix-turn-helix
FT                   domain,score 0.00015"
FT   misc_feature    566659..566835
FT                   /note="HMMPfam hit to PF08279, HTH domain, score 0.0019"
FT   misc_feature    566704..566769
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1391.000, SD 3.92 at aa 107-128, sequence
FT   misc_feature    567280..567552
FT                   /note="HMMPfam hit to PF00874, PRD domain, score 2.4e-13"
FT   misc_feature    567868..568284
FT                   /note="HMMPfam hit to PF00359,Phosphoenolpyruvate-dependent
FT                   sugar phosph, score 0.00023"
FT   CDS_pept        complement(568360..568932)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0478"
FT                   /product="putative phospholipid-binding lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0478"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45152"
FT                   /protein_id="CBJ45152.1"
FT   misc_feature    complement(568381..568551)
FT                   /note="HMMPfam hit to PF04972, Putative
FT                   phospholipid-binding domain, score 5.1e-13"
FT   misc_feature    complement(568591..568785)
FT                   /note="HMMPfam hit to PF04972, Putative
FT                   phospholipid-binding domain, score 9e-09"
FT   misc_feature    complement(568846..568914)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0478 by TMHMM2.0 at aa 7-29"
FT   misc_feature    complement(568870..568932)
FT                   /note="Signal peptide predicted for EAM_0478 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.999) with cleavage site
FT                   probability 0.273 between residues 21 and 22"
FT   misc_feature    complement(568876..568908)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(568943..569542)
FT                   /transl_table=11
FT                   /gene="diaA"
FT                   /locus_tag="EAM_0479"
FT                   /product="DnaA initiator-associating protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0479"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45153"
FT                   /protein_id="CBJ45153.1"
FT   CDS_pept        complement(569564..569956)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0480"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0480"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45154"
FT                   /protein_id="CBJ45154.1"
FT   misc_feature    complement(569609..569893)
FT                   /note="HMMPfam hit to PF02021, Uncharacterised protein
FT                   family UPF0102, score 2.9e-35"
FT   CDS_pept        complement(569914..571938)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0481"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0481"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45155"
FT                   /protein_id="CBJ45155.1"
FT   misc_feature    complement(569935..571821)
FT                   /note="HMMPfam hit to PF04348, LppC putative
FT                   lipoprotein,score 4.6e-122"
FT   misc_feature    complement(571849..571938)
FT                   /note="Signal peptide predicted for EAM_0481 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.991) with cleavage site
FT                   probability 0.362 between residues 30 and 31"
FT   misc_feature    complement(571858..571890)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        572001..572864
FT                   /transl_table=11
FT                   /locus_tag="EAM_0482"
FT                   /product="putative tetrapyrrole methylase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0482"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45156"
FT                   /protein_id="CBJ45156.1"
FT                   LGQQGE"
FT   misc_feature    572037..572642
FT                   /note="HMMPfam hit to PF00590, Tetrapyrrole
FT                   (Corrin/Porphyrin) Methylas, score 2.6e-65"
FT   misc_feature    572271..572306
FT                   /note="PS01296 Uncharacterized protein family UPF0011
FT                   signature."
FT   CDS_pept        complement(573512..573832)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0483"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0483"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45157"
FT                   /protein_id="CBJ45157.1"
FT                   FK"
FT   CDS_pept        complement(573865..574185)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0484"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0484"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45158"
FT                   /protein_id="CBJ45158.1"
FT                   FE"
FT   CDS_pept        complement(574256..574495)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0485"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0485"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45159"
FT                   /protein_id="CBJ45159.1"
FT   CDS_pept        complement(574745..575449)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0486"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0486"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45160"
FT                   /protein_id="CBJ45160.1"
FT                   TPVRALVIDLPL"
FT   misc_feature    complement(575093..575443)
FT                   /note="HMMPfam hit to PF02678, Pirin, score 5.8e-31"
FT   CDS_pept        575574..576500
FT                   /transl_table=11
FT                   /locus_tag="EAM_0487"
FT                   /product="LysR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0487"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45161"
FT                   /protein_id="CBJ45161.1"
FT   misc_feature    575598..575777
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 3.2e-15"
FT   misc_feature    575637..575702
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1071.000, SD 2.83 at aa 22-43, sequence
FT   misc_feature    575640..575732
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    575847..576461
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 2.7e-13"
FT   CDS_pept        complement(576497..576706)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0488"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0488"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45162"
FT                   /protein_id="CBJ45162.1"
FT   misc_feature    complement(576581..576649)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0488 by TMHMM2.0 at aa 20-42"
FT   CDS_pept        complement(576703..576945)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0489"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0489"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45163"
FT                   /protein_id="CBJ45163.1"
FT   CDS_pept        complement(577113..577505)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0490"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0490"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45164"
FT                   /protein_id="CBJ45164.1"
FT   misc_feature    complement(join(577140..577199,577242..577298,
FT                   577317..577385,577428..577481))
FT                   /note="4 probable transmembrane helices predicted for
FT                   EAM_0490 by TMHMM2.0 at aa 9-26, 41-63, 70-88 and 103-122"
FT   misc_feature    complement(577155..577484)
FT                   /note="HMMPfam hit to PF07681, DoxX, score 3.5e-37"
FT   CDS_pept        complement(577715..577996)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0491"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0491"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45165"
FT                   /protein_id="CBJ45165.1"
FT   CDS_pept        complement(577996..578388)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0492"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0492"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45166"
FT                   /protein_id="CBJ45166.1"
FT   misc_feature    complement(join(578074..578142,578170..578238))
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0492 by TMHMM2.0 at aa 51-73 and 83-105"
FT   CDS_pept        complement(578390..578695)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0493"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0493"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45167"
FT                   /protein_id="CBJ45167.1"
FT   misc_feature    complement(578393..578677)
FT                   /note="HMMPfam hit to PF05957, Bacterial protein of unknown
FT                   function (DUF88, score 2e-44"
FT   misc_feature    complement(578402..578455)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0493 by TMHMM2.0 at aa 81-98"
FT   CDS_pept        complement(578738..579109)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0494"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0494"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45168"
FT                   /protein_id="CBJ45168.1"
FT   misc_feature    complement(578756..579100)
FT                   /note="HMMPfam hit to PF06476, Protein of unknown function
FT                   (DUF1090), score 2.8e-33"
FT   misc_feature    complement(579050..579109)
FT                   /note="Signal peptide predicted for EAM_0494 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.970 between residues 20 and 21"
FT   CDS_pept        complement(579277..579669)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0495"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0495"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45169"
FT                   /protein_id="CBJ45169.1"
FT   misc_feature    complement(579559..579669)
FT                   /note="Signal peptide predicted for EAM_0495 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.973) with cleavage site
FT                   probability 0.725 between residues 37 and 38"
FT   misc_feature    complement(579565..579633)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0495 by TMHMM2.0 at aa 13-35"
FT   CDS_pept        complement(579666..580340)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0496"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0496"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45170"
FT                   /protein_id="CBJ45170.1"
FT                   NS"
FT   misc_feature    complement(join(579705..579773,579816..579878,
FT                   579897..579965,580116..580184,580203..580271))
FT                   /note="5 probable transmembrane helices predicted for
FT                   EAM_0496 by TMHMM2.0 at aa 24-46, 53-75, 126-148, 155-175
FT                   and 190-212"
FT   CDS_pept        complement(580786..581106)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0497"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0497"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45171"
FT                   /protein_id="CBJ45171.1"
FT                   AS"
FT   CDS_pept        complement(581453..582685)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0498"
FT                   /product="probable transport protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0498"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45172"
FT                   /protein_id="CBJ45172.1"
FT                   MAEERRLEQNA"
FT   misc_feature    complement(581495..582637)
FT                   /note="HMMPfam hit to PF00375, Sodium:dicarboxylate
FT                   symporter family, score 5.4e-137"
FT   misc_feature    complement(join(581633..581701,581729..581797,
FT                   581975..582043,582071..582139,582200..582268,
FT                   582371..582439,582473..582541,582584..582652))
FT                   /note="8 probable transmembrane helices predicted for
FT                   EAM_0498 by TMHMM2.0 at aa 12-34, 49-71, 83-105,
FT                   140-162,183-205, 215-237, 297-319 and 329-351"
FT   misc_feature    complement(581735..581767)
FT                   /note="PS00435 Peroxidases proximal heme-ligand signature."
FT   misc_feature    complement(582569..582685)
FT                   /note="Signal peptide predicted for EAM_0498 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.888) with cleavage site
FT                   probability 0.565 between residues 39 and 40"
FT   CDS_pept        complement(582920..583900)
FT                   /transl_table=11
FT                   /gene="alx"
FT                   /locus_tag="EAM_0499"
FT                   /product="protein Alx ( putative high pH-induced
FT                   membrane-bound redox modulator)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0499"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45173"
FT                   /protein_id="CBJ45173.1"
FT   misc_feature    complement(join(582965..583033,583043..583111,
FT                   583130..583198,583241..583309,583418..583477,
FT                   583490..583558,583571..583639,583709..583777,
FT                   583814..583873))
FT                   /note="9 probable transmembrane helices predicted for
FT                   EAM_0499 by TMHMM2.0 at aa 10-29, 42-64, 88-110,
FT                   115-137,142-161, 198-220, 235-257, 264-286 and 290-312"
FT   misc_feature    complement(583313..583669)
FT                   /note="HMMPfam hit to PF03741, Integral membrane protein
FT                   TerC family, score 5.9e-57"
FT   CDS_pept        584313..586004
FT                   /transl_table=11
FT                   /locus_tag="EAM_0500"
FT                   /product="putative voltage-gated chloride channel protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0500"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45174"
FT                   /protein_id="CBJ45174.1"
FT   misc_feature    join(584349..584417,584475..584543,584892..584960,
FT                   585003..585071,585105..585173,585186..585254,
FT                   585291..585359,585387..585455,585474..585542)
FT                   /note="9 probable transmembrane helices predicted for
FT                   EAM_0500 by TMHMM2.0 at aa 13-35, 55-77, 194-216,
FT                   231-253,265-287, 292-314, 327-349, 359-381 and 388-410"
FT   misc_feature    584499..585551
FT                   /note="HMMPfam hit to PF00654, Voltage gated chloride
FT                   channel, score 1.2e-12"
FT   misc_feature    585630..585992
FT                   /note="HMMPfam hit to PF00571, CBS domain pair, score
FT                   0.00013"
FT   CDS_pept        <586005..586280
FT                   /transl_table=11
FT                   /locus_tag="EAM_0501"
FT                   /product="putative aminotransferase (partial)"
FT                   /note="submitted with /partial"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0501"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45175"
FT                   /protein_id="CBJ45175.1"
FT   CDS_pept        586280..587341
FT                   /transl_table=11
FT                   /locus_tag="EAM_0502"
FT                   /product="putative zinc-binding dehydrogenase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0502"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45176"
FT                   /protein_id="CBJ45176.1"
FT                   ANCKVLIRMGKRN"
FT   misc_feature    586352..586681
FT                   /note="HMMPfam hit to PF08240, Alcohol dehydrogenase
FT                   GroES-like domain, score 2e-39"
FT   misc_feature    586454..586498
FT                   /note="PS00059 Zinc-containing alcohol dehydrogenases
FT                   signature."
FT   misc_feature    586769..587179
FT                   /note="HMMPfam hit to PF00107, Zinc-binding
FT                   dehydrogenase,score 2.5e-05"
FT   CDS_pept        587346..587987
FT                   /transl_table=11
FT                   /locus_tag="EAM_0503"
FT                   /product="putative hydrolase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0503"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45177"
FT                   /protein_id="CBJ45177.1"
FT   misc_feature    587358..587891
FT                   /note="HMMPfam hit to PF00702, haloacid dehalogenase-like
FT                   hydrolase, score 2.6e-17"
FT   CDS_pept        587984..589186
FT                   /transl_table=11
FT                   /locus_tag="EAM_0504"
FT                   /product="major facilitator superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0504"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45178"
FT                   /protein_id="CBJ45178.1"
FT                   Q"
FT   misc_feature    join(588086..588139,588176..588244,588263..588316,
FT                   588329..588397,588434..588502,588530..588589,
FT                   588623..588691,588749..588808,588842..588895,
FT                   588905..588973,589010..589078,589088..589156)
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0504 by TMHMM2.0 at aa 35-52, 65-87, 94-111,
FT                   116-138,151-173, 183-202, 214-236, 256-275, 287-304,
FT                   308-330,343-365 and 369-391"
FT   misc_feature    588086..589087
FT                   /note="HMMPfam hit to PF07690, Major Facilitator
FT                   Superfamily, score 3.6e-25"
FT   CDS_pept        complement(589247..589750)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0505"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0505"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45179"
FT                   /protein_id="CBJ45179.1"
FT                   GRAG"
FT   misc_feature    complement(589283..589738)
FT                   /note="HMMPfam hit to PF01863, Protein of unknown function
FT                   DUF45, score 1.8e-05"
FT   CDS_pept        589833..590960
FT                   /transl_table=11
FT                   /gene="ygjO"
FT                   /locus_tag="EAM_0506"
FT                   /product="putative ribosomal RNA small subunit
FT                   methyltransferase D"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0506"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45180"
FT                   /protein_id="CBJ45180.1"
FT   misc_feature    590424..590942
FT                   /note="HMMPfam hit to PF05175, Methyltransferase small
FT                   domain, score 4.2e-71"
FT   misc_feature    590736..590756
FT                   /note="PS00092 N-6 Adenine-specific DNA methylases
FT                   signature."
