G+C Content {seqinr}R Documentation

Calculates the fractional G+C content of nucleic acid sequences.

Description

Calculates the fraction of G+C bases of the input nucleic acid sequence(s). It reads in nucleic acid sequences, sums the number of 'g' and 'c' bases and writes out the result as the fraction (in the interval 0.0 to 1.0) to the total number of 'a', 'c', 'g' and 't' bases. Global G+C content GC, G+C in the first position of the codon bases GC1, G+C in the second position of the codon bases GC2, and G+C in the third position of the codon bases GC3 can be computed. All functions can take ambiguous bases into account when requested.

Usage

GC(seq, forceToLower = TRUE, exact = FALSE, NA.GC = NA, oldGC = FALSE)
GC1(seq, frame = 0, ...)
GC2(seq, frame = 0, ...)
GC3(seq, frame = 0, ...)
GCpos(seq, pos, frame = 0, ...)

Arguments

seq a nucleic acid sequence as a vector of single characters
frame for coding sequences, an integer (0, 1, 2) giving the frame
forceToLower logical. if TRUE force sequence characters in lower-case. Turn this to FALSE to save time if your sequence is already in lower-case (cpu time is approximately divided by 3 when turned off)
exact logical: if TRUE ambiguous bases are taken into account when computing the G+C content (see details). Turn this to FALSE to save time if your you can neglect ambiguous bases in your sequence (cpu time is approximately divided by 3 when turned off)
NA.GC what should be returned when the GC is impossible to compute from data, for instance with NNNNNNN. This behaviour could be different when argument exact is TRUE, for instance the G+C content of WWSS is NA by default, but is 0.5 when exact is set to TRUE
... arguments passed to the function GC
pos for coding sequences, the codon position (1, 2, 3) that should be taken into account to compute the G+C content
oldGC logical defaulting to FALSE: should the GC content computed as in seqinR <= 1.0-6, that is as the sum of 'g' and 'c' bases divided by the length of the sequence. As from seqinR >= 1.1-3, this argument is deprecated and a warning is issued.

Details

When exact is set to TRUE the G+C content is estimated with ambiguous bases taken into account. Note that this is time expensive. A first pass is made on non-ambiguous bases to estimate the probabilities of the four bases in the sequence. They are then used to weight the contributions of ambiguous bases to the G+C content. Let note nx the total number of base 'x' in the sequence. For instance suppose that there are nb bases 'b'. 'b' stands for "not a", that is for 'c', 'g' or 't'. The contribution of 'b' bases to the GC base count will be:

nb*(nc + ng)/(nc + ng + nt)

The contribution of 'b' bases to the AT base count will be:

nb*nt/(nc + ng + nt)

All ambiguous bases contributions to the AT and GC counts are weighted is similar way and then the G+C content is computed as ngc/(nat + ngc).

Value

GC returns the fraction of G+C (in [0,1]) as a numeric vector of length one. GCpos returns GC at position pos. GC1, GC2, GC3 are wrappers for GCpos with the argument pos set to 1, 2, and 3, respectively. NA is returned when seq is NA. NA.GC defaulting to NA is returned when the G+C content can not be computed from data.

Author(s)

D. Charif and L. Palmeira and J.R. Lobry

References

citation("seqinr").

The program codonW used here for comparison is available at http://codonw.sourceforge.net/.

See Also

You can use s2c to convert a string into a vetor of single character and tolower to convert upper-case characters into lower-case characters. Do not confuse with gc for garbage collection.

