choosebank {seqinr}R Documentation

To select a database structured under ACNUC and located on the web

Description

This function allows to select one of the databases structured under ACNUC and located on the web. Called without arguments, choosebank(), will return the list of available databases. Then, you can use query to make your query and get a list of sequence names. Remote access to ACNUC databases works by opening a socket connection on a port (for example on port number 5558 at pbil.univ-lyon1.fr) and by communicating on this socket following the protocol described in the section references.

Usage

choosebank(bank = NA, host = "pbil.univ-lyon1.fr", port = 5558, server = FALSE,
                    blocking = TRUE, open = "a+", encoding = "", verbose = FALSE,
                    timeout = 5, infobank = FALSE, tagbank = NA)

Arguments

bank string. The name of the bank. If NA, choosebank will return the names of all database known by the server.
host string. Host name for port (see socketConnection)
port integer. The TCP port number (see socketConnection)
server logical. Should the socket be a client or a server? (see socketConnection)
blocking logical. (see socketConnection)
open string. A description of how to open the connection (see socketConnection)
encoding string. The name of the encoding to be used. (see socketConnection)
verbose logical. If TRUE, verbose mode is on
timeout integer. The timeout in seconds for socketConnection. Default 5 seconds.
infobank logical. If infobank is TRUE and bank is NA, a data.frame with all database informations will be returned
tagbank string. If bank is NA and tagbank is documented, the names of special purposes databases are returned. Current allowed values are TP for frozen databases (TP is an acronym for "travaux pratiques" which means practicals in french, these databases are useful mainly for teaching so as to have stable results), TEST for test databases, and DEV for databases under development (unstable).

Details

When called without arguments, choosebank() returns a list of all the databases names known by the server, as a vector of string. When called with choosebank(infobank = TRUE), a data.frame with more information is returned.

Value

When called with a regular bank name, an (invisible) list with 6 components:

socket an object of class socket
bankname the name of the bank
banktype the type of the bank (GENBANK, EMBL, SWISSPROT, NBRF)
totseqs the total number of sequences present in the opened database
totspecs the total number of species present in the opened database
totkeys the total number of keywords present in the opened database
A vector of all available bank names.
bank The name of the bank.
status The bank status (on/of).
info Short description of bank with last release date.

Note

The invisible list returned when a database is opened is stored in the variable banknameSocket in the global environment.

Author(s)

D. Charif, J.R. Lobry

References

For more information about the socket communication protocol with ACNUC please get at http://pbil.univ-lyon1.fr/databases/acnuc/remote_acnuc.html. To get the release date and content of all the databases located at the pbil, please look at the following url: http://pbil.univ-lyon1.fr/search/releases.php
Gouy, M., Milleret, F., Mugnier, C., Jacobzone, M., Gautier,C. (1984) ACNUC: a nucleic acid sequence data base and analysis system. Nucl. Acids Res., 12:121-127.
Gouy, M., Gautier, C., Attimonelli, M., Lanave, C., Di Paola, G. (1985) ACNUC - a portable retrieval system for nucleic acid sequence databases: logical and physical designs and usage. Comput. Appl. Biosci., 3:167-172.
Gouy, M., Gautier, C., Milleret, F. (1985) System analysis and nucleic acid sequence banks. Biochimie, 67:433-436.

citation("seqinr")

See Also

query, connection, socketConnection

Examples

  ## Not run: 
# Need internet connection
  # Show available databases:  
  choosebank()
  # Show frozen databases:
  choosebank(tag = "TP")
  # Select a database:
  choosebank("emblTP", tag = "TP") 
  # Do something with the database:
  myseq <- gfrag("LMFLCHR36", start = 1, length = 30)
  stopifnot(myseq == "cgcgtgctggcggcaatgaagcgttcgatg")
  # Close the database:
  closebank()
## End(Not run)

[Package seqinr version 1.1-6 Index]