FT   CDS_pept        complement(591030..593039)
FT                   /transl_table=11
FT                   /gene="fadH"
FT                   /locus_tag="EAM_0507"
FT                   /product="2,4-dienoyl-CoA reductase [NADPH] (2,4-dienoyl
FT                   coenzyme A reductase)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0507"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45181"
FT                   /protein_id="CBJ45181.1"
FT   misc_feature    complement(591033..591917)
FT                   /note="HMMPfam hit to PF01266, FAD dependent
FT                   oxidoreductase, score 0.0013"
FT   misc_feature    complement(591483..591917)
FT                   /note="HMMPfam hit to PF07992, Pyridine
FT                   nucleotide-disulphide oxidoredu, score 0.00019"
FT   misc_feature    complement(591648..591917)
FT                   /note="HMMPfam hit to PF00070, Pyridine
FT                   nucleotide-disulphide oxidoredu, score 0.0052"
FT   misc_feature    complement(592050..593030)
FT                   /note="HMMPfam hit to PF00724, NADH:flavin oxidoreductase /
FT                   NADH oxidas, score 1e-115"
FT   CDS_pept        complement(593255..593410)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0508"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0508"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45182"
FT                   /protein_id="CBJ45182.1"
FT                   DKCRSQ"
FT   CDS_pept        593502..593708
FT                   /transl_table=11
FT                   /locus_tag="EAM_0509"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0509"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45183"
FT                   /protein_id="CBJ45183.1"
FT   CDS_pept        594172..594798
FT                   /transl_table=11
FT                   /locus_tag="EAM_0510"
FT                   /product="putative carbonic anhydrase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0510"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45184"
FT                   /protein_id="CBJ45184.1"
FT   misc_feature    594259..594768
FT                   /note="HMMPfam hit to PF00484, Carbonic anhydrase, score
FT                   1.7e-31"
FT   misc_feature    594295..594318
FT                   /note="PS00704 Prokaryotic-type carbonic anhydrases
FT                   signature 1."
FT   misc_feature    594415..594477
FT                   /note="PS00705 Prokaryotic-type carbonic anhydrases
FT                   signature 2."
FT   CDS_pept        594795..596273
FT                   /transl_table=11
FT                   /locus_tag="EAM_0511"
FT                   /product="putative sulfate transporter"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0511"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45185"
FT                   /protein_id="CBJ45185.1"
FT   misc_feature    594795..594884
FT                   /note="Signal peptide predicted for EAM_0511 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.997) with cleavage site
FT                   probability 0.978 between residues 30 and 31"
FT   misc_feature    594813..595988
FT                   /note="HMMPfam hit to PF00860, Permease family, score
FT                   0.0025"
FT   misc_feature    join(594822..594881,594900..594968,595026..595094,
FT                   595107..595175,595233..595301,595335..595403,
FT                   595653..595721,595758..595826,595947..596015)
FT                   /note="9 probable transmembrane helices predicted for
FT                   EAM_0511 by TMHMM2.0 at aa 10-29, 36-58, 78-100,
FT                   105-127,147-169, 181-203, 287-309, 322-344 and 385-407"
FT   misc_feature    595083..596021
FT                   /note="HMMPfam hit to PF00916, Sulfate transporter
FT                   family,score 8.8e-26"
FT   CDS_pept        596384..597433
FT                   /transl_table=11
FT                   /locus_tag="EAM_0512"
FT                   /product="putative dipeptidase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0512"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45186"
FT                   /protein_id="CBJ45186.1"
FT                   RILRKTWGN"
FT   misc_feature    596408..597418
FT                   /note="HMMPfam hit to PF01244, Membrane dipeptidase
FT                   (Peptidase family, score 4.6e-121"
FT   CDS_pept        597604..597678
FT                   /transl_table=11
FT                   /gene="pqqA"
FT                   /locus_tag="EAM_0512A"
FT                   /product="coenzyme PQQ synthesis protein A
FT                   (pyrroloquinoline quinone biosynthesis protein A)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0512A"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45187"
FT                   /protein_id="CBJ45187.1"
FT                   /translation="MQWTKPTFIDMRLGLEVTLYISNR"
FT   CDS_pept        597774..598685
FT                   /transl_table=11
FT                   /gene="pqqB"
FT                   /locus_tag="EAM_0513"
FT                   /product="coenzyme PQQ synthesis protein B
FT                   (pyrroloquinoline quinon biosynthesis protein B)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0513"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45188"
FT                   /protein_id="CBJ45188.1"
FT   CDS_pept        598682..599437
FT                   /transl_table=11
FT                   /gene="pqqC"
FT                   /locus_tag="EAM_0514"
FT                   /product="pyrroloquinoline-quinone synthase (coenzyme PQ
FT                   synthesis protein C)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0514"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45189"
FT                   /protein_id="CBJ45189.1"
FT   misc_feature    598718..599353
FT                   /note="HMMPfam hit to PF03070, TENA/THI-4/PQQC family,score
FT                   1.7e-72"
FT   CDS_pept        599434..599715
FT                   /transl_table=11
FT                   /gene="pqqD"
FT                   /locus_tag="EAM_0515"
FT                   /product="coenzyme PQQ synthesis protein D"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0515"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45190"
FT                   /protein_id="CBJ45190.1"
FT   misc_feature    599458..599703
FT                   /note="HMMPfam hit to PF05402, Coenzyme PQQ synthesis
FT                   protein D (PqqD), score 1.4e-44"
FT   CDS_pept        599702..600850
FT                   /transl_table=11
FT                   /gene="pqqE"
FT                   /locus_tag="EAM_0516"
FT                   /product="putative heme/metallo cofactor biosynthesis
FT                   related protein"
FT                   /product="coenzyme PQQ synthesis protein E
FT                   (pyrroloquinoline quinon biosynthesis protein E)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0516"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45191"
FT                   /protein_id="CBJ45191.1"
FT   misc_feature    599747..600223
FT                   /note="HMMPfam hit to PF04055, Radical SAM
FT                   superfamily,score 4.8e-33"
FT   misc_feature    599753..599788
FT                   /note="PS01305 moaA / nifB / pqqE family signature."
FT   CDS_pept        600854..603244
FT                   /transl_table=11
FT                   /gene="pqqF"
FT                   /locus_tag="EAM_0517"
FT                   /product="coenzyme PQQ synthesis protein F (pyrroloquinolin
FT                   quinone biosynthesis protein F) (putative peptidase)"
FT                   /EC_number="3.4.24.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0517"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45192"
FT                   /protein_id="CBJ45192.1"
FT   misc_feature    600890..601297
FT                   /note="HMMPfam hit to PF00675, Insulinase (Peptidase family
FT                   M16), score 2.2e-32"
FT   misc_feature    600953..601024
FT                   /note="PS00143 Insulinase family, zinc-binding region
FT                   signature."
FT   misc_feature    601361..601873
FT                   /note="HMMPfam hit to PF05193, Peptidase M16 inactive
FT                   domain, score 8.6e-08"
FT   misc_feature    602312..602356
FT                   /note="PS00196 Type-1 copper (blue) proteins signature."
FT   CDS_pept        603553..603786
FT                   /transl_table=11
FT                   /locus_tag="EAM_0518"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0518"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45193"
FT                   /protein_id="CBJ45193.1"
FT   misc_feature    603553..603645
FT                   /note="Signal peptide predicted for EAM_0518 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.991 between residues 31 and 32"
FT   misc_feature    603565..603633
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0518 by TMHMM2.0 at aa 5-27"
FT   CDS_pept        603861..603995
FT                   /transl_table=11
FT                   /locus_tag="EAM_0519"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0519"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45194"
FT                   /protein_id="CBJ45194.1"
FT   CDS_pept        604352..604486
FT                   /transl_table=11
FT                   /locus_tag="EAM_0520"
FT                   /product="putative cytochrome oxidase subunit (partial)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0520"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45195"
FT                   /protein_id="CBJ45195.1"
FT   misc_feature    604412..604480
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0520 by TMHMM2.0 at aa 21-43"
FT   CDS_pept        604539..605087
FT                   /transl_table=11
FT                   /gene="srlA"
FT                   /locus_tag="EAM_0521"
FT                   /product="glucitol/sorbitol-specific PTS system IIC
FT                   component"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0521"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45196"
FT                   /protein_id="CBJ45196.1"
FT   misc_feature    604542..605066
FT                   /note="HMMPfam hit to PF03608, PTS system enzyme II
FT                   sorbitol-specific facto, score 4.1e-134"
FT   misc_feature    join(604614..604682,604740..604799,604938..605006)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0521 by TMHMM2.0 at aa 26-48, 68-87 and 134-156"
FT   CDS_pept        605103..606104
FT                   /transl_table=11
FT                   /gene="srlE"
FT                   /locus_tag="EAM_0522"
FT                   /product="glucitol/sorbitol-specific PTS system IIB
FT                   component"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0522"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45197"
FT                   /protein_id="CBJ45197.1"
FT   misc_feature    605109..605657
FT                   /note="HMMPfam hit to PF03612, Sorbitol phosphotransferase
FT                   enzyme II N-t, score 1.4e-121"
FT   misc_feature    605595..605669
FT                   /note="PS00107 Protein kinases ATP-binding region
FT                   signature."
FT   misc_feature    join(605673..605732,605742..605810,605829..605897,
FT                   605925..605993,606027..606095)
FT                   /note="5 probable transmembrane helices predicted for
FT                   EAM_0522 by TMHMM2.0 at aa 191-210, 214-236,
FT                   243-265,275-297 and 309-331"
FT   misc_feature    605820..606098
FT                   /note="HMMPfam hit to PF07663, Sorbitol phosphotransferase
FT                   enzyme II C-t, score 9.2e-54"
FT   CDS_pept        606119..606487
FT                   /transl_table=11
FT                   /gene="srlB"
FT                   /locus_tag="EAM_0523"
FT                   /product="glucitol/sorbitol-specific PTS system IIA
FT                   component"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0523"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45198"
FT                   /protein_id="CBJ45198.1"
FT                   GQPPLVIEPGQKFRVVSE"
FT   misc_feature    606119..606472
FT                   /note="HMMPfam hit to PF03829, PTS system
FT                   glucitol/sorbitol-specific IIA, score 5.1e-72"
FT   misc_feature    606137..606169
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        606502..607281
FT                   /transl_table=11
FT                   /gene="srlD"
FT                   /locus_tag="EAM_0524"
FT                   /product="sorbitol-6-phosphate dehydrogenase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0524"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45199"
FT                   /protein_id="CBJ45199.1"
FT   misc_feature    606508..607020
FT                   /note="HMMPfam hit to PF00106, short chain
FT                   dehydrogenase,score 2e-22"
FT   misc_feature    606922..607008
FT                   /note="PS00061 Short-chain dehydrogenases/reductases family
FT                   signature."
FT   CDS_pept        607329..607691
FT                   /transl_table=11
FT                   /gene="srlM"
FT                   /locus_tag="EAM_0525"
FT                   /product="glucitol operon activator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0525"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45200"
FT                   /protein_id="CBJ45200.1"
FT                   SAATQQALALAISHKG"
FT   misc_feature    607338..607664
FT                   /note="HMMPfam hit to PF06923, Glucitol operon activator
FT                   protein (GutM), score 4.5e-64"
FT   misc_feature    607347..607406
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0525 by TMHMM2.0 at aa 7-26"
FT   CDS_pept        607784..608551
FT                   /transl_table=11
FT                   /gene="srlR"
FT                   /locus_tag="EAM_0526"
FT                   /product="glucitol operon repressor (DeoR-family
FT                   transcriptional regulator)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0526"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45201"
FT                   /protein_id="CBJ45201.1"
FT   misc_feature    607799..607969
FT                   /note="HMMPfam hit to PF08220, DeoR-like helix-turn-helix
FT                   domain, score 2.5e-14"
FT   misc_feature    607799..607954
FT                   /note="HMMPfam hit to PF08279, HTH domain, score 0.00021"
FT   misc_feature    607799..607903
FT                   /note="PS00894 Bacterial regulatory proteins, deoR family
FT                   signature."
FT   misc_feature    608006..608476
FT                   /note="HMMPfam hit to PF00455, Bacterial regulatory
FT                   proteins, deoR family, score 1.1e-70"
FT   CDS_pept        608556..609521
FT                   /transl_table=11
FT                   /gene="gutQ"
FT                   /locus_tag="EAM_0527"
FT                   /product="putative phosphosugar binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0527"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45202"
FT                   /protein_id="CBJ45202.1"
FT   misc_feature    608658..609068
FT                   /note="HMMPfam hit to PF01380, SIS domain, score 6.6e-33"
FT   misc_feature    609162..609515
FT                   /note="HMMPfam hit to PF00571, CBS domain pair, score
FT                   1.3e-22"
FT   CDS_pept        complement(609597..610211)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0528"
FT                   /product="putative phage repressor protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0528"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45203"
FT                   /protein_id="CBJ45203.1"
FT   misc_feature    complement(609948..610142)
FT                   /note="HMMPfam hit to PF07022, Bacteriophage CI repressor
FT                   helix-turn-h, score 3.4e-34"
FT   misc_feature    complement(610041..610106)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1635.000, SD 4.76 at aa 36-57, sequence
FT   CDS_pept        610556..610744
FT                   /transl_table=11
FT                   /locus_tag="EAM_0529"
FT                   /product="hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0529"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45204"
FT                   /protein_id="CBJ45204.1"
FT                   GITPASVMVISSFQNPF"
FT   CDS_pept        610834..610947
FT                   /transl_table=11
FT                   /locus_tag="EAM_0530"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0530"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45205"
FT                   /protein_id="CBJ45205.1"
FT   CDS_pept        611323..611514
FT                   /transl_table=11
FT                   /gene="rlsC"
FT                   /locus_tag="EAM_0531"
FT                   /product="levan regulatory protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0531"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45206"
FT                   /protein_id="CBJ45206.1"
FT                   MAKIRSHQSTQSTSHPDP"
FT   CDS_pept        611930..612289
FT                   /transl_table=11
FT                   /locus_tag="EAM_0532"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0532"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45207"
FT                   /protein_id="CBJ45207.1"
FT                   QLPRWVVLKACQSRG"
FT   CDS_pept        612299..612577
FT                   /transl_table=11
FT                   /locus_tag="EAM_0533"
FT                   /product="putative prophage protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0533"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45208"
FT                   /protein_id="CBJ45208.1"
FT   CDS_pept        join(612475..612588,612592..612741)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0534"
FT                   /product="putative prophage protein"
FT                   /db_xref="PSEUDO:CBJ45209.1"
FT   misc_feature    612563..612574
FT                   /note="PS00294 Prenyl group binding site (CAAX box)."
