| choosebank {seqinr} | R Documentation |
This function allows to select one of the databases structured under ACNUC and located on the web.
Called without arguments, choosebank(), will return the list of available databases.
Then, you can use query to make your query and get a list of sequence names.
Remote access to ACNUC databases works by opening a socket connection on a port (for example
on port number 5558 at pbil.univ-lyon1.fr) and by communicating on this socket following the protocol
described in the section references.
choosebank(bank = NA, host = "pbil.univ-lyon1.fr", port = 5558, server = FALSE,
blocking = TRUE, open = "a+", encoding = "", verbose = FALSE,
timeout = 5, infobank = FALSE, tagbank = NA)
bank |
string. The name of the bank. If NA, choosebank will return the names of all database known by the server. |
host |
string. Host name for port (see socketConnection) |
port |
integer. The TCP port number (see socketConnection) |
server |
logical. Should the socket be a client or a server? (see socketConnection) |
blocking |
logical. (see socketConnection) |
open |
string. A description of how to open the connection (see socketConnection) |
encoding |
string. The name of the encoding to be used. (see socketConnection) |
verbose |
logical. If TRUE, verbose mode is on |
timeout |
integer. The timeout in seconds for socketConnection. Default 5 seconds. |
infobank |
logical. If infobank is TRUE and bank is NA, a data.frame
with all database informations will be returned |
tagbank |
string. If bank is NA and tagbank is documented, the names
of special purposes databases are returned. Current allowed values are TP
for frozen databases (TP is an acronym for "travaux pratiques" which means practicals
in french, these databases are useful mainly for teaching so as to have stable results),
TEST for test databases, and DEV for databases under development (unstable). |
When called without arguments, choosebank() returns a list of all the databases names known
by the server, as a vector of string. When called with choosebank(infobank = TRUE), a data.frame
with more information is returned.
When called with a regular bank name, an (invisible) list with 6 components:
socket |
an object of class socket |
bankname |
the name of the bank |
banktype |
the type of the bank (GENBANK, EMBL, SWISSPROT, NBRF) |
totseqs |
the total number of sequences present in the opened database |
totspecs |
the total number of species present in the opened database |
totkeys |
the total number of keywords present in the opened database |
|
A vector of all available bank names. |
bank |
The name of the bank. |
status |
The bank status (on/of). |
info |
Short description of bank with last release date. |
The invisible list returned when a database is opened is stored in the variable
banknameSocket in the global environment.
D. Charif, J.R. Lobry
For more information about the socket communication protocol with ACNUC please get at http://pbil.univ-lyon1.fr/databases/acnuc/remote_acnuc.html.
To get the release date and content of all the databases located at the pbil, please look at the following url: http://pbil.univ-lyon1.fr/search/releases.php
Gouy, M., Milleret, F., Mugnier, C., Jacobzone, M., Gautier,C. (1984) ACNUC: a nucleic acid sequence data base and analysis system.
Nucl. Acids Res., 12:121-127.
Gouy, M., Gautier, C., Attimonelli, M., Lanave, C., Di Paola, G. (1985)
ACNUC - a portable retrieval system for nucleic acid sequence databases:
logical and physical designs and usage.
Comput. Appl. Biosci., 3:167-172.
Gouy, M., Gautier, C., Milleret, F. (1985) System analysis and nucleic acid sequence banks.
Biochimie, 67:433-436.
citation("seqinr")
query, connection, socketConnection
## Not run:
# Need internet connection
# Show available databases:
choosebank()
# Show frozen databases:
choosebank(tag = "TP")
# Select a database:
choosebank("emblTP", tag = "TP")
# Do something with the database:
myseq <- gfrag("LMFLCHR36", start = 1, length = 30)
stopifnot(myseq == "cgcgtgctggcggcaatgaagcgttcgatg")
# Close the database:
closebank()
## End(Not run)