| SeqFastadna {seqinr} | R Documentation |
as.SeqFastadna is called by many functions as read.fasta. It creates an object of class SeqFastadna.
is.SeqFastadna returns TRUE if the object is of class SeqFastadna.
summary.SeqFastadna gives the base composition of an object of class SeqFastadna.
as.SeqFastadna(object, name = NULL, Annot = NULL)
is.SeqFastadna(object)
## S3 method for class 'SeqFastadna':
summary(object, alphabet = s2c("acgt"), ...)
object |
a vector of chars representing a biological sequence |
name |
NULL a character string specifying a name for the sequence |
Annot |
NULL a character string specifying some annotations for the sequence |
... |
additional arguments affecting the summary produced |
alphabet |
a vector of single characters |
as.SeqFastadna returns an object sequence of class SeqFastadna.
summary.SeqFastadna returns a list which the following components:
length |
the legth of the sequence |
compo |
the base counting of the sequence |
GC |
the percentage of G+C in the sequence |
D. Charif
citation("seqinr")
s <- read.fasta(system.file("sequences/malM.fasta",package="seqinr"))
is.SeqFastadna(s[[1]])
summary(s[[1]])
myseq <- s2c("acgttgatgctagctagcatcgat")
as.SeqFastadna(myseq, name = "myseq", Annot = "blablabla")
myseq