FT   CDS_pept        612719..612850
FT                   /transl_table=11
FT                   /locus_tag="EAM_0535"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0535"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45210"
FT                   /protein_id="CBJ45210.1"
FT   CDS_pept        613003..613185
FT                   /transl_table=11
FT                   /locus_tag="EAM_0536"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0536"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45211"
FT                   /protein_id="CBJ45211.1"
FT                   LRSGASEGFASALRR"
FT   misc_feature    613045..613104
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0536 by TMHMM2.0 at aa 15-34"
FT   CDS_pept        613195..613314
FT                   /transl_table=11
FT                   /locus_tag="EAM_0537"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0537"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45212"
FT                   /protein_id="CBJ45212.1"
FT   CDS_pept        complement(613308..613832)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0538"
FT                   /product="putative exported endonuclease"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0538"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45213"
FT                   /protein_id="CBJ45213.1"
FT                   WGESQGFDSLY"
FT   misc_feature    complement(613779..613832)
FT                   /note="Signal peptide predicted for EAM_0538 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.975 between residues 18 and 19"
FT   CDS_pept        614218..614475
FT                   /transl_table=11
FT                   /locus_tag="EAM_0539"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0539"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45214"
FT                   /protein_id="CBJ45214.1"
FT   CDS_pept        614483..614656
FT                   /transl_table=11
FT                   /locus_tag="EAM_0540"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0540"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45215"
FT                   /protein_id="CBJ45215.1"
FT                   GKMRVYNAELKG"
FT   CDS_pept        614753..614956
FT                   /transl_table=11
FT                   /locus_tag="EAM_0541"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0541"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45216"
FT                   /protein_id="CBJ45216.1"
FT   CDS_pept        complement(614939..615181)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0542"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0542"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45217"
FT                   /protein_id="CBJ45217.1"
FT   CDS_pept        615239..615361
FT                   /transl_table=11
FT                   /locus_tag="EAM_0543"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0543"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45218"
FT                   /protein_id="CBJ45218.1"
FT   CDS_pept        615391..615594
FT                   /transl_table=11
FT                   /locus_tag="EAM_0544"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0544"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45219"
FT                   /protein_id="CBJ45219.1"
FT   misc_feature    615391..615459
FT                   /note="Signal peptide predicted for EAM_0544 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.902) with cleavage site
FT                   probability 0.677 between residues 23 and 24"
FT   CDS_pept        615735..615950
FT                   /transl_table=11
FT                   /locus_tag="EAM_0545"
FT                   /product="putative prophage protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0545"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45220"
FT                   /protein_id="CBJ45220.1"
FT   misc_feature    615741..615881
FT                   /note="HMMPfam hit to PF04606, Ogr/Delta-like zinc
FT                   finger,score 2.6e-26"
FT   CDS_pept        complement(616022..616246)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0546"
FT                   /product="hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0546"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45221"
FT                   /protein_id="CBJ45221.1"
FT   CDS_pept        616307..616573
FT                   /transl_table=11
FT                   /locus_tag="EAM_0547"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0547"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45222"
FT                   /protein_id="CBJ45222.1"
FT   CDS_pept        616573..618459
FT                   /transl_table=11
FT                   /locus_tag="EAM_0548"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0548"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45223"
FT                   /protein_id="CBJ45223.1"
FT   misc_feature    617557..617580
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        618450..619112
FT                   /transl_table=11
FT                   /locus_tag="EAM_0549"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0549"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45224"
FT                   /protein_id="CBJ45224.1"
FT   misc_feature    618450..618509
FT                   /note="Signal peptide predicted for EAM_0549 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.991) with cleavage site
FT                   probability 0.954 between residues 20 and 21"
FT   misc_feature    618471..618503
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        619136..619312
FT                   /transl_table=11
FT                   /locus_tag="EAM_0550"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0550"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45225"
FT                   /protein_id="CBJ45225.1"
FT                   RTVYDMEGCKIWK"
FT   CDS_pept        619303..619965
FT                   /transl_table=11
FT                   /locus_tag="EAM_0551"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0551"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45226"
FT                   /protein_id="CBJ45226.1"
FT   misc_feature    619303..619362
FT                   /note="Signal peptide predicted for EAM_0551 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.991) with cleavage site
FT                   probability 0.948 between residues 20 and 21"
FT   misc_feature    619324..619356
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        619989..620165
FT                   /transl_table=11
FT                   /locus_tag="EAM_0552"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0552"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45227"
FT                   /protein_id="CBJ45227.1"
FT                   RTVYDMEGNKIWK"
FT   CDS_pept        620156..620815
FT                   /transl_table=11
FT                   /locus_tag="EAM_0553"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0553"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45228"
FT                   /protein_id="CBJ45228.1"
FT   misc_feature    620156..620215
FT                   /note="Signal peptide predicted for EAM_0553 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.991) with cleavage site
FT                   probability 0.948 between residues 20 and 21"
FT   misc_feature    620177..620209
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        620839..621015
FT                   /transl_table=11
FT                   /locus_tag="EAM_0554"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0554"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45229"
FT                   /protein_id="CBJ45229.1"
FT                   RTVYDMEGNKIWK"
FT   CDS_pept        621006..621665
FT                   /transl_table=11
FT                   /locus_tag="EAM_0555"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0555"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45230"
FT                   /protein_id="CBJ45230.1"
FT   misc_feature    621006..621065
FT                   /note="Signal peptide predicted for EAM_0555 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.991) with cleavage site
FT                   probability 0.954 between residues 20 and 21"
FT   misc_feature    621027..621059
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(621814..>622053)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0556"
FT                   /product="putative transposase (partial)"
FT                   /note="submitted with /partial"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0556"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45231"
FT                   /protein_id="CBJ45231.1"
FT   tRNA            complement(622419..622492)
FT                   /gene="tRNA-Met"
FT                   /locus_tag="EAM_t022"
FT                   /product="transfer RNA-Met"
FT                   /anticodon="(pos:622456..622458,aa:Met)"
FT                   /note="tRNA Met anticodon CAT, Cove score 81.94"
FT   CDS_pept        623269..624663
FT                   /transl_table=11
FT                   /locus_tag="EAM_0557"
FT                   /product="major facilitator superfamily protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0557"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45232"
FT                   /protein_id="CBJ45232.1"
FT                   AAEDAI"
FT   misc_feature    623383..624537
FT                   /note="HMMPfam hit to PF07690, Major Facilitator
FT                   Superfamily, score 2.4e-20"
FT   misc_feature    join(623386..623454,623497..623565,623590..623658,
FT                   623686..623754,623791..623859,623887..623946,
FT                   624088..624156,624184..624252,624271..624324,
FT                   624352..624420,624481..624540,624550..624618)
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0557 by TMHMM2.0 at aa 40-62, 77-99, 108-130,
FT                   140-162,175-197, 207-226, 274-296, 306-328, 335-352,
FT                   362-384,405-424 and 428-450"
FT   misc_feature    623392..624660
FT                   /note="HMMPfam hit to PF00083, Sugar (and other)
FT                   transporter, score 1.7e-10"
FT   CDS_pept        624745..625761
FT                   /transl_table=11
FT                   /locus_tag="EAM_0558"
FT                   /product="LacI-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0558"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45233"
FT                   /protein_id="CBJ45233.1"
FT   misc_feature    624769..624834
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1497.000, SD 4.29 at aa 9-30, sequence
FT   misc_feature    624943..625740
FT                   /note="HMMPfam hit to PF00532, Periplasmic binding proteins
FT                   and sugar b, score 1.1e-09"
FT   CDS_pept        625777..626763
FT                   /transl_table=11
FT                   /locus_tag="EAM_0559"
FT                   /product="putative hydrolase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0559"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45234"
FT                   /protein_id="CBJ45234.1"
FT   misc_feature    625777..626745
FT                   /note="HMMPfam hit to PF01156, Inosine-uridine preferring
FT                   nucleoside hy, score 1.5e-42"
FT   CDS_pept        complement(626811..628205)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0560"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0560"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45235"
FT                   /protein_id="CBJ45235.1"
FT                   WQRSIK"
FT   misc_feature    complement(join(626844..626912,627003..627071,
FT                   627405..627464,627507..627575,627636..627704,
FT                   628050..628118))
FT                   /note="6 probable transmembrane helices predicted for
FT                   EAM_0560 by TMHMM2.0 at aa 30-52, 168-190, 211-233,248-267,
FT                   379-401 and 432-454"
FT   misc_feature    complement(627504..627584)
FT                   /note="HMMPfam hit to PF03929, PepSY-associated TM
FT                   helix,score 0.0032"
FT   misc_feature    complement(627654..627734)
FT                   /note="HMMPfam hit to PF03929, PepSY-associated TM
FT                   helix,score 0.017"
FT   misc_feature    complement(628059..628139)
FT                   /note="HMMPfam hit to PF03929, PepSY-associated TM
FT                   helix,score 0.062"
FT   CDS_pept        complement(628282..628722)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0561"
FT                   /product="putative exported protei"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0561"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45236"
FT                   /protein_id="CBJ45236.1"
FT   misc_feature    complement(628498..628521)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(628615..628722)
FT                   /note="Signal peptide predicted for EAM_0561 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.870 between residues 36 and 37"
FT   misc_feature    complement(628618..628686)
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0561 by TMHMM2.0 at aa 13-35"
FT   CDS_pept        join(628953..629294,629297..629398)
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0562"
FT                   /product="putative membrane protein (pseudogene)"
FT                   /db_xref="PSEUDO:CBJ45237.1"
FT   misc_feature    join(628962..629027,629076..629144,629202..629261,
FT                   629297..629365)
FT                   /note="4 probable transmembrane helices predicted for
FT                   EAM_0562 by TMHMM2.0 at aa 4-25, 42-64, 84-103 and 115-137"
FT   CDS_pept        complement(629491..629730)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0563"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0563"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45238"
FT                   /protein_id="CBJ45238.1"
FT   CDS_pept        complement(629792..630889)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0564"
FT                   /product="putative signal transduction protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0564"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45239"
FT                   /protein_id="CBJ45239.1"
FT   misc_feature    complement(629852..630331)
FT                   /note="HMMPfam hit to PF00990, GGDEF domain, score 1.5e-53"
FT   misc_feature    complement(join(630392..630460,630518..630586,
FT                   630620..630673,630701..630760,630779..630847))
FT                   /note="5 probable transmembrane helices predicted for
FT                   EAM_0564 by TMHMM2.0 at aa 15-37, 44-63, 73-90, 102-124 and
FT                   144-166"
FT   CDS_pept        631136..631369
FT                   /transl_table=11
FT                   /locus_tag="EAM_0565"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0565"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45240"
FT                   /protein_id="CBJ45240.1"
FT   misc_feature    631136..631360
FT                   /note="HMMPfam hit to PF07256, Protein of unknown function
FT                   (DUF1435), score 9e-25"
FT   misc_feature    631136..631327
FT                   /note="Signal peptide predicted for EAM_0565 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.852) with cleavage site
FT                   probability 0.446 between residues 64 and 65"
FT   misc_feature    join(631154..631207,631217..631276,631295..631363)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0565 by TMHMM2.0 at aa 7-24, 28-47 and 54-76"
FT   tRNA            complement(631467..631550)
FT                   /gene="tRNA-Leu"
FT                   /locus_tag="EAM_t023"
FT                   /product="transfer RNA-Leu"
FT                   /anticodon="(pos:631514..631516,aa:Leu)"
FT                   /note="tRNA Leu anticodon CAG, Cove score 51.29"
FT   tRNA            complement(631585..631668)
FT                   /gene="tRNA-Leu"
FT                   /locus_tag="EAM_t024"
FT                   /product="transfer RNA-Leu"
FT                   /anticodon="(pos:631632..631634,aa:Leu)"
FT                   /note="tRNA Leu anticodon CAG, Cove score 51.29"
FT   tRNA            complement(631705..631788)
FT                   /gene="tRNA-Leu"
FT                   /locus_tag="EAM_t025"
FT                   /product="transfer RNA-Leu"
FT                   /anticodon="(pos:631752..631754,aa:Leu)"
FT                   /note="tRNA Leu anticodon CAG, Cove score 48.35"
FT   CDS_pept        complement(631966..632994)
FT                   /transl_table=11
FT                   /gene="rsmC"
FT                   /locus_tag="EAM_0566"
FT                   /product="ribosomal RNA small subunit methyltransferase C
FT                   (rRNA (guanine-N(2)-)-methyltransferase)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0566"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45241"
FT                   /protein_id="CBJ45241.1"
FT                   KK"
FT   misc_feature    complement(631996..632499)
FT                   /note="HMMPfam hit to PF05175, Methyltransferase small
FT                   domain, score 1.3e-95"
FT   misc_feature    complement(632098..632394)
FT                   /note="HMMPfam hit to PF08242, Methyltransferase
FT                   domain,score 8.3e-06"
FT   misc_feature    complement(632509..632973)
FT                   /note="HMMPfam hit to PF08468, Methyltransferase small
FT                   domain N-term, score 4.2e-91"
FT   CDS_pept        633164..633586
FT                   /transl_table=11
FT                   /gene="holD"
FT                   /locus_tag="EAM_0567"
FT                   /product="DNA polymerase III, psi subunit"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0567"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45242"
FT                   /protein_id="CBJ45242.1"
FT   misc_feature    633167..633478
FT                   /note="HMMPfam hit to PF03603, DNA polymerase III psi
FT                   subunit, score 2e-39"
FT   CDS_pept        633549..633989
FT                   /transl_table=11
FT                   /gene="rimI"
FT                   /locus_tag="EAM_0568"
FT                   /product="ribosomal-protein-alanine acetyltransferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0568"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45243"
FT                   /protein_id="CBJ45243.1"
FT   misc_feature    633666..633935
FT                   /note="HMMPfam hit to PF08445, FR47-like protein, score
FT                   9e-05"
FT   misc_feature    633675..633911
FT                   /note="HMMPfam hit to PF00583, Acetyltransferase (GNAT)
FT                   family, score 6.3e-21"
FT   CDS_pept        634004..634684
FT                   /transl_table=11
FT                   /locus_tag="EAM_0569"
FT                   /product="putative 5'-nucleotidase (putative nucleoside
FT                   5'-monophosphate phosphohydrolase)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0569"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45244"
FT                   /protein_id="CBJ45244.1"
FT                   LLGA"
FT   misc_feature    634016..634603
FT                   /note="HMMPfam hit to PF00702, haloacid dehalogenase-like
FT                   hydrolase, score 1.8e-33"
FT   misc_feature    634520..634561
FT                   /note="PS00761 Signal peptidases I signature 3."
