 | ROSO |  |
 |  |  |  |
 |  |  |  |
Learn more about selecting and loading input files
Learn more about configuration
Learn more about selecting and loading input files
Choice of input files
The use of ROSO requires two kinds of input FASTA formated files:- an interest file containing the sequences of overall genes spotted on the chip.
- a facultative external file that contains the sequences of any genes not spotted on the chip,
but with that user wants to avoid any cross-hybridization.
As an example, if the interest file contains a subset of CDS from an organism gene, the others CDS, as well as pseudogenes and intergenic regions might be added in the external file.
A list of external file dedicated to model organisms is provided.
WARNING: if a personal external sequence file and a model database are selected, then only the database will be processed.
FASTA formated files
The FASTA format is a very common format for sequence files.A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (">") symbol in the first column.
Example:
>refgb|NM_005455|NM_005455 Homo sapiens zinc finger protein 265 (ZNF265), mRNA
ATGTCGACCAAGAATTTCCGAGTCAGTGACGGGGACTGGATTTGCCCTGACAAAAAATGT GGAAATGTAAACTTTGCTAGAAGAACCAGCTGTAATCGATGTGGTCGGGAG
>NM_004441
GAATTCCACATGCACACCCACACCCACGCGCGCCCGCACCGCCCCACGCGCACACACTCC TGCCCACGCCCACGCAGCGCT
Learn more about configuration
Default parameters are proposed for basic search. However, it is possible to customize these parameters.Parameters |
Use and constraints |
|---|---|
| Research settings | Expressed Sequence Tags (ESTs) are read from mRNA (cDNA). Two EST with 95 % homology on more than 100 bases (or 70 % of total lenght) will be considered as identical and only one set of probes will be designed for the both. ROSO provides a list of one to n probes per gene. Probe overlapping can be allowed or not. |
| Probe settings |
The sequences N4 (GGGG, TTTT, CCCC, AAAA) are difficult to synthetize and should be avoided. Identity: DNA probe to study cDNA labelled target. Reverse: cDNA probe to study mRNA directly labelled target. Number of duplex increases with probe size, reflecting the greater stability of longer duplexes and also faster kinetics due to increased opportunities for nucleation with an increase in length. |
| Solution concentrations |
Na+ and K+ concentrations within the target solution. Target concentration is fixed by default to 10E-6 M. |
| Hybridization temperature (Tm) |
ROSO calculates a set of probes with minimal Tm variability. However, user might limitate range of Tm. Melting temperature is defined as the temperature at which half of the target molecules are bound to their probes. Hybridization is usually performed 5-10 °C below melting temperature. However, use of formamide (25-30 %) allows to hybridize at lower temperature (40-50 °C). |
| Secondary structure thresholds |
A probe can fold back upon itself to form helixes. A double strand molecule where both strands are the same probe. Such structures might limitate hybridization yield. Every probe with hairpin or homoduplex more stable than threshold values will be removed. |
| Selected area research | Research on all nuceotides of genes. Research on an area begining on 5' or 3' end and with a size defined by user. |