Examples

   mysequence <- s2c("agtctggggggccccttttaagtagatagatagctagtcgta")
   GC(mysequence)  # 0.4761905
   GC1(mysequence) # 0.6428571
   GC2(mysequence) # 0.3571429
   GC3(mysequence) # 0.4285714
#
# With upper-case characters:
#
  myUCsequence <- s2c("GGGGGGGGGA")
  GC(myUCsequence) # 0.9
#
# With ambiguous bases:
#
  GC(s2c("acgt")) # 0.5
  GC(s2c("acgtssss")) # 0.5
  GC(s2c("acgtssss"), exact = TRUE) # 0.75
#
# Missing data:
#
  stopifnot(is.na(GC(s2c("NNNN"))))
  stopifnot(is.na(GC(s2c("NNNN"), exact = TRUE)))
  stopifnot(is.na(GC(s2c("WWSS"))))
  stopifnot(GC(s2c("WWSS"), exact = TRUE) == 0.5)
#
# Coding sequences tests:
#
  cdstest <- s2c("ATGATG")
  stopifnot(GC3(cdstest) == 1)
  stopifnot(GC2(cdstest) == 0)
  stopifnot(GC1(cdstest) == 0)
#
# How to reproduce the results obtained with the C program codonW
# version 1.4.4 writen by John Peden. We use here the "input.dat"
# test file from codonW (there are no ambiguous base in these
# sequences).
#
  inputdatfile <- system.file("sequences/input.dat", package = "seqinr")
  input <- read.fasta(file = inputdatfile) # read the FASTA file
  inputoutfile <- system.file("sequences/input.out", package = "seqinr")
  input.res <- read.table(inputoutfile, header = TRUE) # read codonW result file
#
# remove stop codon before computing G+C content (as in codonW)
#
  GC.codonW <- function(dnaseq, ...){
         GC(dnaseq[seq_len(length(dnaseq) - 3)], ...)
  }
  input.gc <- sapply(input, GC.codonW, forceToLower = FALSE)
  max(abs(input.gc - input.res$GC)) # 0.0004946237

  plot(x = input.gc, y = input.res$GC, las = 1,
  xlab = "Results with GC()", ylab = "Results from codonW",
  main = "Comparison of G+C content results")
  abline(c(0, 1), col = "red")
  legend("topleft", inset = 0.01, legend = "y = x", lty = 1, col = "red")
## Not run: 
# Too long for routine check
# This is a benchmark to compare the effect of various parameter
# setting on computation time
n <- 10
from <-10^4
to <- 10^5
size <- seq(from = from, to = to, length = n)
res <- data.frame(matrix(NA, nrow = n, ncol = 5))
colnames(res) <- c("size", "FF", "FT", "TF", "TT")
res[, "size"] <- size

for(i in seq_len(n)){
  myseq <- sample(x = s2c("acgtws"), size = size[i], replace = TRUE)   
  res[i, "FF"] <- system.time(GC(myseq, forceToLower = FALSE, exact = FALSE))[3]
  res[i, "FT"] <- system.time(GC(myseq, forceToLower = FALSE, exact = TRUE))[3]
        res[i, "TF"] <- system.time(GC(myseq, forceToLower = TRUE, exact = FALSE))[3]
        res[i, "TT"] <- system.time(GC(myseq, forceToLower = TRUE, exact = TRUE))[3]
}

par(oma = c(0,0,2.5,0), mar = c(4,5,0,2) + 0.1, mfrow = c(2, 1))
plot(res$size, res$TT, las = 1, 
xlab = "Sequence size [bp]",
ylim = c(0, max(res$TT)), xlim = c(0, max(res$size)), ylab = "")
title(ylab = "Observed time [s]", line = 4)
abline(lm(res$TT~res$size))
points(res$size, res$FT, col = "red")
abline(lm(res$FT~res$size), col = "red", lty = 3)
points(res$size, res$TF, pch = 2)
abline(lm(res$TF~res$size))
points(res$size, res$FF, pch = 2, col = "red")
abline(lm(res$FF~res$size), lty = 3, col = "red")

legend("topleft", inset = 0.01, legend = c("forceToLower = TRUE", "forceToLower = FALSE"), col = c("black", "red"), lty = c(1,3))
legend("bottomright", inset = 0.01, legend = c("exact = TRUE", "exact = FALSE"),
pch = c(1,2))

mincpu <- lm(res$FF~res$size)$coef[2]

barplot(
c(lm(res$FF~res$size)$coef[2]/mincpu, 
  lm(res$TF~res$size)$coef[2]/mincpu,
  lm(res$FT~res$size)$coef[2]/mincpu,
  lm(res$TT~res$size)$coef[2]/mincpu),
horiz = TRUE, xlab = "Increase of CPU time",
col = c("red", "black", "red", "black"),
names.arg = c("(F,F)", "(T,F)", "(F,T)", "(T,T)"), las = 1)
title(ylab = "forceToLower,exact", line = 4)

mtext("CPU time as function of options", outer = TRUE, line = 1, cex = 1.5)
## End(Not run)

[Package seqinr version 2.0-3 Index]