FT   CDS_pept        634818..635105
FT                   /transl_table=11
FT                   /locus_tag="EAM_0570"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0570"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45245"
FT                   /protein_id="CBJ45245.1"
FT   misc_feature    634947..635015
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0570 by TMHMM2.0 at aa 44-66"
FT   misc_feature    635659..674190
FT                   /note="Type 6 seretion system 2"
FT   CDS_pept        635659..636162
FT                   /transl_table=11
FT                   /locus_tag="EAM_0571"
FT                   /product="putative lipoprotein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0571"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45246"
FT                   /protein_id="CBJ45246.1"
FT                   WIID"
FT   misc_feature    635659..635712
FT                   /note="Signal peptide predicted for EAM_0571 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.959) with cleavage site
FT                   probability 0.506 between residues 18 and 19"
FT   misc_feature    635683..635715
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        636187..636699
FT                   /transl_table=11
FT                   /locus_tag="EAM_0572"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0572"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45247"
FT                   /protein_id="CBJ45247.1"
FT                   RVVNARD"
FT   misc_feature    636187..636288
FT                   /note="Signal peptide predicted for EAM_0572 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.998) with cleavage site
FT                   probability 0.420 between residues 34 and 35"
FT   misc_feature    636229..636261
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        636719..638062
FT                   /transl_table=11
FT                   /locus_tag="EAM_0573"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0573"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45248"
FT                   /protein_id="CBJ45248.1"
FT   misc_feature    636731..638050
FT                   /note="HMMPfam hit to PF05936, Bacterial protein of unknown
FT                   function (DUF87, score 2e-146"
FT   CDS_pept        638080..639321
FT                   /transl_table=11
FT                   /locus_tag="EAM_0574"
FT                   /product="putative outer membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0574"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45249"
FT                   /protein_id="CBJ45249.1"
FT                   GSTRAELNDMAQGN"
FT   misc_feature    638680..638748
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0574 by TMHMM2.0 at aa 201-223"
FT   misc_feature    638950..639246
FT                   /note="HMMPfam hit to PF00691, OmpA family, score 1.2e-16"
FT   CDS_pept        639325..642957
FT                   /transl_table=11
FT                   /locus_tag="EAM_0575"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0575"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45250"
FT                   /protein_id="CBJ45250.1"
FT   misc_feature    join(639361..639429,639472..639540,640753..640821)
FT                   /note="3 probable transmembrane helices predicted for
FT                   EAM_0575 by TMHMM2.0 at aa 13-35, 50-72 and 477-499"
FT   misc_feature    639769..639792
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    640933..641853
FT                   /note="HMMPfam hit to PF06761, ImcF-related, score 1.4e-60"
FT   misc_feature    642175..642552
FT                   /note="HMMPfam hit to PF06744, Protein of unknown function
FT                   (DUF1215), score 3.2e-27"
FT   CDS_pept        642968..643684
FT                   /transl_table=11
FT                   /locus_tag="EAM_0576"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0576"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45251"
FT                   /protein_id="CBJ45251.1"
FT                   AGAKPGRNGLYPPMFE"
FT   CDS_pept        643702..644721
FT                   /transl_table=11
FT                   /locus_tag="EAM_0577"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0577"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45252"
FT                   /protein_id="CBJ45252.1"
FT   misc_feature    643855..644037
FT                   /note="HMMPfam hit to PF06812, ImpA-related
FT                   N-terminal,score 1.7e-17"
FT   CDS_pept        644784..645320
FT                   /transl_table=11
FT                   /locus_tag="EAM_0578"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0578"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45253"
FT                   /protein_id="CBJ45253.1"
FT                   PKADDKAADDHGNKE"
FT   misc_feature    644808..645284
FT                   /note="HMMPfam hit to PF05591, Protein of unknown function
FT                   (DUF770), score 1.8e-92"
FT   CDS_pept        645324..646823
FT                   /transl_table=11
FT                   /locus_tag="EAM_0579"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0579"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45254"
FT                   /protein_id="CBJ45254.1"
FT   misc_feature    645387..646802
FT                   /note="HMMPfam hit to PF05943, Protein of unknown function
FT                   (DUF877), score 0"
FT   misc_feature    645588..645623
FT                   /note="PS00213 Lipocalin signature."
FT   CDS_pept        647101..647583
FT                   /transl_table=11
FT                   /locus_tag="EAM_0580"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0580"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45255"
FT                   /protein_id="CBJ45255.1"
FT   misc_feature    647110..647508
FT                   /note="HMMPfam hit to PF05638, Protein of unknown function
FT                   (DUF796), score 5.6e-38"
FT   CDS_pept        647662..648141
FT                   /transl_table=11
FT                   /locus_tag="EAM_0581"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0581"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45256"
FT                   /protein_id="CBJ45256.1"
FT   CDS_pept        648126..648494
FT                   /transl_table=11
FT                   /locus_tag="EAM_0582"
FT                   /product="putative exported protein"
FT                   /note="Highly similar to EAM_0584 (81.4% id)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0582"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45257"
FT                   /protein_id="CBJ45257.1"
FT                   HSKQLDNLVKQFKGKQDD"
FT   misc_feature    648126..648191
FT                   /note="Signal peptide predicted for EAM_0582 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.919 between residues 22 and 23"
FT   CDS_pept        648632..649039
FT                   /transl_table=11
FT                   /locus_tag="EAM_0583"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0583"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45258"
FT                   /protein_id="CBJ45258.1"
FT   misc_feature    648632..648703
FT                   /note="Signal peptide predicted for EAM_0583 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.818) with cleavage site
FT                   probability 0.719 between residues 24 and 25"
FT   misc_feature    648710..649024
FT                   /note="HMMPfam hit to PF07007, Protein of unknown function
FT                   (DUF1311), score 2.8e-12"
FT   CDS_pept        649165..649533
FT                   /transl_table=11
FT                   /locus_tag="EAM_0584"
FT                   /product="putative exported protein"
FT                   /note="Highly similar to EAM_0582 (81.4% id)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0584"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45259"
FT                   /protein_id="CBJ45259.1"
FT                   HSGQLDKLVKEFKGKQDD"
FT   misc_feature    649165..649230
FT                   /note="Signal peptide predicted for EAM_0584 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.850 between residues 22 and 23"
FT   CDS_pept        649652..651493
FT                   /transl_table=11
FT                   /locus_tag="EAM_0585"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0585"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45260"
FT                   /protein_id="CBJ45260.1"
FT   CDS_pept        651490..652284
FT                   /transl_table=11
FT                   /locus_tag="EAM_0586"
FT                   /product="putative protein phosphatase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0586"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45261"
FT                   /protein_id="CBJ45261.1"
FT   misc_feature    651496..652176
FT                   /note="HMMPfam hit to PF00481, Protein phosphatase 2C,score
FT                   0.00018"
FT   CDS_pept        652303..653310
FT                   /transl_table=11
FT                   /locus_tag="EAM_0587"
FT                   /product="putative exported protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0587"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45262"
FT                   /protein_id="CBJ45262.1"
FT   misc_feature    652303..652359
FT                   /note="Signal peptide predicted for EAM_0587 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 1.000 between residues 19 and 20"
FT   CDS_pept        653320..654141
FT                   /transl_table=11
FT                   /locus_tag="EAM_0588"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0588"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45263"
FT                   /protein_id="CBJ45263.1"
FT   misc_feature    653332..654117
FT                   /note="HMMPfam hit to PF07024, ImpE protein, score 1.4e-68"
FT   CDS_pept        654138..654704
FT                   /transl_table=11
FT                   /locus_tag="EAM_0589"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0589"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45264"
FT                   /protein_id="CBJ45264.1"
FT   misc_feature    654234..654671
FT                   /note="HMMPfam hit to PF07025, Protein of unknown function
FT                   (DUF1316), score 2.1e-33"
FT   CDS_pept        654723..656597
FT                   /transl_table=11
FT                   /locus_tag="EAM_0590"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0590"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45265"
FT                   /protein_id="CBJ45265.1"
FT   misc_feature    654726..656594
FT                   /note="HMMPfam hit to PF05947, Bacterial protein of unknown
FT                   function (DUF87, score 4e-257"
FT   CDS_pept        656594..657658
FT                   /transl_table=11
FT                   /locus_tag="EAM_0591"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0591"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45266"
FT                   /protein_id="CBJ45266.1"
FT                   DLTFSPEPLAEIAP"
FT   misc_feature    656672..657589
FT                   /note="HMMPfam hit to PF06996, Protein of unknown function
FT                   (DUF1305), score 2.6e-101"
FT   misc_feature    657380..657439
FT                   /note="PS00179 Aminoacyl-transfer RNA synthetases class-II
FT                   signature 1."
FT   CDS_pept        657755..660370
FT                   /transl_table=11
FT                   /locus_tag="EAM_0592"
FT                   /product="putative ATPase with chaperone activity"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0592"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45267"
FT                   /protein_id="CBJ45267.1"
FT                   "
FT   misc_feature    657824..657982
FT                   /note="HMMPfam hit to PF02861, Clp amino terminal
FT                   domain,score 9.8e-05"
FT   misc_feature    658415..658999
FT                   /note="HMMPfam hit to PF00004, ATPase family associated
FT                   with various cellul, score 3.3e-08"
FT   misc_feature    658430..658453
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    658694..658732
FT                   /note="PS00870 Chaperonins clpA/B signature 1."
FT   misc_feature    659558..660064
FT                   /note="HMMPfam hit to PF07724, ATPase family associated
FT                   with various cellul, score 1.1e-87"
FT   misc_feature    659570..660079
FT                   /note="HMMPfam hit to PF07728, ATPase family associated
FT                   with various cellul, score 0.00012"
FT   misc_feature    659585..659608
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        660400..661806
FT                   /transl_table=11
FT                   /locus_tag="EAM_0593"
FT                   /product="putative protein kinase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0593"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45268"
FT                   /protein_id="CBJ45268.1"
FT                   EGAWLLNPQS"
FT   misc_feature    660466..661284
FT                   /note="HMMPfam hit to PF00069, Protein kinase domain, score
FT                   5.3e-10"
FT   misc_feature    660484..660555
FT                   /note="PS00107 Protein kinases ATP-binding region
FT                   signature."
FT   misc_feature    661441..661521
FT                   /note="PS00107 Protein kinases ATP-binding region
FT                   signature."
FT   CDS_pept        661853..663817
FT                   /transl_table=11
FT                   /locus_tag="EAM_0594"
FT                   /product="Rhs-family protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0594"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45269"
FT                   /protein_id="CBJ45269.1"
FT   misc_feature    662951..663187
FT                   /note="HMMPfam hit to PF04524, Protein of unknown
FT                   function,DUF586, score 1.1e-52"
FT   CDS_pept        663840..664907
FT                   /transl_table=11
FT                   /locus_tag="EAM_0595"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0595"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45270"
FT                   /protein_id="CBJ45270.1"
FT                   DGGVNTGCVTVLIGD"
FT   misc_feature    663894..663983
FT                   /note="HMMPfam hit to PF05488, PAAR motif, score 1.1e-06"
FT   misc_feature    663987..664082
FT                   /note="HMMPfam hit to PF05488, PAAR motif, score 3.6e-05"
FT   CDS_pept        664931..665365
FT                   /transl_table=11
FT                   /locus_tag="EAM_0596"
FT                   /product="putative membrane protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0596"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45271"
FT                   /protein_id="CBJ45271.1"
FT   misc_feature    join(664937..664984,665012..665080,665141..665209,
FT                   665291..665359)
FT                   /note="4 probable transmembrane helices predicted for
FT                   EAM_0596 by TMHMM2.0 at aa 3-18, 28-50, 71-93 and 121-143"
FT   CDS_pept        665389..666456
FT                   /transl_table=11
FT                   /locus_tag="EAM_0597"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0597"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45272"
FT                   /protein_id="CBJ45272.1"
FT                   RCLELFLSTITMIEE"
FT   CDS_pept        666730..668664
FT                   /transl_table=11
FT                   /locus_tag="EAM_0598"
FT                   /product="Rhs-family protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0598"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45273"
FT                   /protein_id="CBJ45273.1"
FT                   KAPDSGSDA"
FT   misc_feature    667828..668064
FT                   /note="HMMPfam hit to PF04524, Protein of unknown
FT                   function,DUF586, score 1.1e-52"
FT   CDS_pept        668661..669110
FT                   /transl_table=11
FT                   /locus_tag="EAM_0599"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0599"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45274"
FT                   /protein_id="CBJ45274.1"
FT   CDS_pept        669100..673707
FT                   /transl_table=11
FT                   /locus_tag="EAM_0600"
FT                   /product="Rhs-family protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0600"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45275"
FT                   /protein_id="CBJ45275.1"
FT                   KTVLEPIGNPFGLGS"
FT   misc_feature    join(669142..669210,669229..669297)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0600 by TMHMM2.0 at aa 15-37 and 44-66"
FT   misc_feature    669379..669474
FT                   /note="HMMPfam hit to PF05488, PAAR motif, score 0.92"
FT   misc_feature    669730..669819
FT                   /note="HMMPfam hit to PF05488, PAAR motif, score 5.6e-05"
FT   misc_feature    670543..670671
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.17"
FT   misc_feature    670687..670806
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.0093"
FT   misc_feature    670972..671079
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.058"
FT   misc_feature    671101..671217
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.54"
FT   misc_feature    671230..671343
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 2.7e-06"
FT   misc_feature    671356..671472
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.00019"
FT   misc_feature    671482..671595
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 2.2"
FT   misc_feature    671608..671721
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 9.5e-07"
FT   misc_feature    671734..671844
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.089"
FT   misc_feature    671887..672006
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 7.3"
FT   misc_feature    672052..672162
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.00011"
FT   misc_feature    672178..672303
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 3.7"
FT   misc_feature    672310..672426
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.11"
FT   misc_feature    672463..672567
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.0062"
FT   misc_feature    672676..672798
FT                   /note="HMMPfam hit to PF05593, RHS Repeat, score 0.0028"
FT   misc_feature    672781..672810
FT                   /note="PS00175 Phosphoglycerate mutase family
FT                   phosphohistidine signature."
FT   CDS_pept        673711..674190
FT                   /transl_table=11
FT                   /locus_tag="EAM_0601"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0601"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45276"
FT                   /protein_id="CBJ45276.1"
FT   CDS_pept        674372..674494
FT                   /transl_table=11
FT                   /locus_tag="EAM_0602"
FT                   /product="Rhs-family protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0602"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45277"
FT                   /protein_id="CBJ45277.1"
FT   CDS_pept        674726..674890
FT                   /transl_table=11
FT                   /locus_tag="EAM_0603"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0603"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45278"
FT                   /protein_id="CBJ45278.1"
FT                   FDKISILPE"
FT   CDS_pept        674896..675069
FT                   /transl_table=11
FT                   /locus_tag="EAM_0604"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0604"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45279"
FT                   /protein_id="CBJ45279.1"
FT                   KVKTITVEKKRW"
FT   CDS_pept        complement(join(675267..675557,675563..675748,
FT                   675752..676003,676007..676648,676648..676782,
FT                   676784..676885))
FT                   /pseudo
FT                   /transl_table=11
FT                   /locus_tag="EAM_0605"
FT                   /product="putative TonB-dependent receptor (pseudogene)"
FT   misc_feature    complement(join(675270..675557,675563..675748,
FT                   675752..676003,676007..676045))
FT                   /note="HMMPfam hit to PF00593, TonB dependent
FT                   receptor,score 9.1e-09"
FT   misc_feature    complement(676061..676084)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        677272..682077
FT                   /transl_table=11
FT                   /locus_tag="EAM_0606"
FT                   /product="putative type III effector protein"
FT                   /note="similar to EAM_0331 (27.5% id), EAM_0606 (27.8%
FT                   id),EAM_2296 (20.1% id), EAM_2297 (23.6% id)."
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0606"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45281"
FT                   /protein_id="CBJ45281.1"
FT   misc_feature    679723..679755
FT                   /note="PS00639 Eukaryotic thiol (cysteine) proteases
FT                   histidine active site."
FT   CDS_pept        682256..683350
FT                   /transl_table=11
FT                   /locus_tag="EAM_0607"
FT                   /product="putative ribosylglycohydrolase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0607"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45282"
FT                   /protein_id="CBJ45282.1"
FT   misc_feature    682469..683323
FT                   /note="HMMPfam hit to PF03747,
FT                   ADP-ribosylglycohydrolase,score 2.1e-50"
FT   CDS_pept        683412..684056
FT                   /transl_table=11
FT                   /locus_tag="EAM_0608"
FT                   /product="putative DNA methyladenine glycosylase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0608"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45283"
FT                   /protein_id="CBJ45283.1"
FT   misc_feature    683484..684017
FT                   /note="HMMPfam hit to PF03352, Methyladenine
FT                   glycosylase,score 9.1e-77"
FT   CDS_pept        complement(684501..685640)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0609"
FT                   /product="putative acyltransferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0609"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45284"
FT                   /protein_id="CBJ45284.1"
FT   misc_feature    complement(684522..685556)
FT                   /note="HMMPfam hit to PF01757, Acyltransferase family,score
FT                   3.8e-17"
FT   misc_feature    complement(join(684543..684596,684753..684821,
FT                   684840..684899,685023..685079,685098..685166,
FT                   685254..685322,685359..685427))
FT                   /note="7 probable transmembrane helices predicted for
FT                   EAM_0609 by TMHMM2.0 at aa 72-94, 107-129, 159-181,188-206,
FT                   248-267, 274-296 and 349-366"
FT   CDS_pept        685977..687566
FT                   /transl_table=11
FT                   /gene="prfC"
FT                   /locus_tag="EAM_0610"
FT                   /product="peptide chain release factor 3"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0610"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45285"
FT                   /protein_id="CBJ45285.1"
FT                   YPDVTFRKTREH"
FT   misc_feature    686007..686816
FT                   /note="HMMPfam hit to PF00009, Elongation factor Tu GTP
FT                   binding domain, score 4.7e-62"
FT   misc_feature    686148..686195
FT                   /note="PS00301 GTP-binding elongation factors signature."
FT   misc_feature    686913..687116
FT                   /note="HMMPfam hit to PF03144, Elongation factor Tu
FT                   domain,score 1.1e-12"
FT   CDS_pept        687840..688454
FT                   /transl_table=11
FT                   /gene="osmY"
FT                   /locus_tag="EAM_0611"
FT                   /product="osmotically inducible protein Y"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0611"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45286"
FT                   /protein_id="CBJ45286.1"
FT   misc_feature    687840..687917
FT                   /note="Signal peptide predicted for EAM_0611 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 1.000 between residues 26 and 27"
FT   misc_feature    688023..688214
FT                   /note="HMMPfam hit to PF04972, Putative
FT                   phospholipid-binding domain, score 9.4e-15"
FT   misc_feature    688260..688451
FT                   /note="HMMPfam hit to PF04972, Putative
FT                   phospholipid-binding domain, score 3.1e-16"
FT   CDS_pept        688577..688738
FT                   /transl_table=11
FT                   /locus_tag="EAM_0612"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0612"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45287"
FT                   /protein_id="CBJ45287.1"
FT                   LFTGRKKL"
FT   misc_feature    688577..688666
FT                   /note="Signal peptide predicted for EAM_0612 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.926 between residues 30 and 31"
FT   misc_feature    688580..688723
FT                   /note="HMMPfam hit to PF07043, Protein of unknown function
FT                   (DUF1328), score 1.6e-19"
FT   misc_feature    join(688589..688645,688655..688723)
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0612 by TMHMM2.0 at aa 5-23 and 27-49"
FT   CDS_pept        688841..689893
FT                   /transl_table=11
FT                   /locus_tag="EAM_0613"
FT                   /product="patatin-like phospholipase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0613"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45288"
FT                   /protein_id="CBJ45288.1"
FT                   DSDYNKGSLA"
FT   misc_feature    688919..689428
FT                   /note="HMMPfam hit to PF01734, Patatin-like
FT                   phospholipase,score 1.3e-22"
FT   CDS_pept        689890..690666
FT                   /transl_table=11
FT                   /locus_tag="EAM_0614"
FT                   /product="TatD related DNase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0614"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45289"
FT                   /protein_id="CBJ45289.1"
FT   misc_feature    689896..690660
FT                   /note="HMMPfam hit to PF01026, TatD related DNase, score
FT                   3.4e-93"
FT   misc_feature    689902..689928
FT                   /note="PS01137 Uncharacterized protein family UPF0006
FT                   signature 1."
FT   misc_feature    690274..690306
FT                   /note="PS01090 Uncharacterized protein family UPF0006
FT                   signature 2."
FT   CDS_pept        690929..691708
FT                   /transl_table=11
FT                   /gene="deoC"
FT                   /locus_tag="EAM_0615"
FT                   /product="deoxyribose-phosphate aldolase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0615"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45290"
FT                   /protein_id="CBJ45290.1"
FT   misc_feature    690956..691666
FT                   /note="HMMPfam hit to PF01791, DeoC/LacD family
FT                   aldolase,score 8e-76"
FT   CDS_pept        691831..693153
FT                   /transl_table=11
FT                   /gene="deoA"
FT                   /locus_tag="EAM_0616"
FT                   /product="thymidine phosphorylase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0616"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45291"
FT                   /protein_id="CBJ45291.1"
FT   misc_feature    691837..692034
FT                   /note="HMMPfam hit to PF02885, Glycosyl transferase
FT                   family,helical, score 1e-25"
FT   misc_feature    692062..692829
FT                   /note="HMMPfam hit to PF00591, Glycosyl transferase
FT                   family,a/b doma, score 2.8e-70"
FT   misc_feature    692167..692214
FT                   /note="PS00647 Thymidine and pyrimidine-nucleoside
FT                   phosphorylases signature."
FT   misc_feature    692878..693102
FT                   /note="HMMPfam hit to PF07831, Pyrimidine nucleoside
FT                   phosphorylase C, score 2.2e-29"
FT   CDS_pept        693217..694440
FT                   /transl_table=11
FT                   /gene="deoB"
FT                   /locus_tag="EAM_0617"
FT                   /product="phosphopentomutase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0617"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45292"
FT                   /protein_id="CBJ45292.1"
FT                   MAWGKPLF"
FT   misc_feature    693223..693537
FT                   /note="HMMPfam hit to PF08342, Phosphopentomutase
FT                   N-terminal, score 5.1e-69"
FT   misc_feature    694042..694371
FT                   /note="HMMPfam hit to PF01676, Metalloenzyme
FT                   superfamily,score 7.1e-40"
FT   CDS_pept        694514..695233
FT                   /transl_table=11
FT                   /gene="deoD"
FT                   /locus_tag="EAM_0618"
FT                   /product="purine nucleoside phosphorylase DeoD-type"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0618"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45293"
FT                   /protein_id="CBJ45293.1"
FT                   SEMIEIALESVLLGDKA"
FT   misc_feature    694556..695212
FT                   /note="HMMPfam hit to PF01048, Phosphorylase family, score
FT                   2.8e-113"
FT   misc_feature    694697..694744
FT                   /note="PS01232 Purine and other phosphorylases family 1
FT                   signature."
FT   CDS_pept        695380..696711
FT                   /transl_table=11
FT                   /locus_tag="EAM_0619"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0619"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45294"
FT                   /protein_id="CBJ45294.1"
FT   misc_feature    695416..695481
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1530.000, SD 4.40 at aa 13-34, sequence
FT   misc_feature    695980..696225
FT                   /note="HMMPfam hit to PF07805, HipA-like N-terminal
FT                   domain,score 1.4e-20"
FT   misc_feature    696241..696474
FT                   /note="HMMPfam hit to PF07804, HipA-like C-terminal
FT                   domain,score 2.7e-08"
FT   CDS_pept        complement(696741..697400)
FT                   /transl_table=11
FT                   /gene="smp"
FT                   /locus_tag="EAM_0620"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0620"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45295"
FT                   /protein_id="CBJ45295.1"
FT   misc_feature    complement(join(696849..696917,697296..697364))
FT                   /note="2 probable transmembrane helices predicted for
FT                   EAM_0620 by TMHMM2.0 at aa 13-35 and 162-184"
FT   misc_feature    complement(697278..697400)
FT                   /note="Signal peptide predicted for EAM_0620 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.564 between residues 41 and 42"
FT   CDS_pept        697559..698536
FT                   /transl_table=11
FT                   /gene="serB"
FT                   /locus_tag="EAM_0621"
FT                   /product="phosphoserine phosphatase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0621"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45296"
FT                   /protein_id="CBJ45296.1"
FT   misc_feature    697889..698440
FT                   /note="HMMPfam hit to PF00702, haloacid dehalogenase-like
FT                   hydrolase, score 8.9e-27"
FT   misc_feature    697898..698506
FT                   /note="HMMPfam hit to PF08282, haloacid dehalogenase-like
FT                   hydrolase, score 0.00085"
FT   CDS_pept        698546..699928
FT                   /transl_table=11
FT                   /gene="radA"
FT                   /locus_tag="EAM_0622"
FT                   /product="DNA repair protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0622"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45297"
FT                   /protein_id="CBJ45297.1"
FT                   DL"
FT   misc_feature    698618..698635
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   misc_feature    698849..698872
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        699977..701209
FT                   /transl_table=11
FT                   /gene="nadR"
FT                   /locus_tag="EAM_0623"
FT                   /product="transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0623"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45298"
FT                   /protein_id="CBJ45298.1"
FT                   ELVKEMLGAQS"
FT   misc_feature    699995..700162
FT                   /note="HMMPfam hit to PF01381, Helix-turn-helix, score
FT                   1.2e-07"
FT   misc_feature    700022..700087
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1877.000, SD 5.58 at aa 16-37, sequence
FT   misc_feature    700688..700711
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    700691..700714
FT                   /note="PS00687 Aldehyde dehydrogenases glutamic acid active
FT                   site."
FT   CDS_pept        701574..702740
FT                   /transl_table=11
FT                   /locus_tag="EAM_0624"
FT                   /product="putative lipoprotein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0624"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45299"
FT                   /protein_id="CBJ45299.1"
FT   misc_feature    701574..701672
FT                   /note="Signal peptide predicted for EAM_0624 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.989) with cleavage site
FT                   probability 0.276 between residues 33 and 34"
FT   misc_feature    701616..701648
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   misc_feature    701955..701987
FT                   /note="PS00639 Eukaryotic thiol (cysteine) proteases
FT                   histidine active site."
FT   CDS_pept        702801..704540
FT                   /transl_table=11
FT                   /locus_tag="EAM_0625"
FT                   /product="putative polypeptide transport protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0625"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45300"
FT                   /protein_id="CBJ45300.1"
FT                   NGS"
FT   misc_feature    702801..702875
FT                   /note="Signal peptide predicted for EAM_0625 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.909) with cleavage site
FT                   probability 0.842 between residues 25 and 26"
FT   misc_feature    703023..703250
FT                   /note="HMMPfam hit to PF08479, POTRA domain,
FT                   ShlB-type,score 8.7e-13"
FT   CDS_pept        complement(704633..705634)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0626"
FT                   /product="putative zinc-binding alcohol dehydrogenase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0626"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45301"
FT                   /protein_id="CBJ45301.1"
FT   misc_feature    complement(704756..705199)
FT                   /note="HMMPfam hit to PF00107, Zinc-binding
FT                   dehydrogenase,score 8.2e-09"
FT   misc_feature    complement(705299..705553)
FT                   /note="HMMPfam hit to PF08240, Alcohol dehydrogenase
FT                   GroES-like domain, score 1.8e-08"
FT   CDS_pept        705732..706613
FT                   /transl_table=11
FT                   /locus_tag="EAM_0627"
FT                   /product="LysR-family transcriptional regulator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0627"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45302"
FT                   /protein_id="CBJ45302.1"
FT                   AMRSEILRDFYR"
FT   misc_feature    705732..705803
FT                   /note="Signal peptide predicted for EAM_0627 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.998) with cleavage site
FT                   probability 0.244 between residues 24 and 25"
FT   misc_feature    705747..705926
FT                   /note="HMMPfam hit to PF00126, Bacterial regulatory
FT                   helix-turn-helix, score 4.5e-18"
FT   misc_feature    705786..705851
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1558.000, SD 4.49 at aa 19-40, sequence
FT   misc_feature    705789..705881
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   misc_feature    705996..706583
FT                   /note="HMMPfam hit to PF03466, LysR substrate binding
FT                   domain, score 5.6e-41"
FT   CDS_pept        complement(706679..708346)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0628"
FT                   /product="ABC transporter, ATP-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0628"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45303"
FT                   /protein_id="CBJ45303.1"
FT   misc_feature    complement(706793..707302)
FT                   /note="HMMPfam hit to PF00005, ABC transporter, score
FT                   4.3e-55"
FT   misc_feature    complement(707258..707281)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    complement(707642..708253)
FT                   /note="HMMPfam hit to PF00005, ABC transporter, score
FT                   7e-59"
FT   misc_feature    complement(707816..707860)
FT                   /note="PS00211 ABC transporters family signature."
FT   misc_feature    complement(708209..708232)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(708348..708833)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0629"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0629"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45304"
FT                   /protein_id="CBJ45304.1"
FT   misc_feature    complement(708717..708749)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(709182..709925)
FT                   /transl_table=11
FT                   /gene="deoR"
FT                   /locus_tag="EAM_0630"
FT                   /product="deoxyribose operon repressor"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0630"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45305"
FT                   /protein_id="CBJ45305.1"
FT   misc_feature    complement(709227..709697)
FT                   /note="HMMPfam hit to PF00455, Bacterial regulatory
FT                   proteins, deoR family, score 2.6e-48"
FT   misc_feature    complement(709743..709904)
FT                   /note="HMMPfam hit to PF08220, DeoR-like helix-turn-helix
FT                   domain, score 8.6e-11"
FT   misc_feature    complement(709797..709862)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1809.000, SD 5.35 at aa 22-43, sequence
FT   misc_feature    complement(709800..709904)
FT                   /note="PS00894 Bacterial regulatory proteins, deoR family
FT                   signature."
FT   CDS_pept        complement(join(710049..710180,710183..>710203))
FT                   /transl_table=11
FT                   /locus_tag="EAM_0631"
FT                   /product="putative amidase (partial)"
FT                   /note="submitted with /partial"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0631"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45306"
FT                   /protein_id="CBJ45306.1"
FT                   GLVAI"
FT   misc_feature    complement(710127..710159)
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   CDS_pept        complement(710222..710455)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0632"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0632"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45307"
FT                   /protein_id="CBJ45307.1"
FT   CDS_pept        710657..712591
FT                   /transl_table=11
FT                   /gene="slt"
FT                   /locus_tag="EAM_0633"
FT                   /product="soluble lytic murein transglycosylase"
FT                   /EC_number="3.2.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0633"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45308"
FT                   /protein_id="CBJ45308.1"
FT                   ADKEWQQRY"
FT   misc_feature    710657..710737
FT                   /note="Signal peptide predicted for EAM_0633 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.996) with cleavage site
FT                   probability 0.986 between residues 27 and 28"
FT   misc_feature    712097..712459
FT                   /note="HMMPfam hit to PF01464, Transglycosylase SLT
FT                   domain,score 3e-40"
FT   misc_feature    712154..712240
FT                   /note="PS00922 Prokaryotic transglycosylases signature."
FT   CDS_pept        712678..713010
FT                   /transl_table=11
FT                   /gene="trpR"
FT                   /locus_tag="EAM_0634"
FT                   /product="trp operon repressor"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0634"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45309"
FT                   /protein_id="CBJ45309.1"
FT                   TNSAKV"
FT   misc_feature    712723..712986
FT                   /note="HMMPfam hit to PF01371, Trp repressor protein, score
FT                   4.2e-40"
FT   CDS_pept        complement(712996..713544)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0635"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0635"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45310"
FT                   /protein_id="CBJ45310.1"
FT   misc_feature    complement(713035..713529)
FT                   /note="HMMPfam hit to PF01931, Protein of unknown function
FT                   DUF84, score 1.3e-65"
FT   CDS_pept        713595..714242
FT                   /transl_table=11
FT                   /gene="gpmB"
FT                   /locus_tag="EAM_0636"
FT                   /product="probable phosphoglycerate mutase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0636"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45311"
FT                   /protein_id="CBJ45311.1"
FT   misc_feature    713601..714065
FT                   /note="HMMPfam hit to PF00300, Phosphoglycerate mutase
FT                   family, score 4.4e-50"
FT   misc_feature    713610..713639
FT                   /note="PS00175 Phosphoglycerate mutase family
FT                   phosphohistidine signature."
FT   misc_feature    714030..714098
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0636 by TMHMM2.0 at aa 146-168"
FT   CDS_pept        complement(714450..714809)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0637"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0637"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45312"
FT                   /protein_id="CBJ45312.1"
FT                   VRQGLRFFPQRTPQS"
FT   CDS_pept        complement(714915..715799)
FT                   /transl_table=11
FT                   /gene="rob"
FT                   /locus_tag="EAM_0638"
FT                   /product="right origin-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0638"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45313"
FT                   /protein_id="CBJ45313.1"
FT                   EYLIPIRRQPEAI"
FT   misc_feature    complement(714936..715424)
FT                   /note="HMMPfam hit to PF06445, Bacterial transcription
FT                   activator, effect, score 7.1e-20"
FT   misc_feature    complement(715485..715619)
FT                   /note="HMMPfam hit to PF00165, Bacterial regulatory
FT                   helix-turn-helix pro, score 1e-09"
FT   misc_feature    complement(715500..715637)
FT                   /note="PS00041 Bacterial regulatory proteins, araC family
FT                   signature."
FT   misc_feature    complement(715635..715775)
FT                   /note="HMMPfam hit to PF00165, Bacterial regulatory
FT                   helix-turn-helix pro, score 6.4e-12"
FT   misc_feature    complement(715671..715736)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1159.000, SD 3.13 at aa 22-43, sequence
FT   CDS_pept        716006..716479
FT                   /transl_table=11
FT                   /gene="creA"
FT                   /locus_tag="EAM_0639"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0639"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45314"
FT                   /protein_id="CBJ45314.1"
FT   misc_feature    716006..716068
FT                   /note="Signal peptide predicted for EAM_0639 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.582 between residues 21 and 22"
FT   misc_feature    716024..716476
FT                   /note="HMMPfam hit to PF05981, CreA protein, score 1.2e-87"
FT   CDS_pept        complement(716552..717268)
FT                   /transl_table=11
FT                   /gene="arcA"
FT                   /locus_tag="EAM_0640"
FT                   /product="global response regulator (two-component response
FT                   regulator)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0640"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45315"
FT                   /protein_id="CBJ45315.1"
FT                   ATIHGEGYRFCGELQD"
FT   misc_feature    complement(716573..716803)
FT                   /note="HMMPfam hit to PF00486, Transcriptional regulatory
FT                   protein, C te, score 4.1e-18"
FT   misc_feature    complement(716924..717259)
FT                   /note="HMMPfam hit to PF00072, Response regulator receiver
FT                   domain, score 1e-32"
FT   CDS_pept        complement(717543..717878)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0641"
FT                   /product="putative transposon modulator protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0641"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45316"
FT                   /protein_id="CBJ45316.1"
FT                   CGMQDLS"
FT   CDS_pept        718410..720872
FT                   /transl_table=11
FT                   /gene="thrA"
FT                   /locus_tag="EAM_0642"
FT                   /product="bifunctional aspartokinase/homoserine
FT                   dehydrogenase I [includes: aspartokinase I; homoserine
FT                   dehydrogenase I]"
FT                   /EC_number=""
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0642"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45317"
FT                   /protein_id="CBJ45317.1"
FT                   TLSWKLGV"
FT   misc_feature    718410..719261
FT                   /note="HMMPfam hit to PF00696, Amino acid kinase
FT                   family,score 4.6e-61"
FT   misc_feature    718416..718442
FT                   /note="PS00324 Aspartokinase signature."
FT   misc_feature    719355..719564
FT                   /note="HMMPfam hit to PF01842, ACT domain, score 2.2e-08"
FT   misc_feature    719598..719813
FT                   /note="HMMPfam hit to PF01842, ACT domain, score 5.2e-08"
FT   misc_feature    719823..720227
FT                   /note="HMMPfam hit to PF03447, Homoserine dehydrogenase,NAD
FT                   binding d, score 1.6e-37"
FT   misc_feature    720249..720842
FT                   /note="HMMPfam hit to PF00742, Homoserine
FT                   dehydrogenase,score 4e-98"
FT   misc_feature    720387..720455
FT                   /note="PS01042 Homoserine dehydrogenase signature."
FT   CDS_pept        720875..721804
FT                   /transl_table=11
FT                   /gene="thrB"
FT                   /locus_tag="EAM_0643"
FT                   /product="homoserine kinase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0643"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45318"
FT                   /protein_id="CBJ45318.1"
FT   misc_feature    721121..721324
FT                   /note="HMMPfam hit to PF00288, GHMP kinases N terminal
FT                   domain, score 4.6e-21"
FT   misc_feature    721142..721177
FT                   /note="PS00627 GHMP kinases putative ATP-binding domain."
FT   misc_feature    721502..721741
FT                   /note="HMMPfam hit to PF08544, GHMP kinases C
FT                   terminal,score 4.5e-08"
FT   CDS_pept        721808..723094
FT                   /transl_table=11
FT                   /gene="thrC"
FT                   /locus_tag="EAM_0644"
FT                   /product="threonine synthase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0644"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45319"
FT                   /protein_id="CBJ45319.1"
FT   misc_feature    722036..722944
FT                   /note="HMMPfam hit to PF00291, Pyridoxal-phosphate
FT                   dependent enzyme, score 3e-35"
FT   misc_feature    722096..722140
FT                   /note="PS00165 Serine/threonine dehydratases
FT                   pyridoxal-phosphate attachment site."
FT   CDS_pept        complement(723158..723934)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0645"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0645"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45320"
FT                   /protein_id="CBJ45320.1"
FT   misc_feature    complement(723167..723934)
FT                   /note="HMMPfam hit to PF03883, Protein of unknown function
FT                   (DUF328), score 6.6e-171"
FT   misc_feature    complement(723650..723697)
FT                   /note="PS00225 Crystallins beta and gamma 'Greek key' motif
FT                   signature."
FT   CDS_pept        724202..725155
FT                   /transl_table=11
FT                   /gene="talB"
FT                   /locus_tag="EAM_0646"
FT                   /product="transaldolase B"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0646"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45321"
FT                   /protein_id="CBJ45321.1"
FT   misc_feature    724238..725140
FT                   /note="HMMPfam hit to PF00923, Transaldolase, score
FT                   5.6e-182"
FT   misc_feature    724292..724318
FT                   /note="PS01054 Transaldolase signature 1."
FT   misc_feature    724586..724639
FT                   /note="PS00958 Transaldolase active site."
FT   CDS_pept        725350..725937
FT                   /transl_table=11
FT                   /gene="mog"
FT                   /locus_tag="EAM_0647"
FT                   /product="molybdopterin biosynthesis protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0647"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45322"
FT                   /protein_id="CBJ45322.1"
FT   misc_feature    725368..725805
FT                   /note="HMMPfam hit to PF00994, Probable molybdopterin
FT                   binding domain, score 1.9e-31"
FT   misc_feature    725554..725595
FT                   /note="PS01078 Molybdenum cofactor biosynthesis proteins
FT                   signature 1."
FT   CDS_pept        complement(726065..727216)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0648"
FT                   /product="putative acyltransferase"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0648"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45323"
FT                   /protein_id="CBJ45323.1"
FT   misc_feature    complement(726119..727195)
FT                   /note="HMMPfam hit to PF01757, Acyltransferase family,score
FT                   2.8e-20"
FT   misc_feature    complement(join(726140..726208,726236..726304,
FT                   726398..726451,726464..726523,726542..726595,
FT                   726623..726682,726695..726763,726902..726970,
FT                   727031..727099,727112..727180))
FT                   /note="10 probable transmembrane helices predicted for
FT                   EAM_0648 by TMHMM2.0 at aa 13-35, 40-62, 83-105,
FT                   152-174,179-198, 208-225, 232-251, 256-273, 305-327 and
FT                   337-359"
FT   CDS_pept        727747..729660
FT                   /transl_table=11
FT                   /gene="dnaK"
FT                   /locus_tag="EAM_0649"
FT                   /product="chaperone protein (heat shock protein 70)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0649"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45324"
FT                   /protein_id="CBJ45324.1"
FT                   KK"
FT   misc_feature    727756..729558
FT                   /note="HMMPfam hit to PF00012, Hsp70 protein, score 0"
FT   misc_feature    727765..727788
FT                   /note="PS00297 Heat shock hsp70 proteins family signature
FT                   1."
FT   misc_feature    728320..728361
FT                   /note="PS00329 Heat shock hsp70 proteins family signature
FT                   2."
FT   misc_feature    728755..728799
FT                   /note="PS01036 Heat shock hsp70 proteins family signature
FT                   3."
FT   CDS_pept        729768..730913
FT                   /transl_table=11
FT                   /gene="dnaJ"
FT                   /locus_tag="EAM_0650"
FT                   /product="chaperone protein (heat shock protein J)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0650"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45325"
FT                   /protein_id="CBJ45325.1"
FT   misc_feature    729780..729968
FT                   /note="HMMPfam hit to PF00226, DnaJ domain, score 9.3e-37"
FT   misc_feature    729906..729965
FT                   /note="PS00636 Nt-dnaJ domain signature."
FT   misc_feature    730173..730415
FT                   /note="HMMPfam hit to PF00684, DnaJ central domain (4
FT                   repeats), score 6.5e-46"
FT   misc_feature    730212..730286
FT                   /note="PS00637 CXXCXGXG dnaJ domain signature."
FT   misc_feature    730212..730229
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   misc_feature    730263..730280
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   misc_feature    730371..730388
FT                   /note="PS00190 Cytochrome c family heme-binding site
FT                   signature."
FT   misc_feature    730452..730817
FT                   /note="HMMPfam hit to PF01556, DnaJ C terminal region,score
FT                   1.3e-76"
FT   CDS_pept        730913..731290
FT                   /transl_table=11
FT                   /locus_tag="EAM_0651"
FT                   /product="hypothetical protein"
FT                   /note="No significant database matches"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0651"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45326"
FT                   /protein_id="CBJ45326.1"
FT   misc_feature    730955..731023
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0651 by TMHMM2.0 at aa 15-37"
FT   CDS_pept        731378..732538
FT                   /transl_table=11
FT                   /gene="nhaA"
FT                   /locus_tag="EAM_0652"
FT                   /product="Na(+)/H(+) antiporter 1"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0652"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45327"
FT                   /protein_id="CBJ45327.1"
FT   misc_feature    731378..731473
FT                   /note="Signal peptide predicted for EAM_0652 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.981) with cleavage site
FT                   probability 0.519 between residues 32 and 33"
FT   misc_feature    731390..732520
FT                   /note="HMMPfam hit to PF06965, Na+/H+ antiporter, score
FT                   1e-226"
FT   misc_feature    join(731414..731467,731555..731608,731666..731725,
FT                   731753..731821,731840..731908,731918..731986,
FT                   732023..732091,732149..732217,732230..732298,
FT                   732362..732430,732449..732517)
FT                   /note="11 probable transmembrane helices predicted for
FT                   EAM_0652 by TMHMM2.0 at aa 13-30, 60-77, 97-116,
FT                   126-148,155-177, 181-203, 216-238, 258-280, 285-307,
FT                   329-351 and 358-380"
FT   misc_feature    731894..731986
FT                   /note="PS00044 Bacterial regulatory proteins, lysR family
FT                   signature."
FT   CDS_pept        complement(732806..733069)
FT                   /transl_table=11
FT                   /gene="rpsT"
FT                   /locus_tag="EAM_0653"
FT                   /product="30S ribosomal protein S20"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0653"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45328"
FT                   /protein_id="CBJ45328.1"
FT   misc_feature    complement(732815..733066)
FT                   /note="HMMPfam hit to PF01649, Ribosomal protein S20, score
FT                   1.6e-44"
FT   CDS_pept        733385..734323
FT                   /transl_table=11
FT                   /gene="ribF"
FT                   /locus_tag="EAM_0654"
FT                   /product="riboflavin biosynthesis protein [includes:
FT                   riboflavin kinase; FMN adenylyltransferase]"
FT                   /EC_number=""
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0654"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45329"
FT                   /protein_id="CBJ45329.1"
FT   misc_feature    733427..733885
FT                   /note="HMMPfam hit to PF06574, FAD synthetase, score
FT                   2.9e-81"
FT   misc_feature    733439..733897
FT                   /note="HMMPfam hit to PF01467, Cytidylyltransferase, score
FT                   0.0082"
FT   misc_feature    733931..734305
FT                   /note="HMMPfam hit to PF01687, Riboflavin kinase, score
FT                   4.7e-66"
FT   CDS_pept        734360..737176
FT                   /transl_table=11
FT                   /gene="ileS"
FT                   /locus_tag="EAM_0655"
FT                   /product="isoleucyl-tRNA synthetase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0655"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45330"
FT                   /protein_id="CBJ45330.1"
FT                   SGEERKFA"
FT   misc_feature    734438..736282
FT                   /note="HMMPfam hit to PF00133, tRNA synthetases class I
FT                   (I,L, M and V), score 0"
FT   misc_feature    734531..734566
FT                   /note="PS00178 Aminoacyl-transfer RNA synthetases class-I
FT                   signature."
FT   misc_feature    736412..736888
FT                   /note="HMMPfam hit to PF08264, Anticodon-binding
FT                   domain,score 1.4e-58"
FT   misc_feature    737051..737140
FT                   /note="HMMPfam hit to PF06827, Zinc finger found in FPG and
FT                   IleRS, score 3e-11"
FT   misc_feature    737173..737250
FT                   /note="Signal peptide predicted for EAM_0656 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.615) with cleavage site
FT                   probability 0.396 between residues 26 and 27"
FT   CDS_pept        737176..737682
FT                   /transl_table=11
FT                   /gene="lspA"
FT                   /locus_tag="EAM_0656"
FT                   /product="lipoprotein signal peptidase (prolipoprotein
FT                   signal peptidase) (signal peptidase II)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0656"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45331"
FT                   /protein_id="CBJ45331.1"
FT                   SEHKG"
FT   misc_feature    737203..737667
FT                   /note="HMMPfam hit to PF01252, Signal peptidase (SPase)
FT                   II,score 5.1e-74"
FT   misc_feature    join(737209..737268,737374..737433,737470..737538,
FT                   737581..737649)
FT                   /note="4 probable transmembrane helices predicted for
FT                   EAM_0656 by TMHMM2.0 at aa 13-32, 68-87, 100-122 and
FT                   137-159"
FT   misc_feature    737491..737523
FT                   /note="PS00855 Signal peptidases II signature."
FT   CDS_pept        737686..738156
FT                   /transl_table=11
FT                   /gene="fkpB"
FT                   /locus_tag="EAM_0657"
FT                   /product="FkbB-type 16 kD peptidyl-prolyl cis-trans
FT                   isomerase (rotamase)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0657"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45332"
FT                   /protein_id="CBJ45332.1"
FT   misc_feature    737692..738108
FT                   /note="HMMPfam hit to PF00254, FKBP-type peptidyl-prolyl
FT                   cis-trans isomeras, score 2.3e-05"
FT   misc_feature    737722..737769
FT                   /note="PS00453 FKBP-type peptidyl-prolyl cis-trans
FT                   isomerase signature 1."
FT   CDS_pept        738137..739090
FT                   /transl_table=11
FT                   /gene="ispH"
FT                   /gene_synonym="lytB"
FT                   /locus_tag="EAM_0658"
FT                   /product="4-hydroxy-3-methylbut-2-enyl diphosphate
FT                   reductase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0658"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45333"
FT                   /protein_id="CBJ45333.1"
FT   misc_feature    738143..738994
FT                   /note="HMMPfam hit to PF02401, LytB protein, score
FT                   1.6e-178"
FT   CDS_pept        739351..740172
FT                   /transl_table=11
FT                   /gene="dapB"
FT                   /locus_tag="EAM_0659"
FT                   /product="dihydrodipicolinate reductase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0659"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45334"
FT                   /protein_id="CBJ45334.1"
FT   misc_feature    739366..739737
FT                   /note="HMMPfam hit to PF01113, Dihydrodipicolinate
FT                   reductase, N-terminus, score 1.1e-66"
FT   misc_feature    739744..740157
FT                   /note="HMMPfam hit to PF05173, Dihydrodipicolinate
FT                   reductase, C-terminus, score 8.5e-78"
FT   misc_feature    739810..739863
FT                   /note="PS01298 Dihydrodipicolinate reductase signature."
FT   CDS_pept        740642..741790
FT                   /transl_table=11
FT                   /gene="carA"
FT                   /locus_tag="EAM_0660"
FT                   /product="carbamoyl-phosphate synthase small chain"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0660"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45335"
FT                   /protein_id="CBJ45335.1"
FT   misc_feature    740648..741094
FT                   /note="HMMPfam hit to PF00988, Carbamoyl-phosphate synthase
FT                   small ch, score 1.6e-92"
FT   misc_feature    741224..741760
FT                   /note="HMMPfam hit to PF00117, Glutamine amidotransferase
FT                   class-I, score 4.9e-74"
FT   misc_feature    741431..741466
FT                   /note="PS00442 Glutamine amidotransferases class-I active
FT                   site."
FT   CDS_pept        741805..745029
FT                   /transl_table=11
FT                   /gene="carB"
FT                   /locus_tag="EAM_0661"
FT                   /product="carbamoyl-phosphate synthase large chain"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0661"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45336"
FT                   /protein_id="CBJ45336.1"
FT   misc_feature    741805..741873
FT                   /note="Signal peptide predicted for EAM_0661 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.767) with cleavage site
FT                   probability 0.700 between residues 23 and 24"
FT   misc_feature    741820..742182
FT                   /note="HMMPfam hit to PF00289, Carbamoyl-phosphate synthase
FT                   L chain,, score 5.6e-64"
FT   misc_feature    741844..741876
FT                   /note="PS00013 Prokaryotic membrane lipoprotein lipid
FT                   attachment site."
FT   misc_feature    742186..742896
FT                   /note="HMMPfam hit to PF02786, Carbamoyl-phosphate synthase
FT                   L chain,, score 7.3e-144"
FT   misc_feature    742294..742338
FT                   /note="PS00866 Carbamoyl-phosphate synthase subdomain
FT                   signature 1."
FT   misc_feature    742693..742716
FT                   /note="PS00867 Carbamoyl-phosphate synthase subdomain
FT                   signature 2."
FT   misc_feature    743074..743445
FT                   /note="HMMPfam hit to PF02787, Carbamoyl-phosphate
FT                   synthetase large c, score 2.4e-63"
FT   misc_feature    743476..743820
FT                   /note="HMMPfam hit to PF00289, Carbamoyl-phosphate synthase
FT                   L chain,, score 1.3e-26"
FT   misc_feature    743746..744351
FT                   /note="HMMPfam hit to PF02655, ATP-grasp domain, score
FT                   0.0013"
FT   misc_feature    743824..744456
FT                   /note="HMMPfam hit to PF02786, Carbamoyl-phosphate synthase
FT                   L chain,, score 3.7e-27"
FT   misc_feature    743932..743976
FT                   /note="PS00866 Carbamoyl-phosphate synthase subdomain
FT                   signature 1."
FT   misc_feature    744319..744342
FT                   /note="PS00867 Carbamoyl-phosphate synthase subdomain
FT                   signature 2."
FT   misc_feature    744400..744423
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   misc_feature    744670..744930
FT                   /note="HMMPfam hit to PF02142, MGS-like domain, score
FT                   1.2e-34"
FT   CDS_pept        complement(745163..745777)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0662"
FT                   /product="LysE-type translocator"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0662"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45337"
FT                   /protein_id="CBJ45337.1"
FT   misc_feature    complement(745166..745741)
FT                   /note="HMMPfam hit to PF01810, LysE type translocator,score
FT                   9.9e-32"
FT   misc_feature    complement(join(745265..745333,745361..745429,
FT                   745505..745573,745583..745651,745697..745765))
FT                   /note="5 probable transmembrane helices predicted for
FT                   EAM_0662 by TMHMM2.0 at aa 5-27, 43-65, 69-91, 117-139 and
FT                   149-171"
FT   CDS_pept        745970..746449
FT                   /transl_table=11
FT                   /gene="folA"
FT                   /locus_tag="EAM_0663"
FT                   /product="dihydrofolate reductase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0663"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45338"
FT                   /protein_id="CBJ45338.1"
FT   misc_feature    745970..746443
FT                   /note="HMMPfam hit to PF00186, Dihydrofolate
FT                   reductase,score 2.9e-61"
FT   misc_feature    746006..746074
FT                   /note="PS00075 Dihydrofolate reductase signature."
FT   CDS_pept        complement(746491..747315)
FT                   /transl_table=11
FT                   /gene="apaH"
FT                   /locus_tag="EAM_0664"
FT                   /product="bis(5'-nucleosyl)-tetraphosphatase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0664"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45339"
FT                   /protein_id="CBJ45339.1"
FT   misc_feature    complement(746866..747315)
FT                   /note="HMMPfam hit to PF00149, Calcineurin-like
FT                   phosphoesterase, score 1.6e-17"
FT   CDS_pept        complement(747329..747706)
FT                   /transl_table=11
FT                   /gene="apaG"
FT                   /locus_tag="EAM_0665"
FT                   /product="conserved hypothetical protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0665"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45340"
FT                   /protein_id="CBJ45340.1"
FT   misc_feature    complement(747344..747706)
FT                   /note="HMMPfam hit to PF04379, Protein of unknown function
FT                   (DUF525), score 6.7e-66"
FT   CDS_pept        complement(747703..748530)
FT                   /transl_table=11
FT                   /gene="ksgA"
FT                   /locus_tag="EAM_0666"
FT                   /product="dimethyladenosine transferase"
FT                   /EC_number="2.1.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0666"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45341"
FT                   /protein_id="CBJ45341.1"
FT   misc_feature    complement(747733..748509)
FT                   /note="HMMPfam hit to PF00398, Ribosomal RNA adenine
FT                   dimethylase, score 2.1e-95"
FT   misc_feature    complement(748327..748410)
FT                   /note="PS01131 Ribosomal RNA adenine dimethylases
FT                   signature."
FT   CDS_pept        complement(748523..749515)
FT                   /transl_table=11
FT                   /gene="pdxA"
FT                   /locus_tag="EAM_0667"
FT                   /product="4-hydroxythreonine-4-phosphate dehydrogenase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0667"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45342"
FT                   /protein_id="CBJ45342.1"
FT   misc_feature    complement(748550..749443)
FT                   /note="HMMPfam hit to PF04166, Pyridoxal phosphate
FT                   biosynthetic protein Pdx, score 3.5e-163"
FT   CDS_pept        complement(749505..750800)
FT                   /transl_table=11
FT                   /gene="surA"
FT                   /locus_tag="EAM_0668"
FT                   /product="chaperone (peptidyl-prolyl cis-trans isomerase)
FT                   (survival protein A)"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0668"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45343"
FT                   /protein_id="CBJ45343.1"
FT   misc_feature    complement(749655..749936)
FT                   /note="HMMPfam hit to PF00639, PPIC-type PPIASE
FT                   domain,score 3e-39"
FT   misc_feature    complement(749775..749840)
FT                   /note="PS01096 PpiC-type peptidyl-prolyl cis-trans
FT                   isomerase signature."
FT   misc_feature    complement(749985..750269)
FT                   /note="HMMPfam hit to PF00639, PPIC-type PPIASE
FT                   domain,score 2.8e-37"
FT   misc_feature    complement(750105..750167)
FT                   /note="PS01096 PpiC-type peptidyl-prolyl cis-trans
FT                   isomerase signature."
FT   misc_feature    complement(750741..750800)
FT                   /note="Signal peptide predicted for EAM_0668 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 1.000 between residues 20 and 21"
FT   CDS_pept        complement(750854..753193)
FT                   /transl_table=11
FT                   /gene="imp"
FT                   /locus_tag="EAM_0669"
FT                   /product="organic solvent tolerance protein precursor"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0669"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45344"
FT                   /protein_id="CBJ45344.1"
FT   misc_feature    complement(751112..752272)
FT                   /note="HMMPfam hit to PF04453, Organic solvent tolerance
FT                   protein, score 4.6e-127"
FT   misc_feature    complement(752606..753178)
FT                   /note="HMMPfam hit to PF03968, OstA-like protein, score
FT                   1.4e-54"
FT   misc_feature    complement(753122..753193)
FT                   /note="Signal peptide predicted for EAM_0669 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.987 between residues 24 and 25"
FT   CDS_pept        753441..754265
FT                   /transl_table=11
FT                   /gene="djlA"
FT                   /locus_tag="EAM_0670"
FT                   /product="DnaJ-like protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0670"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45345"
FT                   /protein_id="CBJ45345.1"
FT   misc_feature    753441..753506
FT                   /note="Signal peptide predicted for EAM_0670 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.745) with cleavage site
FT                   probability 0.441 between residues 22 and 23"
FT   misc_feature    753459..753527
FT                   /note="1 probable transmembrane helix predicted for
FT                   EAM_0670 by TMHMM2.0 at aa 7-29"
FT   misc_feature    753897..753962
FT                   /note="Predicted helix-turn-helix motif with score
FT                   988.000,SD 2.55 at aa 153-174, sequence
FT   misc_feature    754062..754259
FT                   /note="HMMPfam hit to PF00226, DnaJ domain, score 1.2e-05"
FT   CDS_pept        complement(754433..755086)
FT                   /transl_table=11
FT                   /gene="rluA"
FT                   /locus_tag="EAM_0671"
FT                   /product="ribosomal large subunit pseudouridine synthase A"
FT                   /EC_number="5.4.99.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0671"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45346"
FT                   /protein_id="CBJ45346.1"
FT   misc_feature    complement(754583..755029)
FT                   /note="HMMPfam hit to PF00849, RNA pseudouridylate
FT                   synthase, score 6e-58"
FT   misc_feature    complement(754871..754915)
FT                   /note="PS01129 Rlu family of pseudouridine synthase
FT                   signature."
FT   CDS_pept        complement(755128..758034)
FT                   /transl_table=11
FT                   /gene="rapA"
FT                   /locus_tag="EAM_0672"
FT                   /product="RNA polymerase-associated protein (ATP-dependent
FT                   helicase)"
FT                   /EC_number="3.6.1.-"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0672"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45347"
FT                   /protein_id="CBJ45347.1"
FT   misc_feature    complement(756232..756468)
FT                   /note="HMMPfam hit to PF00271, Helicase conserved
FT                   C-terminal domain, score 9.5e-19"
FT   misc_feature    complement(756673..757566)
FT                   /note="HMMPfam hit to PF00176, SNF2 family N-terminal
FT                   domain, score 3.6e-71"
FT   misc_feature    complement(757081..757584)
FT                   /note="HMMPfam hit to PF04851, Type III restriction
FT                   enzyme,res subunit, score 1.8e-06"
FT   CDS_pept        complement(758205..760568)
FT                   /transl_table=11
FT                   /gene="polB"
FT                   /locus_tag="EAM_0673"
FT                   /product="DNA polymerase II"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0673"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45348"
FT                   /protein_id="CBJ45348.1"
FT   misc_feature    complement(758208..759458)
FT                   /note="HMMPfam hit to PF00136, DNA polymerase family
FT                   B,score 2e-27"
FT   misc_feature    complement(758907..758933)
FT                   /note="PS00116 DNA polymerase family B signature."
FT   misc_feature    complement(759672..760490)
FT                   /note="HMMPfam hit to PF03104, DNA polymerase family
FT                   B,exonuclease do, score 2.7e-36"
FT   CDS_pept        760739..761500
FT                   /transl_table=11
FT                   /locus_tag="EAM_0674"
FT                   /product="putative membrane protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0674"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45349"
FT                   /protein_id="CBJ45349.1"
FT   misc_feature    join(760775..760843,760901..760969,761168..761236,
FT                   761264..761332,761393..761461)
FT                   /note="5 probable transmembrane helices predicted for
FT                   EAM_0674 by TMHMM2.0 at aa 13-35, 55-77, 144-166, 176-198
FT                   and 219-241"
FT   CDS_pept        complement(761480..762193)
FT                   /transl_table=11
FT                   /gene="thiQ"
FT                   /locus_tag="EAM_0675"
FT                   /product="thiamine ABC transporter, ATP-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0675"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45350"
FT                   /protein_id="CBJ45350.1"
FT                   PEAAVLGIALKEHLP"
FT   misc_feature    complement(761576..762121)
FT                   /note="HMMPfam hit to PF00005, ABC transporter, score
FT                   4.3e-64"
FT   misc_feature    complement(761762..761806)
FT                   /note="PS00211 ABC transporters family signature."
FT   misc_feature    complement(762077..762100)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."
FT   CDS_pept        complement(762177..763787)
FT                   /transl_table=11
FT                   /gene="thiP"
FT                   /locus_tag="EAM_0676"
FT                   /product="thiamine ABC transporter, permease protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0676"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45351"
FT                   /protein_id="CBJ45351.1"
FT   misc_feature    complement(762183..762797)
FT                   /note="HMMPfam hit to PF00528, Binding-protein-dependent
FT                   transport syst, score 0.0012"
FT   misc_feature    complement(join(762210..762278,762336..762404,
FT                   762603..762671,762729..762797,762855..762923,
FT                   763008..763076,763134..763202,763311..763379,
FT                   763437..763505,763542..763610,763683..763751))
FT                   /note="11 probable transmembrane helices predicted for
FT                   EAM_0676 by TMHMM2.0 at aa 13-35, 60-82, 95-117,
FT                   137-159,196-218, 238-260, 289-311, 331-353, 373-395,
FT                   462-484 and 504-526"
FT   misc_feature    complement(762975..763634)
FT                   /note="HMMPfam hit to PF00528, Binding-protein-dependent
FT                   transport syst, score 4.3e-06"
FT   misc_feature    complement(763224..763289)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1137.000, SD 3.06 at aa 167-188, sequence
FT   misc_feature    complement(763668..763787)
FT                   /note="Signal peptide predicted for EAM_0676 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.916) with cleavage site
FT                   probability 0.305 between residues 40 and 41"
FT   CDS_pept        complement(763763..764749)
FT                   /transl_table=11
FT                   /gene="tbpA"
FT                   /locus_tag="EAM_0677"
FT                   /product="thiamine ABC transporter, substrate-binding
FT                   protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0677"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45352"
FT                   /protein_id="CBJ45352.1"
FT   misc_feature    complement(764696..764749)
FT                   /note="Signal peptide predicted for EAM_0677 by SignalP 2.0
FT                   HMM (Signal peptide probability 1.000) with cleavage site
FT                   probability 0.901 between residues 18 and 19"
FT   CDS_pept        complement(765042..766736)
FT                   /transl_table=11
FT                   /locus_tag="EAM_0678"
FT                   /product="putative substrate-binding protein"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0678"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45353"
FT                   /protein_id="CBJ45353.1"
FT   misc_feature    complement(765255..766250)
FT                   /note="HMMPfam hit to PF00496, Bacterial extracellular
FT                   solute-binding prot, score 6.2e-42"
FT   misc_feature    complement(766602..766667)
FT                   /note="Predicted helix-turn-helix motif with score
FT                   1469.000, SD 4.19 at aa 24-45, sequence
FT   CDS_pept        766992..768197
FT                   /transl_table=11
FT                   /gene="setA"
FT                   /locus_tag="EAM_0679"
FT                   /product="sugar efflux transporter A (major facilitator
FT                   superfamily protein)"
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0679"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45354"
FT                   /protein_id="CBJ45354.1"
FT                   LS"
FT   misc_feature    766992..767081
FT                   /note="Signal peptide predicted for EAM_0679 by SignalP 2.0
FT                   HMM (Signal peptide probability 0.998) with cleavage site
FT                   probability 0.671 between residues 30 and 31"
FT   misc_feature    join(767028..767087,767130..767198,767232..767291,
FT                   767304..767372,767433..767489,767499..767567,
FT                   767649..767717,767745..767813,767832..767900,
FT                   767910..767978,768015..768074,768084..768152)
FT                   /note="12 probable transmembrane helices predicted for
FT                   EAM_0679 by TMHMM2.0 at aa 13-32, 47-69, 81-100,
FT                   105-127,148-166, 170-192, 220-242, 252-274, 281-303,
FT                   307-329,342-361 and 365-387"
FT   misc_feature    767043..768083
FT                   /note="HMMPfam hit to PF07690, Major Facilitator
FT                   Superfamily, score 3.8e-32"
FT   CDS_pept        complement(768253..768858)
FT                   /transl_table=11
FT                   /gene="leuD"
FT                   /locus_tag="EAM_0680"
FT                   /product="3-isopropylmalate dehydratase"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0680"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45355"
FT                   /protein_id="CBJ45355.1"
FT   misc_feature    complement(768478..768855)
FT                   /note="HMMPfam hit to PF00694, Aconitase C-terminal
FT                   domain,score 8.8e-53"
FT   CDS_pept        complement(768868..770265)
FT                   /transl_table=11
FT                   /gene="leuC"
FT                   /locus_tag="EAM_0681"
FT                   /product="3-isopropylmalate dehydratase large subunit"
FT                   /EC_number=""
FT                   /db_xref="EnsemblGenomes-Gn:EAM_0681"
FT                   /db_xref="EnsemblGenomes-Tr:CBJ45356"
FT                   /protein_id="CBJ45356.1"
FT                   ADIRELA"
FT   misc_feature    complement(768898..770259)
FT                   /note="HMMPfam hit to PF00330, Aconitase family (aconitate
FT                   hydratase), score 4.8e-263"
FT   misc_feature    complement(769033..769074)
FT                   /note="PS01244 Aconitase family signature 2."
FT   misc_feature    complement(769204..769254)
FT                   /note="PS00450 Aconitase family signature 1."
FT   misc_feature    complement(769696..769719)
FT                   /note="PS00017 ATP/GTP-binding site motif A (P-loop)."